Clone Read LE_HBa0129L05_SP6_98456

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0129L05_SP6_98456
Primer
SP6
ID from Seq. Facility
LE_HBa_129_L05-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
750 trimmed for vector and quality, 982 raw
Genbank Accession
Sequence
>LE_HBa0129L05_SP6_98456 (raw untrimmed)
CCGGGCATAATGGTTGAAATACTATACTATTTATTTACTTAATTATGTCTTTAGACGTACCCAAAGCCATTGCAACCTGTGTCACATGCCTGAATAATAT
CGGAGCAAAGTGCAATCTTATCGATGTTTCGAGTAATTTGATATGATTTGAATAGTATATAAGCAGTCCCTAAAGTTCCAGTGTAGAGTGTGTAGTCTTT
TACATGTCTTCCTTTCGCTGACCATGTCTCCCTCACAACCTTATAATTTAGGGAACACAAAATTAGAAACACACAAAAATTAATGAATTTCAATTATTCA
AATGTAGACAAACTCATAAAAATTAAGTATGAAAATTGCAAAACATAAATAAATACTCCAATGTTTCAGTTTATACTACACATATTTTTTTAATCAATCT
AAAAAGAAAAGATCTTTTTTGGCCAGAAAATTTGACCAGAATGAATTTTTTAAATATAATTTTACTTTTTAAAAAACATTTTTACCCTTTTAGCACTAAT
AATTTTTTGACCAAATTCTGATCAAATTTTCTAACCATTTAACACACCTAGAAAATTATAATACATTCTTTTAAGTTCAAGGGAGGAAGTAGTAGCATAG
TGTATTTCTATCAATAAAAATTCATTAGATATATAAAAATATTAGTAGCAGCATAGTGTATTTCTATCAATAATAAATTCACTAGATATGTAAAAATATT
AATTTAAAGCCCAATAATTACCACTTGTCAGATAAAATTCACAACAAGTTAAATTAAAATCCTAATGTCACCTATAGCTAAATCTAAACTTTGTTTAGCA
AAAGTTCCTCCAAGTATTCTCCATCTTTTTTTTAAGGGTAATTTTAAAACATGATGAAATCTCTCTTACTTAATTAAACTTCCTAACCAGGGAAATCACA
TAAATTGAAACGAAACAAAAAAAAATCCCCAAATCGTCATGAATTTCCGGCCAAAATGAGTTTTCCTTTTTAAACCGGTGAC
>LE_HBa0129L05_SP6_98456 (trimmed for quality and cloning vector)
TATTTACTTAATTATGTCTTTAGACGTACCCAAAGCCATTGCAACCTGTGTCACATGCCTGAATAATATCGGAGCAAAGTGCAATCTTATCGATGTTTCG
AGTAATTTGATATGATTTGAATAGTATATAAGCAGTCCCTAAAGTTCCAGTGTAGAGTGTGTAGTCTTTTACATGTCTTCCTTTCGCTGACCATGTCTCC
CTCACAACCTTATAATTTAGGGAACACAAAATTAGAAACACACAAAAATTAATGAATTTCAATTATTCAAATGTAGACAAACTCATAAAAATTAAGTATG
AAAATTGCAAAACATAAATAAATACTCCAATGTTTCAGTTTATACTACACATATTTTTTTAATCAATCTAAAAAGAAAAGATCTTTTTTGGCCAGAAAAT
TTGACCAGAATGAATTTTTTAAATATAATTTTACTTTTTAAAAAACATTTTTACCCTTTTAGCACTAATAATTTTTTGACCAAATTCTGATCAAATTTTC
TAACCATTTAACACACCTAGAAAATTATAATACATTCTTTTAAGTTCAAGGGAGGAAGTAGTAGCATAGTGTATTTCTATCAATAAAAATTCATTAGATA
TATAAAAATATTAGTAGCAGCATAGTGTATTTCTATCAATAATAAATTCACTAGATATGTAAAAATATTAATTTAAAGCCCAATAATTACCACTTGTCAG
ATAAAATTCACAACAAGTTAAATTAAAATCCTAATGTCACCTATAGCTAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.909859
Expected error %
0.403846
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0129L05
Clone
Clone name
hba-129l5
LE_HBa0129L05
C07HBa0129L05
P129L05
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found