Clone Read LE_HBa0141K10_SP6_99954

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0141K10_SP6_99954
Primer
SP6
ID from Seq. Facility
LE_HBa_141_K10-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
299 trimmed for vector and quality, 923 raw
Sequence
>LE_HBa0141K10_SP6_99954 (raw untrimmed)
ATTAACTTTTTCTACGTGCCATATCTTTTAGGGACCTATGCTCCTGGAACCACTGCTCGTATTTATGGTTCACAGGTATAGTTTGTTGCCTCAATGCTTG
AGCATAATCTTCAGAAGATGCTAAGGATTTTGGAGGAGGCGTGTTTCCTCTTGCTGCAACTGTGATGAGTGATCTTATTCACAAAGATCCCACCTGCTTC
CCTGTATTGGAAGCAGCTGGTCTTCCTTCTGCCTTCATTGATGCCATTATGGATGGGGTTGTTTGCTCTGCAGAAGCTATCACCTGCATACCTCACTGTT
TAGATGCATTGTGCTTGAATAACAATGGTCTTCATGCTGAGAAACATCTCTATGATTTGAGGTGTTTTGCAAAAATATTCACTTCAAAATCTTATGTCAG
AGCCCTTAGTGGAGATACTACAGCATCTTTGACAAAAGGCCAGGATGAACTGAAGCGAAATACCTCTTCTGTGCGAGGACCTGGAGTGAAAACTTATGAT
TGAAATCTAAAAAGAAAATGCAATGCTTAAATGTCTTCCAGATGATAATTCTCCCTCATATAAATGGCCTCATGCATCTCACCTGGTAACGAAGGAAGCA
AAACGTAAGAAAATGGCAGTCTCTTTAACTTACCTAATATCATTAGGAATTTCCCCTGAAAAATCATTATTGCAACTTCCAAACGAACAATTTTCTACAT
TTTGGAATTTCAGTAGTGTATGTTCCCTGATAATTTTTTGCAATTCATAAGGAGTTCCTCAGAATTGTAAAGTACACAAACTTGGTGGGAAAATACCTGG
GAGTGATTACTAATAATTCAATAATATTATTGTACTTACGACTCCCCTTCCTCTTTGTGAACCCCTAATATATATTCTTTCATATATTCCTCTTGATGCT
CCTCGTTAACCTATAACCTGTTA
>LE_HBa0141K10_SP6_99954 (trimmed for quality and cloning vector)
GGACCTATGCTCCTGGAACCACTGCTCGTATTTATGGTTCACAGGTATAGTTTGTTGCCTCAATGCTTGAGCATAATCTTCAGAAGATGCTAAGGATTTT
GGAGGAGGCGTGTTTCCTCTTGCTGCAACTGTGATGAGTGATCTTATTCACAAAGATCCCACCTGCTTCCCTGTATTGGAAGCAGCTGGTCTTCCTTCTG
CCTTCATTGATGCCATTATGGATGGGGTTGTTTGCTCTGCAGAAGCTATCACCTGCATACCTCACTGTTTAGATGCATTGTGCTTGAATAACAATGGTC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.958011
Expected error %
1.58194
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g70320.1 Score 124 E Value 2e-31 Identity 82.90% Align. Length 249bp (83.28%) Frame 2
68414.m08090 ubiquitin-protein ligase 2 (UPL2) nearly identical to ubiquitin-protein ligase 2 [Arabidopsis thaliana] GI:7108523; E3, HECT-domain protein family; similar to ubiquitin-protein ligase 2 GI:7108523 from [Arabidopsis thaliana]
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g55860.1 Score 122 E Value 6e-31 Identity 81.40% Align. Length 249bp (83.28%) Frame 2
68414.m06406 ubiquitin-protein ligase 1 (UPL1) nearly identical to ubiquitin-protein ligase 1 [Arabidopsis thaliana] GI:7108521; E3, HECT-domain protein family; similar to GI:7108521, GB:AAF36454 from [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_177189.1| Score 124 E Value 2e-29 Identity 82.90% Align. Length 249bp (83.28%) Frame 2
ubiquitin-protein ligase 2 (UPL2) [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
sp|Q8H0T4|UPL2_ARATH Score 124 E Value 2e-29 Identity 82.90% Align. Length 249bp (83.28%) Frame 2
E3 ubiquitin protein ligase UPL2 (Ubiquitin-protein ligase 2)
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0141K10
Clone
Clone name
hba-141k10
LE_HBa0141K10
P141K10
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found