Clone Read LE_HBa0108F10_SP6_95874

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0108F10_SP6_95874
Primer
SP6
ID from Seq. Facility
LE_HBa_108_F10-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
620 trimmed for vector and quality, 851 raw
Genbank Accession
Sequence
>LE_HBa0108F10_SP6_95874 (raw untrimmed)
ATTACGTTTTTTTTACAGTATCCCACAGACNTTGTTGACTACTGCGCCAATCCTTACCCTGCCAGTAGAGGGTAAGAACTTCATTGTTTATTGTGATGCA
TCCTATTCTGGCTTGGGTGCAGTACTAATGCAAGAGAAGAATGTAATTGCTTATGCTTCAAGACAATTAAAGGTGCATGAACGTAATTATCCGACCCATG
ATTTGGAATTGGCTGCGGTAGTGTTTGCCTTAAAGCAATGGAGACACTATCTATATGGAGTTAAGTGTGAAGTATACACGGATCATCGTAGCCTACAGTA
TGTCTTTACTAAAAAAGATTTGAATTTAAGACAGAAGAGATGGATGGAACTACTGAAGGACTACGATATCACTATTTTGTATCATCCGGGAAAGGCTAAT
GTTGTGGCAGACGCCTTAAGTAGAAAGGCAGGGAGCATGGGAAGTCTAGCTCACTTGCAAGTTTCTAGATGTCCATTGGCTAGAGAGGTTCAGACTCTGG
CCAACGACTTTATGAGGTTAGAAGTAAATGAGAAAGGAGGATTGTTGGCTTGTGTGGAGGCGAGATCTTCTTTTCTTGACCAGACTAAGGGAAAGTAGTT
TAATGATGAGAAATTGACCCAGATCCGAGATAAAGTGTTGCGAAGAGAGGCTAAAGAAGCAACAATCGATGAGGAAGGTGTTTTGAGAATCAAGAAAAGG
GTATGTGTGCCCCCCCTTGATGATTTGATCAACACTATTCTGACAGAAGCTCCTAGTTCAAGGGTCTCCTTTACATCCGGGGGCAACCAAAATGTACCCG
TGACCTAAAAGCAACACTTTTTGGGGGAGAAGAAATGAATCCGGAACATTG
>LE_HBa0108F10_SP6_95874 (trimmed for quality and cloning vector)
TTGACTACTGCGCCAATCCTTACCCTGCCAGTAGAGGGTAAGAACTTCATTGTTTATTGTGATGCATCCTATTCTGGCTTGGGTGCAGTACTAATGCAAG
AGAAGAATGTAATTGCTTATGCTTCAAGACAATTAAAGGTGCATGAACGTAATTATCCGACCCATGATTTGGAATTGGCTGCGGTAGTGTTTGCCTTAAA
GCAATGGAGACACTATCTATATGGAGTTAAGTGTGAAGTATACACGGATCATCGTAGCCTACAGTATGTCTTTACTAAAAAAGATTTGAATTTAAGACAG
AAGAGATGGATGGAACTACTGAAGGACTACGATATCACTATTTTGTATCATCCGGGAAAGGCTAATGTTGTGGCAGACGCCTTAAGTAGAAAGGCAGGGA
GCATGGGAAGTCTAGCTCACTTGCAAGTTTCTAGATGTCCATTGGCTAGAGAGGTTCAGACTCTGGCCAACGACTTTATGAGGTTAGAAGTAAATGAGAA
AGGAGGATTGTTGGCTTGTGTGGAGGCGAGATCTTCTTTTCTTGACCAGACTAAGGGAAAGTAGTTTAATGATGAGAAATTGACCCAGATCCGAGATAAA
GTGTTGCGAAGAGAGGCTAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.97044
Expected error %
0.0745925
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38745.1| Score 288 E Value 7e-77 Identity 23.30% Align. Length 605bp (97.58%) Frame 2
putative polyprotein, 3'-partial [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 286 E Value 3e-76 Identity 22.90% Align. Length 605bp (97.58%) Frame 2
putative polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0108F10
Clone
Clone name
hba-108f10
LE_HBa0108F10
P108F10
Clone type
BAC
Contamination
none
Estimated length
104,795
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found