Clone Read LE_HBa0141F08_T7_99711

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0141F08_T7_99711
Primer
T7
ID from Seq. Facility
LE_HBa_141_F08-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
758 trimmed for vector and quality, 939 raw
Sequence
>LE_HBa0141F08_T7_99711 (raw untrimmed)
TCTAGCCGGGTCCCGGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGACAATAAAACATCCACTTGTCTTTAATCTATACTTATAGAGCATAA
AAAAGTATTGAGTCAGCATAAACAATGTACTAAGTATGGCATTTGCAAAATCATGCAAAAAAGGAAAATTTAGTTGAAGTATACAAGTCATGATATTTTG
GTAACTTTCATGAACTAAGTTTCAAAACAATATATAGTACCTTCATTTAACACATAAGGTAAAACTTCTATTTGTCTTAATATTGGAGCATACAAAAACT
AAAAACAAAAAATAACACATAAACTACTCTATTCTAAGTTATCCTAAGGGTCCCCGGAGAAAGACATAAGAAATTGCTCATACAGTCTCCTCAATATCTA
CTTAGGAGATCCTAAAGATCATTATGGATAAGCTTACTTCATTTAATTTACAAAATTCACCCTGAATATCAAGACACTATAGAAAAATTCATATACTTTT
AAACTTCACATAAAACCATCTTCCAAGTAAACCCAAAATTTACTTTTGGTGAAATGTGAATGTAGCATCCCATACTACCACTTACACTTAGTGATCCTTA
GGAATAACTATAGAATAGGCACATCACATTCATCAGATAATAAGCTTTCATCATACAAGTTTTAATATCAACAAGCTCACTTAATATTTAACATAAAGTC
ACATTACTTATCATTCACATTATATCATGACCCATTTCATACATTCCATATGAGGACATACAAGGACTCCCTCAAATGTCTACTTTTGCAATGGATAGGT
AGCATCCCATTAAACCATATACCCTAAGTGGTTCCCCCTTAAGAAAAACTAATTTCATATACCAACTTTTTAGGATCTACTTTAACCTATCTAACGCAAA
AAATTTTGGAAGGAACCCAAAATGACCCTAACCGTAGAG
>LE_HBa0141F08_T7_99711 (trimmed for quality and cloning vector)
AGCTTGACAATAAAACATCCACTTGTCTTTAATCTATACTTATAGAGCATAAAAAAGTATTGAGTCAGCATAAACAATGTACTAAGTATGGCATTTGCAA
AATCATGCAAAAAAGGAAAATTTAGTTGAAGTATACAAGTCATGATATTTTGGTAACTTTCATGAACTAAGTTTCAAAACAATATATAGTACCTTCATTT
AACACATAAGGTAAAACTTCTATTTGTCTTAATATTGGAGCATACAAAAACTAAAAACAAAAAATAACACATAAACTACTCTATTCTAAGTTATCCTAAG
GGTCCCCGGAGAAAGACATAAGAAATTGCTCATACAGTCTCCTCAATATCTACTTAGGAGATCCTAAAGATCATTATGGATAAGCTTACTTCATTTAATT
TACAAAATTCACCCTGAATATCAAGACACTATAGAAAAATTCATATACTTTTAAACTTCACATAAAACCATCTTCCAAGTAAACCCAAAATTTACTTTTG
GTGAAATGTGAATGTAGCATCCCATACTACCACTTACACTTAGTGATCCTTAGGAATAACTATAGAATAGGCACATCACATTCATCAGATAATAAGCTTT
CATCATACAAGTTTTAATATCAACAAGCTCACTTAATATTTAACATAAAGTCACATTACTTATCATTCACATTATATCATGACCCATTTCATACATTCCA
TATGAGGACATACAAGGACTCCCTCAAATGTCTACTTTTGCAATGGATAGGTAGCATC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.921305
Expected error %
1.0526
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0141F08
Clone
Clone name
hba-141f8
LE_HBa0141F08
C02HBa0141F08
P141F08
Clone type
BAC
Contamination
none
Estimated length
125,397
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found