Clone Read LE_HBa0091J18_T7_95315

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0091J18_T7_95315
Primer
T7
ID from Seq. Facility
LE_HBa_091_J18-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
839 trimmed for vector and quality, 918 raw
Sequence
>LE_HBa0091J18_T7_95315 (raw untrimmed)
CCTTGGGTTGTACTAGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGGGTTGCCCAAGTAGTCAAGTCCTTTTTCACTGAAGATCTGGGAT
CCGGCCTTGAACCACACAGCCTCACCGAACTTGACACCATTACGGGCCAAGAGCTCAGGGAAGACACATCCAAGAGCACCAAGCATAGCCCATCTGCAGT
GGATCACCTCAAGTTCACGGTTCTTGGCAAAAGTTTCAGGGTCTGCTGAAAGTCCAGCGGTATCCCACCCGTAATCACCAGGAAATTCACCGGTCAAGTA
GCTTGGGGACTCACCAGAGAATGGGCCCAAGTACTTAACACGGTCAGGGCCATACCATGGGCTGCTAGATGGGGCGGACTTGGCAACAGCCTTTCTCATA
GTGATCCTTCCATTTCCAGAAATTTCTGAGGCAGATGGTGAGAGTTTGACTGCCTGTCCAGCAAATGAAGGGGAAGAAAGAGCCATTGTAGCAGCTGCCA
TTTGTGTTTATTTTAAGAGAAGAATTAAGTGTTTGATGGGTGATGAAGATGAAGTTAGTTGGGGTTGAGAATATATAGGAGAAAAGAGAGAGAATCATCT
TATCAAGTGATATCTATATGTATGATCTCATTGGGTATCAAGATCCCATGTGTAGCACACTTGGCAATCTATAATCCATCAACTTCTTCATGATTTTTTA
CGAGGGGGACCCAACCAATGTTGTCCTCCTATGTATGGCTACAAGGATTTCACTCTAACTCGTGAGCTTACATTATGAACCCTCTACCAGCAGGATAACA
GATACCATCTGTTTCTACAGCTAGCTCATTCAATGGAGGTCCTTAAGCCTTTTTTTTTTGATGCATCTATTCCCTCCGGGTTTAGAGTTAACTGGGCAAG
AAAGAAAAAATGAAAGAA
>LE_HBa0091J18_T7_95315 (trimmed for quality and cloning vector)
AGCTTGGGGTTGCCCAAGTAGTCAAGTCCTTTTTCACTGAAGATCTGGGATCCGGCCTTGAACCACACAGCCTCACCGAACTTGACACCATTACGGGCCA
AGAGCTCAGGGAAGACACATCCAAGAGCACCAAGCATAGCCCATCTGCAGTGGATCACCTCAAGTTCACGGTTCTTGGCAAAAGTTTCAGGGTCTGCTGA
AAGTCCAGCGGTATCCCACCCGTAATCACCAGGAAATTCACCGGTCAAGTAGCTTGGGGACTCACCAGAGAATGGGCCCAAGTACTTAACACGGTCAGGG
CCATACCATGGGCTGCTAGATGGGGCGGACTTGGCAACAGCCTTTCTCATAGTGATCCTTCCATTTCCAGAAATTTCTGAGGCAGATGGTGAGAGTTTGA
CTGCCTGTCCAGCAAATGAAGGGGAAGAAAGAGCCATTGTAGCAGCTGCCATTTGTGTTTATTTTAAGAGAAGAATTAAGTGTTTGATGGGTGATGAAGA
TGAAGTTAGTTGGGGTTGAGAATATATAGGAGAAAAGAGAGAGAATCATCTTATCAAGTGATATCTATATGTATGATCTCATTGGGTATCAAGATCCCAT
GTGTAGCACACTTGGCAATCTATAATCCATCAACTTCTTCATGATTTTTTACGAGGGGGACCCAACCAATGTTGTCCTCCTATGTATGGCTACAAGGATT
TCACTCTAACTCGTGAGCTTACATTATGAACCCTCTACCAGCAGGATAACAGATACCATCTGTTTCTACAGCTAGCTCATTCAATGGAGGTCCTTAAGCC
TTTTTTTTTTGATGCATCTATTCCCTCCGGGTTTAGAGT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.981443
Expected error %
1.37535
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g29930.1 Score 256 E Value 1e-68 Identity 27.70% Align. Length 446bp (53.16%) Frame 1
68414.m03657 chlorophyll A-B binding protein 2, chloroplast / LHCII type I CAB-2 / CAB-140 (CAB2B) identical to SP|P04778 Chlorophyll A-B binding protein 2, chloroplast precursor (LHCII type I CAB-2) (CAB-140) (LHCP) {Arabidopsis thaliana}
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g34430.1 Score 254 E Value 3e-68 Identity 27.50% Align. Length 446bp (53.16%) Frame 1
68415.m04223 chlorophyll A-B binding protein / LHCII type I (LHB1B1) identical to photosystem II type I chlorophyll a/b binding protein [Arabidopsis thaliana] GI:16366
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
sp|P07370|CB2B_LYCES Score 281 E Value 2e-74 Identity 30.60% Align. Length 446bp (53.16%) Frame 1
Chlorophyll a-b binding protein 1B, chloroplast precursor (LHCII type I CAB-1B) (LHCP) gb|AAA34147.1| chlorophyll a/b-binding protein Cab-1B
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAA80589.1| Score 281 E Value 2e-74 Identity 30.60% Align. Length 446bp (53.16%) Frame 1
chlorophyll a/b binding protein
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0091J18
Clone
Clone name
hba-91j18
LE_HBa0091J18
C02HBa0091J18
P091J18
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found