Clone Read LE_HBa0141K10_T7_99955

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0141K10_T7_99955
Primer
T7
ID from Seq. Facility
LE_HBa_141_K10-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
703 trimmed for vector and quality, 924 raw
Sequence
>LE_HBa0141K10_T7_99955 (raw untrimmed)
TTACATGGGGCCCGGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTACTACAAGAAACTATCTCAGCCGGTATTTTACCAGAAAGTTGATTCT
TCCCAAGATTCAATTTTGTTAATTCTGTTAAAGAACCAACACTTGGACTTAACGAACCCGAAAGCCTGTTGTCTGAAATATCCACATACTGTAGACTCCC
TGGCAGTTTCTCTGGCAAAGAACCAGTAAACGCGTTCGAATGGAGATCAAGAAACTCAAGATTTTTACATCCTGATATTGCTGAAGGAATTTCTCCCATA
AAATGATTTCCACTCATGTCAAGAAAGTTCAAATTACTCAACTTTCCTATTTCTGATGGAACAGTACCACCTAGCCTATTCCTATTCACTCTAAATCTAT
ACAAATTTGTGCAGTTTCCAACATCAGTTGGTATAAAACCAGACAAATCATTGGAAAGAAGCAACAACTTTGTTAGATTTTTCAAACTGAAAATTTCTTT
AGGTATGGAACCAAAAAGATTATTGTAAGAAAGGTCTAAAGCCTGAAGATTCTCACAGTTAGATAATGAAACAGGAATTTCACCTGTTAAATTATTTTGC
CAAGCAAAGAATAATGTCAAGCTCTTTAACTTACCTATTTCATTAGGAATTTCCCCTGATATATCATTATTGTCAACTTCCAAATGAGACAATTTAGTAC
AATTTGGATTTTCAGTAGGTAGTGTACCTGATAACTTATTGACCCTCAACTGCAATTCTTCAAGACTTGAAAGTTCACAAAGCTTGTAGGAATACTCCTG
GTTAGAATTTTCAAACAGGTCAATACTGGAAAGGACTTAAATTTCCAAGCTCTTTGGAATCCCTCCACCAAACTATTCGGCCAAGCAAAAACTTTGAAGC
TCCTGGATTTTCCTAAAATCCTGG
>LE_HBa0141K10_T7_99955 (trimmed for quality and cloning vector)
AGCTTACTACAAGAAACTATCTCAGCCGGTATTTTACCAGAAAGTTGATTCTTCCCAAGATTCAATTTTGTTAATTCTGTTAAAGAACCAACACTTGGAC
TTAACGAACCCGAAAGCCTGTTGTCTGAAATATCCACATACTGTAGACTCCCTGGCAGTTTCTCTGGCAAAGAACCAGTAAACGCGTTCGAATGGAGATC
AAGAAACTCAAGATTTTTACATCCTGATATTGCTGAAGGAATTTCTCCCATAAAATGATTTCCACTCATGTCAAGAAAGTTCAAATTACTCAACTTTCCT
ATTTCTGATGGAACAGTACCACCTAGCCTATTCCTATTCACTCTAAATCTATACAAATTTGTGCAGTTTCCAACATCAGTTGGTATAAAACCAGACAAAT
CATTGGAAAGAAGCAACAACTTTGTTAGATTTTTCAAACTGAAAATTTCTTTAGGTATGGAACCAAAAAGATTATTGTAAGAAAGGTCTAAAGCCTGAAG
ATTCTCACAGTTAGATAATGAAACAGGAATTTCACCTGTTAAATTATTTTGCCAAGCAAAGAATAATGTCAAGCTCTTTAACTTACCTATTTCATTAGGA
ATTTCCCCTGATATATCATTATTGTCAACTTCCAAATGAGACAATTTAGTACAATTTGGATTTTCAGTAGGTAGTGTACCTGATAACTTATTGACCCTCA
ACT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.945867
Expected error %
0.543715
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g56040.1 Score 285 E Value 1e-77 Identity 62.10% Align. Length 695bp (98.86%) Frame 1
68418.m06992 leucine-rich repeat protein kinase, putative contains leucine rich repeat (LRR) domains, Pfam:PF00560; contains protein kinase domain, Pfam:PF00069
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g26540.1 Score 265 E Value 1e-71 Identity 60.10% Align. Length 698bp (99.29%) Frame 1
68417.m03823 protein kinase family protein Three false introns were added with non-consensus splice sites to circumenvent frameshifts likely due to sequencing errors; this is extremely unusual and is under investigation.
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAL59906.1| Score 285 E Value 6e-76 Identity 62.10% Align. Length 695bp (98.86%) Frame 1
putative receptor protein kinase [Arabidopsis thaliana] ref|NP_200415.2| leucine-rich repeat protein kinase, putative [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|XP_483121.1| Score 277 E Value 2e-73 Identity 57.10% Align. Length 698bp (99.29%) Frame 1
putative receptor protein kinase [Oryza sativa (japonica cultivar-group)] dbj|BAD10022.1| putative receptor protein kinase [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0141K10
Clone
Clone name
hba-141k10
LE_HBa0141K10
P141K10
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found