Clone Read LE_HBa0129M03_T7_98501

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0129M03_T7_98501
Primer
T7
ID from Seq. Facility
LE_HBa_129_M03-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
642 trimmed for vector and quality, 755 raw
Genbank Accession
Sequence
>LE_HBa0129M03_T7_98501 (raw untrimmed)
ATTAACTCGGTACCGTGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTGCGGGATTTGCTTGCTTGCCCTTTAATCTTCGGTGGAGGTAGGTTA
TGGTTTTTACACTACCCTTAATAAACTCTTAATATCGAATGATATATATTGGGTAGTGTTGTAAACCCTTCTATATGCTTAATTGTGTGTTTGCATGTTG
TGATTATATAATTGTGATGAGATAAGCATGATGAAGCTATTGAATTCTAAATCTTGAAAAAGAAACCCTAATCTACTTTGTTAATGATGATTCCTTAGTA
TACGAGAAGGCTTGATGAACGAAAGTAGTGAGATTAGGGGATCGGGTGCCACGTTCTGGTACCAGGATAGTATATGAGGATCGGAGTGTCACGTTCCGAC
ATAAGGATAGTATATGGATCGGGTGCCACGTTCCTGTACCAGGATAGAATATGGATCGGGTGTCACATTTCGACACTAGGATAGTATATGAGGAGCAGAG
TGTCACGTACCGACACGAGAGGAATAAAGATGATGAATTTTGAAAGATGTTAATATACTCAATCTAATGAACCTAATTTCCAAATGAGTATGATTGAGGA
GGCGTGAGTCCTCATTGATGTGCTAGGTGTTGTAACCAAGGGTTATGGTAATTGTAAATGCTGCATGCTTAGGATATTATTTGATTTTATTGATGTTTTC
TGTTATTTTACTGGTTTCTCTTTTGATTTGTCCCATTATATCTTATTATCTTTTG
>LE_HBa0129M03_T7_98501 (trimmed for quality and cloning vector)
AGCTTTGCGGGATTTGCTTGCTTGCCCTTTAATCTTCGGTGGAGGTAGGTTATGGTTTTTACACTACCCTTAATAAACTCTTAATATCGAATGATATATA
TTGGGTAGTGTTGTAAACCCTTCTATATGCTTAATTGTGTGTTTGCATGTTGTGATTATATAATTGTGATGAGATAAGCATGATGAAGCTATTGAATTCT
AAATCTTGAAAAAGAAACCCTAATCTACTTTGTTAATGATGATTCCTTAGTATACGAGAAGGCTTGATGAACGAAAGTAGTGAGATTAGGGGATCGGGTG
CCACGTTCTGGTACCAGGATAGTATATGAGGATCGGAGTGTCACGTTCCGACATAAGGATAGTATATGGATCGGGTGCCACGTTCCTGTACCAGGATAGA
ATATGGATCGGGTGTCACATTTCGACACTAGGATAGTATATGAGGAGCAGAGTGTCACGTACCGACACGAGAGGAATAAAGATGATGAATTTTGAAAGAT
GTTAATATACTCAATCTAATGAACCTAATTTCCAAATGAGTATGATTGAGGAGGCGTGAGTCCTCATTGATGTGCTAGGTGTTGTAACCAAGGGTTATGG
TAATTGTAAATGCTGCATGCTTAGGATATTATTTGATTTTAT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.955919
Expected error %
1.58606
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0129M03
Clone
Clone name
hba-129m3
LE_HBa0129M03
C08HBa0129M03
P129M03
Clone type
BAC
Contamination
none
Estimated length
97,885
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found