Clone Read LE_HBa0126O06_T7_97835

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0126O06_T7_97835
Primer
T7
ID from Seq. Facility
LE_HBa_126_O06-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
461 trimmed for vector and quality, 815 raw
Genbank Accession
Sequence
>LE_HBa0126O06_T7_97835 (raw untrimmed)
CCCGGTCCCGGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGTGCACGAATCAATATATGACAAGGTACTTGAACCACTAGTTGATGTTTACA
AGCAAGTTAAGATAGGGGATCCTTTAGAAAAAGGAACCTTACTTGGGCCATTGCATACTCGTACTTCTAGGGAAAACTTCGAGAAGGGAATCCACAATAT
CAAGTCCCAGGTATGTCCAGTTTCTTGAGACTTTTATTTCCAAATTATTTCTAAATTGACATTGATTTTGCCTCTCCTCCTAGTCTTGCCCTACCCCTTG
TTATATGTTGATGGTGAGGACAGTTGTACAACATGGATAAGATTTGTCTAACAAGTTGATTTGTTAAAGTTTCACAGTTTTATCCCCCCTAAGCATATCT
CTAGTAATCAGGTCATACAATATTTTTGAAAAGAAAAGGAGACATAATTTGTCAACTCAGCTGGAATTGAATTTTTTCCTTTTCCAATAGAAAGTGAAGT
GTTATCATAACCTCGGTACTTAAATGGAACATTTTGCAGGGTGGTATGCTCCACACCCGTGTCCTCCATCTTAGAAAAGTGAGGGGTAATTATTGCCTGT
CCACCGATTGCTGTAATTACCCTCCGATCTTGCAGTCGCGCTTGCTTCCATGTGAATGCTACCATCTGCCTACTTTAAAGCTAGTTCCTACTATCTTCCC
TCACTTCAGCTCGCTCAATTTTCTACTCATTCTAGTTATTGTTAATTATTGTCTGTATTGCTATGACATTATCATCACGATGGATCTTCTCCTCTTCTCT
CGCCTGCTCCTCTTT
>LE_HBa0126O06_T7_97835 (trimmed for quality and cloning vector)
AGCTTGTGCACGAATCAATATATGACAAGGTACTTGAACCACTAGTTGATGTTTACAAGCAAGTTAAGATAGGGGATCCTTTAGAAAAAGGAACCTTACT
TGGGCCATTGCATACTCGTACTTCTAGGGAAAACTTCGAGAAGGGAATCCACAATATCAAGTCCCAGGTATGTCCAGTTTCTTGAGACTTTTATTTCCAA
ATTATTTCTAAATTGACATTGATTTTGCCTCTCCTCCTAGTCTTGCCCTACCCCTTGTTATATGTTGATGGTGAGGACAGTTGTACAACATGGATAAGAT
TTGTCTAACAAGTTGATTTGTTAAAGTTTCACAGTTTTATCCCCCCTAAGCATATCTCTAGTAATCAGGTCATACAATATTTTTGAAAAGAAAAGGAGAC
ATAATTTGTCAACTCAGCTGGAATTGAATTTTTTCCTTTTCCAATAGAAAGTGAAGTGTTA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.954217
Expected error %
0.500251
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g54100.2 Score 87 E Value 3e-18 Identity 25.50% Align. Length 164bp (35.57%) Frame 1
68414.m06167 aldehyde dehydrogenase, putative / antiquitin, putative strong similarity to SP|Q41247 Aldehyde dehydrogenase family 7 member A1 (EC 1.2.1.3) (Antiquitin 1) (Brassica turgor-responsive/drought-induced gene 26 protein) (Btg-26) {Brassica napus}; similar to turgor-responsive protein 26G (aldehyde dehydrogenase family 7 member A1) [Pisum sativum] SWISS-PROT:P25795
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g54100.1 Score 87 E Value 3e-18 Identity 25.50% Align. Length 164bp (35.57%) Frame 1
68414.m06166 aldehyde dehydrogenase, putative / antiquitin, putative strong similarity to SP|Q41247 Aldehyde dehydrogenase family 7 member A1 (EC 1.2.1.3) (Antiquitin 1) (Brassica turgor-responsive/drought-induced gene 26 protein) (Btg-26) {Brassica napus}; similar to turgor-responsive protein 26G (aldehyde dehydrogenase family 7 member A1) [Pisum sativum] SWISS-PROT:P25795
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
sp|Q41247|AL7A1_BRANA Score 89 E Value 3e-17 Identity 26.10% Align. Length 164bp (35.57%) Frame 1
Aldehyde dehydrogenase family 7 member A1 (Antiquitin 1) (Brassica turgor-responsive/drought-induced gene 26 protein) (Btg-26) gb|AAB33843.1| aldehyde dehydrogenase homolog [Brassica napus]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAE48164.1| Score 87 E Value 1e-16 Identity 25.50% Align. Length 164bp (35.57%) Frame 1
putative aldehyde dehydrogenase [Arabidopsis thaliana] gb|AAM51420.1| putative aldehyde dehydrogenase-like protein [Arabidopsis thaliana] gb|AAM13853.1| putative aldehyde dehydrogenase homolog [Arabidopsis thaliana] gb|AAM26712.1| At1g54100/F15I1_19 [Arabidopsis thaliana] ref|NP_849807.1| aldehyde dehydrogenase, putative / antiquitin, putative [Arabidopsis thaliana] ref|NP_175812.1| aldehyde dehydrogenase, putative / antiquitin, putative [Arabidopsis thaliana] gb|AAK82504.1| At1g54100/F15I1_19 [Arabidopsis thaliana] gb|AAK55676.1| At1g54100/F15I1_19 [Arabidopsis thaliana] gb|AAD25783.1| Strong similarity to gb|S77096 aldehyde dehydrogenase homolog from Brassica napus and is a member of PF|00171 Aldehyde dehydrogenase family. ESTs gb|T46213, gb|T42164, gb|T43682, gb|N96380, gb|T42973, gb|Z34663, gb|Z46535, gb|T45453, gb|T04256, and gb|T20704 come from this gene. [Arabidopsis thaliana] sp|Q9SYG7|AL7A1_ARATH Aldehyde dehydrogenase family 7 member A1 (Antiquitin 1)
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0126O06
Clone
Clone name
hba-126o6
LE_HBa0126O06
C03HBa0126O06
P126O06
Clone type
BAC
Contamination
none
Estimated length
93,094
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found