Clone Read LE_HBa0091N05_SP6_95480

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0091N05_SP6_95480
Primer
SP6
ID from Seq. Facility
LE_HBa_091_N05-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
583 trimmed for vector and quality, 836 raw
Sequence
>LE_HBa0091N05_SP6_95480 (raw untrimmed)
CCTTTTGGGGAGTGCATAGTAGGTTTCCCTTTTGAGGGGGTGATGTGTGGATCCTTCTAAGATGGAGACACTTAAGAATTGGGTAAGACCTACTAATGTG
TCAGAAATAAGGAGCTTTGTTGGTCTAGCTAGCTATTACCGTCGATTTGTCAAGGGATTCTCTTCCATTGCTTCCCAATTGACAAACTTGACTAAGTAGA
ATGTTCCATTTGTATGGTCGGATGAATGTGAAGAAAGCTTTCAGAAGCTCAAGACCTTGTTGACTACCGCACCAATCCTTACCTTGCCAGTGGAAGGTAA
GAATTTCATTGTCTACTGTGATGCATCCTATTCGGGTTTGGGTGCAGTACTAATGCAAGACAAGAATGTAATTGCTTATGCTTCGAGGCAATTAAAGGTG
CACGAACGTAATTATCCGACTTTTGATTTGGAGTTGGTTGCGGTAGTGTTTGCATTAAAGCAATGGAGACATTATCTATATGGAGTCAAGTGTGAAGTCT
ATACTGATCATCTTCGCCTACAGTATGTCTTTACTCAGAGGGATTTGAATTTGAGATAGAGGACGTGGATGGAACTACTGAAGGATTATGATGTTACCAT
CCTGTATCACCAAGGAAAGGCTAATGTTGTGGCAGACGCCTTAATTATTTTTTTTGTTTTTTGTTTTTCCCAGCCTGGTTACTATTTTCTAGACGCCCAT
TTGCCATAGAGGTCCATACTCCGGCTAACAACTTTAGGAGGTTAAAAGTAAATGAGAAGGGAGGATTGTGGGTTTGTGTGGGAGGCAAATTCATTCTTTC
TTAACAACAATAAAGAGAAACAGTTTAATGATAAGA
>LE_HBa0091N05_SP6_95480 (trimmed for quality and cloning vector)
GGATCCTTCTAAGATGGAGACACTTAAGAATTGGGTAAGACCTACTAATGTGTCAGAAATAAGGAGCTTTGTTGGTCTAGCTAGCTATTACCGTCGATTT
GTCAAGGGATTCTCTTCCATTGCTTCCCAATTGACAAACTTGACTAAGTAGAATGTTCCATTTGTATGGTCGGATGAATGTGAAGAAAGCTTTCAGAAGC
TCAAGACCTTGTTGACTACCGCACCAATCCTTACCTTGCCAGTGGAAGGTAAGAATTTCATTGTCTACTGTGATGCATCCTATTCGGGTTTGGGTGCAGT
ACTAATGCAAGACAAGAATGTAATTGCTTATGCTTCGAGGCAATTAAAGGTGCACGAACGTAATTATCCGACTTTTGATTTGGAGTTGGTTGCGGTAGTG
TTTGCATTAAAGCAATGGAGACATTATCTATATGGAGTCAAGTGTGAAGTCTATACTGATCATCTTCGCCTACAGTATGTCTTTACTCAGAGGGATTTGA
ATTTGAGATAGAGGACGTGGATGGAACTACTGAAGGATTATGATGTTACCATCCTGTATCACCAAGGAAAGGCTAATGTTGTG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.971068
Expected error %
0.803183
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 273 E Value 3e-72 Identity 22.50% Align. Length 581bp (99.66%) Frame 3
putative polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38745.1| Score 271 E Value 1e-71 Identity 22.20% Align. Length 581bp (99.66%) Frame 3
putative polyprotein, 3'-partial [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0091N05
Clone
Clone name
hba-91n5
LE_HBa0091N05
P091N05
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found