Clone Read LE_HBa0109A21_SP6_96424

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0109A21_SP6_96424
Primer
SP6
ID from Seq. Facility
LE_HBa_109_A21-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
670 trimmed for vector and quality, 778 raw
Sequence
>LE_HBa0109A21_SP6_96424 (raw untrimmed)
CATTTGTTATGTGTTGGGGTGTTTCAGATGTCTACAGTTTCTTAGAACAATTAATTTGATTTAAAACACAAACTCTTGACAAGAAACGAGAGTTTGGCTG
CGTCAACTAAAATTAGCTGTGACAATTCATTTTCTAGTACTATGTTACTGGTAGTTTGATACTATTTGTATAATATATTATAGGGATATTAATGAGTATT
TTCTTCCCTGGCTGGCTGGCTCCTCATAAGTTTTTTATAGGATTGAGATTAGTTCTAGTATTATGTATAGAACATTTACATAGCTAACCCTGAACTAGCT
CAGGGTTGTGTGGTGGATTGATCTATTGAGTGATTGCTGGACATTCCTGATGCAAGAAGAAGCTTACTATGCTGTAGGTTTGGGCAAAAGGTGGTATTAG
GTCTCGATGAGAACCAACTATGTAGCATCTACATTGAGAACTCAAGTCAATATATGTCATCAGTCCAATCCTTTGTAAGAACTACCACTAATAACGAACT
TCCAAATAAAGTAACAAAAAGATGATCTTATTATTGTAAACCAAGATATTGAATATTCAAATAAATCCCTAAATTCGCAACTCCCCTTATCCAGTAAAAA
ATCTATAATTCCTATTAATAAACCGAATCCCCTTCAAAATTAGTTACTAGCGCTTTTTGAGAATTTCCATAACTTTTGGAGTGATATTGTTTGAGTAACG
GATTGATACATCCTCTTAATTAAAATAAAGTGGAAACAGGAGTTGATCTAACTATGTGATAATGAAAGAATTTATTAT
>LE_HBa0109A21_SP6_96424 (trimmed for quality and cloning vector)
GTGTTTCAGATGTCTACAGTTTCTTAGAACAATTAATTTGATTTAAAACACAAACTCTTGACAAGAAACGAGAGTTTGGCTGCGTCAACTAAAATTAGCT
GTGACAATTCATTTTCTAGTACTATGTTACTGGTAGTTTGATACTATTTGTATAATATATTATAGGGATATTAATGAGTATTTTCTTCCCTGGCTGGCTG
GCTCCTCATAAGTTTTTTATAGGATTGAGATTAGTTCTAGTATTATGTATAGAACATTTACATAGCTAACCCTGAACTAGCTCAGGGTTGTGTGGTGGAT
TGATCTATTGAGTGATTGCTGGACATTCCTGATGCAAGAAGAAGCTTACTATGCTGTAGGTTTGGGCAAAAGGTGGTATTAGGTCTCGATGAGAACCAAC
TATGTAGCATCTACATTGAGAACTCAAGTCAATATATGTCATCAGTCCAATCCTTTGTAAGAACTACCACTAATAACGAACTTCCAAATAAAGTAACAAA
AAGATGATCTTATTATTGTAAACCAAGATATTGAATATTCAAATAAATCCCTAAATTCGCAACTCCCCTTATCCAGTAAAAAATCTATAATTCCTATTAA
TAAACCGAATCCCCTTCAAAATTAGTTACTAGCGCTTTTTGAGAATTTCCATAACTTTTGGAGTGATATT

This is probably not a useful sequence.

Problems:
  • Probable foreign DNA contamination
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.948691
Expected error %
0.145143
Sequence Annotations 
Automatic Annotations
Nicotiana tabacum Chloroplast (screening/organelle/nicotiana_tabacum_chloroplast)NCBI BLAST
gi|11465934|ref|NC_001879.1| Score 92 E Value 3e-20 Identity 87.50% Align. Length 254bp (37.91%) Frame 2
Nicotiana tabacum plastid, complete genome
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0109A21
Clone
Clone name
hba-109a21
LE_HBa0109A21
C01HBa0109A21
P109A21
Clone type
BAC
Contamination
none
Estimated length
22,868
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found