Clone Read LE_HBa0129L05_T7_98457

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0129L05_T7_98457
Primer
T7
ID from Seq. Facility
LE_HBa_129_L05-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
476 trimmed for vector and quality, 660 raw
Genbank Accession
Sequence
>LE_HBa0129L05_T7_98457 (raw untrimmed)
CTCTAGCTCGGTCCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCATAATCTAATGCCATAAGTTCGGGGCGTTTCCTCTTTGTTTTTGG
TCCAAAAGCATCAGCACCTGGCTCATTGTCAAGCAGATGAACTTTTACTTGCTTTAATCAAAAAGAGAAAAAGAGAAAAATATTAGCAAACAAATCCAGT
ATGAAGCATAAAGCAACAAGATTTAGCCTCAATTTGCCAAGTTATTCTATACACACACAAATAGTACATGTGCGTATCACAGGAAGCCCCCAAATCATAC
AATAATGAGTGCACATTAGAATTACAATAGCAGAGTAAAGAGATTCACGGTGACTCAGCAGGAACATAAGAACAAGTTGTTAAATAATAAAACTAAGGAA
AAAGAATCTCCCATACCTTCTGATGATCATTTAAAAGGGACATGGGCAACTTCCTTTCTTTTAATATAACATTGTAGTTACTGGAAAGCCGAGTTTGGAG
CTCTTCTCTAAAAAACTCCAGTTCCTTCTGGTTGACCCCCCGAGTATTACCTGTGAAGTTGGGAAAATAATTCCCCAATTCATTTATTTCAACAAAATTC
AGTCCTACCCGAAAAGTAGCCTCCACTAAACCAAAAGGACTTTTTTAACGAAGAAAATAA
>LE_HBa0129L05_T7_98457 (trimmed for quality and cloning vector)
AGCTTCATAATCTAATGCCATAAGTTCGGGGCGTTTCCTCTTTGTTTTTGGTCCAAAAGCATCAGCACCTGGCTCATTGTCAAGCAGATGAACTTTTACT
TGCTTTAATCAAAAAGAGAAAAAGAGAAAAATATTAGCAAACAAATCCAGTATGAAGCATAAAGCAACAAGATTTAGCCTCAATTTGCCAAGTTATTCTA
TACACACACAAATAGTACATGTGCGTATCACAGGAAGCCCCCAAATCATACAATAATGAGTGCACATTAGAATTACAATAGCAGAGTAAAGAGATTCACG
GTGACTCAGCAGGAACATAAGAACAAGTTGTTAAATAATAAAACTAAGGAAAAAGAATCTCCCATACCTTCTGATGATCATTTAAAAGGGACATGGGCAA
CTTCCTTTCTTTTAATATAACATTGTAGTTACTGGAAAGCCGAGTTTGGAGCTCTTCTCTAAAAAACTCCAGTTCC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.945169
Expected error %
0.964813
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g52980.1 Score 65 E Value 2e-11 Identity 27.80% Align. Length 107bp (22.48%) Frame 3
68414.m05995 GTP-binding family protein contains Pfam domain, PF01926: GTPase of unknown function
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0129L05
Clone
Clone name
hba-129l5
LE_HBa0129L05
C07HBa0129L05
P129L05
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found