Clone Read LE_HBa0126O21_SP6_97864

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0126O21_SP6_97864
Primer
SP6
ID from Seq. Facility
LE_HBa_126_O21-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
473 trimmed for vector and quality, 755 raw
Genbank Accession
Sequence
>LE_HBa0126O21_SP6_97864 (raw untrimmed)
ACCAAGGTGTTCCAAGACGTATCTCTCCCTTTTTGAAGGTCCCCCAATATGGCTTGGTATCATGCCTGAAAACCGTTTACCAGAAAGATCTAGTCCTACA
ATGGCCTTCAGTCCTCCAATATCCTGTGGAACTTCTCCCTCTATAGAATTTTGTGACATGATTAGATAGAGAAGACCACTCATCTTCCAAATGCTCAAAG
GAATCTTGGATGAGAATTTGTTAGAACTCAATCTAATGGCTTGTAGCATGCTAATATTTCCTAAACATTCTGGAATTAATCCAGAGAGCTCATTACCATC
CAGACTTAACTGAACCATATTAGATAAATTGCATACCGCCTCTGGAATATGTCCCTGCAATTTATTGTTATTTAGATACAACCCTTGGAGTTGTTCAAGC
TTAACAACATCAGAAGGAATACGCCCCGCCTAGTTGTTCTCTCCAAGGCTTAGGGTTATTAGACCGCTCATGTTGCGTATACCCCTGGGGATGGGGCCAT
AAATGTGTGCATCTGATATATGTAAGTATTCAACAGTAGATGAATGATTCCCAATAGAATTGGGCAGAATGCCATTCAACGGATTGCGACCCTCTTGTAG
ATATTCTCAACATCCCTTCCAGTTCCGACCAAAGAATTGAAGAACTGCAATTCATGCCCTCTTTGGTTCACTGGTAAATTGAATATTGATTTATGAATTG
ATCTTAGCAAGCTTCTGTAAGATTTCCCCAAATTTCCTACGAATTTAGTGCCCGG
>LE_HBa0126O21_SP6_97864 (trimmed for quality and cloning vector)
GCTTGGTATCATGCCTGAAAACCGTTTACCAGAAAGATCTAGTCCTACAATGGCCTTCAGTCCTCCAATATCCTGTGGAACTTCTCCCTCTATAGAATTT
TGTGACATGATTAGATAGAGAAGACCACTCATCTTCCAAATGCTCAAAGGAATCTTGGATGAGAATTTGTTAGAACTCAATCTAATGGCTTGTAGCATGC
TAATATTTCCTAAACATTCTGGAATTAATCCAGAGAGCTCATTACCATCCAGACTTAACTGAACCATATTAGATAAATTGCATACCGCCTCTGGAATATG
TCCCTGCAATTTATTGTTATTTAGATACAACCCTTGGAGTTGTTCAAGCTTAACAACATCAGAAGGAATACGCCCCGCCTAGTTGTTCTCTCCAAGGCTT
AGGGTTATTAGACCGCTCATGTTGCGTATACCCCTGGGGATGGGGCCATAAATGTGTGCATCTGATATATGTA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.96884
Expected error %
0.6075
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g11080.1 Score 114 E Value 2e-26 Identity 40.10% Align. Length 470bp (99.37%) Frame 2
68416.m01339 disease resistance family protein contains leucine rich-repeat domains Pfam:PF00560, INTERPRO:IPR001611; similar to Cf-2.2 [Lycopersicon pimpinellifolium] gi|1184077|gb|AAC15780
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g46330.1 Score 112 E Value 1e-25 Identity 40.10% Align. Length 470bp (99.37%) Frame 2
68418.m05703 leucine-rich repeat transmembrane protein kinase, putative
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAC15780.1| Score 122 E Value 4e-27 Identity 38.90% Align. Length 470bp (99.37%) Frame 2
Cf-2.2 [Lycopersicon pimpinellifolium]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAC15779.1| Score 122 E Value 4e-27 Identity 38.90% Align. Length 470bp (99.37%) Frame 2
Cf-2.1 [Lycopersicon pimpinellifolium] pir||T10504 disease resistance protein Cf-2.1 - currant tomato prf||2207203A Cf-2 gene
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0126O21
Clone
Clone name
hba-126o21
LE_HBa0126O21
P126O21
Clone type
BAC
Contamination
none
Estimated length
154,496
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found