Clone Read LE_HBa0091J18_SP6_95314

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0091J18_SP6_95314
Primer
SP6
ID from Seq. Facility
LE_HBa_091_J18-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
709 trimmed for vector and quality, 930 raw
Sequence
>LE_HBa0091J18_SP6_95314 (raw untrimmed)
TTCGGGCTGCTTGATCGCACTTGGAATATGCTGGATCCTAGAGAAGATGTCAATGTAAACTTTGCATCGGATAACAGCTCCAGTGTGTACGTCTGTCGCA
TAGACAGCAGTCTCCTTTCGACCTCTATAAGAGGCAATTGACTTCAAGCGGGCACTTGTAGAGCATTGATTACTCACATTGTACTCAGGCAGCACAGCTA
AAATGTCGTGATGATCCCATGTCCTAAATCCAAAAGGCAGACACACAGAAAGTAGAGCGAAAAAATATTAGTAGAAATCCATAAGAAGAGTTTCTAAGAA
GTAGAAAGTTACTTAACCAGCATCAACTTTTCACAATTTAAGAGGTCAGAGTATCAGTTGTCAATAGAAATCAGGTGATGAATCATGGCTTTAAAGTGCT
CAATAAACTTCCAATGGCATGAGATTTGTTCTATAAAACATAGAGCATGAAAAAGAAGCAAAAAACATTATTCAAGACTGAATAATTTTGCATCTAATAC
CGTTCCTTAATACAAAGTAAACACTTACCAATATATGTTACTATTGATATCCTTTGTAATCATAAACTATTCAAACTTCACTTATCATAATATCATGGCT
CTTGAAACCCCCAATAACTTCCTATTAATAGCCTATTCAGAAAAATGGATCACCCAGTATCAAAACCTCAGTTCCCAAAAGAAGGCAAGACAAACAATCA
GCAACAAACAAAAACACCAGCATAAACTTCAAGAACTAAACAGAGAACAGAGCTAAGAGAAAGCCTACATAGCTCAAAACCTTCACTGAAATCTATCACC
TATACCCGCACAGCTAATACCCAACTAAGCTTAAAGTTCCTTCAAACCTACTCACCTACCTCTTAAAGTAAATCACCAATATTTAAAACCAATTGGCACT
GATGTTTGTAGCCTAAACCCTCCAGGTAGT
>LE_HBa0091J18_SP6_95314 (trimmed for quality and cloning vector)
GGATCCTAGAGAAGATGTCAATGTAAACTTTGCATCGGATAACAGCTCCAGTGTGTACGTCTGTCGCATAGACAGCAGTCTCCTTTCGACCTCTATAAGA
GGCAATTGACTTCAAGCGGGCACTTGTAGAGCATTGATTACTCACATTGTACTCAGGCAGCACAGCTAAAATGTCGTGATGATCCCATGTCCTAAATCCA
AAAGGCAGACACACAGAAAGTAGAGCGAAAAAATATTAGTAGAAATCCATAAGAAGAGTTTCTAAGAAGTAGAAAGTTACTTAACCAGCATCAACTTTTC
ACAATTTAAGAGGTCAGAGTATCAGTTGTCAATAGAAATCAGGTGATGAATCATGGCTTTAAAGTGCTCAATAAACTTCCAATGGCATGAGATTTGTTCT
ATAAAACATAGAGCATGAAAAAGAAGCAAAAAACATTATTCAAGACTGAATAATTTTGCATCTAATACCGTTCCTTAATACAAAGTAAACACTTACCAAT
ATATGTTACTATTGATATCCTTTGTAATCATAAACTATTCAAACTTCACTTATCATAATATCATGGCTCTTGAAACCCCCAATAACTTCCTATTAATAGC
CTATTCAGAAAAATGGATCACCCAGTATCAAAACCTCAGTTCCCAAAAGAAGGCAAGACAAACAATCAGCAACAAACAAAAACACCAGCATAAACTTCAA
GAACTAAAC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.951374
Expected error %
0.321167
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g40480.1 Score 103 E Value 1e-22 Identity 24.90% Align. Length 188bp (26.52%) Frame 3
68418.m04909 expressed protein ; expression supported by MPSS
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAB10497.1| Score 103 E Value 6e-21 Identity 24.90% Align. Length 188bp (26.52%) Frame 3
nuclear pore protein-like [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_198864.1| Score 103 E Value 6e-21 Identity 24.90% Align. Length 188bp (26.52%) Frame 3
expressed protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0091J18
Clone
Clone name
hba-91j18
LE_HBa0091J18
C02HBa0091J18
P091J18
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found