Clone Read LE_HBa0091J06_SP6_95290

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0091J06_SP6_95290
Primer
SP6
ID from Seq. Facility
LE_HBa_091_J06-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
209 trimmed for vector and quality, 881 raw
Sequence
>LE_HBa0091J06_SP6_95290 (raw untrimmed)
GGGGGGGATTAGTTTCCTATTTCCTTCTTTTCTTTCTCAAACTTAATAATTTTATCTTATACTTTNTAATACATCTCCCTTTAAGGGCCGCNNNNNNNNA
NNNAANNANANNNNNAAAACTTAAAAGGGCTCTTCGAGCAGCCCACNCNGGAACNGCNACNCNCAAGGAAGCNACNACAGAAGCNANAAGGGACTGGGTG
AGA
AATGTTGAAACAACTCACTACATACTTGGATTTGTTGCAGGACCACACCCTTACCCCATGATGGTTAGGGAGTTCCATGCAGTGATTGGTAAAGAAA
CAAGGAAGCAATCATTGGAAAAGTGGGGCGGGAAACCATATTTTTTTGTTGCATGTGTTGGTGGAGGTTCAAATGCTATGGGACTCTTTCATGAGTTTGT
TGATGACAAAGATGTTTTTTTTTTTGGGGAAGAAGCAGCAGGCCCCGGACGAGAGAGGGGGAAACAAGCCCCCACGGGGACAAAGGGGGAGGNAGGAGNA
CCGCAAGGAGCAAAGAGAAAACGACAGCAAGACGAAGAAGGGCAGACGGAAGAGCCACAAACAAGCAGCGCCGGGAAAAAACAAGAACCAAGCGAGAAAC
GAAAGAGCACAAGAAGAGAGAAAAAACAAAAAGCAAGGCAAGAGAGGACGCGACGGAAAAAAAGAGGAAGAGGACAAAACAAAGAAAAGAACACCGAAAG
GGCCNAGCCAGCCACGGAAAAAAAGAGCGAGAACCCAAGAGAAGGCAGAACACAGCAGAAAAAAGAAGCGGAGAGAAGAAAAAGAGACAGGAGAGGAGAG
GAGGAAAAGGGAAAAAAAAGCAGCCAACGAAGCGGGCACAGGACAAAAAAAGGAAAAAAAAGACAGAAAAGAAAAGAGAAG
>LE_HBa0091J06_SP6_95290 (trimmed for quality and cloning vector)
AATGTTGAAACAACTCACTACATACTTGGATTTGTTGCAGGACCACACCCTTACCCCATGATGGTTAGGGAGTTCCATGCAGTGATTGGTAAAGAAACAA
GGAAGCAATCATTGGAAAAGTGGGGCGGGAAACCATATTTTTTTGTTGCATGTGTTGGTGGAGGTTCAAATGCTATGGGACTCTTTCATGAGTTTGTTGA
TGACAAAGA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.916026
Expected error %
0.876192
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g27070.1 Score 134 E Value 8e-33 Identity 29.90% Align. Length 203bp (97.13%) Frame 2
68417.m03892 tryptophan synthase, beta subunit 2 (TSB2) identical to SP|25269
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g54810.1 Score 133 E Value 2e-32 Identity 29.90% Align. Length 203bp (97.13%) Frame 2
68418.m06827 tryptophan synthase, beta subunit 1 (TSB1) identical to SP|P14671
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAD83779.1| Score 138 E Value 4e-32 Identity 30.90% Align. Length 206bp (98.56%) Frame 2
tryptophan synthase beta subunit [Polygonum tinctorium]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAB97526.1| Score 137 E Value 1e-31 Identity 30.40% Align. Length 206bp (98.56%) Frame 2
tryptophan synthase beta [Camptotheca acuminata] gb|AAB97087.1| tryptophan synthase beta subunit [Camptotheca acuminata] sp|O50046|TRPB_CAMAC Tryptophan synthase beta chain 2, chloroplast precursor
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0091J06
Clone
Clone name
hba-91j6
LE_HBa0091J06
P091J06
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found