Clone Read LE_HBa0109D12_T7_96551

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0109D12_T7_96551
Primer
T7
ID from Seq. Facility
LE_HBa_109_D12-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
495 trimmed for vector and quality, 962 raw
Genbank Accession
Sequence
>LE_HBa0109D12_T7_96551 (raw untrimmed)
TCAACCCGGTTCCGGGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCATAGTCCTCTGTCGAATCTTTAGTCTTGACCGCTACAAAGCGAG
AAGACTTAGCCATCCTATCAACTATCACCCAAATTGATTCATGTTGTGTGCGAGTACGAGGTAACCTGTGATAAAATCCATATTGATCACTTTCAATTTC
CAAGTAGGAATATCGATCTCTTGAGTCATACGTCTTGGTTTCTGATGTGCTACCTTGACTTTTTGGCAATTGGGGCACTTACTAACAAAGTCTAATGTAT
CCCTCTTCATGTAATTCCACAAATAGAATTCCCACAGAACGCGGTAAATCTTAGTGGCACCTCGATAAATAGAAAATTTGGAGTTATGGGCTTCTATAAG
GATATGCTTTCTCAAGTCACCCACATCAGGAACGCACAATCTACACTTCTAGCGAAGAACACCATCTCCCCCTTGGGAGAAAACCTTCACTCTCTGATTG
TGGACTGAATTTTTAAGTTCAAGCTAAATTGGATCATTGTCTTGCCTTTTCTAAACCTCCGACACCGAAAAGAAATTCTGCCCCATGCTGAAGTGATAGA
CTTGGACCTGATGATCGCACAGGGCGCGATGCTGAACGACCGTTCCTGTGAGCTTTCCTTATACATCTCCTTCCTTTTTCACCCTAGTGTTTAATATTAT
TCAATGTTTATTACATATTAGTTCCTACCGATAGGTCTCCAAGATGAGTTGTGATCCACCCTCCCATGATTATCTAATAGAACTCAATTTTCTTTCGATG
ATTATATAGACATGTGTCGCGTAATCGTACTGAATCCACGTCTGAACTGAATTGCAACTTGCGACACTATTTCAGTCTTAGAATTATCATATCTCAGAAC
ATACGACGCGCCACGCCGGCTGATAGGGAACTCAATCCACTCCGTAATCATGAGTAGTCTAA
>LE_HBa0109D12_T7_96551 (trimmed for quality and cloning vector)
AGCTTGGCATAGTCCTCTGTCGAATCTTTAGTCTTGACCGCTACAAAGCGAGAAGACTTAGCCATCCTATCAACTATCACCCAAATTGATTCATGTTGTG
TGCGAGTACGAGGTAACCTGTGATAAAATCCATATTGATCACTTTCAATTTCCAAGTAGGAATATCGATCTCTTGAGTCATACGTCTTGGTTTCTGATGT
GCTACCTTGACTTTTTGGCAATTGGGGCACTTACTAACAAAGTCTAATGTATCCCTCTTCATGTAATTCCACAAATAGAATTCCCACAGAACGCGGTAAA
TCTTAGTGGCACCTCGATAAATAGAAAATTTGGAGTTATGGGCTTCTATAAGGATATGCTTTCTCAAGTCACCCACATCAGGAACGCACAATCTACACTT
CTAGCGAAGAACACCATCTCCCCCTTGGGAGAAAACCTTCACTCTCTGATTGTGGACTGAATTTTTAAGTTCAAGCTAAATTGGATCATTGTCTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.977622
Expected error %
0.851331
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38744.1| Score 156 E Value 1e-48 Identity 57.90% Align. Length 490bp (98.99%) Frame 1
putative gag-pol polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38724.1| Score 156 E Value 6e-49 Identity 57.90% Align. Length 490bp (98.99%) Frame 1
putative retrotransposon protein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0109D12
Clone
Clone name
hba-109d12
LE_HBa0109D12
P109D12
Clone type
BAC
Contamination
none
Estimated length
120,875
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found