Clone Read LE_HBa0091J06_T7_95291

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0091J06_T7_95291
Primer
T7
ID from Seq. Facility
LE_HBa_091_J06-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
781 trimmed for vector and quality, 896 raw
Sequence
>LE_HBa0091J06_T7_95291 (raw untrimmed)
TTTGACTCGGTCCCGAGGGGTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCCGTCAGTAAGCAATGTGCAAACGGAGCCAATAGTTGTGCAAATTGA
TAGACTTGATTTAGTTCTTGAAGAAAGAGATGATCTTGATACACCTAAGAGCTCTAGCAGGTATTATAGAGGCTCAACATGATTGATTTACCTTTTTGGA
TAGTAGCTCACGCGTTGGCCATATATTTTGAAGTTCAAACTTGAAAATTTGATTTTCTGAAGTTGTGTTTGGACGTGCATTTTATTTGGAAAAAGTAGTT
GAAGTTTTTTTGAATGGAAGTTCAAATTTCTGCAAAACAGAGATTTGAAGACAAAATTTTCATAAGTTGATCCAAAATCTATGGCCAAATGCTAGCTTGA
GCTTGGTTTGATTATTGTTGTCTCACTTGGTATCATACTGCTTTCCATCAGTCCGGTGTCATCTGGTAGCTCCTCGAAGGGAAGTGGATATGGATTTGCT
GACAAGGTTAGCAACATAATAGTATCAGCTTACTTGGTTTGATGTTATGTAAGAGTGTTTGAGTTAATTCCTTGCGGGGCAATGGGAATTGTGCGTACAT
AATTTGTTTAGATTTGATGATTTCATACACAATTTTGAATGTGATAATAAAAGTTGATTACGAAATACGAACTAGCAAGTTGCAATTATGATATCATCCA
TCATACGGGTGTTTCAAGAGAAGGATGAAATACATTTTTTGAGATAAAGAGAAGGATGAAATACTTAAAAATGCATATAATTTTAAGATTGCTGATGTAA
AGCATAATTCAATGGGTTCAGTAGACCCTTAGTATTGTTTATCCGCAAAAACTTTTATAGGTCTGCGATGGTCATATCTTCCTTATAGTGTGAAAC
>LE_HBa0091J06_T7_95291 (trimmed for quality and cloning vector)
AGCTTCCGTCAGTAAGCAATGTGCAAACGGAGCCAATAGTTGTGCAAATTGATAGACTTGATTTAGTTCTTGAAGAAAGAGATGATCTTGATACACCTAA
GAGCTCTAGCAGGTATTATAGAGGCTCAACATGATTGATTTACCTTTTTGGATAGTAGCTCACGCGTTGGCCATATATTTTGAAGTTCAAACTTGAAAAT
TTGATTTTCTGAAGTTGTGTTTGGACGTGCATTTTATTTGGAAAAAGTAGTTGAAGTTTTTTTGAATGGAAGTTCAAATTTCTGCAAAACAGAGATTTGA
AGACAAAATTTTCATAAGTTGATCCAAAATCTATGGCCAAATGCTAGCTTGAGCTTGGTTTGATTATTGTTGTCTCACTTGGTATCATACTGCTTTCCAT
CAGTCCGGTGTCATCTGGTAGCTCCTCGAAGGGAAGTGGATATGGATTTGCTGACAAGGTTAGCAACATAATAGTATCAGCTTACTTGGTTTGATGTTAT
GTAAGAGTGTTTGAGTTAATTCCTTGCGGGGCAATGGGAATTGTGCGTACATAATTTGTTTAGATTTGATGATTTCATACACAATTTTGAATGTGATAAT
AAAAGTTGATTACGAAATACGAACTAGCAAGTTGCAATTATGATATCATCCATCATACGGGTGTTTCAAGAGAAGGATGAAATACATTTTTTGAGATAAA
GAGAAGGATGAAATACTTAAAAATGCATATAATTTTAAGATTGCTGATGTAAAGCATAATTCAATGGGTTCAGTAGACCCT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.951116
Expected error %
0.442353
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0091J06
Clone
Clone name
hba-91j6
LE_HBa0091J06
P091J06
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found