Clone Read LE_HBa0109C06_T7_96491

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0109C06_T7_96491
Primer
T7
ID from Seq. Facility
LE_HBa_109_C06-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
438 trimmed for vector and quality, 1006 raw
Sequence
>LE_HBa0109C06_T7_96491 (raw untrimmed)
CTAAGCTCGGTACCGAGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAACTAGCATAAGTGACAACTCCCTTAAGGGAAANACAACAGNNCANA
ACCNNCNAAAAGGCCTTTTGGGGGNANGAGAAGCAGNNNAAGCAANGAAAACNAAAACCAGCNCGCACAACAACGAGCACAANAGAAATCAAAAAAACAA
CANGGAAAAAAGNACACNANNACAAGCAAAAAGCACGAGAGNCCNCCNNCAACAGAANACAACACNCAGACGACAAAAAANAGAGACANGNCGAGGNAGA
GAAGCNAAAAGGAGACANGGAGNAACAAAAANAAAGNACANACNAAACGNGCAAAGACGCAAGAGAGCAAAAANAGAGACAGAANNNCNNNACCAACAAC
ACCAGCNCAACNAGAAGAAAAACAAAGNAAACAAAGCACNGCCACNNGCAAGGCGACNAAANCACNNGAAAGGAGAGAAGAAAAACACAANNNCNNNCGA
AGNNNGGCNANNGAAANACGGGCAACGCNACNGAANCACCNGAAGAAAAAAAGAANNGCGAANCAANCACACAACCAAACAGGAACGAGNNAGGAACGAG
ACAANGANGCCAACAAAGAAGCACCAGNCCACAAAAACAAGGACAAANCAGNAACACAACGNNNGGAAGCGCCNCCAAAAGGGAACACACCCNCAAGCGA
CACAGCAGAACNCNCGAGGCACAAAGGAAGAGGGGAACAAGAGAGGCCCCCCAACCAGGGCACGGACCAAGAAAAAAAACCAAGCAGGAAGCCACAAGCC
CAACGGGAAGAACCCGGACCAGCCGAAAACCAGCCCAAGGCCCGGAGAAAAAGGCAACACAACCCACAAACAACCCACCGGAAAACCGAAACCAACCGCG
AGCACAACAAAGAAAGGGAAACACAAAGACCCACCAAAAACCCGAACCCGCAAAAACCCGCAAAAGGGGGGGGCGCCAAAAGCCCCCAGACCGCCCAANA
CAACAN
>LE_HBa0109C06_T7_96491 (trimmed for quality and cloning vector)
AGCTTAACTAGCATAAGTGACAACTCCCTTAAGGGAAANACAACAGNNCANAACCNNCNAAAAGGCCTTTTGGGGGNANGAGAAGCAGNNNAAGCAANGA
AAACNAAAACCAGCNCGCACAACAACGAGCACAANAGAAATCAAAAAAACAACANGGAAAAAAGNACACNANNACAAGCAAAAAGCACGAGAGNCCNCCN
NCAACAGAANACAACACNCAGACGACAAAAAANAGAGACANGNCGAGGNAGAGAAGCNAAAAGGAGACANGGAGNAACAAAAANAAAGNACANACNAAAC
GNGCAAAGACGCAAGAGAGCAAAAANAGAGACAGAANNNCNNNACCAACAACACCAGCNCAACNAGAAGAAAAACAAAGNAAACAAAGCACNGCCACNNG
CAAGGCGACNAAANCACNNGAAAGGAGAGAAGAAAAAC

This is probably not a useful sequence.

Problems:
  • High predicted error rate
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.942167
Expected error %
25.125
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0109C06
Clone
Clone name
hba-109c6
LE_HBa0109C06
P109C06
Clone type
BAC
Contamination
none
Estimated length
74,678
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found