Clone Read LE_HBa0132L21_SP6_99256

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0132L21_SP6_99256
Primer
SP6
ID from Seq. Facility
LE_HBa_132_L21-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
413 trimmed for vector and quality, 817 raw
Sequence
>LE_HBa0132L21_SP6_99256 (raw untrimmed)
TTTTTTTCGGCTGTAGAATAACCAGAAACTACGTTAAACACATATCTTGAAGACATATCAAAAGGAAAAAGACACACATTAATGCCTCGGCGAGATAACA
TAAGAGCAAAGAAAAAATAACTCATTTCCAGTAAGCAAATTCTTCAACACCAACTTTCATTAAGAGCATTTACTCTTATTTTGTTATTTCTTTAGCCTGT
GTATACTCTAAGGGTGGCAATTGAGTGGGTAGGGTAAAATTTGGGCAGGCCATAATGGGTCAAGACAACAAACAGGTCAAGACCCAACCCAACCCAAATC
TGCTTGGGACAAAACGGGTGAGGTAATGGGTCATAAAACGGGTCAAGACCCAACTCAAAACGTTTTGACAAGATTCCTCATAAGCCAATTTGGGTTGCAT
ATCAACCCAAAGGGTAAAATGGGCTGAGTTAATAAATGGGAGGGTCAATAACCCTTCCAAAATTAAATGGGTTGAGCAGGTTGGATTGATATCGCCACAC
CTAGCATACTCTGTGCAACAAAACCACGATCACCTCTTAACGGAAATTATTACATAAACTAAGTAGTAAAATTGTAATATGCACTACATCAACCTCAAAC
CAACGTGTTCTCTGGTATTGTGGCACAGCAATCTTCCCAATATTATGCCTTTTAAACTTGAATAAACTATTATCTTTAAATGATTATCGAATTCCCTTTA
TCGTAACGCTCTCCTATTACTGCCTTTATTCTCCCTTCCCCGTTCTCTGCCTCACCTCCAATATGATTATACCGTTTCCTCTTTCCTTTCCTCTATCATT
TTCTCTTGTTTTCCTAT
>LE_HBa0132L21_SP6_99256 (trimmed for quality and cloning vector)
AAACTACGTTAAACACATATCTTGAAGACATATCAAAAGGAAAAAGACACACATTAATGCCTCGGCGAGATAACATAAGAGCAAAGAAAAAATAACTCAT
TTCCAGTAAGCAAATTCTTCAACACCAACTTTCATTAAGAGCATTTACTCTTATTTTGTTATTTCTTTAGCCTGTGTATACTCTAAGGGTGGCAATTGAG
TGGGTAGGGTAAAATTTGGGCAGGCCATAATGGGTCAAGACAACAAACAGGTCAAGACCCAACCCAACCCAAATCTGCTTGGGACAAAACGGGTGAGGTA
ATGGGTCATAAAACGGGTCAAGACCCAACTCAAAACGTTTTGACAAGATTCCTCATAAGCCAATTTGGGTTGCATATCAACCCAAAGGGTAAAATGGGCT
GAGTTAATAAATG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.949783
Expected error %
0.975455
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0132L21
Clone
Clone name
hba-132l21
LE_HBa0132L21
P132L21
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found