Clone Read LE_HBa0129M03_SP6_98500

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0129M03_SP6_98500
Primer
SP6
ID from Seq. Facility
LE_HBa_129_M03-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
701 trimmed for vector and quality, 957 raw
Genbank Accession
Sequence
>LE_HBa0129M03_SP6_98500 (raw untrimmed)
CGGGGGTTACTTTTTTGCATCTTTTTTGTTTTGTTTGAAGTGCTAAAGTTTTGATTCTCTTAGCTATGATAGTTGATGCCATAAAAAGTATAGTTCTACC
TTATAGACATATCGCCTGTTCTTTCCAGTTTCAGTCAATCTTGTCCAGAGCACATTCATGACCATCTGACACTCGGAGCTGCAAAATACCTAAATAGATC
AACCAGCTGAAGAAAAGACGCAGACAAATAATATTTTTTTTTGAAACGAAAAGACGCAGACAAATAATTAATCAACTGAATCAAGAATATACAATGGCTA
ACTCGTACAATTTTTTTGTAGCCTGTGCTATCTCAGCCAAAGCAGTACCATGAGGGCCCCAGGGCTCATCATCAGTAGCATCCAATACCTAGTACCATGT
TGAAATAATCACATCATCCTTCAAACCAATGAAAAAAAAAGAAGAGGAGAGTCCAAAGTAGAAAGCCCTAACATCCAATCTAATTTCCACGCCGCTCATT
TCATGTAAGAAGCCTAGCATAAGGATACTCGCCAGCATTTTCCTAGACCAAAAAGTAATCCTGAACTATGCAAAGTTAAAATGCATAGCAAAGAGCACAA
CTCTGGTGATGCTTTCATGATGACATTTAGCCCACTAAACTTCATTTTTTGGGTTCTAACACACGATCAAATGAGTAGGTAATTAAGAATATTAGCAAAC
AGCAGATAGAATTCTGAGGAACAATTAAGACAGAGATCCTAGATCCGGACAAATAAGATGCTTATAGCATTGTATCTCATTGCTATGGTTCAACCCCGTA
GGGATTCTCTGCGTATTCTTAAGCTTAGTTCTGTCGCTTTAACCTGTAGTAACTATTCTCCACATTTTTCACTCAACAACATAAAAAACCCAAATTTTGT
TTTAGAAAAATCTATGTATCTTCATCTAAGGGCCTTTTATCTAGAAATACTTCTTTT
>LE_HBa0129M03_SP6_98500 (trimmed for quality and cloning vector)
GTTTTGTTTGAAGTGCTAAAGTTTTGATTCTCTTAGCTATGATAGTTGATGCCATAAAAAGTATAGTTCTACCTTATAGACATATCGCCTGTTCTTTCCA
GTTTCAGTCAATCTTGTCCAGAGCACATTCATGACCATCTGACACTCGGAGCTGCAAAATACCTAAATAGATCAACCAGCTGAAGAAAAGACGCAGACAA
ATAATATTTTTTTTTGAAACGAAAAGACGCAGACAAATAATTAATCAACTGAATCAAGAATATACAATGGCTAACTCGTACAATTTTTTTGTAGCCTGTG
CTATCTCAGCCAAAGCAGTACCATGAGGGCCCCAGGGCTCATCATCAGTAGCATCCAATACCTAGTACCATGTTGAAATAATCACATCATCCTTCAAACC
AATGAAAAAAAAAGAAGAGGAGAGTCCAAAGTAGAAAGCCCTAACATCCAATCTAATTTCCACGCCGCTCATTTCATGTAAGAAGCCTAGCATAAGGATA
CTCGCCAGCATTTTCCTAGACCAAAAAGTAATCCTGAACTATGCAAAGTTAAAATGCATAGCAAAGAGCACAACTCTGGTGATGCTTTCATGATGACATT
TAGCCCACTAAACTTCATTTTTTGGGTTCTAACACACGATCAAATGAGTAGGTAATTAAGAATATTAGCAAACAGCAGATAGAATTCTGAGGAACAATTA
A

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.953018
Expected error %
0.326246
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAD41810.2| Score 53 E Value 1e-12 Identity 65.70% Align. Length 288bp (41.08%) Frame 2
OSJNBa0083N12.8 [Oryza sativa (japonica cultivar-group)] ref|XP_473754.1| OSJNBa0083N12.8 [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0129M03
Clone
Clone name
hba-129m3
LE_HBa0129M03
C08HBa0129M03
P129M03
Clone type
BAC
Contamination
none
Estimated length
97,885
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found