BAC Sequence – LE_HBa0023C06

>C01HBa0023C06.1
TGGGGATTTTAAATTCAAGATGTGTAATGTATAAAATGATCATTTAGTGACATCTCCTTTAAATATATTAAAAAGGAAAAAATAAGATAAAATAAAGATG
ACACTATAGTTAAATTAACTAGCAACATTGACTTTTGGTATATCGAAAAATCATTTTTCCAAAAAAATATATCTCAACAATTATTTTCTAAAATAAATTT
CGTATAGTTGATTAGTGAGTGAACATATATTGTTAGTAAATTAGATAATGCCTCGTACGAGAATATTTAAGTAATAAATATCGAAAATAATTTTTTTTAA
AAAAACATTATTTGGCAATCCAGTAGCAGAAAATCGATTTATTTCTAAGCATATTGCTGAATTTATATAATTAAATTTGTAATAATTAAAAAATCATCTA
ATATTTTTTCAAAATTATAAAAAAAAAACGAAAACCTGTTAAATTCGTACTTAATGGTAGAAAAAGAAATCAAAAAGAAAAAATTTAATCAGAGTTTCTA
TCTTCCCCTTTTCTTTCTTCATTTTATTTTGGTGTGGGAATTTCCAGTTCAGGGCTAGGGTTTAAGGTACAGGGAAACAGGGTAAAATCGGAGATGGCGA
TGACACAGTGGTGCAGCACAGTAGCGAGGAGACTGATGACTGTTATGGAGCAACGAATGGCATATTCATCTTCAGCTGCTCCGTCGGCGGCGATGGGAGG
TCCGATCCTTTGCGGACGAGGGGACAAGAGGACGAAGAAAGGGAAGAGATTCAAAGATTCGTATGGAAATTCAAGACCTAAAAAGGAGAAGAAAATTGAA
CGCATCAAGGATAAAGTTGAGGTCCCCAGGTCTACACCTTGGCCTCTTCCTTTCAAACTCATTTGATTTCATTTTCTGTACCCTTCAAAAAAAATCTAGT
CTTGTTTCTCTTTGCCATTAGAAGATAGATTATGTTTTTCTTATGATGAATCTGAATGTACTGACGTCTGGGCAAAATTGTGTTTCAATTGCTTTGTTTA
GCCTTACGATTTGCATTCCATATGGCATTCTAGAATTAGGAGTTGAGAATAAATGCTGAATTACTGTGTCTGTTTCACGAAGGACACTGATTAATCGGTG
CCTAATCAAAATCACTTTTGGTTATTTGGTGTTATAACACAACTTAGCTCCACTGTGCAAATTCAGTTGGGGTAAGCTATATGAATCGTAGTTTGACTAT
TTTTAACGACATTAACTGTCGACCTAAGGCAAAACCTTCCTGTTCTGTCCGGGTTTGGGACTGTTATGGTTTTGCATGTATTTTAGTCCAGAAAAACTGA
AGATCCCGATTTAGTTATCTCAGCTACTGCTCATCAATAAAGATCTAATCTTTATAGATATCAGCATCTCGGTTGTCCAAATTTGGGGTATAAGAGATAC
TTGTTGCTCTAGTTATCCTGCAGTAAATATTGTGGGGTGATATATATCTGTTTTCCTTGATTGATATGACCTTATGAGCTGATCGACTCTTGTGCCCGAG
TTAAGATAGTGTGAGATTCAAATTAAAATATAGGCTAAAGAAGAAAAAAGGATATGAATTTGCTTTTTTTCATGTTGTTAATAGTAGTTGCTTGGCTTGA
AGGGTGTGTCTATAGTTTTGGAACTCAGCCACTTCTGGCAGAACTGGTCTGATGGGTGGAATCAAACTAATCTTCGATCTAGAGAGAAATTTTTTAAGAA
AAAGTTGCATAACTCTCCTTAAAACATCCTTGGGGAGGGACAGGGTAGAGTTAATTGACTTGATGAAACTGCAGGAGAGTTTTCTGCAGCTTTCAACATT
GAACTTCATGTTTTCGTGTGTATGGCATCCATCCTCTCGATTTCTTTAAAAGTTGATGCTGAGCAAGAGATCTTCTCGCCTATTGACAGTTTATCTCATT
AGATCAACTTGTGGAAGAGATTTGACACCTTTCTAAAGTGACAGTCGACTGACTTAATACTCATGCTGATGCTGGAGTACATACATAATGGTGTATTCAC
ATATTCAAAGTAAAGGCAAAAGAGTGCAATTATGCAAAGGGCCTATATGATCTCCTCTCTACTCTGTCAGTAGATGTTAGAATTGATATGACAGAGAGAA
TGGAATGGAGAACAATGAAATGTGATGTTCAATGATTTTGCCAATTACTGTTTTCTGGTGAAATTAATCTTTTGACGTATACACTGTGATACATACATGT
CTGCAGAGATATGAGTTTGCTCGTTCTTATAGAATATGCAATAACAACATATGACACCTCTTTTAAAGAAGGTGAATTGTGCGTCTTTCATAATCCAGAG
CTAATAGGCTGCTCTCTTATGCCGTGTAAGTGAAATACAAAAGATGATTTTAGGTTGAATTTTTTCTTGCATTCGTTTGTTGTTCAATGAAAATCATGTA
CAAATTTTATACAGTGCATCAGGGCATTTTGACATAGTAGTCGAATGAACCATAATAAGTTTGAATGCTCATATGTTAAGGGGACGCATGCAAAGTGCAA
ATGTAGCATTATTTTGCTATTATGAAGAACCCTTTGCGGGTTTTATACATTATAGGATCAATTGATGCAAAGGCCAGTAAGAGATTATGAGTTTTAGATC
TAATGACTAATTAGCGATGGTCCCATTTGATTAATACACATTAAAAACACGTACGGAGTTCAACCAAAACCCAATGCATGAGTAGCAAAGCCATCTGTAG
TTTACAACTCTATCAAAACTTTGCTAAGGTTGTTATAGATGATTAAAACTTAGTTCATGTGAAAAGCCAATGTGAAGTAGGAAAAGTCACTGTTATAAAT
CCTTTTAGCTGATTTTTAGGTTGATAGATAAGAATAAGACAAGACATCAATCTAATGCGACTTTGCTTGCTCTACTATGTATCTTTCATTTCATCTCCCT
TCAAATCCAAGAGTGTACAACTACATATCTATTCCGTCTGCCAAACAAATGGGACAACTATTTGTCCGTCACTATTGCAATAAAGGCAAGTATACAATCT
TTTATAACAAGAAAGAAACTGTTCAAACAACAATACATTAATGATAGCTCACAATACTTTTAAAAAGAAGGTCAAGACATGAATAATGATTACTGAAATT
CGACAAATTGTAAGCCAAACAAATCCTCAACTTGGTCTATTTCAAATCAAAATCTGACATTTATTTTTGCAATTCTTGGTATGCAGCTCACAACTACTAA
ACGGTCAATTTTAAGTGAGCATAGTGCCGTTGCCAATTCCCATTTCTCTAAATATCAAACCAGAAAACATATTTAACGTTTCATTGTTCAAAGCTAGATG
GAATCACTAAAAAAGAAGACAGGACTGGATGCAACTCTCCTTGAATGCCCACAACTTTATGAACCTGCAACCCAAAAAAATGAAATTATTCACTCAAATG
GCAAAATTTACAAATATAGATCCTTACCAATGTCATGGACGTTGTTCAGTTTTTATTCATTGACATGTTTAAGGTGATAATTGAAACTAAAACAGATGTC
GTGTATGCCCAGTTAGCCGACAATAGTTTACTAGCTCAAAATTTACCAAAACTCAGGCCAGAATTTTCTTCCACTAGTTTTACAGGTGGTTGGGGTGTCC
TCTTCAGTTGTTGGGGTGGGGGAAGCAACAGAGGGGATAAACATGATGAGAGTATTGAGAAACGCAAATGTGTGAAGATTCTACCTTTTATTCATTTCAT
GGGAGAATATCATACTAGTTCAGCCTCTTCCTTGCCATAGTCATACACTATCTCAATCTGCATCAAACGTCAAGGAGTTATTAAACATAAGGGATCCATG
AAGTCTGCCTGGTTTAACAAGAACAGAAGAATTTGGGCGGCAATTGACATCAAATAACATTTTTCTTATGTGAAAAGGTAAATAGTGATTTCTTGACCTC
TGCAGCACCAAGTTGGTGTTGCAGATACAAAAAGCAAAGAAACAAAAGTATTGTCGATTCTGTAGGAACTAGTGAACTCTATCATAGTTTCTGTGCATTT
ACATCAACTCCATTACACACCCAAACAAAGAAAACTAATACAGTTGTATTGTAAATTTGTAACTTCCTAGTACAAAAGACACCAAAGTGATTGCATTTGG
ACCATACATATCCAACAAGTTTGATCCTTCTTTTACTTTGTTGTTCTGGCTCCCTCGTAGGGGAACCCTTTTTGGGTCAAATATGGTCCTAAATGGATGA
GATCTGGATTCAGATAATTTTTTACACATTGAGTCAGGTTAAGTGGGTCAGGGGAGAGAGAGAGCATAGAGGTAGGTGTAAGTGTGTAACATTTGGACAA
ACATCAATCCAGATCTACTCCACTCCAACACTAATCTTTTGGACCACAACTATTCCCAATTCAAATTACTCGAAGATGAAGAAAATACATGGACACATGT
CTGAGTGGATCCCTAGGAAGGAAATGGGAAATAGGGACAACCAGAAATATGGCAGCAACTCATCCTGAATACTTAAAACTATTCAATAGTAAAAAATTAC
TACTCTTTAATGATCACAAGCAGGTTCAAACAAGGACTTGACTTGTATGGAGGGAGTAGAGCATCTACTCCTTTCATCAGAATATCCTTGTCCTACTTTT
CTTGCTACTGTCATAGATTTTCATCTAGTAATTACCAGTAGTACAACCAAGTATGACATCGTATTCCTATGATGTTGATGTGACATCTTTTTGATAAGCT
CCCTCTTTGACAGTTTTAACTATTTTAAGTTGTGAATATAATTGGCATAAACCACCCGTTGTAGTCATATAAATGTAGGACAATAAGGATAAAATGTCAG
ATAGCAAATCACGATGAGAAAATAAAGATCTTCACATGTCATGACATTTAAAGAAGAATGAATTAGCAAGTTGTCAACAGATAGAAAAATTAACAGTTGA
AGAGTACTCCTGATGGTTGCAAAAACTGACGAAACAGGAAAGTAAATGGCTAAAGCAACTAGCATAAACTGAAACATTGTCCGTGATGTAAATAAATGTC
TAAGCAAATTACCCCTTCTGGCGGCACTGGATTTCTGTTGAACTTGGAACCACCAGGTGCCCATGGAACTGCTCATCATTGAAAGACAAACTATTACCAG
AAGTCTAAAGCATAAAATAGTTCACTCAACTTTTCATATTTCCACAATTTACCACATTTCCGAAGTGTGTCAAAAAATCAAAAGACTATCCTTTCAAAAA
CTAATACTTCACATTAAAAAAAATTATAAAGGCAATCTGTTTACTGCTTGTTAACATTTGACAAAAGTTGTATGAACAAAAAAGATCATCACACAATCCA
ACAAGGAAACATGCAAAGGTAAGTAGGACAAGACTTAAGGTAATCACTTATCAATTAGCATCTACAAACTTCAACATAGATAAAAATTTAGATGAGACAT
ATCCTGCAGATATTTTTCTTTTCTTCCTTTTTTTCTCGTGATCCACAAGACATTTCATCATTAGAGGCAGTCTTTTTTCATATGAAAAAACAATACTCCC
TAGGTCTAAGAACTTAGCACCCCTAACAGTTGGGAAGATGTGAAAGATTTCAACAGAACTTATGCCGGCTATAATTTCAAGGCTTCTTGTTGATGGCTGA
GAAATCCCTGCTTGCCAGTAGTGACATTTTGAAATTCAGTGGAAAATGGGCTCCATCCTACCCTTCACTCAAAATACCAGCCATTTTTTTTATAATTTAA
AATACCAGGCTTTAATCTGTGACATGCGCCTAACCCCACACAGTACAAGCTGCTCTCTCTCCACTAGACCAAAACCCACACCCTGGGGGGTCCTAATTCA
GTTCAAAACCTGTATCTCATATAATACAGACTCCGACATATCCTTAACATTTTTGTGGTTCATTGGATTGAAAATCCAGTTTATTAATAGCGAAAAACTC
ACAAAGAATACATAGACAGTGAGGATTCATATAGCAAACTTCAACTTGCTTGGGATCGAAGTGCAGTTGTTTGATACAAAAATCATAAAGAAACATACCA
ATGTAAGGATCAGGGTGCCGCCACTTATTGTAGGATGCTTCACCATCAGCTATAAGTCTATCAATAGTTTCAACATCTTCCTGAATGTTAACAAACCAAG
ACAGAATAAAATGAACTTAAAAGATAAAACTACAAAAAAGAAAAAAACATAATGCAAAATATGTTACTACAGAATTACAATTTCACTTGTTGAAAAAGAG
AACGCAGATGCTCAGTCATTTGGCCATGAAATTAGCCATCACTAAGATGAAAGCAGCGTAAATTTTCATTATCCATAAAGAACTTTAATACAGAATACTC
AATCCCAGAAAGTTACTAATTGAACCAAAACCAATCCGTAACTAATTGTTCTTACTATATAACAGAATCTGCAACATTGACCTCACACTGTTTCCAGTAT
CACTTGTGCATCAAATACGAATTGAGCATGACAAAGGTGAATTCTTTTTTCGAAACACATATGATCAGAACATATCATGTCCAAATATCGAACTAAACAC
ATATGATACCACCAGCAAATGCCAATTTGTATACTCCAAAAATATGCTAGTACACAAACAAATCACAACAAAAACAAGGAAAAGAAGAATGAAATGAACA
CTTCAGGACTCATACAGTCTAAAATAATTTTTATTTTACCCTTCACAAATACTTCTATCACTACTTGTATTCAACACTAATTAATACTTCAGCATTTTAT
TTGATAGTACACTAAATGTGAACTTTTATTGTTTTTTTGATAAACATACACAATTAAAAAATTACACATGAACAAGTCGCTCTGTATAACACTAAAACAT
ACAGACTTCACTCCCAACATCAAGCTAAAACCATATAATCCTTATCAGAAAAATGAAAAGTTGCATAAAAAGGATAAGAAGAAGGAAAATAAAAACAAAC
CACTTTTCTGTTGACCTCAAATCGCTCCCTTAGGGCATCCGCCTGAAAACAAACAAACAAACAAACAAATAAATTAATCAATAACACGAATCACCAGTTA
TATATAACTAAAAACAAGAACACATAGAGATCGAATGAAGGAAATGTGGAAAAAACGAATCAATGGAAGAAACCCTAGGAATTGGGATAAACATTTTTAC
ATCAGGATAGAAGAGATGACGATGGACGGCCCAATTAAGAGTGTCTCTGAGAGCACGCCTGTAGAGGATCCGAACCCTCTCCCTCTGCGATGCTCTTCGA
GCTAAGAACGATACCGATGCTATTCCGCTCATCGCTTTCTCAATCTCTCTCCCTTTGGTTTACTCAGAGCTCTCTCCCCCTTTCTGGATCTTTGTATTCA
GAACTACTTCCTACGACGTCGTTCCACAACATACCTTTTCATTTATAAGGTTTTTCATTTTCATTTGTCTTATTGGTGGTTTGTTAAAAATAATTATTAT
GTTATTTTAATTAGGTTAGTGCTTCTGAATAATGACATATGATCTATTACAAGCTAGTTAAGTTGGTATCAACTTTGAAGAAATGTGAATGGAAAATAAG
AATAATTAAGAAAGATGTATATTGTAATTAAGGCTTGTTTGGAAAGAGACAAAGATGAAATTTGATATAATTAAACGTAGTTACACAGTTTGATACGCTT
ATTTCAAATTTAGGCCTAAAATCAATTTAATTTTATTCACCAAAAAAATCAAAATGCATGATAAGTAATTATTAAATAATTTTTTGATAAATAATTGTGA
TGGAATGAATAAGATCGCTCTTTAATTTTAATGAGAGGTAATATTTTAAATGGATCAAAGTTCCAAAGACTACAGAATTTAATAAAGAAAAATATAGCTA
AAATTCTTGCAAATCTATTGTATGACACGATAAACGGTGTAAAAAATTGTAGACTTGCTATGTCATTTAACTGGTTCTGGTAATCGCCAATTTATGGCTT
GTATAGATAGGTACAGCTTACAAGTAATTGGTTTTATAATATCATATGCCAAAAGAATTACTTGAACACTTTCTCCAATTCCAGATTTAGATTGTTAAGG
ACATTATCTATTACTATCAAATATGAAGCAAAAAATTATAATTGATTCCCCAGAGTAGTATTGTACAAACTTTAAGCAAACTAATAAAAGAAACTATTCA
TCAATCCTCTAAATCAGTGAATTGGCAACATGTATCCAATCCAATTACATTCATCATAAGACTATTGCTAATTTCACCTATATCCTTCTTTTGCTACCGA
ACTTTCAAAAAGCTCAGAGAAGGGATGACATACTGTTCTTCCAGCCAAAAGATCTCCTGCTCTTCCTCGGAGGAGGTGTAATGCTAAGCCCAAACATCTC
CTTGAGGGCCGGACCCTGGTCAGAGAACCCAATCAGCTTCGCGACAATGGCAGCACTATCTATCACATGATTCAGATCTGTGTCATTCCAAAGACGATGA
ACCAGTTGGTGTCTCCTCCTTTTGGAGTTCAAATTTATGCCCCATTTCTGGTATATTTCGTTTCTTTCAGCTCCTGGTAACTTTTTATATATGAGCCGAC
AGAGCATACTTCTCTCGCGTCTAAGAGCTTTGAGGCTGTTGAATAAAAATGATAATGAATCATATTAGCAGATGTTACAGAGATGGTAGTTACAAAATTT
TCATGATACCAGGCTATACATAAAGTTTAAGCTAGTATTTTCAGTCCATACGCCTCTTAACAAATTTACATTGGCGTCATTTCACTTAAAACTGTTGCAT
TAATACACAAGACTAGTTTGTATGCACAGCAAGCGCATACACACCAAAAAGTGGGACGGGAATAGGAATATGAGAAATGCAGGGTAGAGAATATACCTAG
ATGCAAGTGTGATTGTCTGACCGCCTTGCACAGCTGAATTTCCATTTGAAAGTATTTCCTTGAGGAAGGAAAGTCTTCTAACCTCTACCTCCATGTAAAT
AGAATCCATTTGGTCACCTTTAAACAGCAGGAGGAAGTATGTCCTGTGGATCAATGAAATATGGCAAGTTTGCCAGAGTCCAATGATCATTTTCTGTAGC
CTTCCAAATTCAAGAGGCCAATCTGAAGGAGCCTCCACGGAGTCCAGCATCGGGTCCACTCCAATACTTTTGAAGCTCCTTTTTGACTTTCCAGCCTCTT
GACCCTGTGACATAGATATTATTTTTATACATACAAAATGATGATAAAGTGTGACATAAATCAAGTTCCGTCAAGTTATAAACTTAATGCTTACTACAAA
TCATTGCAAAAATAGCTTAAACAATACTCTCAAATTGTTAATTGCTTACACATAATTCAATCTGAATAGTTGTATTAGTATAACCTAGCACAATTACCCC
GTCATGCCCACGACCAAAAATAAGAGAAAGCAAAAACAGATCAAACAGCTAGAACTGATCATGCAAACAGTATCTGTCATCAAATCGCCCAAAATAACAT
GATGCACAAAAACCAAATGATGCAGACATGTTCCAGTAATCCCATGCTTAAAAAAGCAAGCAAAAAAGTGCGAGCAACTCTAAACACACACAGCTGGTTC
CAAGATATTTCATACCTGATCATGAAGTTGCTTAGCCATCTCCTTAAGACCTGCCACAAAATTGTCAACACTTGGGATATCCTCATCTCCAGGGACATTA
TTCCCATCCACAAAAGCACTACCAATGGAAGACTGTGAATTGTTTCTCGATAAGTTAGATCTGTTTGCTCCATAAATTAACAGGGGTAGTTTCCAGTGCT
TCCGTTGGAAACCCTCAGGTCTTCCTGGAAAATCCTTATCCAGCACATTAGGTGGGGTGGTCTGGTTTTCTTCAGCTGTCTCAGTGTTGGGTGAAAGTGA
GCCAATCATAAAATTAGCTCTACAGCTTTTGCTTCTTGTTAATTTATGGCTTTTGGAACCTGATAAACTTGTTGAAAGGGAAGGTGAAGAAGAATCATCA
GGGAAAGGTCTAACAAGAGAATTGATTGTATTCTGGATATCAAGCATTTTCTGCTCCCAGGCCCCATGAAGAGAACGACCGCTGGTGCTGCTTGCATGTC
CAAGTAACATTGGTGATTGCTGTTGGAGGTCAGAATTTCTGATACTGGAAGCAGGAGGCATTGACATACTTTCTCCATAGTCAGTGTTTGACAAACTGAT
GGATGCAGAGGTTTGCTTTTCACTAGACTCATCTATCTCAATACATCGAACTTCCTTGCAATGGTCATCACAATCTTCTTCTGACGAATTTACAGAGTCT
TTTACCCTCTGCTGTTGACCAGCAGCAGGCACAGCATACGAGGTAGCATCACTTTCATTGTCCCTGATATAGGACCCTGCTACAGCTGATGAGCAAGACA
CAGAACATTCATCTTCATATGTGTTCCCTTCTGAATGTAGCCTTGATATGTCCTGAAACTTTGCGTAAAATAAGTAACAGATAAAGGAACATCTCTAATA
GATAATCTAAGTAGGTTACTTAATACAAACCTTTTGGCTGGAGGTTTTATCACTTTTAAGCGTCTGCAGCAAATCCTTAACCCGCGATTGAGCAAGATCA
CGTTGCTTAGTTAGTTCCCTCACTTCTTTCTCTAGCTGCAGATATTTACCAGATTAACTATGTAAACATTCTATAAACAAACGAATATCACATTTAATTG
AACTCATTTCAATACAACTGTGGAGCCAACAATTTTTCAGATGGACAGATAAAATTCGGAATTGAAAACATTTCAATTTGTATAACCCTTGGAAAATTTT
GCTGTAACATGAAAGCAAGGATAACTTTGACAAATAAAATGTAAAATAACGGAGTGAAGAATAAGTGATTCAGCAGTAAGATAAAAGCCTTGGCATGAAC
AGAAAATAGATTAACAATTGGTTAATTGGATCAATTCAACTGCTCGTGGTAACCAATCCAAAGTCTAGTGGCTGAAATTTCCAGAAGAAGCAACAGTTGG
GAAAGAAAACTCGCCTTTTCAATCTGCTGGTCTTTCTTTCTCAGCAATACCACATGATCACAAGTAGTTGTGGGGGTTTTTAATTCACTCTCTAATCTAG
CCAACTCTTTCTGCAAATGCTTCACCAATGCCTTGTCAGACATCACAACATTGACTTGTGCATTAGTGGTCACTTCTTTGGCACAACAGGCAAATAGAAG
TGTATTTCTAGATTGTTCTACATGGCTTCGAGCAGGACTCAGGGTGCAGATTATGCCAGTTCTTGCATTGCCCCCCAAAGCAGGTTGAAGGATACGAGTT
AGCTTAGAATCTCTGTAATTGACATGCCCATGTCTTCCCTTGCTGCAATTAAGTTAAATCGTTACATGCAGTGAAGCTTCAACAATAGGGTAGTGGAAAA
AGATTAATCGAATGCACACATCTTGAATGTATATACAAACAGTCAAAGGGCATGTGATGGATGTCCATACTTTGGTTAACATCATTCCATGTACTATTAA
TAACATACGCAATTCACATAGCAATACTATTCGACACCATAAAGCTTTTCTTAGCTAATCTGAGAAATGAAAAAGAAAAAAATCCCCAACTTGCAATGTG
GACATCAAAACTGAATAAATTTTTAAAGATCATTCTGACATGTAACCAAGTGCAGCAAATTTAGATGCCCTAACAAGATGACTTAAGTAACAAGCAATCA
ACCTTAGCTTGCGAATAACAGTTCCCAAAGTCAACAAACTACGATTAATATGACAGCCTTCTTTCAGTCTCTGCCCAACTGACAGAGACTGAGATGCACG
TTCGCTACCTGCTAGATCAACAAAATTCTGCATTCAAAGATCATAAATTTGCCATCAGCAACTCAGGCTTCCATGAAGAGACTGTCAATAAAATCCTAAA
GTGAACTAACTGATGCATACCACACTAGCAGAAAGAGTTGTTTTGTTGTCCTTCCCTATAAACTCACGGGCTGAACTTTCAATTGTCTGAAACAGAACGA
CAAAAAAGTATCAGAAGTATTCACACATCTCTATTCCATGATAGTATTTTACTGTTCTGTACAGAGAACAAAATATGCCAATACCAACTTTATCAAAAGG
AAAAAAGGAGAGAAAGGCAATACCAGTCTAAGAATCTGATGAGACCTGGAGCTATTTTCATTAAGATAAGTTTCGCCAATTTGTCTTTGAGCTGCATAAG
GACCATAAAAACTAGTAAATTCTGGAAAAAATATATAGGTGCTAACTTCTATATTGTTATTAAAACTAAAGCGTAGAGTTGGAGATTGGCACTACCTTCA
CATACCGACAAGAGATCTTTCAGATGGTCCCAGTCCCTTAAAGTTTCTTCTGTGAGTTTCTCAATAATGGTCCCTTTCTACAAAACTCAAAATCATTAGA
AACCTTCATCTGCTCACTGTAAAACTAAGAAACAGAAACTCACTTCAGGATCATCGAGCAGCCTTAGAGGAGAACTATCTGAGCTGAGGAGGTCTCGGAC
AACTTCATTGTAGATCTCCATTGCAGAAAACTTCAAAACAAAAGCTCTTTCTTCGTGCTGAAAAAGCGAAGGAAATATCATGTTTGCAATAAATAAAGAA
AAAAAGAAGATAAGATGCATTACATCATGCACTGCTCAAACATTCCAAGTCAAAGAATATAATGTGACAGTTAACGTTAATTACCTTTCGCATATAATCA
TATATGTCTGCTACAGTAAACTCTGTAATTCCATTCATTGTGTAGGTCTTTCCACTGCTTGTTTGACCATACGCAAAGATAGTTGCTGCATAATATGTTT
AGGTAGTTGTAACAGTGAGTTTTCTTTCAAATGAACAATGAATCTGCAACAAAATGTGAAAGGCATATGACTGGAACACTCACAGTTGATTCCGCTAACA
ACAGAAAGAGCAATGTCCTTTGTTCCTCCCTCATACACTTCCCTTGTTGAGCAATCACCTCTATACACCCTGTCTAATCTCAGAAAAGAAAAGCAAGAAG
ATATGTGTTGCATCAGTAAATCATTTATAAATCGCACTTGAAATTACCCCGACAAATATAAATAGTTCTGCAGAGTATAACAGCCCAACCCAGGAATTGA
TGTCAGATGGAGTTTCCAAGCTAAAATATCCAGATCTAAACCTCAATTCACCTCACTGTCATTTCTCATTCTACAATAATCAGGTTTACATGCAAATGAT
GAAATAGGGAATTTTCTTACCAAAGGTATAAGCAGTCGGCAATCCAGACCGTTCCTGGAGACTGTTCCTATATAAGATGCTGGTCTCATTGATACATTCC
CAATCTGAAACTTCATTCCTTGAAATTTCCTTTTCACTAAGAGGCCTCAGCCTTACCAACACCAATATCTTCTCTTCACCGCCCAATGCAGCCCCTTGCA
TTTTCTCCCACTTCTTCAACTCTTCCCCACCAATAGCTCCCATGCCTATCTTTTCCCCCCTCCTCTCTTTGTAGCCACTCCAATCACAATGCCAACAACG
GACCCATAATCAATGGTCACCCAAAGGTAAGCGTAAAAAGAAGAAAACTTCTCACTGCCTCATATTGCTGCTGCCAACACCCAACAGAAAAAGGAAAAGA
CAGTTAGAATGTTTGAGACATGGTGGTTGTGATTGCTAAAAGAATACAGTAGCCATTGAATGATCTATAACTAATCGTAGAAAGTATTTAAAAAATTAAC
CACACGATTAGGTAGGTCAATTCATGTGTTAGTTGTGATTAAGCACTTTGCTTAAAAACCTTAACACCCAATTTTTTCAAAACCTAAAGTTCCATAAAAA
GCGCCATAACGCAAATCCACTTTACTTTGCTTTACGGGGACCAATATTGGGACCCAATTATGCTTCAGCACCAAGTGACAATACTATTCTACTATGAAAT
TTCCACAGTAGCTCTGAAGCTTTTGAAACTTTTTAGCAAGGGTGGACCCCAAAACCTATATAGAATACAAATATCCAAACAACAACAAACCCAGTGCAAT
CCCCACAAGTTGAGTTTCAACAAGATAGGATGTTCGAGATTGTTGCAAATAGCCAAACAACAAATTTTATATACATATGCTGATATAAAAATAGAAGCCA
CATTGACAAAAAAGTTGACTGTTCACCTTCTCTATTGTTTCCACTGAAATAATGAGGACCTCAGAGATAGATAAGGGATTTCAATTCAACGGTCTGCTTC
AATCCTTGTGCTGAGATTTAAATAACAAAAATGTAACGTAGATATTAAATTCTCACAAGATCCTAACGGTAAAAAAAATCGTGTTTATTCAGATTGAACA
ATTTAATAAATAATATTTCAACAGAAAAAAAAGTATTAAAAGAACAAGATCCGGATTATTCGATGCATACAATTTTTTATAAAAATAAATAAATAAAAGA
GCTTGAAAACTGAATAGTCCTTTTCTTCAGCTGATTAACAAAAAAAACACAGATTGAACTTGAAGCTAATATACTATTGAAGCGTCATTCTCAGAATCTC
AGTACAGAAAGATGAAGCTTTACGCATCGAATAAAGTTGATCATGAATGAGAAAAAGAGAAAAAAAAAACGATATCAGTAAATATTACCTCCATTCTCAA
ATTCTCCATTAAAATAAACAACAATTTCAGTGGAGAAGACGAAGTAAAATACACACACAGAAAATCACAGTGCACAAAATTTCCTCTTCTGGGAACTGCA
TACAGTTTTATGGATCGAAGAGAGAGCGTCAACGTCTTTTTTTCGTGTGACGGTGTAATGACAAAATTACCCTCTCTTGGTATGAACCACGTGACCACGT
GGCTCTGGGATATCGGTGAGTAAATACGATGCTTTATTTTAACCGTATGGATTTATGACACGTGTCATTGGAGGTAGTGGTCCACTAAAACAGGGACCAT
TTTGGAATTATTTATTTCTTTAATTTAATTCGGTTAATATTTAATTAGTATTTCTCTTGTTTGGTCATTCTTATACCAAACAATACTTTAATTAATTGGG
AAACTATTTAATTTATTTTCACGATTCTATGTGTATTTTATTAGTAGACAAAACAATTGTCAAAATTAGTACGACTTCTTGTCATAATAAGAACTAGAAG
ACATGGTTTGGTAGGCAATTTATGATTATTTTTTTAAGAGATCTGAAAAAAACATTTCCTTTTATTTAATTGGACATTAATCAAAAAAATTGTTTTTCTT
ATCTTCTTCATATTAGGTGTGTTTGATATGGATAGTTTTCTTATTGATCAAAATTTTAGAAATTTTTTTAGAAAAATAAAATTCTTGAAATTGAGATCAA
AGACAGTCATTTTGACCCTTTAACATATCATATTTTCACCTCATCCCCTTGCGCCCAATCAACATTCCTTTTTTCCGCTCTTATTTTTTATCGTATTTAT
TTAAATTATATATACATATATATTTTTTTAAAGAAATTTTAATGATAACTTTTAAGAAATTTGGCTTGACTAAGCATTCCCACCGGGTAAACATTTTGAA
CTTACATGGTTGGCGTGACTTTCTTCCTTTCGGCCTAAAAGGAATACTTGGCCCAATCAACCACTTTCAGATTAAAATAAATTTTACTTGGTACAAAATT
TAAAATTTTAAAAAAATTAAATTTTATGATGTTAACTCAAAGATTTATAAACATATATCAAAATATCTTTTTAAATTTATTATCTTAATTATGTCACGAA
ATTAAAAATTAAAACAGACCGAGACTAATTACCACATTAATTTCTAGCAGATAATTTTTTTCAAATACTTATTATTAAAAAAATGAAATTAAGGTGATTG
TTAAATTTAATAGTAGTTCTAAGAGTTCAAAGTGTCAGTAGTAACATATGAGACTGACATATGGATATAACTTTCAGATGTAATAATAATTTTCTTTGAG
AAATCTAAAATGAGAAATATATTATTTTATTATTTAGAATAAGAGAAAAAGGTAATTCGATTCATCATGAAAATTGAAAGGTAAACCAAAGAAAAAGAAG
TTACAGGAAAAAGTTGAAATGAGTAGTCATGGCCCTAGTCGGTTGAAGCAACTTCCATACACTTTCAAAAATAACTGCTTCTCCCCATTTTATTAGTACG
TGATTGGGATTTAAATATTAAGTGTTAAATTAAAAAAAAATGCTTAGGTTTGTATATTTATTTTTAATTAACTATAACGTATAACTGTAAAAGATATAAA
TATCATGTCACAAGAGTTAGAAATTCTAATTTTAAATTTCCGTGTTATTATTATTACAAAAAATATTTCTCGTAGTTAATTAAATACAGTGAAAAATATT
ATGTATCAAAACCACAATTGAGTAAATTACACAAAACAAACTCTTAACAATTTAAATTTTTAAATGAATTCATATTATAAAATTACATTAGTCGTATCTC
ATATAATGATAATTCAGTTGTTGCCAGGAGGAAAAGAAAAAAAAAACAAGGCCTTTAATTTGTTTCCATTTCCCAAAAGTGGATCAAATCTGTAATTAAA
ATGTTAATAACTTGCTGAGATTTAGCTGAAAGGAGTTGGTTAATATAATGTCAAACCCGGCATTCACGCATCAGTGATTGCTTCAGCTGTCTAGTTATTC
AGTACAGCTTTGCGGTGTTTATTCTTCTCCCTATCCGACTAATATAGATTCACATAATAAAATTTATAACGATATAAAACGTTTTTATAAATAAATTTAT
GTCTAAAACTTAAATTTTAAAATCTATAAATTAAGAATTTATCACTTTATCATAATACTTATTATTATCTTGATTCAAAAAATAAATATAGTTATTATTT
ATTATTAAAGATTATACATAGTTGAAAAGTAAAAGAGATAGCAGATGAAAAGGGCATAGTTCACATGGTTTAATAATTATGAAGATGCTCGATTTATCGT
GACACCCACCGCAATTTTCTCATTCTTTGAAGTACAACTAAAGTTTATATATTACAGTCATATTGTAAAAAGCAGTAATTTCAATTTGCAGATAACTTAA
TTTAATAATGTTAGTTGATATTGATAACTTTAAATAACTAAATCATGATGACATGTGAAATTACTGTTTGTATAAAAGAAAAACTATTACTCTATTATTA
TAATTTAGATCCCATTTCTTATGAGGGTTTTACCTTTTATTACTACTAACATTTAAAAACAAAATTATATACATTACTTAATAATATTCCCTTAAGACTC
ATTTTATTATGTCATGAACTCGTGTTATTTGATTGTGCATGAAATAATATTAGTGAAATGTAAGATAATATGACTTTTTTGTACTTAACTTCATTTATCA
ATCAGACCTTTATATTCACCATTTTGTTAACTGAATTTTTAAGAAAAAATTATCCAACCAAATACGAATGTAATACAAATAAGTACACGTGAAATTTCAT
GTGGTTTTCTAATGACACACAAAAAAACATTAAATATAAAATACTCTTTTAATTTAATATTAAGGAATTAAGTGACACGTAAGAAATTGCTACAAAGTTC
CTCTGTTTTGACAGTTTCAAATTTCTACAAAAGTAAATATAAGGACTCTTTTCAATTTACTCACATTTTGGTGAAATTGGTTATCGTTCACCAGAAACCA
CCTAATAAAAAGATTCTTATTAATGTTTTTTAGTTAAATTGGAAATGTCAGAAATGATATTAATGAGTACTATTTATTTATTTATTCCATTGCCCCCACC
AACCGCACCATTTGAAGACCAACAACAAAATAAGTATATATTATCTACCTTCTTAAATTTTCCTATAATTTGAACGTAGATAACTTTTTTGAACTTGGGC
GTGTTGGGTACTAATTAAGGAAGATGTGTTTTACGATAAATATAATATTTTTAAATATAAGTAATTATTTTTTTATTTGGTAGATAAGTAAAAATATCAG
TTAAAAAATATTTTTCTTCATATTAAATATATTTATGATTTAAACAAATATTAAAAGAGACTAAAGATGAATGAAGATGAAGTGTGTTGAAAGATAAGTC
AGCAACGACTATCATGGAATGTCATCAACTTATTTTTCCTTTATTTTTATTAAAAAAAATTATTTTCTCATTTACAATAAAACTAATTTTCTAGATGAAA
TTTTTTTAAAAAGAATTTTTTCTCTATACCACACTCACTCTTTATCTTTTCAAATGCCATGATTAATCCCTCGACCCTCGAAACACAAATTGAGATAATC
AACTTACTTTTTTCCATAGTCAAATTAAACCTTGAAAGGTTTTGTCATAGCTTATAATTATGAAAAAGAAAAAGTAAATTATATTACCAATGTTTTTTAG
CTTACAATAGTACGTTACTTGTCAATTTTATCAATATCAATAATATATACTAAAGATTTATACGTTAACTTTTTATATAAAAAGTATTCTTATCGTGGAA
ATATTTCTTTAAAGTTGCATATATGGAATTATAACTTTGAAGATAAAAAAGATTAAGCCCTTCTCTTCCTTAACTAACTAGTTGTTCTTTTTTATTTCAA
CATCGTGCTCCTTAATTAAGCATCTTATTATAATTGGGTAGTTCAATTTACCATTTTTATAATTTCAAATGAAGCTTAGAAAACTCGTTTAAATAAAAAC
CAAACAATAACATCAATGAAACTTGTTTATGGTTTAATTGCAAAGATCATTAGTGTTAGGTTCATTTAAGGCTACCACGTTAGGAACGTTTCTTACATGT
TGAACTAATTAATAAATCTATGTCTGTTGGTGGTTGCTTAAATAGAGTCTAACGTAATTTGATTAGGTGGATAAGTTGTTAATTAGTATTATTTGGTAAA
TAATTTAGAAATACGAACAAAGTCCTCTCCTTTCCCCTCTTGCCTTTAAATGACGGAGAAAGTCAAGTTCAAATTCATTTAAATGCTTTATTTGTTTTAA
TTTGTTTGTCCTAATATATTTGTAGTTCATTTTAAAAGGGAAAGTTTTTTTTCCCTCTTTTTGATAACTATTTAATTAAAATATTCTACATGACATATTT
AAGGTGACAAGAATAAAATGACATTTTTTATACATTTTTATATTAATCAAGATCACAAAAAGATTAAAAGTTTTTTTTCTTACTTTCTTAGAAAAAATTA
TCAAGTTAAAAATAACAATTAAATTAAAATATTCCGTTAGTTATTATGAACAATTTGTACCTACATGTTATATGGAGGAGAGAGACAAGTGAGATCGAGA
GAGGCGAGGGGGAGAGGGAAGAGAGTGGGAGAGAGATTAAATTGTATACGTATATAATTGTATATTATACATATGTATTTGTATATATGGAAAGCAAGAT
CGATAGAGGGAGGAGAGAGGGCAGAGAGTGGGAGACAGGTAAAGTATATATGTATATAGGTTAAATAATTGTATATTATGCATATGTATTTGTATATCCT
GACGAATTATACATATACAAACGTGACTAATCATACAAACTCAAAGTCAGCCCACGTAATTAATGTATAATGTTAGTCGCAAGTGATAATTATAGCAAAC
TATAGCTATAATAAGTAATTAAATAATATAAATTTGTTTAATCGCATAATTTTTTCAATTTAATATTTATAGAGTCCATGAAAAGATAATCAAGTCGAGA
GACGTCGACGGAGCTTTGAAAGAATTAAATGGACCAATTTATTTGGGCCATAGCAAAGTATGCTTGAGAAGGTCTAGCCCATTGCTGTACCGTATCCTAT
ATTAGCAGGTACAAATAAGGAAACCAACCAAAATCTCAAGTCAATTGATGTAATTAATTCAACTTTTTTTAAAAAAACTAATTTTTTTTTTTGTTATAAA
ATTTCCTTTAGGTTAGCTGATTAAAAGTAGTCGATAAGTAGCAATTAGTAATTACAGAAAAACATGGAAATTAATATGAATAATTACTTTGCAAAATTTA
AATGAATAAGTAAAAATGAACGAACAGAACATGATACTTGATTATTTCAAATCCTACTTTAAATTATTTTAAAAAACTTTGACAGACCCGTAACTATATT
TTAAACGTAGTTATTATATATTTTAGTGGATGACATATTAATTACTAGTAAACCATCCAACATAATTGAAACATGTGTTGGAAATCTAAAGATGGATAGT
AGAAGATGTTGGAAGTAATGTCATCACCATAATTTGGTAGAGTGGAGTCATTCATAAAAAAATTATCATGAAAAAATAATGGCATTAAAGATGTAACCTA
ATTATCGATATATAAAAAAAAATACTTCATAAGAGATGCAAATTTCAATAGAAAATAAATACACTTAATTAGTTAGTAATTTCTTTTCATTTGTTTAAGT
TTCGATTAATATAATTAACTAATATTTATATTAACAATTAAAATTAAACTGACTCAAACATCATAATTAAACGTAAATGAAAAGATGGGACCCGAAAGAG
AAAGGAATTAGTGGATGAAAATAAAGGAAGAGGACTTTAGAAGTATGTGGCTAAAAATTGTTGTTTTGATCCTACTTTGTAAATTAGGACAATCTTGTGT
ATCAATAAAATCTTCAACAGCCACACCCTTGTTGATTCTCACGTGTCCAATGACCATGGCCCATCTTATTGGATTACTTGTGGACCTCATTTTTATCTAC
TTTTTATTTCAAATCCTCTTACCCACCAAACTCAAAATAGATACTCCTTTATTTTATATGAATTAATTTAATTTAATATAAAATTTATATATGAAGAATT
TTTTTTTTGAAATTTATAATTGAAATAAGTAATGGATTATAGATATTTGTGTGTTCATAAATCATTAGTAACATTAAACTGTTATTTAATATAAAAATAT
ATTATTCTTTTTGGGACTGATTAAAAAGAAAGTAAGTCATATAAAAAAGTTTTTTTTTTAATTTTGTGGTTTAAATTTCAAGAAATGTCAAATATATCAA
AATACTCATTAATCTTATATTCTTAAATATGTCATGTGAAAAATTTAAAATTAATGAACCGCTAAAACAGAGAAAATGATCATTTTTTTTTAAAAACGGA
CGAAGAAAGAAGCATGTGTCAATAAGATTTTAACGGACCAATGTAAAAAGAAGTCTTTTGGGGGGCAAAGTCAAGAGGCTAAATACACTTGATTACATTT
GAAGCCTTCAATAAATTTTTTTATAGTTACTTATTTACAATATGTTAGAGCAATTGGATAGTGTAAAACTTACAATATGTTAGAGCAAATATGTTCTATT
GTAATTTTCTTTCATCCAAAAGATGAAACAAGTAATTGGTGGTGTGTATGATAATTGTCATTTCTAGGATAAAAAAGTAATATAATTGACATTTCAAATG
TAGAACTATTGCCATCATTTCATTTATGAAATTTGTATTAGCCTTTCATATCATAGAAAATATAACAAAAGGCTAGGGTAGTGTGGGGGCAGGACAAGAG
GAATAAGAAGGTTATAGGGGGGGGGGGGGGAATGGATTGTGTTGGCAAAGTCACAATGGCAACTTAAAACAAGGCCAAAGTAAGGGCCTAAAAGATTGTG
GGGAGGGTTTATTTGATTTTGTCATCAAGATTAGCAATTTGAATTTTAATGTAGTATAACATATTGTCTAAAGAGGCCATTTTTCATTTCTTTAAAGGGG
TTTAGTGGAAATTATAATTATCAACACCAAAAAAATAAATAAATATTGTTTTATCTTTCTCTACTTGCTAATATTTCAATTTTATAATACATCAAGTAAA
AAAAAAAAAGAATGACATCCAAAAGACGACAACTAAACTATGTTGGTTTACAACTTGATTATTTTATTTTTTAATAACATATTTCAACTATTTCACCACA
TAATTGACATCTCTTTTAACACGTATATCAAATAATTTTTCTCAATTAAGGTTGAAGAAATCACCTAAAGTATTCTTGTTTGTATTATCAAAGCGAGTAA
CACTAATATTTAGATACATACCAACACTGGTATTAGATACATACCTCTGCGAGGCTTAAGCTGAAAAATCGATCTAAAGTGTTTTGGCTAATATCATCAA
GTCCATGAAACTTGCTAACTGGTCGTAGCAAAATCAGTATTTTTATTTTTTGTAGTGATATTGTTCGGATCGACTTGTACAAAAACTCAATTATTTTATC
AGACAACTACTACCTCTCACCAACGCCACCAATACTAATAAGTATCTCTATTAAGCTTAAGCCAAAGACACGGCCTAAATTATTCTTGACTATATCAAAC
AATGAAACCATTTAATTATACAAAACACAATCAATATTTTAACTTTTTGTAACTATATTGTTCGGATCAACTTTCACCAATATTCAATTATTTTATCAAA
CAATCACTTCCTCCCACCAGAACCACCAACCAATACTATATAAGTAGCTCCGTAAAGCTTACACCAAAGAAGTGACCTAGATGTTCTTGGCTATGCCATA
AAAATTTCAAAACCATGTAACATGATAATTGGTCGCAACATCATCTGCGTGCCAAAACAACAAAAACCAAAACAAACCACTTAACATGCTAATTTGGCAA
CATAATGGATAAAAAAGGCAATTTAGACAAGAAAATAGGAACATTAGAGCTTGAAGACTCAAATTATATATATTGTTGCGTCTCTTTGTGTGGGTCTGTC
TCACTGTTGATCCCATTTGTCCTCCACGCTTTCTTTTTTTCTCCTCTCTTTCCTCATTCAGCATTCTTCTTCTTTTCTTAGCACAGCTCGACCACTTCTT
CTTTTCTTGTCAAGACCCCAAGATTCCCTTTTTGTCTCTTTATTTTAACTCTTCCTCTATCTTTGGCAAAAAAAACTAAAACTTTATTTCATACAGATTT
GTGGGTGTTCTTTGTTTTTGTTAAATCGACAGTATGATGAGTGAATCAATGGCCTGAAGTGGATTCTTGAAAAATGAGTAAAGGAAATTGAAGAGTGAAA
ATATAGAAACAAATATGAGAACCCTTTGTGATGTTTGTGAAAGTGCTGCGGCAATACTTTTCTGTGCTGCTGATGAGGCTGCTCTCTGCCGTTCTTGTGA
CGAAAAGGTATTTGTCGAATTCCAATTTTTCAGTGTAACTCGATTTCTTGGTTCTTGATAGAGAATAAGTTGTCTAAATCTTGGGTTACTGATGGATGTT
GTTTATGTTAAAAGAGTGTCCGTTTGTTGTTGTACTATGATATCTTGAATTGGTTGGTTCATTATCTTAGTATTTGCCTTATTCATGTAGTTTCTTGATT
TTGATATATGTTACCATTCATGTAGTTTCTTGCTTTTGACGTATGTTGCCATCTCTGTTTTGGCTATAGCATTGATTTGTTGTTGTTATTGTTCCTTGTC
AGGATGTTCTGTACTGTTTTCCTTATTAATTGCCGTATTTTCATTACTGCCATTTCTCTCCATAACTACTTGATTTGCTGCACTTGAGCTGGGGTCTTTC
AAATACAGTTTCTCTACCTCCACAAGTTAGCAACAAGATCTGGATACTCGCTGTACTCCTGTGACCCTAGTTGTGGGATTTCATTGGGTATGTTGTTGTT
TGTTGTATACAAACTATCTAACTAAAGGGATGAAATTATCTTCTTTGAGGTCCATTATGTTGGTTTCCACTTTGTTGTGCAGAGAGGGATCTAGGATTTT
TAGATACTTTACATCTTCCACTGATGTAGTGCATATGGTGGTCTATGTTTCTTTCTTTGTACTTACTACTTATACTATGCCTTCTCTTCTAGAGTATATA
ATTCAATGCAATCCCTTTTGGTACTGCACCTTCTGAAATTCCACATCCACACTCTTGATCAACCTGAATGGACTAGATGCCTTATTTTTGTTTGATAAAG
GTGACGTCCAGCCCATCTCCTCACTCGATTATTCCACTAAGTACCTCCTATCTCCCACCAATATAGGTAACATTACTCTCCTCCCCAAAGCTTAGGCAAG
GTGAGAAGAAATCATTAGATTCTGTTGTCTCTATGATTTTAACTGTGGTTTCTGATGGTTTTCATTGACCGCTAAACCACACCCTTGGGTGCTAATGGAC
TATTAAGGCTTTCTTTGGAATTATTCTCTTCATAACACCTTTATCTAGTTAGGCTTATATATTCTGATGCGTGTTGGAAACTTCTCCATATCCAGCATTT
GCTCATTCACGCCTCGTCTCACCTATATTTACTTCCCTTGTCTGATCTTCCAAGGAACTACTAGTGTTTGAGAACACAAAAATGATATACATGTTGCAGG
ATAGAAGAACATTCACTTGTAAGGAATTAATTTGGTAAAATATAATCTTCTGTCACATTTGGTTAGTACCTGCTTCTTCACAATTGTAACTCACTAGTTT
TAATTCATCTATTTTCTACTGAAAGAAATTCACGGTCCTTGATATATCTGATATTAGGTCCATATGTTCTGTCACATTTGTTTGGGATCTGCTTGTTCAC
TTTTGTGACACAAATTTTAATTCATCTGCTTTCTACTGAAAGAAATTCACGGTCCTTGTTATATCTGATATTAGGTCCATATGTTCTGTCACATTTGGTT
GGTATTCACTTTTGTGACTCACAAGTTTTAATTCATCTGTTTTCTACTGAAGAAATTCACGGTCCTTAATATCTGATATTAGGTACATTTGTGCAACAAG
CTTGCAAGTCGACATGTAAGAGTTGGGCTAGCTGACCCCAGTAAAATCCAGCGTTGCGACATATGCGAAAATGCACCTGGTATGTAGCTTCATTTCTTCT
CTTTCCTCATCCTGTTTCTTTTGGCCAAGATGGCTACATTATATGAAGTTTTTGCTTCTTTGCTGGATACATGTATGTAGCTTTCTTTTATTGTGAGATC
GATGGAAGTTCCCTTTGTTTGCAATGTGATATGATTGTCCATGTTGGAGGTAAACGAACCCATGGAAGATATCTCCTTATAAGGCAGAGGATTGAGGTTT
GTAAATTCATGCTAAGACAAGCCCTGCTTCAAGTTCTTCTTGCGTTTAGGGAAGAGTCTATTTTATTTCTTCTTTTATGTCCTTCTGTAGTTTCCGGGGG
ATAAATTGGGCCCTTCAAATGAGCAAGGATTGCCATCTACTGAACAAGGTGATGTAAGGAGGGAGACTGCACAGCCCTTTAAACTCCCTATGATAGACAA
TCACCAACCAAACAGGGAGACTGCTATGACAGCAGTAGAAAATAACGTGAATAATAGCGTAAAAGTGGAGAATGAGTTGATTGACCTTAACTCCAGACCT
CAAAGGATGCATGGTCAAACGTCAAATAATCAGGTATCTACTCAAATTGGTAGTACTATCTCAGTCACTTTGTTCAGCTATTGGTCTCCAGTAATTATAA
AATTTAATGCAGGAACAAGTAATGGACATGCTTGGTGGTAGCAATCATGAGTCTGTCGGCGTGGTTCCTGATGGGCCCTTCAAAAGAGAACCAGAGAAGT
GATCAAGGTATGTACTCTACTGAGTGAATTTGAGTTTGTAATGCCCTTCTATCAACTTTGTCAAAGTCTTGGAGTATCTTGAATAGTACTATTAATTTTT
TGCCATTACAAATTACAATGTGCATGTACATATGCAATATTCTATTCAGTCAGACATTTTATGGGTTGTGACACCTTTTTCCATTAAGAGTGTATATAAG
CAATGAAAGAATGATTGTCACTTTCTGCAAAAGGATCTGTGCTGTACTTAATTGCAGATTCTGAAGAAGTATTTAAGGACGTTTAGGTGCGCTTCAAGGT
GGCTGGGTTAAAAAAAGGTACTTGAGAGGCATTTGAACCTTTTCGGCTGAGATGTGTTGTCACTGCAATTTCTCTTGAGTGCCTCGCTGCTGCTAAGCAG
TTACATGATGAGGATAACAAGTTTAACAAAAAGAAGAGGAATAAACCATTTTCAGCAAGGAAGAAATTGAAGAATCGGTGAGATCAAAATATCTCATTTC
TGGAGAAGCTGGAAGGGGATATAGAGCAGGAATGGGAGAAGAAGGATTGCCTTCCCAACTATTTCAATTTTATGGATTTAGTGGTAGTGGAAATAAACTA
CATACATGAATTGTACTTCGGCAGTTTTGAATTAGACTGAAAACAAATTTATTTTGGTTCTATAAACCAATAAAGGAAGGTAACAGACGTAAAAATGTTG
TTCATGCATCAAAGAGGATCATTTATCATTTTGTTTTTTGATGGGGTACTTATAAAGAATTGAGTTATGCAGAATGCACGAAGGCACTTAGTAGAATGAG
TTCTCTCTTTTAAGACAACTGATAATGATAGGATATTTAGTACAACAATAAGATACCCAATGTGATCCCACAAGTGTGGTCTGTGGATGGTAGAGTGTAC
ACCGACCTTAAACCTGATCTTGTGAGGTATAGGCGTTGTTTTGGATAGACCCTCGCTTCAAGAAAAACATTGCAAGGCTGATAGGATGTTTTGTAAGAGA
GAAATGCTTTCTAGGTATGCAGGAATAGTGAAGACACTTAATACAACAAATCAAACAGTGCATAAGAAATAAGCTCAGCATAACTAGTATACACCTACCC
TATCCAGCTCTATTCTTATACACCCTACTAAAGAACCCTAATAGAGTTGTAAAAGCAGTAAGATAGTGAATTGGGTGCTAGATTTTCATCTTGAGCTGGG
TACCGAATATGTACTTTAAAGTGTAACATATCAGTAAAATATCTAGCTTGAACTGTTCAGTTCTACGATGTTCATGGTCAATTTTGCAGCACTCATGTTC
ATTGTATGCAATACATGTTCTTTGACTATGTATGTAAAATATAACAAAGCAAAACTTTGAAGATGTCTAAGTTTGAACTCGTGGAATTGTACTTGATAAA
TACTGCTCAGTTTATAAGGCTTGTAAGCATAACTTTCTATCTCTCTCGCATGCTTATCGTTTCCCTTTTTTGAAGTGTAGATGTGAGCTGCTGCCATTCC
AAATTTCAAACTTGAATTATGAATTGGAGTTGCCGGCCCCAGCTGAGTTCTATGCAATGTCAAAGCTTTAAGAGAAGCTTTTGAACTAGCCGGGACCAAG
TTGAGGTATTTCTTGAGTGAAGAGCTCTCTGAAGTTCATTATTCAACCACTTCATGCATATACTTTGAGAAGAGGATCAGAAAGAAATTCTGCCATCTCG
CTTTGGAGAGAGGATAAGGCTGCAGTCACCACATTTGCCTCTGTAATTTTCTGTAATGAGTAATGAGAAAAAACAATCTCTACAGATTCAAGATGAACTG
TATAGCAGTGACATTCATTTATTGTTGTTTTTATTCATCAAATTTCCACCATTACTATTGTAATTCATCTGGTTTGAATTCTGTTAAACTTTATAATCAT
TCAAGGTTGACACAAACTACTGGGGAGTAAAACCCCAGTACCAAACATGTTGAGTCCGATTCGGTTTAACCAAGCAGAAGACTGCTCTGGAATCTTATGA
CTGGCATTTCCAGGACTGGATTCAACATTTTCTTCTCTTGGATGATATCATCTATGAGATTAACTCTAGGTGATCTTGTGGATTCTGTAACCAGGTTTCG
AGTTTGAGTCCTTGGTATGGAAACATTCTTTGTTAAGGAGCGCTTTTTCCATTAATAAGCACAAAGTATCACGCCAGTGGGATCGGGATATCGACATGCA
ACCCGGTTCAGATTTCCTGGAACACTGCCTCAACAGTAAGAAGCTCTACAGTATTTCCTTCTAATCTTTATAGATTGATCTTGGAGCTAAGGTAAAGTTG
TCTTTGTGTGGTTGTCACGGGCTCGAGCCATAAAAGCAACCACTACTACTTACAGTAGGGCAGGTTGTCTGCATTACACCCCCTGGGGTGCCGCTGTTAT
GATATTATTGCAAGGAATGCCCTTGAGTCCCACATTGGTTAAATGGGGAGCCGATGTGGGGCGTATATTGCATCGGGCTCTCCCACCCAACCTCAATTAG
CTAGCTTATAGGGTGTGGTTCTAGTGAGGTTGTATCAAAGATTACAGGTCTTCAAGAATGAAGACCACAACTACTGCATATATCGATGTAGTTTTGTAGA
AGGGATCTTACTTCCTAACTTGCTAATTTTTCAAAATGTACATAAAAAGTACTGAAGTCCTTAAACAGAGTGATATAGACGGTGAGTATTCATATAGTCG
ATCCGAGCTAGCCTGGGATGAAATCGTAGTAGTTGTTGTTGTATGGTAAAAATGTCTTTCGGTGCAGGGGATCAAGATATATTTAGCCTCCTTGGATAAA
AGAATAGAATCTATCATCTATTGGTAACAAGTATTGCTTTTAAAATGTCTGAAAACCATATGCTCACAATAAGTAATTTTCATTATTCAGTATGCATAAT
AAAACAAAGAGCTGGTTTATAATTTCATAAAGCAACACTAACTAGTCTCAATCAGCAAGAAAGTTTATTAAAGTTGTTAAAAAAAAAAGTGCAGGTAATC
AAATGAACAAAAATACTCTTCTCTATGGCTTTACTAATTGCATAACTTAGTAGTATGAGATAATTCATCATTTCTCTGCTTCACTATGAACCATTCAGCT
CATAATCTTTGTTTTTTTTGCCCCTATTCTTCAAGACTTCAGTGCCTAATAACTTAGTAGACATAGCCCTTTACAAACATTCCTTGTTTAGCTTCATCGG
ATTCACCCTCACCGGTGTACTTTCCGAGCTGAGCAAGAGAGTTCGCTTTGGCCCTGACAAGTAAAGTATCCTGAGCAGCCTTCACATTCTCAGGTTGTCC
TCCCCATGTCTTCAAGCAAGTGTTCTGAAGAGCCCTTGCGTAAGAGAACGACACGTGCCACGGGTTTGGAGCTTGGTTCATGGCATTCAAATTCAATGTA
GCCTCAACTTCTGATTGCCCACCAGACAAGAACTGCTCACAACCCAACAATATTGAATCAATTAGCATAAGGTATGTACTTTCACTTATTCATCTACCCC
TAGCAATGGACTAACAATTCATATTCTATATGTTGGGAAAGTAAAGTTACTATAAACTTCTTATTTTACCCTTAATGTCATGCTCTTATAGCCTGTTAGA
ATGTTCAAGACCTAAGTTTTAAAGGTGCTTCTGATATGTGGCAAAAATTTTCTTTCTTAAACTTTGTGCTTAATCAGACGGTCATTTAAAATGAAACGGA
GAGAAACTTGCCATGATTCCAGGGACAGCTGGGGGAATCCTCCTCTTGAGGAGACTGAGAGTATAGTCTGCGACCTGCTGAGGAGTGGCCCTGTCTTTGC
ATTCAGCACCAGGAGTAACCATGCTTGGTTTCAAGAGGATACCCTCAAACATGACATTGTTCTCAGCCAAGTAGAAGAAGACTTCAGCCCAGACCTTCTG
TGCTACCTCAAAAGTCCTGTCAATGCCGTGTTCACCGTCCAACAAGATCTCTGGCTCCACAATTGGGACCAAACCATTGTCCTGAGAAATGGCAGCGTAG
CGAGCCAAGCCCCATGCTGCTTCCTTGACAGCCAATGCAGATGGTCCGTTGGGAATGCTCACCACGGTACGCCTATAAGTTACCATAATTTTAGCATTAA
TCTTAACATGGGTCGGGTATATGAATCTTCACTGACTTGTCGCTCTATTTTAATTCATCTCATTACCAATATTGTGCAAAAGGAGGATAGATTAGCATAT
AAACTTCTAACATGATGAAAAAGACCTTTTAAAACAACTATTTGGTATAGTCCATATAAATTTTTTCTTCTTCCGCTGTGCATTATGAGAAAATAACAAA
GTGAATTAGGACTCCAAATGTACCATTTGGCGAAACGTGCTCCCTGTTGGTAGTATGCAGCAGAGCGCGAGGCAAGTCCATCAAGACCTTGACACCATGA
CTCATCATTTGAACCAGCAAGGGGAACCAAACCCTGTGAACAGATATAATGATTAGGAGATTGACAGAAATCTCATTTCAGTATAACTTGTTCTTGTTAA
ACAGTTACAATCCTGCCTTTCCTCTTCTATCGTTAGTATAACCACATATATGACCAAGCAAGTTGGGGTCGGTTATACAAATCCTTACTGATCATGTCAT
TCCATTTAAGTTTCTGCTCAGACCAATATTATACAAAATAAAAGTTCGCTATATTTTTTCACCAGCAACAATAACTCTTTACTATTGTCCTTTTTCAAGT
TGTGGGTGCAGGTTAATATACCTTGTCAACTTTGATACCAGGAACAATGTTTTGCTCAATAAGAACATCAACTATTTTGCGTCCATCCACGGTAGACTGG
TAGAGGGTCTCCTCAAAAAGAATAGCACCAGAGATGTACTGTCCAAGGCCTGGAGCTGACACCAGCAAGGTACGGTACGCTTGGCGGTTAGCCTCAGTGT
TTTCCAAACCAATGGAAGCCAAACGCTTTCCACAAGTGGCATTCGACTCATCCATGGCTAAAATTCCACGGCCTGGTGATGCAACAGTTTTCTACAAATA
ACAAACACTTTATTGTTAGCAACAAAAATTTGTTCGGTACACTAATTCATAGCTAAGAGTTTTAAGTTATACACAGTAACAGTGTAAATTTTTTTGTGTA
CTATCATAAAATTCATAGTGATGCACATTTGCGTGACAGATGACTGATTGATGCATAAAATTTAATCTTACAGTACACAAAACATGAACTCGTTAAACTA
AAACTTACAGCGGTTTTAATGAGCTCATCAGCATAAGAGGAAGCTGCGCGGACAGTAAGAGAAGTAGCATTGGTGGGATGACAACGGACCACTGAGACAG
AAGGCTGACGAAGGCTTTGCCCCTTTAAAAACTCAGATTTGTCAAGAACTGGGGATGACTTTAGTAGAGATGCTGAGGCCATTTTCTTTTTCTTTACTTC
AAATTTTTTCCTCTCTACAAGAAATCTCCTTATCTCTCAGCACAATCTATTCTCAGTGTCACTCTTTGCCACACAAATTTCTCAAGCAGAGTGCTAAAAT
TTATAACTGCGCTAAAGTGTAATTGAAGATGTATCATTTGAGGTGGTTATGAGCCAACCAATGACTTTTTGACATGTAATTTTGATTATTTTGTCTACTT
GGCACATTGTACAAGTTGTTGATTTAGATGGAATTATTGTAATGGTAGACAAACGTGAGGCTCTGATTAGCAATCCTACCTTGAGTGGCTTGGTAACATT
TCCTTTTTGTTTTGGTTATCCCTAGGTGATCAGTGGTCATGGTTCAGTTCCAGGATTGGGTTTGACAGTGACTTTCAAATATTTCTAACAATTCTTTTTT
AATAATAATAGTGTCCAAACCAAATTGCGCGCACCTCATATAATCCAGGATACCTCCAAAATTTGTAAATGAAAAATATATCTAACTACTTTGTGGAGAC
GAGCTTTCACCCTTGCGGAAAATTCCTCACTACTTAACCGTCTCAAGGCTGAAAGAAAAACTCAGAAGAATTTCATGCACCGAATCTAAAATCCCATTTA
TTGTATCAGCTAACAGACTCCAGTTCAAAAGGAAGGAAAGCATTAACTAAGTAATCTATATACCAATATACAAGGAAAATTGAAGGACAAAAACCTGTTT
TCTTATACTAGTTGTACTTAATAATCAAGCTAAATAACTTAAACATTGAGCAACATCTGCAAATTTATGCCTGAGCGTATATGATCGTCTTTCCTTCTTG
GACCATGCACAGACATGCCAACCTCTTTCTACGAGAAATCAAGTCAGAAACAGTAAGCTGCAAAACGGGTTCGTTGAAGTTTTCTTTAAACTACCTCGAG
CTTTGCATCTAAAGCAGCATGCTCCAGATCAGAATTTGGATTTGCAACATAACTTAATCAGTTGTTGGATTCAATGACATGTCATCGAGGCCAGAAACGA
TATCATCAACCAACTTGTTGACCAGTACCTCAACATTTTCAGAAGCTGGAGGGATGGAGTCCACGGAGCTTCCAACAAGGGCTTTGTTGAGTTGTTTAAC
AAGTCCATCTTCCTCATCGGGAATGTCAAGTTCCCAGACCTTGAATATATCGTCATCCAAATTTTCTTCAACAAATGTTGAAAACTCTGAATCTACTTCA
GAATCGGAGGGTTCAACTACTCTCATGTTCTCGTTATAGGTGGAAGAAAAAACATTTTCTAAGTTAATTCTGGACCAAAAAATATCTGGATCTTTGTTAT
TAATCAGATGACGAGTAGTGTCCCCTTCTTGTTCATTAATTGGAGAAAAATCATAAATCGAGTCATCTAAAATTCCTGAAATTTCTGTCTCTTCAATAGA
GGGGACAATACGAGAGTCTTGAGGAGAGTCATCCCTTACCACTGCAGAAAAGATTGCTTGGGAAGGAAAAGTGTCCAGTAAGACATGCTTCAAAGAATCC
ATGCCGTGGTCCAATATAGCAAGATCATTAATGAGGCATGAGTCAGCCCATGCTACATCCTCAGGTGAAAGCACATCTCCACTCTTGTTGCTATCTATAG
AAATGAGGTCAAGCGGAGAATCACTGTCATCTTTCATGTCATCATCAACAGCCATGGCCATGGCCATGGAGAGAAGTTCAGTCATATTCCTTAGCAACCA
CCCTGCAACAGAAAGTACATAGGTAAAGCCTTCAGGAATCATCAACAAACATTTTATGACTCCAAGCACAAGTAATTAAAATAAGACCACAATACAACGG
TTTCAAATGTCATGAAACTGAGGTTTCAACCACAAAAAGATGGCAAAAAGTGGATTACTAGCATCAACAATTCATCACTGGGGAAATATTCAGGATCAAA
CCTAAACAATTATAATACCAAGCAACACAGAGACAGATGAATATCTTCAGCTGTTGTAGCAGACTAGAACTGCCTATAATTGATGAAATCAGTTAAAAGG
CTTGGTGTGAGTGTCACTACTAAGAGCAAGACAACAATTAAACATACAGAAGCATCAAGGGAATGAGGATTCAATAATATACTCCCTATTTGACCATACA
GAAAGAGAGAAGCAAACTTCATTCAAATGAAAGAACCACTCATTATGAAAGGTCTCGGTGTACTTGATAGAATCCAAAGGCAGAACCATTGAAGATGCAG
CAGACATAGCCAACATAATATTATCAGGAGTGACAGAGTAACCACTAGATTTGCATTTACTCAAACATCAGCACTAAAACGTTAAACATCTTCTAAATCA
AATCCTAAACTTCAACTATGATATGTCATTTTCTTCTAATTGGTAAGACATGTCATTTAATATTCAGAGACAATAAGCAGAGTAATCAAAAGTGTCCTTC
ACATACAGAAACCAATTATATGCGACTATTCCTCAAGGGTGTAATTCTATGGTGACTAATACTTAAATGTATAACCTTTACTTTGTTAAGTTTCCACAGC
AACACGAATTCAGTATTAGCTCATCACTACAGCTCCTACCTTGCATCCTTACCGGCCCTTCCTTTCCACTTCTGCCTACCTCAAGCTTCTCTCACACACA
GCAAAAGGGTGAAAGTAGCTGGTTAGTCCAAACTTAACAATATTCTTTCATATTGACTTTGGAATGAATAAGCAGAGGTTTTATACATGAAATATGAAGT
ACTATCAAAAATGCTAAAGCACCCAATCTTTTTCATGTACCAATGAAACAATCAGCACTTCTTTTTTTGATAAACATGGTGTCTCTCACACCTTGACTAA
TTGCACTACCACCTCCCACCAAAAAACAAGTTCATGATAACTTTGTCCACCAAGACTAGGACACGTACGAAAAAATCACCTATAGTCTCAGGTTAAACTT
GAACCTGTA