Clone Read LE_HBa0091N05_T7_95481

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0091N05_T7_95481
Primer
T7
ID from Seq. Facility
LE_HBa_091_N05-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
807 trimmed for vector and quality, 882 raw
Sequence
>LE_HBa0091N05_T7_95481 (raw untrimmed)
ACCAAACGGGTCCCGGGGGGTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTATTGAGGCTGGATTTATCCCTTTAGTTAAGTACCCTACATGGGTTTC
AAGTATTGCCCGTCTGAGAAAAAAGAATTGGCAAATTCAAGTTTGCATTTACTTTAGCGATCTCAATAATGCATGTACAAAAGATGAATTTCTACTTCCT
ATCCCTTAACTTATGATTGATACCATTACTGGATATGAGGTGATATCTTTTATGGATGGTTCATCCAGATACAACCAGATCCGCATGTCACCAAAGGATG
AAGAGTTGACCGCATTCCGCACTCCTAAAGTCATTTATTGCTACAAAGTTATGCCTTTTGGTTTGAAGAATGCAAAAGCAACATACCAAAGAGCTATGCA
GAACATCTTTGATAGCATTCTTCACAAAAATATTGAATGTTATGTTGATGATTTAGTAGTGAAATAAAGGAAAAAGTGTAACCACTTGCAAGACTTAAAG
ATGGTGCTTGATCTACTACGAAGGTATCAACTTAGAATGAATCCTTTGAAATGTGCATTTGGAGTTACCTCTGGAAAATTTCTTGGCTTCTTTGTACGAC
ATCGATGTATCAAAATTGATCAAGCAAAAATAGACGCAATTCTGAAGATGGTTGATCTAAGAAACATTCATGAATTGAAGAGTCTACAAGAGAAACTAGC
AGATCTTAAGAGATTCATCTCGAATCTAGCAAGAAAGTGTCAACCATTCAGTTGTCTTATAAAAAGGGCACTCTTTTTGAATGGGGACTAATCTTGTAGT
AATTTCTTTGAGAGCATCCAGTCTTAATTGACCAAACCACCAATTTTAGCAGCTCTTTTTCCTTGAAAGCCATTGATACATT
>LE_HBa0091N05_T7_95481 (trimmed for quality and cloning vector)
AGCTTATTGAGGCTGGATTTATCCCTTTAGTTAAGTACCCTACATGGGTTTCAAGTATTGCCCGTCTGAGAAAAAAGAATTGGCAAATTCAAGTTTGCAT
TTACTTTAGCGATCTCAATAATGCATGTACAAAAGATGAATTTCTACTTCCTATCCCTTAACTTATGATTGATACCATTACTGGATATGAGGTGATATCT
TTTATGGATGGTTCATCCAGATACAACCAGATCCGCATGTCACCAAAGGATGAAGAGTTGACCGCATTCCGCACTCCTAAAGTCATTTATTGCTACAAAG
TTATGCCTTTTGGTTTGAAGAATGCAAAAGCAACATACCAAAGAGCTATGCAGAACATCTTTGATAGCATTCTTCACAAAAATATTGAATGTTATGTTGA
TGATTTAGTAGTGAAATAAAGGAAAAAGTGTAACCACTTGCAAGACTTAAAGATGGTGCTTGATCTACTACGAAGGTATCAACTTAGAATGAATCCTTTG
AAATGTGCATTTGGAGTTACCTCTGGAAAATTTCTTGGCTTCTTTGTACGACATCGATGTATCAAAATTGATCAAGCAAAAATAGACGCAATTCTGAAGA
TGGTTGATCTAAGAAACATTCATGAATTGAAGAGTCTACAAGAGAAACTAGCAGATCTTAAGAGATTCATCTCGAATCTAGCAAGAAAGTGTCAACCATT
CAGTTGTCTTATAAAAAGGGCACTCTTTTTGAATGGGGACTAATCTTGTAGTAATTTCTTTGAGAGCATCCAGTCTTAATTGACCAAACCACCAATTTTA
GCAGCTC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.963453
Expected error %
0.903089
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|XP_493776.1| Score 270 E Value 3e-71 Identity 17.30% Align. Length 803bp (99.50%) Frame 1
unnamed protein product [Oryza sativa (japonica cultivar-group)] dbj|BAB08213.2| Similar to Arabidopsis thaliana chromosome II BAC F26H6; putative retroelement pol polyprotein (AC006920) [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAQ82037.1| Score 235 E Value 1e-60 Identity 14.50% Align. Length 791bp (98.02%) Frame 1
gag/pol polyprotein [Pisum sativum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0091N05
Clone
Clone name
hba-91n5
LE_HBa0091N05
P091N05
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found