Clone Read LE_HBa0132B08_T7_98751

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0132B08_T7_98751
Primer
T7
ID from Seq. Facility
LE_HBa_132_B08-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
457 trimmed for vector and quality, 719 raw
Sequence
>LE_HBa0132B08_T7_98751 (raw untrimmed)
TTTAGCCTGGGTCCGCGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTACAATTTTAGAAGGAAACGACCCTTTGAAGCCGTTGTTAGAAAGATA
TAAATAACGTAACTCTTGGAGGTTAGAAAAACTATCGGGAAGTTCACCTGAAAAGGAGTTGGATGAAAGACTTAGATATGTGAGGTGCTTCAATTGAGAG
ATTGTGGAACGAATATGGCCGGTGAAATGATTATAACTGAAATCCAAATACCTAATTTGTGTAAGATTGCCAATGGAATCAGGAATGGAACCAGAGAATC
GACATCCTTTGAGGTTCAAGATATTCAAGGAACTGAAGGTGCCAATTGAATCAGTCAGCTCACCAGAGATTCCTGTGTTAGAAATATCCAACTCCAATAG
AGTAGTGTTGCTCGGGTGGATCTTTGGTAAAACTCCTTTGAGAAGATCATTGGCACCCAATTTGAGATTTTCCAATTTTGGTACAAGGAAAAAGCTCTGT
GTGAAAATACCTCGCAGATTAGTAAATTTCAGATTCCTGTACCTTTCCGACCAAGAAGAAATATTCCCAGGGATTCGAGAAGAAATGTTTAATACCCTAA
AAAGATAGTACCTCCCAATTTGTCAAGTTCCGAAGTTTTGGTTTCCAAGTCTGTCCGATCCACTTTGTATCCTATCCCCCCAAAAAGAAAAAAAAATCAG
TTGAACCCCAATTTGGAAA
>LE_HBa0132B08_T7_98751 (trimmed for quality and cloning vector)
AGCTTACAATTTTAGAAGGAAACGACCCTTTGAAGCCGTTGTTAGAAAGATATAAATAACGTAACTCTTGGAGGTTAGAAAAACTATCGGGAAGTTCACC
TGAAAAGGAGTTGGATGAAAGACTTAGATATGTGAGGTGCTTCAATTGAGAGATTGTGGAACGAATATGGCCGGTGAAATGATTATAACTGAAATCCAAA
TACCTAATTTGTGTAAGATTGCCAATGGAATCAGGAATGGAACCAGAGAATCGACATCCTTTGAGGTTCAAGATATTCAAGGAACTGAAGGTGCCAATTG
AATCAGTCAGCTCACCAGAGATTCCTGTGTTAGAAATATCCAACTCCAATAGAGTAGTGTTGCTCGGGTGGATCTTTGGTAAAACTCCTTTGAGAAGATC
ATTGGCACCCAATTTGAGATTTTCCAATTTTGGTACAAGGAAAAAGCTCTGTGTGAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.959483
Expected error %
0.96691
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g47890.1 Score 111 E Value 1e-25 Identity 42.00% Align. Length 449bp (98.25%) Frame 3
68414.m05333 disease resistance family protein contains leucine rich-repeat domains Pfam:PF00560, INTERPRO:IPR001611; similar to Cf-2.2 [Lycopersicon pimpinellifolium] gi|1184077|gb|AAC15780
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g27060.1 Score 111 E Value 2e-25 Identity 48.00% Align. Length 455bp (99.56%) Frame 3
68418.m03229 disease resistance family protein contains leucine rich-repeat (LRR) domains Pfam:PF00560, INTERPRO:IPR001611; similar to Hcr2-0B [Lycopersicon esculentum] gi|3894387|gb|AAC78593
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_175225.1| Score 111 E Value 5e-24 Identity 42.00% Align. Length 449bp (98.25%) Frame 3
disease resistance family protein [Arabidopsis thaliana] gb|AAG51781.1| disease resistance protein, putative; 3954-7013 [Arabidopsis thaliana] pir||C96519 probable disease resistance protein, 3954-7013 [imported] - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_198058.1| Score 111 E Value 7e-24 Identity 48.00% Align. Length 455bp (99.56%) Frame 3
disease resistance family protein [Arabidopsis thaliana] gb|AAD48937.1| similar to disease resistance proteins; contains similarity ot Pfam family PF00560 - Leucine Rich Repeat; score=166.7, E=4e-46, N=24 [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0132B08
Clone
Clone name
hba-132b8
LE_HBa0132B08
C12HBa0132B08
P132B08
Clone type
BAC
Contamination
none
Estimated length
62,172
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found