Clone Read LE_HBa0126O21_T7_97865

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0126O21_T7_97865
Primer
T7
ID from Seq. Facility
LE_HBa_126_O21-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
438 trimmed for vector and quality, 824 raw
Genbank Accession
Sequence
>LE_HBa0126O21_T7_97865 (raw untrimmed)
TCACGGTCCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCTTCCATTTTTACATATATATACCCTTTAAGGTTATTGGTTATCGAATAGT
GTTTATATATCCTCCTATTCTAATCAATATCGTATGTTTATTCTTTGTTGTTAATTGATTGAATTGTTAAAAAATTGTAACACTATTTTTTTTTACTTTT
AAAAATATCATATGACTATAAAAAGTATTTCACTCATATAGTATTAAATATTAATTTCTTTGATTTGATGACTAAATTAAACATCAGTATTTTTTTTTTT
AAAATCGCGTTGTTACTATATTAGGATATTATAATTATATGCACTACATATTAACTAAAAATTATGTAATGATAACAAAAATAGCATAATGATATCAACA
ATGATCCTGGTGGTCCCAATTTTCAAATATTTTGGTACCATACATTCATGTCGTTCCTTATTATACTCTATTTTTTTTTTTTTGCCCCCCCCCTCTGTTA
TTTAATCTATAACTCCCTAAAATAAATAGGCCTCTTCTCCGTACCACCATACATATTTTTGTTTTAATATTTATTAATTACTCTGTAATAGTATTCCTCT
TTGAATTTTCCTGTTTCATTATAACCCTTACAAAAGTCACCACACTAAATTCCACCTCATAATATACTCTAATTTCCTGTATATTTTTTTATTTTTTTGT
CATTCTTTTCTCTTTCTTTGAATATTCATCCACTTATTTCCATTGTTCGTATTATCAATCATCTCTACATTTTATCCCATATCCATACCCTACCTATACA
CATGCCATAACGTAATTTTACTTT
>LE_HBa0126O21_T7_97865 (trimmed for quality and cloning vector)
AGCTTCTTCCATTTTTACATATATATACCCTTTAAGGTTATTGGTTATCGAATAGTGTTTATATATCCTCCTATTCTAATCAATATCGTATGTTTATTCT
TTGTTGTTAATTGATTGAATTGTTAAAAAATTGTAACACTATTTTTTTTTACTTTTAAAAATATCATATGACTATAAAAAGTATTTCACTCATATAGTAT
TAAATATTAATTTCTTTGATTTGATGACTAAATTAAACATCAGTATTTTTTTTTTTAAAATCGCGTTGTTACTATATTAGGATATTATAATTATATGCAC
TACATATTAACTAAAAATTATGTAATGATAACAAAAATAGCATAATGATATCAACAATGATCCTGGTGGTCCCAATTTTCAAATATTTTGGTACCATACA
TTCATGTCGTTCCTTATTATACTCTATTTTTTTTTTTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.866758
Expected error %
1.70738
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0126O21
Clone
Clone name
hba-126o21
LE_HBa0126O21
P126O21
Clone type
BAC
Contamination
none
Estimated length
154,496
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found