BAC Sequence – LE_HBa0331L22

>C04HBa0331L22.1
AAGCTTCCATGTATACTTTGCTGCATTTTTTTACTGCTTCAAGACCTTTCAAAGTTATATCTTTATCATCACCCAATCCAAGACCTATTATATACAGCAT
GATTCTCCCTTCACTTCACTTCACTTCTAATCCAAAATATACTTCTAATTAGTGATGCAAATTTACAAGTTCCAGTACGAGATACAGAGGAAACAGTTCT
TTTTTCCAGTTGGAACGAGGGAGACGATGAATTTAAACCCTAGTGAAAACTTGTAACTTGAAATATATATACTTATTGAACTATTTGTAGGATGCAGAAC
AAAAGTCGATATGTCCGAGTGGTTAAGGAGACAGACTTGAAATCTGTTGGGCTTCGCCCGCGCAGGTTCGAACCCTGCTGTCGACGGTTTTATTTTTTTG
ATCAATATGATATCGTGTCAATCCATCAACTCATATTTACCTTCATAACCTATAGCCTATCTTAGTTGGGTGTTTTTTTTTTAAATAATAATATCGTACC
AATTTGTCAACTAACATTTACCTGTTATAGCAAATAACCTATCTTAGTTTCAAGATTTTAAATCCTATCCAATGTAAAATCATACATGTATATATCGTCT
GGATGACCCAATGACCATCGATATATATAACTTAAATTAAATTTGAGAGAAGGAAGAGAATTCATCTCCAATTTTATTTTTATAATACGTTAACAAAAAG
ATTTTTTTAAAATGCAATACACACAGGTGCTCAATTTCATTTACAACATCTAGCAATTGGACAAAGCTGGTATTGAAATCATGTATTGCTCAACTTGTTA
AAGATTACATGTAAGAACAGAAGGTGAAAGGAATATGTGAAAACTGAGAAAGGCAGAGAGAGGGGATGAACATAAATGAATTTTACACAATTTTGTGTCA
ATATATTCAGGTCAAAATGACAGGTCTTCTAGACAATAAACAAGTTGTGGCATCCATGCTGAGTATTCTTCCATATCTAATCATCGTCCTTGAATTCCCT
GTCGAGAAGAAGATGACACTCTCAGTATTTGTCTCTCCAAGAATGAGTTCTAACTTCTCCTTATCATACAAAATGCAAACAGAAGTCGCGATTCTATGTT
TTCTTTTTGTGTGTGTAGTAGTAAGAGGTGTAAAGAATGATAACTCACCTGCGATCAAGGTACCGAGGTTGAATGCCACTGCCTTGACATGTTGTGCAAG
TCAAACCACCAGCACCGTCACAATTGATGCACCGAGAGACTTCTGTCTCACCCCCTCCAAGCTCCACCGTCACACTGCCAGTACCCATGCAAAATCTGCA
TTTCTCTGCAATATAAGCCCTTCATAAGTATTAGCTCTAAGTCAGTCTCAAAAAATGTTAGGTTTTAAGGATTAACTGGCTCTACAGTCTTTGATCAGAC
AATCTACTGACTACTTTTTGAATAATCGAACCTCAGTAAGATTGTATGGTTCAATAACTCAATTCTCCTCTTTTACTGGGTGATGTAATGTCTATACATG
CAATCTTAATTGATGGCACATGACAACGAAGATTCACTTTGATATTTAAAGTGGAAACTTCAAGATTATTCACCTAGCAAATTTTAGAAAAACAAAAACG
TCAAATCATAAATCACCCTTCTCTTCGTCGCTCTCTTCGATGATCAAAAACACCACAGCAGATAGAACCACCTTAGGGCCAGGATTAGAACACTTCCCAA
TTACAAAGGCGGTATCTATGAGAAGGAGAAATTTAAGTCAAGCCAGGAGTAAATTGCAAGTTGAATAAAATTGTTGGATCGGAGCCATGGATTTTCTAGA
AGCTCATTGGTAATTGGTCATTGATGTAAGTAGCTGCAACCAGAAATTCCTTAAAGGCACTAGAGACATGCTAAGGGATAGGCGTCAACCTACAATGACA
TCTTTGAAGTGGCATACGAATTAAGTGATTAAAAAATAAATCCTAGATCCATACTATGAGCATTTTGGAAGGATTTCTAAGAAATGCACAATTTGCTCTA
TCCATCATGTCAGATATTTTGATCAACAAGTCATACATGTCAATTTTAAGTGATACAAAACTAGACCATTTCAATAAGTCAACTTAAGATCCATGGAAGC
AATTGACATGTGGGTTTAGTGTCTTTGCTCGGACTTACGGAAGTTGATAAATGACGCATACAAGCAAAAACATCACTAATATAAAGAGATGTGGATAGCT
CAAACCATAGTCTAGTTTCTCTTGGCTGGCAAGCAAATGACTAGATTCGTAGCAAAGTGCAAGTTATGTCTTAAACTGGAATATAGGAAGGAACCATAAG
AGTTATTTTCCTGAGACTTGTAAGAAAGAATCGAGTGATAACAAGGATTGATGAATGTTCTTCATGGGCCAAAAACCATCAGAAAGTACTACAGCATCTA
AAACTGAAGCCAAGCACAAATCAGAACATGTACTTCATAGTTTTATCTTGAGGATATTGAAACTTCTGCCCTTATTCTACAATCTATATTCTCCCATATC
TCACTGCAAACGGCAAATAAAACTTTACCTGGAAATCAGAAATACAACAACACGGGCTCTACTTTTGTTGTTGTTGAACCAATGTATGCACTCCTTCAAC
AACAAGAACTACTGGCTTCCAGTAAATATTTTCAAAAGAAACTGTTCTGGGGGTTCAAAGGCAAACAGGAAACTCTCACTTATTGCAATTGTCTCAATAT
AGTTTAATTAAGCCGAAATACAATTCTGCGGCTCTTTGGCAGCCATTCAGCTCAAATTTCTTAATTGAGTGCCATCCACCAATTATGTATTTTAAGTACA
CTTGTGGACATAACAATATACCTCTAGGCTCATTTGTACTTATCGGATCGAACATATAAAGAAACAACAGAATGGAAAGTCTAGTTTAAGAAATACTTAC
GAGCACCAGTGCCAGTGCAGGGGAAGCAGGGCTGAGTGTTCTCTCTTTTTGCCTACAAAATGTACATTCTTTAACTATGAAAACGGAGATATATATCGCA
GGAATTGTCAAGCAATAAAATGACCAGGAAAACAGAGTTATATATCAAACATAGTTAATTTTAAAATATCAAATTAATCTTATATACTTTAGCTTAGAAA
ATTAGTCAAACGACTCTCGAGAAATGAAATGTAACAAAAACTGTAGTTGTACCAAGCAACTGAGCTCTGCAGAACCCGTAAGTAGCATCCCGGATAATCA
AGAAAGGTACAAAAAAGAGCATATTTCATAAAATTAAATCTTAAAACTTACAGCATTATCAATTTGGGTCTCATAAAAAACTGGAATTCCAACTCCAATA
GCAACACTGAGCACCCCAACTGTAATTGCTATCACCTGCCAAGTACATCACAATTTCCCCAAAAATAAAAAAAAAATAAAAAAAACCCATATGAGATCAA
CTGAAATTAAACAATAATCATGGAGAAAAACACAAAAAGAGAACTTGAGAAAGAAAAGAACCGTGTTTTGATCAAGATCCACAGCTTTAATACATGGGTA
CGAATTTCGCCTACGACATGTTTGATGAAATTTCTGAGTGAAAAAAGAAGAAGAAAGAGTAGGAAGCTTAAGAGGTGAGCTGATAAATGGAGACTTAAAG
CGGGAAAGTGAAGGTGCTGTTAACATTTCCTCCCTTTTCTTTCAATGTTTAGTTTAGCTATGGATTTTGCTATCATCAGAATCAGAAAAACAAGAAATTC
TGAAACTGACACCAACTGTTGTTAGCTATCCATTGTTAAGCCTTTGGATTGTGTGGGGACACATTTCATATTTACCAGTCACTTCATTGTGTTTTTTTTA
AATATATATATATATATATATATAAAATCTAAATGGTAACTCAAAAAAAAATATTCGTCTAAAATTATCCCCTCTATCGTTCATTTTGTATGTTTGATGT
AATAATTTTGTATAGTTCTTTTTATATATAGGTAAATAAATGTCTAAGCCTATATGCAACTTGATTACTCTATTCATTATCATATACTTAGTAAAGTTCA
ATATATGTGAATTTTAATCCTTCGTGATTTTAACCTACTTTACTAATGATAGGCGATTACAACACTTGTTTATTTATATAAAAAAATCTTCAACTTTCAG
TGCGATTTTAACTCATTGAAACAATATTTGGGATGCAACTCTTGTGACTTATCATTTCTGAAATTATGTATTTGTTGGTACTGACGCTATTTTAATTATT
TACGATTAATACGTATATGCTAATTAGGTGGTTTGCACTGGCCACTTTTAACCATAGGCAGATCAGCGTATATCTGCAAACATATCTACATATATTTCAA
GAAAAATGAAAACCAAATTATATGTTAGAACTGTAAAATGTATGATACAATATATGAGCTAGAATTTGTAACACATTCCAAATGTGAATACATATAGTTT
GCATCCAGTTACCGCCTTTCATACAGTAATGGTGATACATATAATACATGATTTTGTGAGTTGTGACACATACTCAGATTGATAGTTTATCTTTGTGATT
TTACAGACGTGTAAAAACATGAAAGGGAATATACATTAATTGATGAAACCACATCTTGTGACTCAACTGACGAGTTCCTTAACCTCGTTGAGCTTCATAC
CTTTGCCACAAATTCTGATTGTATGGTTTGTCTGGCTCATATTCGTCTTCTCCCTGGAGCTCATGTTGCACTACTTTGGTCCGCTAGTTTTTGAAGGGCC
ACATCTCTCCACCATAGCATCGTACAGTTGCCTCCCGTTCTATTTATGAAATTTAATCAGACTAAACCTCACATGTAAAGCAAAAGATACTCATTCTAAG
TTTAAAAACACTTACAAAAATCACTGGGAAAAAGTGTATTTGTCCCTCGGGTTTTGTCTGTTTCTCTTTAAAATAAACCAAAATCGGAAAGTTTGGCCAC
CATAGCTCCCAGTTCACAAATGAAGAATATCTGTTCACATCATTTGAATCAGCCATTTGGCAAAACTGACTTAGAGCAAGGATTGCCTTCTACTTACTTC
CAGCGGTTCTTTCCACCCACGAAAACATTTTCACCTGACTCCTCGAGTTGCTCCCCAACTTTCACCTCCTGCAACGAAGTTAACATAGCAATTAGAGAGA
ACAACTAATATGACAATGCAATGGTATATAAATTGCTTACATCAGATTTATACAAATAAGAATGTAACCACATGCTATACGTACCAGAGCCTCATCATCA
AAGACAAATCTCACTCTTGTTGTCTGCAAGCGAAAAACGATGTGAATCAATAAGGAATGCCGGCCTGATAGATGCTAAATGAATGAACGAGATCAAGGAA
ATTAAGATAATAAGCAGAATGAACAGATGATCTGTTACTAGATCCGGTGCAATAGAAGAAGCTCCCCGTTATAACTTGGATGTCATGGGGTTCAACTCTT
GACAGATGATTCTGAGGTTATTTTCCTTCTTTTTTGGGTTATTGGTCATCCCATCAGCTTATGTACATCTCAACTTCTCCATCGAGCAGCCTCTTCAACT
CAGAAGCACAGGTTGCCAAAAGAAATCCACCAATTTAGAGTTGTGATCTCACAAAAAGTGTAGTTGGGATTCGAACCTAGAATCTCTAAGTTGGCTTGTG
AATTACTTTCTTAAGTTTCTTTAGGCAATGTAAGCAAAACTCTCTCCTACTTATCTTTTATAGGTATAATTCATGCAACACACTAAGGTTGGAAAAGTTC
AGTATATATCATTGAATTCCTACCTCACAATTTTTGTTTGCTAAAAGCCACAAACCTTAGACATGTAAACATGCATCAAGTAAAGGAAAGCATTAATGTC
TATGATTCACAAAGCACGGGTGCCTTGTAGATGACTGGATAATTTTTTAATGTTGCCATGAAGGATGAAACCGCTTAAAACAGAACTAACACAAAATCTC
ATTCTAATAAGATGACTACAGTGCTCTCCATCTCATTTGTTAAAAAAAAAAAGGTACCTGGAATAACAGGAGTAATCCAAGAAGACCAATAGGAACTGCT
GCGGGTAGATTTTCCACATAAAATAAACCACCAGATAACCCTGTTCATACAAAAATGTAAAAAATTAGAACAAAGACACTAGAGAAAAATGAAATGGGGA
AGGGACCGAGGGAAATTCTTCAACAAACAACAGCTTGTTTGGATGGTTGTACATATCGTTTCAGAATGTAGTATATTGTAATGTACTCTGTTGAATTGTT
TTGATGAATATAATGTATATATTGTATTGTTTCCTATTGTTTCATAAGACCACCATGTACCAACAATTTGAACAATAAAACTTATAATATTATCAAAAGA
AATAGAGTATGAGATAGAGTTATGATTTGGTTTAAAGTAATATGATTATTGAATACAAAATAAGGGCAAAATGAGAAAGAAAAAAGAAAGAAAGATGATA
AGCCCACGTGATCACACCAAATAAGTTGTTGCATTATATGGAGTTTACATTACGGAGTTAATAATTCGATACAACAAAATTTAGCGTAGCTTAAGTAACA
TTACGATACAATACCACAGGTAACAACAATCCAAACAATGTGTTTAACTTCAACTATAAATTTGAAAATGTTGATTAATCAAAGATAAAGAGAATTGAAA
GATGCACCTAGAAGGACAATAGGAATTCGGTAATCTGGATCAGGAACAACAGTCTCCTTCTTTATCAGTTTCTTCCGCATCTGCCAAACCACGAACATTA
GCCCAAATTCCCAGGAAACTACAATTAGATACAGTCAAACATCTCTATAACAATCGTCCAACATTTCCCTATAACAGCCTAGTTTTCTTTGAATCAACTT
TCATACTATGTTATATTATATGCTCTTTATAAACTGCATCTCACAATCAGGGGCAGAGCTAGGTGGGTTGCTTCTTCACAAACCCTATATTTGTACTAGA
AAATTAAGTATACCTCTAATAACAAAACTGATTGACAGCTCCATGACAAATTTAGAACCCCAAACTTCTAATATTGGTTCTGCCTCACTACAGAGGCTTC
TCTATATTAGCAATAAGATCATCTCAAATTCCAAAGGCAAAATTAGATCAAATGAAAAAACAGAAAATAGAGAAATATGAATTAACTGACCACTGAGGTG
ATAGTGAGATTGATTTTTTTGAAGTTTTTAGTGAAAAGAGTATGACTATTAATCTCTTTGCCATAGAATGAGCTCTGTAATTTCCTCACAGCCACAGGTC
CACCTACTACTTCTCTTTCTGCTTCTGATAAATACAAAACAAAAATTAGTTTACAATACAAGAAAATTTTAAGATAAGCTTAACAAAGTTTAATTTTACA
GAAATTTTGCTCAACTGTGCAGAGCAGTAGTGAAGCGGGAAGCAGAGAGAAGAGCGCTCTCCATTGCAGTTTCTCTGAAATTGAAAAGAGTGAGAGGCTG
TAGATGATTTCCCTTAATTTTGTCATTTCCACGCTCTATCCGTTTCGCTCCATTGCAAGCCACTGATATGTCTAAAGCTCAAGGGTAAAAATGTCAACAA
ACAAAAATACTCAATGCGGGCTTCGGAAATTGGGTGGAAAATAATTTTTAAAAGAGGAATTTTCGCATATAGTCACTCAAAATTAGTCTAATTATGCTTT
ATAATTAGAGTTTGCTAATTACGATTTGTAACTACATGCTATAGAGAAAGTTGCGAGCGAGAGAGGACAGAGGACAGAGAGTCGGAGAGTGGTGAATTGT
ATATGTGTATAATTAGATAATTGTATATTATACATATGTGTTTGTATATTTTAGCGAGAGAGATTGGGAAAGGGAGGGAAGAGTTGCGAGCGAGAGAGGA
CAGAGGACAGAGAGTCGGAGAGTGATATATTGTATATGTATATCAATTAGATAATTGTATATTATACATATGTGTTTGTATATTCTAGCGAGAGAGATTG
GGAAAGGAAGGAGAGAGGCGAGCGAGATTGGAAGAAGGAGAATAATTTGTACAATTTGCAGGTACGTTTATGTAATTCATATATTTTTATAAAATTGAGT
AATATAAAGTCTGAAATTATACAAATATAGTAAAACTTGAAATAATGAATTGATACAAACATAAACATATGAACTTTAAACTGTTATACAAATTGCATTA
TACAAAATTCAAAAATCACACGTTTATACAAACTTTAAAAAGTTATACACAACAAAAATGAAGGTATATGATGAAAAAACTGTAAAACCAAAGGAAATCA
ACGTCGTATACAAATATAAACAATCGTATACAAATACAAATCAAAGAAAGAAAGTCAATCAACGTAATTTATGTATAATGTTAGTCGCAAGTGATAATTA
TAACAAACTATGTATGTGACGAGTAATTAACTAATATAAATTTGTTTAACCGCATAATTTTCTCTTTTAAAAATAATTAAAACGGAGTTAGCAACCTACT
GGCTTACTGGGTATGCATCGTTTGGTATAAATGATGAATTCTTGTCTAGTGTCCGATACTTATATTAAAGCGCGAGCCTAGAGCCTTTTAAACGTGTCTG
CCTTTCTTTGTACTCGTTCAACTTTTTTAAATAGTAACCACTCTCACCCGGGCCTTTGTCGTTGGAGCAAAAGCAATAGGCCCAGCTCCACCATGGGTTT
TATGTTTTGATGTGCCATTGCTTTTAGATTTGTAGGCTATATAGCTATCGAGCAGAGTAATTACGTTAATATAACAAAAAAATTAAATGAACATTTTATT
TTATTTATACATATGACTGAAAATTCACAATGCACCAAAAGAATAGGAGAATGGGGACAGAATAATTGTTCGTAAAAGCAAAATAAGAATAAAAAAGATG
ATTTCTTCGTTCTTAACTATAATTCTTATATTTAATTTTTTTAATATAAAAAGATTTTGTTGGTGAACATATTTATCTTAAAGTATGATTTTTTGTTAGT
ATACATCTAAATTAGATAAAAAAATTTATAAATATCGAATATCTAACGAAAACGATAAAAGTAAAATAAAAATGGATCAAGAGTGTGAGGGTGACAGGCC
AACAAAGTGCCTATCATTGCAAAGCATGTGATGGTGTGACCATCCCTTTTATGATCTTCATATTAGTAAGGTCTTTAAATAAAGGTAAGGAAGAAAGCTT
TTCGAACAATTTCGTTATGCAAGTGATGATAAATTTTTGAAGAGTGTGAGTAATATGTATTATTTAAAACTTATACATATAATTTTGACTAACTTCTCAA
AATTATTCTATGTGAATTTTTAAAGTAGTTCTATTCATGTTCTTTTTTCCTAAAATAATTTTTTTTAGAAAAATAAGACTATTTTGTATACATTTTTTAT
TACATCTTTAAAGTTTTCAACTAAAATTTCATTCTATATAATTAAAAAAAAAAAAAAAGTACATGAAATCACATGATTGTAGAATGCCATATATAGCCGT
TGTGTGAGTGTGACACATATAAAAGTTGTTCAATGAACCCCAAATGTCGAGGGACACCTTTTTCAACCATACATTAATATAATATTATATTTTATCATAA
AATTATCTCTATTTATAATGTACTTTAATATATTTAATTTAGGAGATACATTATTATTATAGGTTTTGAAACAAACCTAAATTCATCACGTTAGACAATT
AAAATAATTAAACAAGTGATATGGTTGTAGGACACACAAAAATCAATGGCTTTATTGATATAATGTTTATCAAAAATTATTTATTTAATAAAATTTGAGT
ACACATTATTTTCTTGTATTCGACGTATAAAATTACATTTGAAAGGTAAAAAGAAAGGTTTTGCATGAGGAATTGTGTCAGTAAAGAGTGTAATTGAAGT
ATTATTTCCTATCAATTTAAGAATATTCTTTATTTATTTTTTCTTTTTTTGTGATACACATACATTTCTCTTTTGAGAGGGTTAAATAATATACTTTGCA
TTTTGTATACTTATCCATTAGTTCTTATTTTTTTCATTATACTTTGCACATTATCCACTTATCCCAATTCCATTTCTCCAATCCATCTTGGGGCCCATAT
ACTAGCAAAAATAAAAATAAAATTCCTAGTAATTGTGAGCTAAAATTTAACAAAATCCTAAAATATTGTAGTTATGTCCTTTTGTGAAATATTCACAAAA
ATACTTGAGTTTCAAAATTTAAACTTTAAAGAAAATATTTAATTTTCATTTGGAGTAACTTCTCATTTTTTTCTTGTAAAGATTGAGAAATAATCCTTTG
ATATTTTGACGAAATATATATAATTTGTGCGAAAAGTAAAAATTTAACTAATTAGTTATGAGCTAAAAAGAAATAAAACTCATAAATATTACCGTCCATC
CTTTTTGAAATATTTATAAAAAATAATTTTAGTATTTAATCTTAAAAAATTATTAAGTTACGAATTTAATAGTATCATCATTTAAAATTTTATATTTTTT
ACTATAAATTTAAAAATATCACGCACTTTAATTTCTGAAGTAAAACTCATATTCAAATACGAATTTCATCTTAAGCATACCTCTCATTTTATAAAAACTA
AGAAAATATTGAAGAAATACAAACGATTTTTTTTTTTTAAATAACTTTTTACTAAAAACGTTTGTGTTTAGGAACTAAAATAAAAATGAAAATTCATTTT
AAATGCCCATCCGTATAATTTTAAACTCAATAAATGGTTTGAGAAAATCCAAAACGACACAATCTACCACCCCCGTAAATCTCTTTCACACACCTCTTCT
CGCCAACATCGCAACGGTTCGCCGGAGAACTGCGGTGGTGCCACCAACTTCTAAAAAACTGTTTACTTGCCCGCTTTGCTCTAACTAACGGCCAATTCGC
CGGATTTTCTAGTCAGTTCGCCGGTGTTTGCTTTGGATTGATCAGCAAAAGGTACTGATCGGTTTGTCACAGATGTTTGTGCTCTTGTTCTGTTTGTAAT
TTACTATTGAACTTAATTTATTTTTGATTTTATCAGTTTTTGGATCTTATATTTTGTCTTTTATGTTTTTAGATACTTCTGAAGATATACTATTTGTTTG
ACATTGTTTTAGTTTCAACTTTTTAGGGATTTTTTTTAGTCTTGCTATAAACAATGAGTGATAAAGCAGATGGGAAGAAAAAGATGAAATTGTTTTAGTG
TTTTGCTGCATTTTAAAGTCATTTGCAATTTTGATATTCATTTTTATACAACAAAATTGTGAGCTGAGTTTCTATGTAAACAACCACTTTTAAGGAAGGA
GTAAAGTTTGCATACATCCGATTTTCAACAGACTCCACTTGTGAGATTACACTGTGTGTGTTGTTGTTGTATCAACTCAAATTGTAAGTTAAATGGATAG
CTATATGAAGTAATCTATATCCATTTGGTTTCATTTGTACTCGGTTCCGTTTCAATCATCCTTAAATTAGTTCCCCTGATGCATTATCTCCCAAGTTGTG
TTGATTGTAGAGCTTGGTTTAATTAGTGTTATCTTTTTTGTGTCAGGAATTCAAGATGATTGGATCTTTTATCACCAGAGTGCTTGTGTAAATTTCGAAC
TACCCTTATACAAATTATATAGAGTAGTTAATCGTGGATTTTCTATTTCTTGAGTTTCTAAAGCTTTGATCTTTGGTGTTCTTCATGTAGGATGGTTTTT
GGTTATGCTTATCCAGCTTATGAATGCTTCAAAACTGTGGAGATGAACAAACCAGATATTCAGCAACTCCGCTTTTGGTGCCAATATTGGTATGTTGCTA
CATTTTGTTAGACCTCGATGTATCTTATTGTGGATCTCCGTTCTAACTACCTCATTCCTCCAATTTTCAGGATCTTAGTTGCTATGTTGACAGTTTGTGA
GAGGTTCGGTGATGCTTTTATTTCATGGTAATCATAACGAACTTGTTTGTTCAGATCGTATTTTTTGATTACTCCAACTTGTTATATTTTGAAATATTCA
TGTTGATGTTAACTTTCTCTTATTTGTGTGATACTTTTTCTTTTCAAGGGTTCCAATGTACAGTGAAGCTAAGCTGGCATTCGTCATTTACTTGTGGTGC
CCCAAAACTAAGGTATGCAAATATTGAAAAACAAATATTCTGTCTTTGATCGGCTTCAGTTTCATATTAATCTAATTAGTTCATCATCTTATCATAAAAT
TACTGCAGGGAACTACATACGTCTATGATGCCTTTTTTAAACCTGTGATATTAAGGCATGAACCTGAGATTGATAAAAGTTTGTTGGAGTTGAGGACCAG
AGCAGGAGATATGTTCTTTTTATACTGGCAGAAAGCTGCTAGCTATGGCCAGACGAGGGTTTTCGACATTTTGCAGTACATTGCTTCGCAGTCAAATCCA
CCTCCCCCCACTCAGGTTGTCGTTAAGATGTGTTTCAGAGTTTATATGCAAGCTCAATTATTTTCAGCATTTCAAACATGCTCTTTACTAAATGATAGTC
TTAGCTGTTTGAAATTTGAAGATCGTATTAATTTTAGAATTTGCATGCTTTTGAATCCATACAGCTGTGTTGCAATGCAACTCCACAAAGTCCTTCTCTA
ATTGTCCGTGCTGATTTGAAGGTTAAGGAGTGATTATTCATAAGAGTCTTAATATATAACACATGCTTGTGAAGCCTTGGGGTTTACTAGATAGGTTGAA
TCTTTTCAGACTTAGAAATGGGGAGGTTGGGGGTTCAGTGTAGGTGATAGCCAGACTACAGATAATGAACTGTTGCATTGCTGAGTGGATTTGTTTGTGT
TTGTCATTCTAAGTTGGATTCGCTATTTAACTTTCCGGCCGGGAAAGTTAATTTTAGCTGTACGTTGGAATATGGGGTTAGAATCTAAGGGGAAACTTTG
TTGCTGGGTGACCTGTGTATTTTTCATGAGGTGTATTGTTGACTGCATGACTTCCCCACCCAGAGTTATCTGTACAAAATTGCATACACATGTTTTATGT
GGCTTCAGTGTTTTTTTGGCTATAAGACAATCCACCATACATGTTTTTTTTACTCTCATAATTATAGACACGAATAATTCCCATTTCCGTTTTACTTTAT
CAAAAAGAGAAAATATCAATGACAATAATAACAATAGACAAGAACTAACCTAACTAATCAAGTACAAGAGTTCTCTGTGTTTAACATAATATTTTCAGTA
ATGTAGCCCCTATTGTAAATTTCTTACAACACTTGTTCTGAGATTAATACAATACTTTTAACAATTTAAAAAAAAAAAGAATCTTCGATGTTCAATTGGT
AGTCTAATGATTAGCTGTAAGATTGTGAGTGCTGAATTTGATCCCAGTTTTAAATATCAATTTGAGCTGTCTTTCAAAATTGCAGACACACAGGCAAAGC
AGTAGAGGTCGTCAACCCACAGCATCACTAAATCGCAGGTCATCTGCTTCAGCAACACAAGTACAGGCTGAAGAACAAGCACCCCGTGCTTCTTCTGAAT
CTTCAAGCGAGGATGAAGCAGATTCAGCAGAAGAGGCAGGATCCTCCAAAGGTCCTCCACCTGCTTCCACTGCCGCTGCAAATGCACAAAAAACAACTCC
CTCCAAATCACTGGTTTCAACTGTAGCTGCTTCTCTGAACACACAAAAAGCATCTCCCTCCAAATCCCTTGCTGAAATCACAAAACCTTCCACGTCTGTT
GAAACTCGAGTGGTGCAGATTGATTCTGTGCCTCCCTCAGCCACTGAAAGTGTTAACCCTCCTGCTGAGACAGCCTTGGAGGAAGCAGTCCGAGTAACAC
GCGCCAGATCAAGAAAGACAAGGACCTCAAACAACCCTTGATTTATGTCATCAAGTACTTAACCCCCCATGGTAATTTGAATATGTAGTTTATATACATC
GGAAAAAGGATTGGTTCTTCAATGTACATCTGGCATATCTTAGTTCATTCATTACTGTTGTCCATGATTTTTTAGCATGGCTCGAAAAGTATAAGGGTCG
TCGAGTGTGTAGGATTGCCAGATGCAATTACCATTCATTATTAAATATCCAAATTATAGTACTTACGTTTGTGTGAAGGTGGGAAAATGATCATGAATCT
ATGAAGTTAAGAGTTATCTTAGAGGATCACTGTACATACATATAAACATCTGGTTCTTGAGATGGCTTGGTTGATGTACTGAATGGTAATTGGAATGGGA
CTGGGCTTCTATAATTGTATCTCTTCTAATAAACTTTTGAATAATTTGATTTTGGGTTAATTGATTTGGATATTTCAAATTCTAGGTTTTGACTTTTGAG
CCTTTTTTAGTCCGGTCACTACAATTAATTACCTCAATATAATAGTTTGGTCCTTAACAACGATTGAGGCCGACCTATCGCCCGTGATTTTATATTGAAC
TTAATATGGTTTAAAGGATATTAATCTATTAAACTTTTGGAAATAATACTCATTGGACTTTTATGAATTTGACTTATTGGCACTTGAAACACAACTGAAA
CCGATCCAAATTACATAAATTGTAGAATCAAAATACAAAGTCCAATCCATAATCCAAACCAAAAATACAAAAGGTTTGAATTTCAATTTGACCCCAACTC
TGTCCACTCCTACTTGCTACTGCACAATAATTTTGCCTCACAACGCCTTTAAATTCCCAAATGCCAATAGGCAAAAGTTACTTGGAAGGGCATTTGACAT
AATATCCTTACATTCTAATCTCGTTTACTGAGAACAGAACAAATGTAAATTTAAACACACTATGAGCCATTCACAGTAACCATATAAAGGCTAGATATTT
AAGATTCACAAAATTGTCTAAATTTCACAGTTCACTTCAATATTACCCAGAATCATTCAATGTTTAACATAAGCTGCCGGCAAGCAACAATAATAGAACA
GCCAACAGAACTTTTCCAATGAAGTCATATCTAAGGCTAGTCCCAATTCCCAGCATTGGTTAATCATAAGACTGATATTCCTGTGAACCATATAGTTGTA
CGCAAAAGTTGTAGGAGTTTCCCTGAAACCAGTTGTTTCTTACTATAATCTGGCTAGAGATATGTAAAGCTTTTTAGCTTCAAAAGATATTTACATGTTT
ATAAGAAGCCTTATTTCTGTATATCTTCTGGTATCCATATATGGAGTTTGTAACCAGGCTCAATTTTAAAGATTATTCAATGCCCCACAGAGCAGTTGCG
CTAACCGCCTCCTCCGAGCGCAACCAGTAATCATCATCTATCTGCAGTTTAGGGGAAGAACATGTTGTGGATTATAATCAGTGTTTTCATATGAATTCAC
TACTATAGAATAACTATTGTTACAAGAATTGACGGCTTATTAATTGGATTACTTTGCCGGTTAATATTAAAAAAGGGATAGCCCATTGCTTCGAATTACT
TAGTCACTTCAAAACAACAAGGCTGATGGTGTTTAACCATACTGATTCACATGCATTTTAACTTATGCAATAGAGGAAGAGATACCAATAAATTCGAAAG
GGAAAGAGAGGGGTTCAGTCATATACTTACACTGTTATGAGAAGGTACTATTTTATGGACACCCGAGAGCTTTGAGTCTGTTGAATCTAAAGAGCAAGGA
TGTGCTGGGGATGGGTAAGCATCATCCATCTTTTTTGCAGCAGACACTGAATCCATGGACTTGTCATGTTTGATGGTTATGTCCTCATGCTGCCTACCCT
GTTTGCTGCATTTGTTGATAATTATGTTAGTTAATTGGGCCTTGAAGTTTCTTTCTTTATTTTTTTTGCTTGTACAGTAAAATATCACTTTCTTTTTAGG
GGAGACTACTACTACACAAAGAGAATTAGTGAACCAGCCAAGCTATACATACACCCATATGTTACAAAAGGAGAGAAGCTAGTCATGTAGTGGAGATACC
TCAAGAGAAACAAATCTATCGGCCCTGTTGTGCTTCTAAGAATAAGCTTATACTGCCTCTCCAAATCAACATCCTATTAACAAAAATAAGGGATCAGAGT
CTAGCATATTATATGTATTATCATATTGCCAAAGACCACGGTTACTCACCTCACATGGATCAGGAACTTCAATAGAACTAGCATATGGAGCTTTTATAGC
AATGAGAGTTTTATCCTGTGATATACGCCACAAACATTATAGAGAACTGAAACAGCATCATGAATAACATATGTAAGATGGGTGTTACATACCCTGAAAT
AAGGCAAGTTTCTGATATCTTCCTCAGTCAGAAAGAGGCTCCTGAAGAGTCGAACCAGATGATTTTAAGAAACTGATCACATTTTCAGAATAGAAAGAAT
TGCATCAGGAGAAAAAAAGGCATACTTCTGACAATTCATATCAGATTCCAGGTTCCTTATTTGCTCTAGTTTTTCCCTGTATTGAAAAACGTTTCACATT
CATAAAGTAAGAAAACTCAGAAACATGTCCCTCATTGATGACAAGTTGTTATCAAACCTTATGCAGCTATCAAGTCGGTGATCCTCTGCACTTAGATATC
CAATTTGTCCCTGTCATTTAATTGGAAAGCAAGGTTCAGTTAAGAATCAGAATGAGCGAAAATACAAAACACCTTCCTTATTACATTAAAAAAAATTATT
ACTAGTAGATAGGTGCAAGCAAATATTTCTACTTCAGTCGTGTCTTTTAAGAGATTCATTGAGGCATATTATTACCTTGTTTGCTTCATAGCTCTAACTC
AAGCTTCATAAATTACATGCTTTTGTTTATACAACAGCTATAAAATGAAGCAATTAGGGGTGGCAAAAATTTGTTTAAGAAAATATGAAAACTATTACAA
ACAAAATGCAAAATTTATATTTAAAAAAGAAAAACTAGCTATTTTTGAACAAAAATATATTAGAACTTTGAATTAAACTACTCAAATATTTGTCTTAACG
AATAAAGTTTTTGAAACAATATTCAATGCAATATTGCAAACACATGACTGACGATTTATTAGCTTGAATTAATTCTTACTACTGTGTGAAATCAAAGCAT
ATGGACTTTAAACAATAGTACACAGAAAACTAGAAAAACTTGATTTTAACCATTATTTTCTTAAGACATTCTTAGAAGAACTTTATAATCACCTTCAGTG
TAGATACTTGGTTATCCAGCCCTTGAGATTTTGTTGACTGGAACCCTCTGTTAAAGATAAATTTGGATCATCAACATGTAAGATTTAAAAAAAACAGAAC
CAAATCCACAAGTGTATTACTTCCAACGTATACGACTCTTTGTAGTTTTCTCAATTAATCCAATTCCCTCGAGTACATTTGTGATATCATAAATTCTCCT
CTTTGCCACCTGGGAAACAATTATTCAAATAAATTTAGCATCAAATATGAAACAAAAGAAGCTAAATAAAATAAAGAACACAGTATTCTTTTACTAATTT
TATACATTCATATTCATGAAACCTTAATAATAAGGTATAACTTCTACACACTACAATACAAGGGAAAAGCTAACCTCCAAAACCTCTGCAGAATGGTTCA
AATCAAGGGTTCCATCATCAGCCTCTTGAAGCAAACCAATAAATTTCTTAGTCAACAAGCCTGCCAAAAAATGATATATTTATTAATCAATATCTCAAAC
ATCCGCAAGAGCACAATCATCTTGTTCAGGTAAATTACATTTACTCGAAATAACGTACCTAAAGAGTTATCATATCGATAAGTGACACCTAAATTCAGGT
TATCAAGTAGATCTGTTTTAACAGAAAAAGAAAGAAATTGAATTATTAATAAATTTGAACTCCAAATCAATATATATATAGTAATATACCGACTCAATTT
TGTACCTGCATTTATTCCTTTGGTAGCTTCAATGGTATCTCTAGAAGACTTCCTTTTACTAGGTTGTTTAGTACGTGCACTAGGAGCTTGTTCAACGGGA
GAATAGTTGGATGCAAGACTTCTCTGACTAACTCCAGATCCACAATTGTATTCCTTGGACTTTTCAATTTCATTATTCTGCTTCAAGACATGAGAAAAAT
CCATTAGTATAAACATATATAGGTCATTGTATGATCTCCTAGGAGATAACGTTTATGAGCAGAATGTGTACAATCACCAGAAAAGTTCTAAGAAATTTTC
ATTCTACAAAATTAAACGACAATAACTTAGTATGAATGGTGAATTCAACTATTCAAATACACACAATTAATGGAGTACTTTATAAGATTGATGCCTAAAT
AACACAATAAAGGTAGTATCTCTATCGTTAGCAAGAGACCAGAAGAAACTTCCCCACTTCCGCCCAAAAACGTGATTTCAGTATTATTTTCTACTGTTTT
GCATATCGTTAACAGAAATCACGTATTTTACAATAGGAGAAAAAGCAATGATAATGTAATACTACTTACCGTGACAAAAACGAATGTGGAAGAGGCAATT
AAGTGTAAGCATAGGAAGATAAGTAAAGAAAGAAAGGAGAAGCCTTCTTCTCATCTTTCTAAGCTTGGATAACAGATTTACTCTAAATTTATGTTGATTG
AGACAATGGTTGAAGAGAAATGTACCACGTCAGTGAGGGATGAGATTCCCGGACTCTAAGGCTTGGACAATCTTCCATTCTTTGAGATTACTCATCGGAG
CAAATGAAATGTAGAATGGCAATTGAGTCCAAACATCAGGACATAAAGTTAAAAAAAGGGACAAAGACTTTCTCATACATCAAAACTTGGATTGACAGAG
TTACCACATATACGTGTTGAGCTAGCTTTTACGAAACCCGCAATTCAAAAATGGGATAAAAGGGATGAAAACACAATACTACTCAGTAGAGCAAAAAGGA
ATGTAGAATAGGCAAGTAAGTGTAAGCATTGGGAGAGAAAGTAGAAGTAAAAGGAGATAATTTTTTTCCTTATACATTTAAACCTGGATTGACAGAGTTA
CTACGTATTTGTGTTGATTGAGATAACAGATACACAACAAATAAACTGAGGTATGCACAATAGTACTAAATAATATGGAAATCATGTAATTTAGTCATAG
GAGAAAGCGATGAAAACACAATACCATTAACCGGAGAAAAAAGGAATACAGAAGAGGCAATTAAGTGTAAGCATTGAGAATTTGGGAGATAAGTTATAAA
AAGAAAAGGAGATCGGTGTAGGATGAGATCCCTGAACTCCTTATAAGGCTTGGGGAGTCCTCCCATAGAGCTTTTACAGAAATCACTTAATTTAAAAATA
GGATAAAGGCATGAAAACCCAATACTACTTACCGGAGCAAAAAAAATGTGTAGAAAAGGCAATTAAGTGTAAGCATAAGATAAGGAAGGAGAAGCCTTCT
CAACTTCCTCATCGAGATAACATATACACAAGAAATTAACTGAGATGTGCACAACAATACAAAATAGTATGGAAATCACGTAATAGGAGGAAGCGATGAA
AACACAATACTTTTAACTGGAGAAAAGGGAATGTATACGAGGCAATTAAATGCAAGCATTGGGAGATGAAGTTTTGTTTTACAAAAAGTAGAAAGCCTCA
ATGTACCCCATCGGGGAAGGATGAGATTCCTGAACTCCTTTTAGGGCTTGCGGAATCCTCCTCCCTTTGAGCTAACTTTTACGGAAATCATTTCATTTAA
AATAGGAGAAAAGAAAAGCTAAAAACGCAAAGAAGAAGAAGAAAGCCTCAGTGTACCACATCGGTAAAGGGTGAGATTTATGAAATCCTTACAAGGCTTG
AGGAATCCCTATCCCTTTAAGAAAAGGAATATAGAATCGATAACGCATGAGATTCTTGAACTCCTTATAAGGCTTGTGGAATCATTGTCCCTTTGAGAAA
AGGAAGGTAGAATAGGCAATTAATTTTAAGCATTGGGAGATAAAGTTTAAACAAAAGGAGAAAGCATCAGTGTACCACATCGATGATGAAAAATGAGATG
CCTGAACTCCTTATAAGGCTTGTTGAATCCTCGTGGCAATTAAATCCAAGCATTGGGATGAAGTTTAAGAAAAAAGAAGAAATCCTCAGTGTACCACATC
GATGAAAGATGAAAGATGAAATTCTTGAACTCCTTGTAAGGCTCGGGCCTCTCTTTGAGCTAACTTTTATGGAAATCACTTTATTTAAAAACAGGAGAAA
AGGTGAAAGGAAGGTAGAATAGGCAATCAAGTGCAAGCATGGAAGAGACAAAGTTTAACTTGGATTGAGTGACTGACAGAGTTACTATGTATCTATGTTC
ATCAAGATGAGGATGACGTTCTTGAACTCCTTATGAGGCTTGGGCGTCCTCTCTTCGAGCTAATTTTTATGTAAAATCAATTGATTTAAAAAATAGGAGA
AAAGGCAAAAGGAAGGTTGAATAGGCAATAAAGTGCAAGCATTGGGAGAGATACAGTTTAACTTGGATTGACAGAGTTACTAAGTATCTGTGTTGATCAA
GATCACAGATACACAACAAAGAAATAAAAGAATCAATTAAGATTGGATTCACTTAGCTACTCCGAATCTGTGCTGCTCGAGGTAACAGATGCACAAGAAC
TTAACTGATATGTACACAACGGTAAGGAAATCAGGTAAAAGCTTTTTTCTCATATATCTAAACTTGGATTGACAGTTAATCTGTGTCTGTGTTGATAGAA
ATACAGATACACAATACTACTCATCGGAGCAAAAAGAAATGTAGAACAGCAAGCATTGGCAGATAAAGTAAGAAAAATTAAAGCAGAAAACCTTTTTCCT
CATATATCTAAACTTGGATTGACAGAGTTAATCCGTAACTGCTTTGATCGAGATAACAGATACACAACAAATTAACTAATATAAGCACAAACGTACAGAA
ATCAGGTAAAAGCTTTTTTCTCAAATACATAAACTTGAATTCACAGAGTTAATCCGTATCGACATTGATCAATACTACTCATAGGAACAAAAAGGAATGT
AGAACAGCAAGCATTGGTAGATAAAGTAATAAAATTAAAGCAGAAAAGCCGTTTACTCATATATCTAAACTTAGATTGTCCGAATAACTCTGTATCTACA
CTGATCGATAAAGATAAACAATTCTCAATTATTTTTTTTTTAAAAAAAAAAAACTTAGATGCGGACAACAGTACAAAAACCGTACGGAAATCACGTAATT
TTAAAACAGCATCAATCCGCAATTCAACTCACCGGATTAAAACCAAATGTAGCAGATGCCTGAGGATTTCCGGTCAGAGATTCCGAGCAAAGATTGGAGA
GAATACGGGGATGGCTCCGGTAAGGTGTTACAGCAATGGCGGTAGGAGTAGGAGAAGGCGATGATCTTAGATGAAGTGGTGTTGCTAGTGATAAGTTGAG
ATCGACGTTTTCACCGGCGGTAGTAGACATAATTGAGGAAGCAAAAGATTATCAATGGCGGAAAAAAAGAAAAAAGAGGGCTTCAAAACAGCGGGAATGA
ATAGGTGGTAAACTGTGAGGAGGCGCTGAGTTTCGGATTCGAATAAACAAGGGCCCGCTTACGCGCCTACCTTTTATCAATATTTTCGGAAATTTATGTG
AGCCCAGGGCCCATATCTCTCTGTAAACCTCATATTAATTGGGTGAATATAACAATAATAAACGAAGCTAGATCTTAGGGATCTTACCAGTTTTAGCTTA
CACTATATTTTCTCCTCTTGTTAATTTTACTTGTAAATTACTATAGGTTAAAGTTATTTTTGACATTTTAGAGATCAAAGATAAGAATTTTACTTACTAG
GTTTACTGTTAGTTGTTACGTTTCATGTTATAAGAGTTAATTTGATTGGTTTTTGAAGCTGAACTGAATTAGATTAGATTAATATTTAGATATTTAAAAA
TTATACGAAAAATATTATAAGTTAAAATATTTTTTCATTAATATGATGCATGATCAAAATTCATATAATGTAACTCTTAAAAAATAAAAGGTGAAAAAAA
GAAAGTAATCAATTTCTGCACTTTAGTTTTTAAGATAATAAATGTGGAGAGAGATTAATCTGGTGAAAGGAGAGTATTAAATTGAGATCCAATAATAAAT
TTAGCGATTTAGCGAAATTACCTTTTTAGTTAGTGATATTTAAAAAGAAAGTGTGATAGGTAAAACATAATAAGTAAAATGAATTGGCGGGAGTATATAA
AAAGCGTAGAATGTAACTATAAGTGTAGTCAATGTTAATGGTATGATAATCGGTAATTATTTGGTATAAATATTTGTATTGAATTATAGTTATTATTTTT
TTGAATTATAATCTTTATTCGACTTTTTTTAAAATATAACAATTTATAAATATTCGCATTCAATTAAATTGTATCATTTAAATTGAAACGAAACCGTAAT
AAACTTGTCCACTCCTCCAAGGGTGTGACATGAGTCATGACAAGTGTGTTGATAAACCGACACTCCATGGATTTTTTTGAATTTCAAAAGTTTGTGTTTT
AAAATCTAGGCGGCACTCCGCACAATCTGCTCATCATGTCAACTTGCTACTCCAAATTCGTTTGTTTTAGCTGCATAAAAATAATAATTTTAAAATATTT
TATAGAGTTATTCTATTCTATATTTGATAATGAGTATTATTTAGTTTAGAAATTATTTTGTTCCATCTTTTTATATAAAAAAAATGATAAAATAAGTTAT
TTTATATATAAGGTGAATAAAATAATTTCATAAAATATCTCAAATCATGAAATATCTTTATCTATCCTATCCCGTGGAGGCCCAATCGAATGATGCATCC
CAAATAAGTCGTGTGCAAAATGTGTAAAGATTATTTACAATTTTTTATATTAGATTTCTTATGTCCTATAAAATTTTGAATTCGAGACCTGAATATGAAA
AAGTCGTTTGATAGATAGTAGTACCCAAATGGAGGCGGGGGGACATAAATAATAATGATTCATATAGCTAGCCTCAATATGTTTGGAGTTGAAGAATAAT
TGTTAATGTTGTATTACATATTTTATATTTCTTCAACAAAACAGACTTCAATTGCTTGATCCAAGAAAGACAACAATATAATTCTACAATTTACCACTTA
ATCTTCAAATACTTTATAAAGTAAGAGGAAAAAGACCCTTTAGTCTTTTGATTTAGAAGAATTGCTCATACAAAAGCAAGCATACATCAATCAATGAATA
AAAGTACAACATGAGTAACCTTGTTTCTGCCCCAGAAAAGAGACAAGATAATCCCTACATCTATTCTAACAGGGAATATTCTCGAAAGACGAAAATGGTA
TCGTCAAGCGACATGTACAACCAAGCAGAGTGAGATGCCAAAAAAATTTATCCTAGTTAGAGCTGGTAAGGGAGTCACTGCTCGATATTTTCGTGCCACT
TAGTATATAACCACCAAACGCGCTCATCTGCATATGTGGATGGGTTCTTGATGGGAGTACCTGCATGTTTTCAAGTATTTCAGGCACAATTAACAAGCTA
TAGCAAACATAGGCAGATCTAGAGGCAGGTTCAACTGAACACATTGTTTTTGGTTCGATCCACAAATAAACATGCAAGTTTTTGTGTGTGTATTAGACTC
AGTTTAAACCTATTGACTTTAGATCCTAAATTCTGATCACAAGTACAGAAAAAGAAGTTGTCAGTAAAAAAAAAAAAAGTGTACACATGTCAAACTACTT
CAAGTGGAGCTATAGTTAAATTTCTATTATCTGCTTGACAGAATCTCCCTGGAGAATGCAAATAAATATAAAGTTAAGTAATCATGTAAGTGGTCAGATC
CCCTTTTCGGGGTCGTTTCGGTTTAGTTAAAACAAACCTGATATTCACGTAGCCAAGGTTCAGAAATTTGTAATCCAATCGCCATTTTCTCAATCTGCAG
GTTGTGCATACACGTAGCTAGGGGCTGCAATGAAAACAAAGGATTAGTTTTGTCTTATTTTTCCAACAGAAAGGGAAGGTGATGTGACAAAGAGTGCGCT
CCAATTATTGACACAACAGCCCGCCCACCTACCCATCCACACCAGTTTATGGGAGAAAGCAGAGTCTTTTAACAAAAATCTAGCCAAAATATAAGCAGTG
ACGTGATCCTGTTGCAGGATCTCCTCTCAAATGCTTGCATCTCTCAAATGGAAAATGAGAATGACCTTCTGAAAATCTATTTTAGTTCTTCGACTTATTT
ACTCAGCTTTGGACATTAAAGAGCAGAAAAAAGGATATTGATTTGCTACCACATGCTCACTACAGGATGCCTAAATCCAATAACATAAGGTTTTACTATT
AAAAAATGTTTATCTAAACTTCATCCTTAGAAAATTTTTCTAGACATATAAAGAATGCAGAAGTTGGGCTATTGCATAAGTGAATAAGAAAGGGCTGTGT
GTGTGAACAATGAATGAGCAGCCTGGCAGGCTAAGAAACATTAAATAAGATTGGCAAGCTAAGAACAATACCTGAGCATACTGGTGATAAACAGCAAAAG
GAGCTGAAAATGATAAAAGAGGAAGCACTTCTTTAATAATGCCCCATGGGTCCAGTTCCGGAGCAGCAATTATTAGGCTGAAATATTATATTGGAAATGA
GATAGAAGGAGAAACATTATGTGTCAAAGAAAAGAATAAAACCCAGATTAAATTCAAACCTGGAAAAACCGTTTTCTTTCCACGACTTGATGGCCTCGAG
GGTTGCTTTCTGACCTGCTTTTATAGATTTAACAGGCTTGATTATTGGAGAAGAAACTCTCTCAGGTGTTACATCCATGCCACCATCTTCAGCTGGCACA
CTAACTTCGTCTAGACCACCAGAATGAGTGACAGGTAAGGTTTCTTCCTGCAGGAACATGTTTTAGAGAGAAGTTTAAAAGTCATCCACGCACGCATTTA
CAGAAGAAACAATTTACACCAAAAAAGGATCAACTTTTGACATTACAACATGGTTTTACCTGACCCTCAGACACTGAAGCTCCAGTTTGAAATGAATTCA
GGTCGGTCAGTGATGCATGCACGATTCTAGATACATACACAAACAGCAAAGTTTATAGTTAGTACGAATGCAGTAAAACATATTTAGAGTTTAGACAAAA
GCTATCCACTGAAATATACAATTTTTTTCTCTGTGCACTAATTGGGTAATTTTTCTATTTCATTGCAAAAGGAAGTGTACCTTTTACAGATTTCATCGCT
TAAATTAAACATCCTTGTGATATCGACAGGATATGGTGATGATCCACGATAAGTATTGCACACATAACCAGTACCTGCTAATATCATTGTCATGAAAATA
TTAAAAAGTCATTAACTTAAATAGCAATTAACACTCTTTAACAATACTATAAGTCTATAACATGTTCGACATGGTTTCACAACTATAAGCATCAGCGCCG
TTCACATCATGATGACAAACATACGATCAGTATCAGTAGCAATAATCCACAGACATGATACAATTTCCCATTAGTATAGGCTGCATGATCAAATTTTATG
TGTATAAAGCAATGGTCACAATTCACAAATATCCCTTGATTTCCTTAATGTAACTACAGTTAAGAACAAATACATACCTCCAAGTCGTTCTGCAATAGCA
CCAGTAAGAATACCACTGAGCATGTCCACTACAAGTACATCTGCATTTGCAGTAACATTCCCCAAGGAGAGCAGTAGAGATAGTGCATCCACTCGCATGA
ATCTGATGGAATCAAGAGGATATAAAATCAACCCCCATGTAAACCCAGAATCATGCAAAGCAAAATGAATAAGATATGAAACTTTGGGTTATTAGACTAC
AGTGAGCATCTGAACCACAAAGAAAAATAACATCAAGGAGGATATATCAGATTTCAAGATTTTCTGATGCTAAAATAAGTTATCAATGTCTATCCTTCTT
TCCCTCCCATCAAAAAGACAAATCATAACCAGAAACAACAGATGAAGATATTTGATCAAACACAAGAAAAGACCATATTATTACCCGATTTTTTCAGGAT
GTTTCTTGAAGTAGGCCTCACAAATGCTGAAAAATGCAAGAGGTATGTTAGAAATTAAAGAAAAGATTGAGGAAGATAACGACTATGGGATTTGCAACTA
GAAACCAAATGTAGTATTACGACTATCTACATCTGACATCACCACTAATAGCTTGGGGATTTCAAGTTCAGAAATTAAATGCAGAACAATCAATTATATG
ATTTGAAGAACAATAGTGCTTAGAAGAAATTAATGAAAAACTACCATTATATGTTTTACTTATCACCTGAATTAAAAAAAGAAAATCATAAAAAGTGAAA
CACAATCCACAAGCCCTAAAATGCTTTACTAATCAAAAAGCAATACGAGGACATACTCATCCACAGAAAAACTGAGTGTTCCACATGAATGAAGTGGTAT
AATCTAGTTACAACAAATAGACAGTTACTGGATCATTGCTCAAATAAGAAATACTGCCTTCTTCCACCTGGGGCGAACGTGCAACATTTTGCAGCATATG
AAAGTAACTTGTTTAATTTTGATTACATTACCAATCTTAGAGTTTTATTTACTAAGCTATATCAAAGAAATGCAGTGAAAACATTATCCAATCTCGTTCT
ACCTTCCCCTTCTCCAAAGATTAAGTTATAAATGAAGGAAAAATCAGGAAGTAGTACGTCTATCTCCAGAATAACTAAAGGAGATTTAAAGACAGGAGTG
TACCTTCGTGCAAAGGGGCGCCTCAAAAGTACTCGAGGTGCATATTTCTTCTGTTTCTTAACCCTATACTTATCCTGCAAACAATGAGAGGTCAGCATAT
TTTCTCAAAGAAAAACTAATCAACACCAAAAATGCCAAGCTCACTTGTGAAAATAATGTCTTCTTCTCAAAAGTTGCACTGTTTGCAATGAGTGCTTCAA
CTATTTCATCCCCTTTTGCTCCCTGCCTGCAACATAGTCAGATTAATACTTCTCTTCAAAACTGCTAAATGAAAACCTAAGAATCTTGCAGCCTTTTCTT
TTGCTTGAGAGAACTCTTTTGTAAACAAAATTTGTTCAAACATATCAGAAGAAATATAATATAGATCTATAGAAATTCTGGATTCAGAAGCCTCCAATTT
TTCTGTTAATATATCAATGAAATTTGCCAAAACAGAGTGAAACAGCGGCAGATGATGCATACCACCATCCCAGACTAGTTTGCAGTTCTCAAACCTAGAG
GTCGTCTAATTAACTGAAAGTACACATTATCAATATCCACTAAAATAGTATCTTGAAACTGCCTTCGAAAGACTCTTATGCAAGGTTTTCCCACAATTCT
TGAAACTGCCCACTAAAATAAATAAACAATACCACATAAAACCATGAACCTCAGACAAACTCACTTTCGCATCTCGTCAATATCTTCACTAGTGAGACTC
TGAGCAGTATTATTATCAACAAGCGCACGGTTGTCTTTAGATCCATCCACGTCTTTTTCTTCAAGGCCGTTACCTGATAATGAAAATGCACAAAAGTTAC
TATAAATTCCACAATTTGTTAAAAAGAGACTAGAACAATAAGAGAAAGTAACACGAGATGTATAAGGGTAGATTGTCTACATCACACTCTGCAGGTGCGG
CCCTTCCCCAAACCCAGTGTGACACTCGGGATGCTTTGTGCACCGGGATACCCTTTGAACATGAGATGCATAAGCATATTTAGTTTGGTCTATCTTTGCA
TACTAGCTTGGTCAAAGAATTATATACTACCTCTACATCCTAGTCTTCTGTCCCGCTTCAACTGGTTCTTAAGCAAGAAATACACTGTAGTGGATAAACC
AAGCTAAAAAGAAGACTAGTTCTGGTTTTACTAAAAATGTTTGAATGCGTCATGGAAAACGAGAGCTCATTCTTTGGCTCTATCCAAAAACAAGGTATTT
GCAATGTGGCAGGAAGGTCCACAAATGCAACCCCTAAAAGCCATTTGCACAGGCAAAAATATCATCAACTGAAGTCTAAGTACCCCATGTAATCTTCCTT
GTTATAAAGTTAAAGAGTTATGTTAATCATGCTTGCTCCCTCCAAGTCTAAAAGAGTCTATGATGATTATCCATACAAAGCAATGCATTTTTCTGAGAAA
ACCTTGCATTAGAATCTTTCAGATAGATATTATAAGTATATACCATTAAACATAATAGGCTGATTAGCCCTATTATCTGTAATGCTATATAATTACATTA
CACATAAAATTGTCAGACTGTCACGTGAACTCAAGGGCTCTGAGATGTGAAAAAGAACACTTTCAGAAATGAGGGTAAGGATGTGTATGATACATCGTGA
TCGGCACATAGGAAGAGCTTAGTGTATCTGGCTGCCTTTTTTAGTAATTGACTACTTCAAAAACTAAGTACTCCCAGTAAATGACTACCGCCCCAAGTTG
AATAAACTTAGTAATAATAACTAATTGAAGAACAGAGAAAACAGTACTCATAGAAGATGAAAAGGCTAAATCAGAAGAATACCTTCTGCATTCTCAACAA
AACGAGTCAAAAAGGTTCCTTCTTTTCCCGGCTCCACTTGAAACAGAGACCCGAATGGACAACCTATAAGAGGCTGAAGAGAACACTTCTTATTCCCAAT
TTTCAATGTCCTGCATGCACAACACAACTTCTCCATCAGTTCAAAAATCCATAATCCAGAACAAAAAACTGCATCTTTATGCACTAAAATCAATCAACTA
TATCTCAATTACAAAACTAAATGCAGCAGACAGAAGCAAAAAAAAATCGGATGTAATTACTTACGAGGCAGCAGTAAGACGAGAAAAAACTAAACGGTCG
CCATCATTGATGTCAAGCAATACATTGCAACCTTCATAAGTTAATCTACTATTATGATTTTGCTTCGAATCCTCATCAACTGCTTCTTCAATAGACATTT
TTGCTGCTAAAAATTCAATCTTTAAGCATTAGATGAAGCAGTAGAGAAGGAAGTTACACTATAAGCTTCAGTTCTCTGTTAGTTTAAACCCTAGAACCCT
AAACGATGGGTAATTTACAAAACAGGAACTGTTATTTAAACAAATAAATATTTAGGCACTAAAATGGTAGATTTTTGGGGATTTAAAATTGGGATAATTC
ATAAAAGGGGAAATTTCAATTTGCCCCCTAAACTTTAGGTATTTGGTAAAACATCCTCAAATTTTTTTTATAGTAGCAGTATTACCCCCTGATTTATGAA
GGTTGACTTCCAATAGACATCAAGCCCAATGTAAGTCAATACTATCATATATTAAGGGTCAACTCAATTTATGTTAGATCTAGACTTATTTCAATCCAAC
TTGTATCTAATAATTTTTTATCAAGTAAAATATTAGTATATGCTAAATGAGAATTCATTTATTTATTATTCACTCAAATTATTGAATTCGATTATTTTTA
ACATATTAACATGTTGAAATATCATAAAATGACAATTTTTCATAATGTATATGCATATATGAGATCACAAAATATCATATATTTGTCTGAGAAATTTATG
ATGATAAAACTTATTTTTATTATATATATATATATATTTGTTATAGGAGTTAAGGGTATTTTTTTGAAATATACATGCACATATAAGCAAATGAATATGA
AAACTACATGTTTATAATGATATTAAATCTGTTGATACTTGCAAAAGAATTGGTATTGAATCTATTATTATTATTATTATTATTATTATTATTATTATCG
CTATATGCAATTTAAAATTCTTTTTTTTTTTAAAAAAAATGTTGTTTATACATTGTGTGCTTGAGTGAATTAATTAAGAATTGTATTTTGTGTGGATGAT
ATGAGAAGTGGAAATGGTGAACATGTCCGCATATTTTGGGACGACAAGGGAACACCTTCTGCAATATCTTCTCTTAGTGAATGGTTGGCCAAATCAGCAT
CTGACTTCTAACCACTCCATTAAGATTCTTTCATTTTTTAATAATTAACTTGATCACGAAAACGATAATACATAAAAAAATATTACCCGTAGGAGAGTCT
TGAAGCAACAATAAAGTTGCATCAGTATAACTTCGTTGGGGTGTATACCATAACAAAAATAACTTTTAGCGGCATTAAATATTGACATTCAGAAAGAGTG
CTAAAGTCTAAACCCGATATAAGTCGAGTGTCATTAGAACCAATATCGTTAAAGCCTTTAGGAACATATATAAAGAGTGATAATTGCTGTTAAGAATACA
TATTAAGAATTAATTATGATTATTTTTGTTATAGTGATAGTACGTCCCTCCCTGAACGATGCAACCCATGGTTTTGAGTCATAGAATATCAGTTATTGAT
GTTTGCGTCAGGATAATCATAACCATTCGTCGAACCAATTTTTTACATCTGAAAAAAAAAAGATAGTAATGATAAATTATTTAATTAGGGAACAAGTATT
TAGCTTAGTATTTTTTTTTCCTTTTATAGGTTTTGTGTTTATCTGCTGGCTATCCACTTAAACTACAAGTTGTCTAGATCTATAGGCAAAGCATGTTCCA
ATTTCACATGTTGCTAAGTGCCTTAAACTCTATAATGGCTAGAAAGATTGGAAAACATTGTGGAAATATAATAGGGATGTCTTTTGGGAATTTGTACTGA
AAAGATAGAGGCACTTTGTTGAATTTGAGGAACCTAAATGGATAATATATACATATAATAATAATAAGAAGTCAGTCACCCTGTTAGTGTTTACTAGTTT
TCTTTGCAAAATATGTGTGGTTTCTTTTGTCATTTTTCATTTTTCATTTTGCTAATTATTGGAATCTTCAAACCCACCATGTGTTATGAGGAACAAATTG
ACTAGTCATTCCAAACTAAGGAGAAAGTGCGTACATATAAACATTCAGAAGCTTCCAAACTTTTGAGAGTGATCCCATATAAGATACACCCCCTCTGTCA
CGTACGACGGGTGTATCTCACGAGAATTGTCATGTACGATTCACATGTTAACTTGATTTTATTAAACACATTCAAAGTTAGATTGCATGGATGTAAATTG
AGATCAAGTTAAAGTATTGTTTATATATTATGTATTGTCAAATAAATAATGTTGATATTAAAATTCGTCTGTCAAAAAAAAATCAAATTTGATGATTTTT
TTTTAAGTTATGTAATTACAAAATGTACACATAGATTTCCAAGCTATTATTGCATGCGAGGAAGTGCGTAGATATAAACAATCAGAAACTTCCAAAAGTT
TGAGAGTGATCTCATAAGATGTATAAATTGGTGAAAGTTATTAATGTGAAAAATTGGAAAATTGTTCTTTCTTGAAGTCTCTTCTTTTACACTCAAAGTC
ATTGATTCTTGATTTTCTTTTCTATGAAAAAAAGAAGAAGCTAAAATTATGCATTTTTTTCAAGTATTATTAATGTGAAAAATTGGGAAATGACTTAATA
AGTGTTTTAAAGTGATTTTTGTTACAGAAATAGAAAAATGTGGAAAGAAATATAAAATTGAAGGTGCCTTTAGTGTGTGTATATACTATTTGTGTTAAAT
TTAATGCAATTTTCTTTAAAATGAAATAACTTAAACCGGTAGTCAACATTTTTAAAGTTGAATATTTACATTTATGTCACTTCTAGTGTAGACTCCACCA
TGTTTGATCAACTATCAATTTACTCGGTCTTGCCAAAGTCAAATCTAATGAAATTAATGGTTGAGATTAGAAGGGAAAAATCAATTTGATTTAAGTATAG
ATTAATCAAGGTATACATTAAGACAAAAAAAAAAAAAAAAAGCAAACAAATCTACTTATACCATCAAAAAAATATGGTGAGATGAATGAGATTCCTTTAT
TTTTAATCATCAATTTCGAATTACAGCAGAGCAGTAAGTATTTCTTCATTCTTTATCAAAAGTCTCAGGTTCAAGTCTCTTTAATATGAAATCGTCTTTG
TTAAAAAGCACTCTACCTCCAATCTGAAACCTCCCAACGCAAATTCAGATTTAATCAACCTTCAATTTAAGTATTAGATACTGAATAAGAAAAAAATATC
TCCCGTTCGCATTCTCCCTTTTTTACGTGATGCTTCCTTAATCAAAAGTCTCAGTTTTTGAATATGAAAAAGGCTCCGGTAGAAAATACATCCCTATTGA
ATGAGCCTTACACAATATAATGTGATAGAATTAAATTGTTATACCTTGACCAAAAAGTCTCTTAAAAGATATTTGTGATAAAAAATATATATAAAATACA
AATTTAAATTAGTTGAACTTTAATATGAATATGAATACGTTACGCATCGGAGAGTAACTAGAAAAAGACAAATACATCAGGATTATTTTATGCTAAGAAG
CAGCAAACAGAATATTAAATAAATACAGTAGAAGGAGTAGATAATAAAAGAGACCCAACTATTTTTTTTTTTTAATTTTATTTCCCCTTCTTGGATCCCT
CTCCATTAATAAAAAGAAATAAACTACACACTCTTTTACATTAATATAGAAAAGTTAGAACAAACTTCTCTCTCTCTTTTTCTCTTATGAAAAAGAGAAC
TTCTTCAACAATTGCTCTGTTTTTTTCCCATTTTCTTGCTCTGTTTTTAATGGCACTGTTAACATTTTTACCAGAAACATCAGAAAAAAATCAACCTTCA
AAGAGGAGGAAAAAACAACAAAAACAGAATAAGGAGAAACAAAAGCAGCCATCTTCATGGGATCAATTCAAAAACTTATTGACTTGTAAACAAATTGAAA
ACTCAACTGTTCATGATCCTGCTTCCAAAAACCCTCCTCCTTCTGCTGCTGCTGCTGCTCCTGCTGGAGCTTACTCTAAGTTGAGTTCTTGTAGCTCCAT
ATGCAGTTTCAGGTATTAATTACTTAATTAAATCATATTTCCGTAACGTGCGAGTCTGATTCTCTTTTTTTCATAAATCAAATATATAGATTTTTCTCCC
CCACAAGTCTTTCGTACCATGTTGAACTGCGTAAACATCTCATAACAAAAAATCAAAGTCAAAATAGTCATTTTACGATCTTATAATTAAAATATACTCG
TTTTTTAGGATTCATACATGCATTATTATATGCACTTCTTTTTTTTAACTATATGACTTTACTTATGTTTTCTTTTCGTTTCGATATTTATTATAAATAA
AATTTATTTTTTAAAAATAAAAAAGCAAAATCTCTAAATTTATTAATAGTGTCTTAAAATTTTGATTATAAATTGTATTGACTAGGAAGTGATTAGTAGT
GTATTTCATCCAAATTTAAATTATTAGAGAAATTATTGATATAATTTTAATTATTTAATTATATTATGTCTCGATATCATTAGGGATGTGGTACATGGCA
ACACAAGAGTGGTACATAGAGCTGATAATTCCCCAGAAAGTAGCAGTTTAGGCCAAGAAACTCGTCTTCTAAGCAAGAATAAAACTTCACATCATGATCC
TTCATCTTCAAGTTCGAGATCTCTTGCTAGATCAAACGGTAATGGTAGCTCCACATACACTACTTCATCAAGAGGAATGCAATTTCGTAAGCTATCTGGA
TGTTATGAGTGTCACATGATAGTAGATCCTAGCAGGTATAATTTTAATTTCATTTTTCTAATACATTTTATTTGTGATTAATAATCTTGATATATAGCAT
TAATGAGTGAAAATATTAATTTTAATTTTTTTTATAGGTACCCTTTACCAAGGTCAACAATTTGTGCATGTCCAGATTGTGGAGAAGTTTTTCCAAAAAT
TGAGAGCTTAGAACATCATCAAGCAGTTAAACATGCTGGTAAATATTTATATTCGAAAAATCTCAAATACTATCTTAAAAATAAGTATAAATAATTTTCT
ATAAAACTTGTATAATTAGTATCCTGAAAAGCATATGCTTTAAGTAGTTAAATAGATACAGTATCAAAATGACGTATATTATTCGTGTCTATAAGTTAAA
TCCTTATATATATTATATTTTCTTTCCTACTTATATTCATATTCCTTTTGTTTAGATTAGGGAGGAGTAGGGGTGGAGTTTATGTGGAAAATCTCTTTTT
GGAAAAGTGATATAAAGCTAGTCCACACAAAATAATATATAATCGATAAGATATATAATATAATATATAAACATTATATATGTATAATAACAAGTAAATT
TAGATATTTTCTATTGAGCAGTCAAATGTGTAACTTTTTATTTTTAAAATACTCAATTTGCTCGTATTTATCCTAGAAAAGATGATTCCAATCTTGTAAA
AGGAGACAAGCTTTAGACAACATTTAAGCTTTGAATTGTTTTAGGCAAAGTTCAAAATTGTGTTAGTGGAGGCAAAACGGAATTGTTAATACAATTTTTA
TAAAATAATAATATAAAGTACGTTAATTAAATATATTTTTGTGATACATAGGTTGAGCCCCCAATAAATATTTTGCCTTTTTTTTTGGACCACTTAAATA
TTTAAAGGACCATCTAGAGTAATATTTGCCAACTACCTCTTCATAAAATTGAAAAGTACTATATACATGTAGGAAAATTTTAATTGACAGATAATTAATT
TCTCTTTTTATTATCATATACCACACCGACAACATGCATGACACCCTAATTTACAATACTAAATTAATTAATTAAAATATTTTTAGTTTAATAATGTTGA
AGATTATTTTATTTTGATTAATTAAGAATGCATACCTAAGAAAGAATCGAATCTTTAATACTGAGATATTACTTGTCTTTGAATTACATACATTTGGTAG
CCCACTCTACTTAATAATTAATGTTTTCTTATCTTGTTTAGCTATTTGAGTTCTAATTATTTATCATAAAACTAATTCTGGAATAGCTTATTCCTAAATT
ATTTCATAATTAGTTAATAACATTAATGTGTTGGTTGGCCAGTAAGACTTGATATCTTACCAACCAGAAATGAGACCCCATTTATTTTCTTTTGTTTTTT
TTTTCATATATTTTTTTTATCGAATATTAAAAAATATATATATATTATATGTTTGCGGGTTAATTTTAATTTAAGCCGATTGATTTTCAGTGTCAGAGTT
GGGTCCGGAAGATTCAAGCCGTAACATAGTGGAAATAATCTTCAAATCAAGCTGGCTTAAAAAGGATAATCCGATCTGTAAGATCGAACGGATATTAAAA
GTCCACAACACCAAACGCACGATCCAACGGTTCGAGGACTGTAGGGACGCGGTGAAGATACATGCAGTGGCCACAGGCAAGAAAAACCCAAGATGTGCAG
CTGATGGAAATGAGCTGCTTAGATTTTACTGCACGAGCCTTACGTGCGTCCTTGGTGCACGTGGCTCGTCCAGCTTGTGTGGCTCGGTACCCGGTTGTGG
AGTTTGCACTACCATACGTCACGGTTTCCAAGGAAACAAAACTAGTGGAGTCCGCACAACTGCTAGTAGTGGGCGGGCCCACGATTGTCTTGGTAGCGGT
ATGGCCCGACGCAGGGCCATGATCGTGTGTCGGGTCATTGCTGGTAGAGTCAAGCAGAATGTGGGCGCTTCTCCCACGAAAGAGGAGGAGAATTGCTCTG
GCTCTGGTTCTGGTTCTGGTTCTGGCTTGTCTGCTACTGGCTCTACCATATACAATTCAGTAGCTGGACATGTAGGGATTTACTCAAATCTCGAGGAATT
ATACGTATTTAATCCAAGGGCTATACTTCCATGCTTTGTTGTGATATACGAAGCATTGGAATCTTAGGCTTAATGTTTTTTTTTTTTTAATTTGTACTTG
AGCTGTTTGTACGGTTTAGTTTGTTTTTTTCTTTTTTGTTGTGTCCTTAAATTTATGTAACTAATTTCAAGTTAGTTAAAAAAAAGTTGTAACACCCGTG
AGGTAATGCTGATCCAACTATGATTTTTGTAAATATTTATTTATTTTATTTATTTGTCCTTTTTACATAGTGTTAGTTTGTTGAAGGTGAGTAAATACAG
TGATGTTTGAAGTTTATCTACCCAACTGTACCATAATAAATATCTTAAAATATAGCCCCTCAATTAATGCTTTAAAAAAATGCCGTCCTTCAACATTTAA
CTTGTCATTTTCTATGTCAATATAGGTTATCCCACTAAATTCTTTCGCTCTTTCATGATTTAAGTTATAAATACTGATAATATAAAAATATTTATGTCTT
TATATCAATTTTGTTATTATGAAGATTTATATATCTATAGTACATGATAATGTAGGGAACTTGATCTCTTTTAATTGAATATTTACCTTTGTTGTTCTAA
AGCTGCAAGAAATAAAGGTAAAGAAACTATAGATAGAAGTAGGGTAAAGGAAGCATTATAGTACTCAAAAGGATAGCTTTGAACTGTGGATGATTTTTTC
AGAGTTGGGGCCAGAAATGAGTCAAAAAAGAGTAACAATATGATGATGGTAATTTTATTGATTGGAATTTGATAATTAATTACAGTTCCTAATGTTACCA
CAGTCAAGGAAAAAAGGTTGATTCCTTAATTACGGTCTCATATTAATCGGTCATTTTATTAAAAATTATTGTCATATATTATCATCGCAATCAATGGTTT
AAAATGCGGGAACGTGAGGCGGCGCATTTTATACACAATAGGGCGAAGCTTATGCTCCGAGATATGGGGCGTAAGTCTCACGGATCTATGGAGCGTAGTT
TTATGTATATTCCATCTCATAGTTTTATTACTAGTAAAATAAGCAGAGGTAAATCTTTTAATGATTTATGATTTTTATTTGAGATGAGTGTTAATAATTA
ATAATGAAGAAAAGATATTATAATTATTACGTAAAAAATATCATTACACCAACAGTAAAAATATGATTTACTGAAAAAAAGTTTTTTAAAAAAAATTAAA
ATTTCCTGGCATAGGTTTTTACGCCCAGAACTTACATTTTTATGCTCGGAACCTATGCCTCAAATTTTAAGACGTACCCCACCTCGAGACTCCCCCAAAT
ACATTTTTTAAAACACTAATTGCAATTAATTCTTGCAGAATCTACTTCTTCGAGGCTATATAACAAAAGTTATAGCGAAATACTAACACCTTCTTTATTT
TTAACTAAAATTTTAAACTTGAATTCAAATATAATTGAATTTTAATATAAATATCAAAAATTAGATTAAAAAAATTAACATAAAATTTTATTTTTTATAA
ATTTTCATCATAATCTCAAAAAAATGCTCATGTAATTCGTAATTTCGTGATATGACCAAAATTAAAGGAAAAAAGTAGTTGAAGTAACCGCATGAATCAA
TCCATCACATAAATGTATTCCTTTCTTTTTTTTTCTTGTTATTAATGGATGAGCTGGAAGGGCACGTGGGGTCAATATTGGGACCACTGCAAAATTAATT
AAACTTTATATTATACTGTTTACAATAGAAAAAATATGATAACACTTTGACTGCAGTGATGAACTAAAAATATACTCACATTGTCAAATCAATTTTCCCC
GTAACATTATTGCATACACATTCTAGTTTTCTTTTATTTGACTATATATCATTTAGTAGAAAATCAAAATAGGAGTTTTTGAGTAATACAATATGAACTT
AATATCGAGTAAATTAATGATTGTTATTAAATCTAATTCATATTAATAACGCGTGGGAAACTCAATAATGAGTTTTAAGTTATTATATACCGAATGTGTA
AAAACACATCGGTATACTCGTGCAATTAAGCTCTTATTTTAGTAAAGTTCAAAAAAAATTTGCTTTTATTTGTATATATTTATAAGTATTTGAGAGTAGT
GGTTCTTGATTTCCACCCCCTCGTTGTAATACATAATTAATTATGAATGAAGATCACTGAATATCTTGCATTTACTTGTTTTAAATGATGGGTATTAAAA
GGAAAAAGATTAGAATTTGTTTTTTTTTTATCTATGTTATTTTATTTTTTAAAATATGTTTATTATTTTAAAACTTTAAAATAGAAGAAAGAACAGTTTA
TTTAAAATTTAAAAAAATATTATAAATTATTTAAATTTGTAATCAAATTTTCTGACTATTTAGCAGTATTAAATTGTGCGGTTTGAAATGGAAACTTAGT
ACATCTCCCTCCTTGTATTTTGATTTTTGAAAACTGAGATTCGCATTAATGCATTGTAGTACATGTACACGTACTCACCAGTCTGCCAATATGTTCTTTA
TTGTTTAAATATTACTCATACTTAATATATTAACTGAGCTGGCACTCATAGAGTTATTACTTATGTGATGTAAAAAATATTCAATGATGTACTTCGTTCA
GACAAAACTAAATTGTAAATGAATCTTGTATCGTGTAGGATGAGTCATATCGAATTCTTGTAAGGTTAAGACAATTTTTTTTTAATTGACTTTTAAGATG
TGATTTAGGCTCAAAGCTTAATTTAACATGATATCAAAACTATATTCAATTTGATTGTGGGGTGGAATACCTCCGGTCCATGAATGTGCATGCACTGGGG
CGGATAGTAGAATCCCAGATAAATAATGTTTGGATCTAGGCGTGACTCGTGAGGGGTAATGAATAGAATCAATAATACATTGTTGAGGGAAGAAAACCTT
AGCTCCTTGTAAGAATATAAGGACTTGAACAATTCTCTTAGGTGAGTTACGCTCAAAACCTAATTTGACATGTAAATTAACAATATATGATTTGAATGAG
TGAGACTATGCAAATCTTACACCGACTTTTGTGAGATAGAAATGTTAGACCTTTGGCTCAATTAAGTTAAAGATGAGTATTTACATGAAATATGTGTGGC
AATCTAAAGAAAATCTTAATTTCTCATCATTAAGCAAAGTAGGAGGAAGAGACAAGTTTTATCAGAAATTGGTGATCGTAAATTAAATACTTTTATAAGG
CTATGTACTATAACTTAAATAAGACACTTAAAATGGGCTACGTGGTGCAAATCATGTGGTTAATCATTTTTTGGGCCAGAGCCCAATCTTGATTGGGCTC
TGGTTGGTTGCAGGTTCCTGTCCATGGGTTTGGTTTGAGCTTCCTACCACATTGACTTTGGGCCTTTGGCCTTCTTTTTCCAGTCCTTTTACTAAAATTC
TCACTTTTTATATGTATATATATTAGGATAAACAAAATTATTTTCATATATCTGAATCTTGATAGATAAAGTTATTCAATATTATTCAATATTTATAAAG
GTGGATATAATTATATCTTCAATAAATAGAGTTGGTCCATACTACTGTTGGTGGGAGACAACAGATACGCCTGATCGAATAGTTGATGTATGAACTTTGA
GTTGGTGAAGATCAATAAATGCTTGACATAAAAATAGTAGATAATTTCTTTTATATGCCTAAATCTCAATAGACGATAAAGTTATTTGATATTTATAATG
GTGACTAGAATATTATCAAACCTTGATAAACAGAGTAATTAATTGATATGGAGATAACAAATGCCTCAATATACAAGATAGTCCAAATACAATTATATCT
TTTTAATTGAAATTATCCAACATCCAATTGTAAAACTAAAATTAATCAAGATGATAATAAGTCTTTTTTTAAATACAACAAATAATTTTTAACGTATAAT
ATAAGCTCAAGCACATGCAGTACTCATTTGAGAGTGATTCTTAGAGAATATTATCTTAGGAAAAAAGGCAAGTTATTATTGATCATACTCATTAATGTCG
TACTTTTATAACTTCTTTGCTTTTAATTAAAAACTAAGCCAGTCAATCATGTCTTAGTGAACTTGTTGTCTATTACTAATTTAATCATTTAAATATAAAT
GTGATTAGCAAGTCATCATAATATAATTTAGTTTTTTCATCTCATAAATTGCAAGTAAATAACCACTTTATAAGCTTTGTCGTTACCCATAATGCAAAAC
TTCACTTTTTTTTTTATTGAATGATATTTTATTACTTTTAAATCGATCTATGCATTATAAAAATATTTAGAATGTATACACATATATAACCATACTCATT
TTGAACGTCTTAGTAACTTTAAATTATGAATTTACCTATGTCGAACAAACATGCATATATGACATAAGAGAATCTCCCACCTGAATCATTCTTAAGATCA
CCAAGCTCTCTCGTATGAAACTAGACTATAACATAGAGTTTGACTGAAATCAAGAATTTCGATCTAAACTCTAAATTGTCTTAAGAAGTTCATTTTAGTT
ATATTTACAAAGTAATACTCCCTCCGTCCACAGTTAATTGTTTTGGTTTTCTTTTTTAGAGTCAACTAAAAGAACTTTGACTTACATTTTACGATGTATA
TTTTCATCATATTGATATACAAAAAATTGCAGTTTATAGTATTTTTCATATAGTTTATGAATATCTTTTTTTTAAAAAAAAGTATCGAATTAACTTTATT
GACTTTCGAAAAGTACAATGACAAATAAAAGTGAATAGAGAAAATAATTTATTTAGAACTTAATAACTTAAAAGAATCAAATTTCTCGAATTATAAATTT
CAAATGCCTACTTGAAGTACGGTACCTGTATTTACAATCTTTACTTCTCTATTATATTGTTCAATACGTTCACGGATAATATTACTAATTTCGTCAGCTC
GAATGGTTACCATGATTCTTAATTTGGATTCGATAACTTTGAGTTTGTCCATAATTATCCATAAGAGTTAGTTTTGAAAGGATAGAACCAATGATATTAA
TTATTACCATGCTAACATGATTATTTGAATGAGGACTTTTGATTTTTGAGAGTGAGTTAATATAATATCATAGTACAAGACATGATTATTACTTGGAAGT
TAATATAATTAACAATCTAAATAAACAAATGTACTTTGAAAAGACAACAAAAGCCCATATATATGATTTGGTCACATGGTTAAAGAATTAAACCATCATC
TTTTTCCAAATTTCATAAATATATATAAACCTTATTATAGCCAAAACTTATAACAAAAATACAAAGGCTTTTTGTGTTCTAACAACAATAATGTACACTA
ACAAAACTTCTATTCAAAGAGAAAGCTTTGTTATTCAAGTTTCAGAAAATTTTCAATCTTCATCTCAAGTTATTAGCCCTTCTTCTAATAAATTAATCAA
TTTCTCCGCTATGAAGCTTTTCGATCGCTTTCGCAAGATCGTCATGCGATTCGTTTTCCCTATCCCAACGTCTAGCCGGAGGAGGCCGAGTCGGGCTGGG
GCAACGATGTCGGCAACCGGGCCGGGCTCAGGACAGAGACGGAGATCCTGTGACCGGCCCGATCCGCCGAAGACCTCATGTAGCTCTTATTATTCATCAA
CTTCTCATTATAATGAAGCTATTGCTGATTGTATAGAGTTTTTTAATAAGTCATCACAAGATCAAGGTATTTTTAGTGGTAGAAAATCAGACGTTATTGT
GTGATTTTTATGTTTTTTTGGGGCTAAAGTAATTAATTCAGTGCAACCATGCTTGTAGCTTGTGTTGTTTATTTTATTTTATTTTTGAATTTTATGAGTT
CAAATTTGATGTTGTAAATTTAAACATAGTTGTATATGTGGAATAGCTGATTTTGATTTTCTTAATCTATTCAATTATAGAGACCCCATAACAAAATATG
ACTAGTAAAACCCAAAATTAACATCTTAAGAAAATCGAGTTCAAATCGATCTAAAAATTCTCGATGTTCAACTAACTTGAAAAGAAATTTACTATAAAAA
GAAAAAACGTTATCTTTGAATGGATATTTTAGTGAGAATAATTTGTTTTTATTTTTTTCTTACAAAATTTAGTTATTCTCTAGCTATTCTTGAATTTTTT
GTAAAACTCATTAGAGATTTTTTTAAATATTATTACAAGAAGCAAAAGGAATTACATATCATAATTTATAGTATATCTCTTATTGAAAATTGTAAACAAA
GAAATCAAATATGCATATTAACCAACCTTACTTTTCACACTTTGATTTCAAGCAAAAAACCATTGGAAAATTCAAACGGAACGCAAGCCTTGAGATGTCT
TTTTATTCGATTTAAACTCGAGCAGATTGAATGTTATTATCCGAATTACTACCTCTTTTCCTAGAAAAAATTCCCCCAATCAATGGTATGATTAGGGATA
TTTTTTTCTTTTTCTTCTTGTTGATTGAAGGATGGTTTTGTAATAATACAACATGATCATGATCATCACCTTGTGAAGGATTTGCAAATGTGACATATCT
TTTTTTGTGAAACTCAATATTATTTTGATCATGTGACATAATTTGTGATTTCTCTATATATTTTAGGTCTTCAATTTCTGATACCATGACTTTTTGTTGC
TCAAATTTTAGGTTATTAAGCTCATTTCTTGTGCGTTCAAGTTCTTCTTCTAAAGAAGAGAGACATGTAGCCATTACCAATCTTTCTTCTCTTGCCCTTT
CTAGTCTTTGCTTTGTCTCAATTAACTCATCATTAAACGAGTCGTCGCTTTCGTCTTCATGACTCGATCCATCCTGTTTCTGAATAAATAAATAATTAAG
TTAGAGTTATATATACTGACAGTGTAAATAATATTTATCATATCGAGTAAATCATGTAGGCAACTTAGAACTCAAAAAATGAATTTCTTCATTGTATAAT
TAAAGATTAGAGTCATTGATCTAGTTTATATATAAACAGTTCAATTTATATATGTTTGAAATTAAAAGATACTTTGGTTAGTTGGTTAATCCTCTTTTTC
ACTATAATATTGTCAGTCTTTATTCTCCAACATGAAAAAAAATATACTTGTATTACAGATTAAGCAAGCGTTTTTTTTCTTCTTCTTATACTGCTTGATG
TTGCATTTTAGAGATTATAGCACTAATGAGATTTAGCGGCAATTAATCAGTAATTACCGTTAAATATGTATTTTTAGCGGCAATTAACACTCTTTGTATA
TGTTTCTAAAGGCTTTAGCGACATTGAATCTAACGACACTTAACTAATACCGGTAAATAATTAATCACTTTTTATTAATGTGTCTATTTATTACCGATAA
AAGTTGTTTTTGTTGTAGTACAGTAGGTTCAAGCCATGTGAAAATAGCCTTTTGCAAAAGTAGTTGCATACAATATACCTTTATGGTGGGGTTCTTTTCT
GGACTCATAAATAGCAGAAGTTTAGTGCTAACGGTTGTGTTTTCCTCACACAAATAGAGATAATGTATGCGTACATCCTAAAATGAATACTTTTTGAACA
CTAGAACCTTTAATGAGCAACGTGTCCATTTTGGTCGGTAACGTCCAAAAGGTGTCTGTTTTGGAGCCGAACTCGTGATACCTAAACCCCACTGGATAGA
TTAATATTTTATGCGTTATATAGCAAATATACACTATTATATCCCTAAGAGACAACTACATATAATTGTCACTGAATTGAAAAATAATAATAGAAATTAC
GTGCTACAAATATATTAAAAGAACACTCATATAATGTAAAAATTTGGTATACTATCGGTGTATATAATATGAAGTGGAGAATAAATGGTGTATATTACCT
GTTTAAGCTTATTAGCAGAGTAGAGTTCTCCAGCAAGAACTCTTTCTCCGAACAACATGACTGCCTCCTTAACCGAACGAAATGGAGCACTCGTATCGAT
CTCCGCCTTTCCCATCATTGTGGTCACTCCTTCTGATTCTTCCATATCGTTTATTGTCAGTTTCAACACTATTATCGATCGAATGTATGTTTGTAGGAGT
GTGTTTGATGAATGAGAGACTATAAAAGAGCTTAAAAAGTGGAAACAAAAGAAGATGAGTAAGTGGAGCTTCGTTTCTTCAAGTCCACTTCACTAGAATT
ATTCTGCCTTGTAACTTGTACCTCTTTCTTTTTAGTAAAAAATATACAGAATTGATTCAACTAGAAGCTCAAGGCAAATTGGGCTGGATTGTGTGGGTTT
TTTGGTTTATTTAGTGGGCCTACTTTGATTTTGATATAAAAATGAGTAATGACAAACATAAAAATCATATTTGCATAATGTGTTCCATAGCTAATATAAG
TATGTATATTTCACTATACATATACAACAAAACAGTTGTATAAGTCGTCATACATATACAAAAGAAAACAGTTGTATACAAAAGATTAATTGTATAATTT
ATGTACGTATAAAATGAGAAATAGTGAAACACAAAAGAAAATTGCGCAGGTAGGACGAAGATATATGTATTCGCATGTGTATATACAATTTTCTCTCGCT
TTCTACAAACAGAAACACAATTTATACATTTCGTTTATGTTTGTATAAGCAAGCAACGTGAGGGTGGTGAGCGAGATCTGGTAGAAAGGAACGGAAACAT
ATGTATACATATAATTTTCTCTCGCTTTATACAAATACAAACCCATTTTATATATTTGTATTTGTATTAAAAACAAGAGAGACGAGCGAGAGAGGGGCGA
GAGTTTGAGAGAGATAGACGACTGACAAATAATTTGCTACATGACACAAAAATCAAAATACAATTATAACAGTTAATTTAAATTATTAGTTTGTCATTAT
ATACTATTTTTTCATAAAAATAAGTGATACAGATCTAAATAGACTATGATATGTAATAGATTTTGTTGTAGAATAATTATTTTCGATCGCATGAACATTT
TCAATAATTCTTTTTATCAAGTATTAAAACTGTTTTTTTATCCACAATAAAATAAATAGTAAGGAGTGGGGCAAACATACATTTGAAACTCCGACAGAAA
AACCAAAAACCAAAAAAAAAAGGTGAAAAATTCCAAGCAGCCAGCTACTTTTCTTGTCAACATCGTCTTGTCCGCCACAATCCGGAGAGAAACTAGTATT
ATTTGTCACTCTAGTCATTTTTAGTATGTTCTTTAAAAAATATGTATATTATTTTATATAATATTCTTTCTGTTTAAAAAAAAGATTTTTAAAATCTGTT
TTAAAATGAATGATTTTTTTTTTTAATTTTAACTTCGCATATGACATGTTTAATGTCACAAGATTAAAGGATAATTTTGTAAATTTGATATAACATTAAT
ATAGGATCACAAGATTGAACCGTCTTCTTTATTTTCTTAAACTTTATGTCAAACCAAATTAGATCACTTTTTTTCAAACGAAGGGAGTATTTGAAATTTT
TACTCTTAAGTTTAAACTTCTCTTTTTATTAGTATTATACATATTAATATAATAATTAATATATTATCATATGTCTAGAATAGATTTAAGTTGTAAGTGT
AGTTATAATACATGTCAAAAGTCTCATTTCCTTCCTTTTATTTCGTGTGTTTTGGTTTAACATAAGAACATAAATTTTGAGAAAAGTGACTCACTATTAA
TTAAAATATTAAAATCTTTGATCATACTAAAAAATTTAAATATGTGAAAAGATAAATTAATAATAAACAAAATTTTGAAGAAATAAGAATATTATTCAAT
AAGTTCAAAGGCAATAATGACATATTTATCGGATAATCTTTTATGAATATTTTATAAATATTTTAGATGTATCTTTATAAAAAATAACGTTATATATACA
TAAAGTAATCTTTTGAGAGTTTAATTTAAAATCGAATTAACTCGTAAAGTTTTAATTAGACTTAAACGCATGTCGTGAAGTCCTACGGAACTTCATTGTC
CTGCACTAAATTTAGTCAAGCAGAAAAGCTGTAATGCTCTCTGCTACGGTTTAGTTTCAGCACTATGAAAGTAACGAACAGTTTTATAGTTAGCCAAATT
CTTATATTCTTTCATTAAATCCTCACATCATTATTTTATTGAAATTCAACTGTTTTTCATCATTATTTTATTTGAAATTCAACTGTTCAAACAAACTTTT
TTTTTTTTTCAAGTGTTAAAAGTTGAGATCTTCAAACACTCTGTTTCAACGTCACCATTTATTGTCTCTCTTTTTTTCTCCGTCACACAATTGAATTGAT
CTCACTGTTACCTAAAATGTCGGTCACCGTTAGCTCGCCGGCCGTCCGATCCTTCCATGTTTCACGATCACCTCATAAAACGATCTCTAGGCCACGTGTC
ATTATATCTGCCGTCCGATCTACTGACAGCTTAGGAGTAGCACCAATTTTGACGAAGTTGCAGAAAGATTGTGCTACTCCTCTTCCAGTTTTGCGCCACG
TGGCGGATGCAATGGCCGATGATATGAGGGCCGGGCTTGCCGTCGACGGCGGCAGTGATCTGAAGATGATCCTTAGTTATGTCGACACTCTACCAACTGG
GTAAACTACTAATTTTATTTTATTTTGGTTCAGTTGTGATATTAATTGGTTGGCCAGCTAATTGGGTAAAGATCCCATTATTTTTACTTTAAGCTATAGT
TGGTGTACTTCAATTCTTCAAATGTTTAATTTGATGAACATAATCACAAGGAGTTACATGGTTTAAAGACTTGTCTTTTTCGCCATGTAATGTGTTTGTC
ATCTCATCTAAAAGCTGAAAGTTGAATAATTGTTATGTTTGAACACGCGGCTACATGTGAGCTTGATTTTTTTCATGGGACGAACACATTGAAATATTTT
TTACTTGCGATGATGTTTGAATCAATAATCTCTGGTTGATTTGATACCATATTGATGTGTGTGACTATCTTGTCTAAAAGTTTGAGCATGTTATAGTGTC
TTGATTATATATTACTCCCTTCGCTTCATTTATGTGTCTCTAATATTTCCAAGTATGATTTCGATTTGTTCACTTGTTTGATTGTTGAGCTTGTTCTTAT
AGTATTTGTTACAATATATTAATGATTAATGAAGGAATGAGAAAGGCTTGTGTTTGATTGTTGAGCTTGTTCTTATAGTATTTGTTACAATATATTAATG
ATTAATGAAGGAATGAGAAAGGCTTGTTTTATGCGTTGGACCTTGGTGGTACAAATTTCCGGGTGCTAAGGGTGCAGCTAGGTGGTAAAGAAGAGCGTGT
AGTCGCCACTGAGTTTGAGCAAGTCTCTATACCCCAAGAACTGATGTTTGCTACCTCCGAGGTTGTTTAGTTTTTCTTGTTGTAATGGGATTTGACCAAT
ACTATCTTTTTTGTTGTTGTATTCATCTTTGCATCGGTTATTGTAGGAGCTTTTCGATTTCATAGCTTCTGCGCTAGGAAAATTTGCACAAAAGGAAGGT
GGTAATTTTGAGTTGCAACAGGGACGGACAAGGGAAATAGGATTCACGTTTTCTTTTCCGGTGAAACAGACTTCAATAAGAACTGGAATCCTAATCAAAT
GGACAAAAGGTTTTGCTGTCTCTGGAACTGTTAGTATTTCTTGACTCTCTTATTTGTGTAAAGGAGTGGCAGATTTTAGACATCTTACTAATTTAGCCTA
TGACTGATTCTGGAACCATACATCGCTAAGAAGGCCAATCAATTCTGCGTTATTTTAGTTTCAGTAAAGATGGCCAATTTCCCTCGAACTACTAAAACTT
CCAACGAACGTTACGGTTTTACCTTTTTCTGAAGAAAGCACCGGAATCATCTAGTTGGTAAAATCCTGTAATTCCATCCCCAATCGATTGTGCATGTGAG
ATTTTCTGTTTTCTGGACAACCGAGTGTTTCATATTCGTGAGTCCATTTTTTTCAAGATACAACAAATTTGTAAGAGTACTGGTTACACTATGATAACTG
ATTAGTAAGTTGTGTAATTAGAGGGATCATTTCATCGCTTTGTTCTTACAAGTCGAATCGGAAAATACTGGATTCCAAACTAGTAGAGAAGATCGAGTTC
CTTAACATTGACTTTTAACTTTGTCTCTCTTATCATTATCATTTTCATTTTACCTGCCGATTATTTTTTGATTCCATCATAACATGGAACAGGCGGGAAA
AGATGTTGTTGCTTGTCTGAATGAAGCCATGGAGAGGCGGGGAATGGATATGCAAGTGTCTGCCCTGGTAGGTTCTTGCTCAACTTCATGTGTATTGTAG
AAATGTTGGAGAATAGTCTGGCGCTTCCTTAGTTCAATCATTTCATGATTTCATTGTCAAGTTAGGTCAATGACACTGTGGGAACACTTGCCGGAGCAAG
ATACTGGGATGATGATGCCATGGTTGCTGTCATTCTTGGGACTGGAACCAATGCTTGCTATGTAGAACGTGTGGATGCTATTCCTAAGCTGGCAAAAAGG
ATGTCTAAGTCTCCAATAACGGTAAGTAGAGCCCAAATCTCCTTCGTCAAGTTATTTCATGAACAGATTTTAGCAACCATTGAGTTTGATACATCATTAT
ATTTTAGATTGTGAATACCGAATGGGGAGCTTTCTCAAATGGCCTTCCTTTAACTGAGTTTGATAGAGAAATGGATGCCGAGAGCATTAACCCTGGTGAG
CAGGCAAGTATTATTGACTCAAAATGTGAAAATTTCTTTTCTTCGTATTATTGGTATCACACTGTTTCTTAATGGTCTTTTCTACCATCTTATTTCTTGA
TGAAGATTTTTGAAAAGACCATCTCTGGTATGTACCTTGGGGAAATTGTGAGACGGGTGCTGGTCAAAATGGCCAAGGTTGGGGGCTTATTTGGTAGCAG
CTATGTTCCGGAAAAGCTAGTCACTCCATTTGTGCTGAGGTAATTACATCTGTTATATCAGAAGTTTATGATGCAAATGTTCTCGGTTTGTATTAATTAG
TTTTTACTCACTCTGTCTGATCTGCATCATATAGGACACCTGATATATGTGCCATGCAGCAGGATACATCAATAGATCTTGAAGCTGTTGAGTCTGTCCT
CTATGATGTAGCTGGGGTATATTCCTTAACTCTCGTGTTTTAACTTGCACTGCAATACTCTTTCCAGTCACTTATCTTCTAGGCCAATTTTTTTTCCGAT
TGAATACTTGTTGTCCAATAATCGATTCATGAAGAACCTTACATTTGAAGATCTATATTCATTCCAAAGACAACATTCAAAAGGATAGTTTAGCATCTGT
TTCCATAAACATAGAACATTTTCCAGAGTTATGTTTATAGATATGAAAACACACAATAACAACTACTATTACGCCTCAATCCCAAGCAAGTTTAGGTCAG
CAAAAAAATTTAGTCTCTCTAGCACTAGAAGTTCTTTGCAAAAAATATTTTCGTAGAGTATGAAAGAAGTCTACGAACGTTTTGATGTTCACGATTTTTC
TTTGGATTATTAAATTTCAGGTAAAATCCGATCTAAGTGCAAGGAAAACAGTCGTGGACATTTGCGATACTATTGCAAAACGAGGGGGTCGTCTAGCTGG
TGCAGGAATTGTTGGTATATTACAGAAAATGGAGGAAGATTCTAAAGGTCTCATCTTTGGTAAAAGAACAGTTGTAGCAATGGATGGAGGCTTATATGAG
CACTATCCTCAGTACAGAGGATACCTCCAAGAAGCTGTCACAGAGCTACTAGGCTCGGAAATTTCGAAAAATGTAGTGATAGAACATTCAAAAGATGGAT
CTGGTATTGGAGCTGCATTATTAGCTGCTGCAAATTCAAAGTATGAACATGATGATTAAGGGAAAAGCTAAATTTCATGTGTTCAAAGGTTTGCTTGAGG
AAAAATACATGAGCATTTGTAATTTAGAATGTTCTAAAGAAGGATTGATGATTGGATTTATAGAGGCTCTTGTTTGTGATGCCATTTTTTGTACTCCCAT
TAATGAAGTACGAAGAAGTGAGGATTTATATAGCCAACCCCAATTTATTTGGAATCGAGGCGTAGTTGTAATTGTATTATATGCAGCACTGACTTATTTA
TGTGATAAAAAGCACATGTATCAGTAAATATAGAACATCTTGTTTGTTTTGTAATTGTGAAATAAGCACAAATAAAACGCTTTGGACAAAGCGTTTTATG
CTATATTTATCATAAGGGCCTTTTTTTTATACTTACTTACACATGTCCCTACTGTATTGTCTCTAAGTGTCACGTGCAATTCTATTTCTTGCGGGTTATA
TTTTTTATTTTTATTACAAATAGTTATTTTGCACTAATTTTTTTATAAATAAAATGTTTTTTCGTTTTATTTTAGTGACAAGTATCGCAATTGTTTTATA
AATATTTTTCATTATAATTTATTTGATACAGTTGAAATTTTAAGACTTAATCAAGTATTTTTATTGGTATATTTTTATGCATTTTTAATACTTTAATTTG
TTGCTTATTATGTTTTGATAATAATTTTTATGTTATTTTTAAATATATAAATTATATTTAATGATTTATGATAAAATTATATATCCAACTTTTTTGGAAA
AAAATAATTAAAACTGGGGGTGGGGGTGGGGAACAGGGGATTATATTGGGGCATGAATAACAATAAAGCTATGCGGAGTGAGGATTGGACAGGTTGAGCG
TAACCATCAAAAAATTTAATCTGACCCATGAAACAACAAGTAGTAATAAAATTGAAAAATACGAGGAAAACCAAATAATTCATGGTTACGTATTAGTAGT
TTTTTATCCTAATTATCGACATTATTTTATCTAGAATCATGTCCTCGATAAATTGTATGCATATAATATCAACCTACTTATACCTTTAAGAAAAAAGAGA
AACATTCACATATAGCCACTAAAAATAGCTTAATTACTTTCCATAGTTATAGTTTGATAATTACAATTCATAGCTACATGTTATAGGGAGGAGTGAGGCG
AGAGAGATTGGGAGAGAGAGGGCAACAAGTGGGAGAGAGGTGAATTGTATATGTATATCGGTTAGATAATTGTATATTATACATATGTCTTTGTATATAT
GACAAGTGAGATTGGGAGAGGGAGGAGAGAGGTGAGCGAGATTGGGAGAGTGAGTAGAGATGCGAGTAAGAGAGGGGAGACAATGGGAGATAGGTGAATT
GTACATGTATATTAGTTAGATAATTGCATATTATACATATGCACTTGTATATATGACAAGCGAGATTGGGAGAGGGAGGAGAGAGGTGAGCGAGATTGGG
AGAGTGAGTAGAGATGCGAGTAAGAGAGGGCAGACAATGGGAGATAGGTGAATTGTACATGTATATCAGTTAGATAATTGCATATTATACATATGCACTT
GTATATATGACAAGCGAGATCAAGAGAGAGAGGAGAGAGGTGAGCGAGATTGGGAAAGGGAGGAGAGAGGTGAGCGAGAGAGTAGGAGATAGGTGAATTG
TATATGTATATTGATTAGATAATTGTATATTATACATATGTATTTATATATTCTGACGAATTATATGTATACAAATGTGGCTAATTATACAAACTCGATG
TAGCCCACGTAATTAATGTATGATGTTAGTCGTGAGTGATAATTATAACAAACTATAGCTATAATGAGTAATTAAATAGTATAAATTTGTTTAACGCGTA
ATTTTCTCATAAAAACACCTATCATATGAGAGTTGAGCATGCGAAGGAGAAGAAACACATATTACAAAGAAAAAGGTGTGGTCAATCGCGTTTTACGCTT
TATTTATAACAAGGACATTTTTTATATTTACTTACACATGTCCCTACTGCAGTGCCTCTAAGTGAAACGTGCATTCTATTTTGCAGACTATATTTTTTAT
TTTTATTACAAATAGTTATCTTGCATGATTTTTTATAAATGAAATATTTTCACGTTTTATTTTAGTAACAAATATTTCAATTGTTTTATACATATTTTTC
ATTTTAATTTATTTGATATAGTTAAATTCAAGATTTAATCAAGTTTTTCTATTGGTACTTTTAATAATTTAATACGTTAATTATTATGTTTTTTTGTAAT
AATTTTTTATGTAATTTTCAAATATATAAATTAAATTTAAAAAATATAAAAACTTATGTATTCAACTTTTAAAAAAAATAAAAATGAAAATTGAGGGTGG
GAAAAGAGTTGAGTTTAACCTTCAAAAAAAATTAATTCGCCCCGTGTAATAATTGTTTTCATTTTGAACCCGTCTTCGCCCCGCATAGGTCCACTTCACA
CAATTTTTTTTTTTTAATTTTGCCTTTTTAGTTAAGTTTGATATTAAAAATTAAATTATTTTTTATTAAGTTATATAAACTTAATAGATAATGATTAGAT
TTTATTTCTTAGAGATCAAATTTAGACGTATGTAAGAAATTATTTTAGTTTTGATCGAACCATTTTTATTTGTTATCTTGAATATTTTAGTAACTTTAAA
GAAATTAATATAATAGATAATGCTCTTTCACTCATATAATATTTAAAAAGTTAAAATTATGTTTGAAACCGCATAGATTTTTAACTGTATTCCGCATTAG
TTTTTAAAAATTCACTTTAATGTGCTCTGTATCTCTCCTCGGCCCGCACAATTTTAAATTCACCCTGTCGTGCTTGTTGTAGCCTTAAACCCGGTTCGCA
CCTCCCCCCTCCCCCCAATTGTCATCCCTATACCGAGGAATCAAACTCTCACAGTAAAAAGTTTAAGAGTTACTTTTTCTGTTTAAGGGCATTTTCAGCC
CTAGACTCTATTTTACTCTCCAATTATAGAATTTTTCTTTTTCAGAGAATCAACTCCAATTCAATTCTCTATTGTACTTTTTAAAAAAGAATTTTTTTTT
CTCTCCTTAATATTATATTATATTATTTTTATTTTTATTTCATTTTCTTATTTCATAATATAAATTCGTTTTTGAAAAAATAATCACCTTCTATAATTTT
CATGTAATATCAAATTATTATTTTTAATTTTTTTTATCTAATATAAAATTATAGTTTATTACAAATTTCAAAGAACAATTACGAAAAATTAAAAAAAGAA
ATCAACAACCACAAGCACAATCGCAATTACAAACACAACAATGCTCCAGATCATACACTATCTTTTTTCCGAATATTGTTAAATCTGAAAACGACCTACT
AAATTACTATTGTGATTTTAAAAATCATTATGTTAAGTATTGTATTATTATCTCGTACTTAAAAATTATTATGTGATATATTGTATTTTTAAATTAAATT
TTTTCATTTTAAAAATTATTAGGGACTATTTTGTCATTTCTTTAAAACAAAGGTGAAAATTCTTCTCTGGCACCTCAGTTGTGACCCTGAGGGCTTTTTG
CTGGTTTTTACAAATTAAAGAATCAAAGAGATTTTTTCAATTGTTTCTACAGCTGTTTTGCCTGCAGATCTTCTGAACAAAATGGTAACTTTTTTCTCTT
CTCTTTGATCTCACTGAAAATTATTTGGTAGCAGAAATTACAATCATTTTGTTTTCAATTTCATGAATTTGCTGTTCTGATTGATTTTTGATCGTTTGTT
TTCAACTGGGTCATCTCGAAAAATGGGTAGATCCGTTTTATATTGCTTCAGAACAGGCAAGGAAAGACTCGTTTGGCTAAGTATTATATACCTCTTGAGG
AATCCGAGAAGCACAAGGTGGAATATGAGGTATTTTAGTTTTTTTTTTTATGTGAATTTGGTGATTTTAGATTATGGGTTTTGATTATATAGTCAATTTT
GGTCCTTGTAGGTTCATAGGTTGGTTGTGAATAGAGATCCCAAATTCACCAACTTTGTTGAGGTAATCAAGCCTGATTTTTTTTTTTTAAATTTCAGTTG
ATGGAAGCTAGCATTTCTCTGATTAAGCCCTTTTATGTATGTGGAGTTGAGTTTAACTTGATCAGCTTGAAATGCAAAAAGCGAAAATGTGATTATCTGT
CTTGTTTTCGATCTATAGAACACCATACTAAGCGAATTTGCTACAATTGTGCTAAGGCAAAGGGTTCTCTTTCGCTAGCCTTTAATTTTCTAAAAGTAGT
AATGTTTAACTATCTTATACTGTGAGAGGATGATGTCCTCTTGGTGGAGAACTATTTTGCTTTCCCTCTACGCTACGCCTGCACATTATCATGACATTTC
ACATTATTGGTGAAGTAATATCAAGATGGTTTATCGTATTTATCTACCATTGCATCATAAATACTTGTTCCGTTGGTATCAAAGGAATAACTTTGTGAAA
TGATTGAAGGATAGGGAGTGGTGGGGGATTCAAGATATTGTTCAAAATTTAATTTCTGTGTAGAGTAACCTATGTTATGGCTTAGTATGAAATTCTTATT
GAGACATTTCTCCGTACCTACATGTTGTTTCCTAATTCAGTATCTTGGCTTTAGAAAATTTAGAGGTTGGAAGAGAGTGGGAGAGTGGAGGGAGGGAAGG
ATCAAGAAAGAAGAGCCATTTCCCTTTTGCTTGTGCATGATTAGAGGATTTATTTAGAATCATATACAGACTACTTTTTATGCATCATTCTAGCTTCAAT
ATTGGTGTAATATTCCTGGATCTGATTTCTTAAAGAATCAAAAAATGTTAACCTGCAAAAGGAAACAAAAGAAGCATTGTGTTTTAACTTTGTTGGGTAA
TCCTTTCTCATGAGATGCTTCGTGAAGTATAACATACTATTTAAAAGTCCTCGATGACATAAAGTACAAAGCAAGATATCGGACAGAAGCTCTTTTTTCC
TAAGTAAGTGATTTATCCTTGGAGCTGTAAGGGGGAAGGTAAAGCAAAGGAAGAGAGAGAAAACAAGTTTGAGGTTTGAACTTGTGTATATTATATTTTT
GTAAAATATGATAGAAAACAACTGAGTGTGAGCAATAAGGAAAATCAATAGCTTTTCTGCTGAAACCTCATCAGAATTGATGAAAGAAGTTAATCTAGCG
ATTTTTTATTTGATGATGGAGCTGCTTAACTTACTTCAGTAATAGGTTGCACGAGATTTACATCTCTGGCTGATTTCAGTCTCCACTTCTTTTCAGTTTT
TGTGTAGATATGTTCCTTCATAAGTCACTAATAACTAACACCTGCTAGTTATCTCCTCTTTGCAGTTCCGTACTCACAAGGTAATATACAGAAGATATGC
AGGATTATTTTTCTCACTTTGTGTTGATATCACAGACAACGAGTTGGCTTATTTAGAGTCCATCCACTTGTTTGTGGAGATTTTGGATCACTTCTTCAGC
AATGTCTGTGAGCTGGATTTGGTTTTCAATTTCCACAAGGTTAGACATTTCTCATCAAACGTTGCTACTTACAGAAGCAACAAAGTTAATAACATCTTTC
TTTCCTGTGATCCCTGTTGTGGCACAATGGTCTTGTTGAATCTTCTAAGATGCCTGTTAAATATTGCTGCTGTATTTTTCTTTTTATATTTTTGTGCCGG
CTCTCCAACTTGGTGCTGGTCGTCAAATCCTTAGCTGAGCCTTTTAAGTTAGAAATGAAGAAATATGTTTTTCATTAGTAGAGTCAATGGCACCGTTCTT
TACTCATTGTATCATTTATGATCAATTTCTTCCCTCTGCAGGTATATCTGATATTAGATGAGTTTATTCTTGCTGGGGAGCTCCAGGAAACAAGTAAGAG
GGTAAGAAATCTGCTTCCCTAATCACCTCTTACCCCCTCCATCCCTCCTCCAGACGTAGGGCCTGTAGCTGGCCAATTTTCTGATCTTTTGATGCTCTCT
AGCTTGCCAATTTTTTGATTTTTTGATGCTCGCTAGGTCCTGTAGCTGGCCAATTTTTTGGTATTTTGATGCCCACTCACGCACACTCACACTCACACTC
ACACTCACACTCACACTCACACATATGGATATGTGTATATACATATGTGTATTGACTGACATGTACATGCTAATTTCAAGGTGTTAATTTTAAAAAAACA
TATTTAGCAGTGGTCCAAACTATCTCTGCTTAAGCAGGGTAACTAGATATTAGGTGTTGTTTGTCCCTCATCCATGAGAAGACAGATGTTTTGGTTTTGT
ATATATATTCCTTTGCTCTCTTTCCTCACATCCTGCCCAATGGAATAAAGAAGTTGATGCATATTTGATTCTGCCTCGACTTGTTATCCTATATAAATTT
GCACTAAACAACATTCTTTTACACGCCAGGCAATCATCGAGAGAATGGGAGAGTTGGAGAAGCAGGAGTGAAGAACTCCGATGCTTTGCTCAAGAGTCAA
AACAAACACTTGCCTTTTCCTTCATCACCTGCACTTCTCTTCCGGCTGGCTGTATTTACTGCATTAGACATTCTGTATCCCGTTGATACCTTCATGTTGA
TGTGGCCTCATTTAATACAAGATTTGTTCATTCATACATTTAAAGGTAGTTTGCAAGTTTAAATATGAATGTCTCTATCTATTCCCAGTTTAAATATGAA
TATCTTTATCTTTTGTTAACTCCAGAAACTATATTGTTGTTGGAAGTAGGAAAAGGGTTATTTCAATACGAAATTTCTTTATTTTTACTGGCCATCATGC
CTTGGGATAACTTGTATTTGTCCTTCATTCAGAGGGAGCTCCAAACTCGATGTTATAATTGAAAGTAATTTATAGTCAAAATTAAACATTTTCTTTTTTG
AGTTTTGTAACAAATGAAGTCCACTGAATTCATGTCATTGCTCCATTAAAGTAGGAACTAGTACGAAACAATTTCCAAAACTGGGGTGTAAGTATCAAAA
TTCTTTTTCTACTGAAAATAGGGAAAAGAAGTTTGAAAAAATATTTCAATTGATTATATCCTCTCCACCTTGGAATACATTTCATCTTTAAACTCATCTG
TGTAGCCGCCATCCCATTGTATTTATCTATTTTATATACATAATATTTTTTACTTTATCCATCGAACACAAGAAAACATGTATAAAAGAACACTTTATTT
TCCTGAAAATTGCTGAAAGAAATTTAAAGCAGCTGCAATTTTTTTCATTGCCATTCTTCTTCTTGTGTATACTACAAGTCAATAACCTTCTCAGACACAT
AAAGTTTCTTTCCATCTAGGGAAAAACCAACAACCATTTCTGAAGTTGTTACTCTATAATTAATTGAAACTGAAACAGAATAAGCATCTAATAAGGGACA
TGAGATTTACTATATCCTCCCTTTTTTGTGTTCCTTATATTCAGTAACAGAATGAACACCAACTCTCATGCATAAGCAAAGAAAAGAATAAATCAATTAT
GATTTGCAGGAGTTTCGCTCTGATATTATGGACATGGTGCCATGGCTCTCCGTATTAACGACGATCATTGCAAAGAAGCTGCAATGAAGGCACATTATTG
GGGTAGAGTCCATGTCCACTTCCTTCCAAGCCAGAAGGGAAACTGTAATATTGTCCTTTGATCCTTGAATTAGTTCGTGACGTAGAAATGGACATAAGCT
CCTGCTCGTTCAACAAGGGTGGAACATACTTGGAAGAAAGTGCTTCCATCGAGGAAGAAGAAGCTGCCAATTGAGCTTGAGAAGGTCCAAAGATAGGCAT
TGGTCGCCCTGCATTTTGCCAGTCTCGCATTTGTGAGGTAGAGACTCCACCAAACTTGTACTGAGCAGCGAAATGGGCATTTTGTAGTTCATTCTGCTGC
GACATTTGTCTTGGTAAGGCCATAGCAGCTTCTCTTGACGGACAAAATGACGCACCTCCAAGATATGGAGGCAGCAGAACCTGCAACTAGCCACAAAAGT
ATTGCCTTAATCTACTAAACCATGTATTTATTAGTAGTTCCACCACAAACTTACACCTGAATCATTTAATAAATGTACGCCCAGTAAAATGCAATAGATG
ACCAATTTTACATTTAACACTTCTCGAACATTCCAAAAAAGGAGAAGGGGGATCAGAATGAGCTATGGTTCTGGGTGGTCTATGTTGGAAGCAGAATAGT
GTTATCTAACGCATGCTTTGCATAAATACATAGATATGTATGTGTGGGCGGGTGTCTTTAAATAGGCTCATGTACTATAGTCCCTAATAACTTGTTCCAG
CCCCAAAAGTCAAGATTTCAGCATGTACCTACGCTGTTCTCATCCTGATATTACACATAAGAGGGGTAAAATAATCTATGTTCTGGAAAAAACAGTAAAG
TGACCGCACATTTCAGAAGTTGAATTCAATTTAAAGAATCTTCAGTATCTTAACAATTTAAGTCACGGAATTGAGAATCTGACAAACTAGTTGTGTTTCA
AATGGAGCAAAGCAATTTTAATTAGAAGTCACCTGCTGAGTTGCTGCTGTTGCAGGATTGTAACGGAAAGGTGCAGATGAATAACCATTCTGGGGAAGCA
AGAAATGCAGGGCTGGATGTTTCTGTGAGGTTACAGGCGTATCAAGGTTATGACCAGCAATAGTAGCACCACCATTAGTGCCTTTGATCACATAACTTCC
AGCTGACAATGAAAGGAAATCTGCATTCTGCGAAAGAAAGAGGATTATTATCGTGTATGGATGAAGAATATCACACATTATTGAAGATAACTAACCTGCT
TTGCTAAAGAATTGAACCCAGATGTAGTAGAAGCCTGTTGCTGATCTTGGAGGAGTCTTTGGTGCAAAAGGATTGCATTTCTAACTTCAGTTGGATTCTT
CTCAACAGTAGAGGCAACATTCCCAGTAGAAACAATTCCATGCATATCATTCACCTTTACAGTTGGGCTGTTCTGAATTATAGGAGGCTCTTGCTTCACT
CCATCAGGAGGTGAGGACTGAGAAGGATGCGAGGAGACTGTGTCACCTCTCATCGAAGTCTGTAAGCCCTTAGTCAGCCGACTTATATAAACATGAGCAG
CACACCTCTTAAATGACTTCCTCAACTCAAGTGGAACTTGAGAATCCTGCATAATCAAATCAAATGAGTGTTCCATATAGTTGTTCAGAATGGAACAAAG
TACATGAGAGTAACTGAAAGCTATATCGAAGTGCTAAAACACCTTCATGGTTGGTAGACAAGATTTTGCATTTTGAGCTTGATGATCAGTGCCAGCGCTC
CCGATCCAGACAGGAAATTTGCCAATTGGAAACCTATCATTACTCGGTGCATGAGAAACCAAACAATATTTGTAGGCAAGGAAGAGTGCGGTAAGAAATG
GGAACTTACTGTGGTGAAGAATCAAGTATGTCGGAACAAGATGACCCTGCTGCAGACAAGCCTGGCCACAACAATGAACCTGATCGCCAAAACAACATTT
CTGTTAATGTAGATATAAAATACACATGATTTGGATGACACCGTCTCGGATATATTACAACCAGTCATCAGAAAATTTGAAACTTGCAGGCTATAGTTAT
ACCATTATTCCTATTCTCCTTGTGTGTGTTTTGTTTGTTGGCTTGATAAGCAACAACCTGAATACAGAACAGTAAGATCAGCATTTCTGTCACGTATTAA
CCAAAGAGTATAGATGTCCAAACAAAAGTTACTTGTTGCGATGAAATTTCTAGCTGCTCTGTGTTGATGAATGTATCACACGGGGAAGCATCATGAAATG
ATTTTGATTTGGCAGCTTCTCCAGCAGAAACAGCTATGTCTGGAAACTGCTTCAAAGCTTCAGCACTGAATTGGGAGCTGTTTGTCCTTATGTCCTGTTC
TGTTGTTACAACTACACCATTTATGAAATACATTAGTTCGGCAAATGACCAATTATGGAAGAGACCAACATAGAAACGAAGAACTAACAAGCAGACCTCC
ACTTGCGATTACAGAAGCCTCAGGTTCTGGTAAGTCCAAAGATTTCACTTCAGGAAGTTGACTATTTATTTTGCTTTCGCTCAAGGTGTCAACATCTGGG
ATCATACCAGCCAAAGCATACAAGGTTTCAGCCACTTCCTCTTCATCTTTGGTGATTGGACAATCAAGCTCCTCCTTTATACACCGACTTGAACCACAAT
GAGTCTGCATTTAAATCTCATTATCATAGATGAAAATTTTCAATTGAACAGCATATCATTCAATTGTTTGGCAGAGGAACCACAGAGCTAAAAGAACTAT
TAAAAGGAAAAAGCTGCAAAATTTACAAGTCACTAACCAAATTAAGCTTAGACTTGTTGCCATATTTCCTTAGTGTTTCAGCTCCATCTGACATGCGATT
CGCCTTTTTGGAAATCGGCAAAGGTGGAGAGATGAGCTTGCGAATTCTCTTCTTGATAACTACAAAGGGCAAAGGATCCAAAAGCAAACAATTTATGATC
AATTGGAAGTCCAAAGTTTAACTCAAACAAGAACCATTTCACCTTATAAGAGATTAAAACCAGAAACTTGGCCAGTACAATCACCCAAATTGCAGATTAA
GTACTTTTTAATGATTCCAAAGGTTTAAAAAGCGAAATAAGACGAAGAAACTTACAGAATCTTCTCATGCTTAAAAAGAAAGAAAAGGTGAAAAGGAATT
TACTATAATTTACAAAATAAAGCAACAAGTGACCCACTTCCAAGCACTGGGCTCCAACTAACACATAACTATTCCAAATAAGATAACAAACATAAGCAAG
TCAGTAATTTCCAAATTTGATTCACAAAAATACAAACCTGAACGAACTTTCCGAGGAACAGAAGCATGATCTACTCCATTACACTCATCAAAAAACTGCA
AATCCAAAAGGGGTTAATGAATTTAACAGACCAATACCTATTTACAATATACTTAATTGAGCTAAAATATCAAACCTTTTTGGGAAACTTAAATCGCTTC
CGAACAGAAACATTGGAATGAATCTCATCGTTATCATCAGACTTTAAACAACCCATTTCAATGTTGTTCATACTGGACTAAACTTCACCAGCACCACTCA
ATCTTTCTCCCCCTTTCTTCGATTTCTTCGCAATTATTTCATTTCCTCCCTTACAATCTAAGCATTCAAAGCAAAACCCAGAAATATTATCAGAGAATTT
TGTGTGGAAAGCAGAAATCACAAGAAAAATCAAAACAAAAAGAAGGATAAAGAACTGTAACAGATAACCAAAAAAGAAAAAAAGAGAGGAGAAAAGGAGG
AATACAAGACGACACGCGTTTCTCAACCTCGCAAACACCAAAATCCACATATAGATGAATAAGAATAAGAATATATTTGCAGAAACAGACAATAGACGCA
TTGATGGGTCTTGTTGTCTAGTAACCGTTTGATTTTAATACAAAGACGAAACAATAAAATTCACTTTCACACTTAAGCATTACCGATTCTTGTCCATTTC
TGGAAAAAAAATACTGCAACAAAATTGAATTGAAAACAATTTTTTTTCCAGACCCAGCTACAATCAATTCTCTAATCATCAAACAAGAACCTCCAAAATT
CAGAACTTTTGGTAGTGAATCTAAAAACCCGATACAGAAACATTAAAGGCTTTTGGGTTTTACAGTACTAACATTTAAAAACTCTAAAAATGGTTAAAAA
GGGAAGAAGAAGAAGAAAACTGAATTTGGTCCTTTATGTACAACGAATCGGGTTCTTCTTCACATAATAAAGCCGCTCTCTCACTGTGAGTCTGTCACAC
TCGTACTCATCAACCCCCAAAAAGAAAGAGAGAGAGAGAGAAAGAGAAAGACAACACACACGCAAAGTACCTAAAAAAAATCAACCCCATGTAGAGAAAT
TACAGTACCATCTCTATTCATCAACAAAACCCCATTAAAACAGATCAACATATCAGATTATATAGATCAAACGTACATTTTCTTCAGAAAAAGCATAATC
TCATCACTCTTTCAGATCGAAAACGCAAAAATTCAAAATGCAGAAAACAAAAAACTCAGTCATTTCCATGAACAAACAACAGAGAATCATGAAAAAAAAA
ATTAATCCAGCTTACAATCTGTTGCAACAACTCATAACTGAACAAGAACAAACAAACAAACAAAAAGAATAAATTTTTGATTTACCCAAATAGTAACGAT
TTAGCTATCTGAGAATATTTCTGCTTAACAAACGGAAAAACCGAAGCTTTCGGTTTTTGATTACCCGATTCTCTCAAGATTTCACACGAAAACGATCAGT
TACTCTGTTTTCTCTCTTTCTTTTGCGTTTTAAAAGGAATATTTTTAATTATTACGTCGTCACAATATCTACGGACCATACAAACGGGATTTTCGCAGCC
GTTGGATCAAAAGTTCTCGAGTCCCACGTGTCATCTACGTGGCAATAATTTTTCTTACCCAAAATGCCACCGTGTACATCTTCCAATTAATCGCCGATTC
ATTATGTTATACTACGGCTGATTAATAAATACTTTTAGGTTGGGCCCCATGTAGGGTAATGATTTTGATTCTCTGGCGCTGGGTGAAAAGGGAGTGCTTC
ATGAATGATGCGTGAAGTTGAGAGCAATTCGGTTGAAAGGGACTGTGAAAATGACTATTTTACCCTTTGATCGCGATATCAAATGACGAAGATACCCTTC
CATTTGAAGTTAGAATGTATTCAATAACATCCAATATAAAGAAAGATTTGATTAAGTTATCCCATCTCTTTTTGTATATGTGTAATGAATGAGTTGTATG
TTTTTTGAAGCTATTAAATAATATTAACTATTTTGAGAGCTTTTTTAAAATTTTGAATCGAGAAGTTTTAATGTGATTTTTAAACTTAAAATAAATTGAT
TGATGTAAAGTTTTATCATGAAAATAAGAGTTTTAAGTGAGTTGGATGTAGTATGTTGACAATACAAATAAACTAAAAGCTTAGTTTATATAGTCAAAAT
ATGCACCAACCTAGATCTTATAATTGATCGATTAAAATAACAACAAAGTAAAATTGAATAGCATACTAGATGATATATTTTTTTATAAAAAAAATCATAA
ATAGTGTCTTGGATTGATACATGCTTTTTCAGTCAAGTGAGAGCAATAGAGTGAGTCTTTTTTGCTATTCATTTGGAGTGGAAAGTATTCTTTTATTCTT
AATTAGAGGTTTCGAATTTAAGTATTCCTAGATACGAAATCGTTTTTGTTAGAAAATATTTTATCTTTCAATGTATAATTTATCAAGGTGGATCTTTTAA
ATTCGAATATGAATATCGAGCACCTGACGAGAAGCTGTTTAGCATTTATGCTCCTAAGAAACTCACTCTTTATCTAAAAAAGTAAAGTAACTTTTAACAT
TGAGTTTTGGGTTAGGATAACTGGTCTGGATAATATACGCATAGGCCCAATACTTCAGCCCAAAACTTAGCCCTCTGACTCTTCACTCGTGAATGAATAC
GTATTGTTTAGGCCTTTAGGATCCAAATTAAGTCCCGTTCACTGACAGTCTCTGCCGTGTCTACTCTGTCGCCGGTTGCCGCCGGTTGTCGCTGCTCGCA
CGTCTTCTCTTTTTCAGGTGAGTTCGATTATTGTGTGTTTTAATTCTTTCCAAAAGGAACAATTGAAGATGAAGAAAAATCTGTTGAATTTTTAACTTGA
AAAGAACTGAACTATACACACCATAATTGAATCCATACTAGTTCGAAGCGTGATTTATGCTAGTTGAAGATGTGATTTGGATTATCATTATGATAATCAT
TTCTCTATATTTGAAGTTTTTGAACTCAATGTTCTTAGGTTAATTAGATATTTATGAGTCAATTGATTTTTGAATGAACCATTGCATAAAAATCAATTGT
CGATGGTTACTTGTTAGGTTAAATAGGTTTCTGCTGCTGATTGTTTTTGTCGATCTTTAAGTTTTATATAGCTGTACTTTGAGATAGAAGGAAGGTGTTT
GAGCTATGAGAAATTCATTCAGCTTGTAAGTTTTTGATTTGCTTCACCTGGAACTCAATTCGAAGCTAGCCTAACTTATTTTTCTGTTTATTTGTCCCTG
GGCACATAAGTAGAAAGTTTGAGTATCTTCTCTTTACAAGAAAAACCTGAGTTATGTGGCACTTTAGACTACAAATTGTATTTTATACCTGACAGATACT
ATTGTAGGGCATATAATTTAGTTAGATTCGTTTTTGGTTCTGCTTTGGGCTGTATTTCCTTGAGACGAGGGTCGGGAACCACCTCTCTAACTCTGAGGTA
GGGGTAAGGTTTGCGCGCTCTAAACCTTTGGGTATTTTGTTGTTGTAGATTTTATTGTAGTGCATATGGTATTACGTCAACATATTGAGTGTGTTCCCAT
AGTGGGGTCTGGGGAGGGCACTAACCTTCTTCTCCCACATAAAGTGCTACAACACACTGCTACTTACAAGACTTCTACCCTAGTCCTCGACCTCGAAACT
TTCCTATATAGGGTCATATTCCTAGTAAGTTGAAGTTGTGTCATGTAGGGTTGAATCACCTTCCCCTTGTTCTTTTATGACCTATCCCTGCCTTTCTAAC
TCCTGTTCCGCCAATATTGGACTAGCACAGTTACCATTTAATCATTGAACAGTGAAATAGCCTTTCCATGAGAAATCTTTGAAACAGAAAAAATGAACTG
CTTAAAATCATGGTGAGAATTTCGATGCACCAAAAGAAAAGTATCATGACAAAACCGAGCAGTCACTTAACACTAGAAAGGATCACAAACTACTCTAATG
ACAGTTACATATGTAACATGGGTATCTTCTCTGGTACTCGAATGAAATGAACATTCTTCTAGTTTTAAGTATACATTTAGTCTAAGTTGCTCTGATTCTG
CACTTTTGGTGCCACACCCGTGTCGACACGACATGGGTGTGGGATCTTTGTCCGATTTGGTCAACTGATTTTGGGTACTTTGACCAAAATATATGGGGAA
AGTCTTGACAGTTCTAAGATTTCTGTAATCAATACAAAAGCTAAGGTGAATTGAAGAAAATGGAATACCTTTTATATAGAAATTTCTTTGTCTTTCCTTT
TCGTTTAATCTCCTTCCAAGATTCTCCTCAAGTTCTCCACATAATATAGGTTTTATAACTCTATTTTTAGGCGAATCCCTGCACCCGTATCCATACATAG
ATTCATATCCCCAAATCTTAAATTTAGATCTTGAAGGATCCAACCTCTGGATCCACACCCGTATCAGACACCCGCACCCGAGTTCGAGCAACTTAGCATT
TAGTTCTCCTTTCTTCAGATTGTATATTATAAACTTGTTTTGATACTTTGACCCCTCTGACTTTTGAAATTGTTGCTTTTTATGTACTGCAGCTGATATA
AGCCCAAAATTGTAGCTTATGTTTGGACTAAACTACAAATTGGTTAAGGTGCTCCCATCGACAATACACTATTGGAGAACGAGTGCAGAGGTCTGATATT
TCTCGTTCAAGTGTCGACTCAACGCCGAGAGAAGTCGCCTTTTTTGGTTGAGAAAAACCTCGAAACTGCCCTTTGGCTCATCTTAATGTAACTATTATTG
TGACAGAGAAGATAAGAACATTGTTTTTGTGAAATCAGATGTCGACAGCAACATACCCACCACCCCCTCCGTTTTATAGGCTGTACAAGGACTATCTTCA
AGACCCCAAGTCTGCTCCGGAACCTCCCCCTCCAATTGAGGGCACCTATGTCCTCTTTGGTAGCAACTACACTGTAAAGTCTCTGACCCGTTCTTCTACT
CCCTTTTGAAATCCACCCCCAAATGGGGAAAAGGGGTGAAAAAGTCATGATACCCAATTGCTTACTTGTGCTTAATGTGGATGTATGAATGTATAAGGTG
TCTTTGAGGCCCATTCAAGTTACTGGGTAGCTCTTTACCTCGAAAGATTTGCTTTTACTTTAAAGATTGAACCATGTTCTCAGTTTCTTCACTTTCATAT
ACTTTATATTGCTTTTGGGGTAAAGGTATGGATTTAATTCAATGCGCGCTTAAAAAAATACAAAAGATTAGAGGGGGAAAATGTCTGATGCTAAGGTGAG
GTTCAGTGAGATATTCAACAATGATTTAGATTTTATCTATTCTGAAATATGAATGAGGTTTCCATTAACATTCTCACCTTTATCTTATGTCATCTTGAGC
TGCAACGCATCAAGAATCTTTATTCTGGTCACTCCTCTCAGTCCTCTGTGTTCTTGTCTTTTGTGAATTTTGTTTGTCAGTTGTGTTGCTGAAATTAAGT
TGTCGTTGTGGTTTTTATTAGATAGCTATGTGCAAGTTTGCTCATTATTTATTTTGGCATTACCGTTTGCGCAGACTGATGATGTACTCCCAAATTTGGA
AGAGCAGGGTGTGCGTCAGTTATACCCAAAAGGGCCTAATGTTGGTAATGTTTGCAGCTATTCTCAAAAAGCCGTATTTGTTCCTACTGTGATATGTAAC
ATGCATATCTTTTTTAAACATTTATGGTTAAAAGAATTTAAGTATGTGGATACACACATTTGTACCTTATATATCATCCTGCATTTTCGATATGAATCTG
CATGGAACATGACACTCGTTTTTGTTTCCTTATCGTAAGTTCCAAGTAAATATCCTCTACAAGGTCAATCGATATGTCTAATCATTTCTGTTCTCTTTCT
CTAAGCCAGTGACCAGAATAAATAAAAGGGAAATAGATATAAAGTTTGAGCCCTTTAGGTTATTCAAAGTCTTAGACAAAAGATTGCAAATCAAGTATCC
TATGCATTGCAAAAGTTAATTGCAGAATCAATTCCATAGTTGAAACGATGATGTCCCCTTTATTGGGTGCTGCTGCATATGGGATGCTTCCAGAGATAAA
TTTAGGTGCTATTTTGTTGCTTCTCAGAAAAAATTATTCATTCTTATTCTGCTGATTCATGTTACAGATTTCAAGAAAGAACTAAGAGCACTTAACAGAG
AATTGCAGCTACATATATTGGAGCTTGCTGATGTTCTTGTAGAGCGCCCTTCGCAATATGCCAGGAGAGTGGAAGAGATATCTCTGATATTCAAGAACTT
GCACCACCTACTCAATTCTCTGCGTCCTCACCAGGTGATCAATTGGTGAAATCTAAGTGTCTAAATATTTCTGGGTTTTAGCATGGCTATAGAAGATAGA
TGATCTCAATAATCATTTACCTTTGTTTCTTTCTTTTACAGGCTCGAGCCACACTTATCCACATTCTAGAACTTCAGATACAACGACGTAAACAAGCAAT
AGAGGATATCAAGCGGTATGATGTTGTTTGTATGTTCTTTTTATCATATATATTTAGCTTCTTCCTTCATTAGATTTAGATGAAAAATCGTGAGTTTTCT
AGAAGAGTTCAAGTGTGCCTCATCAAACAGTTGCAAGTGAAAGAATTCAGTTTCCCTTTAAGCTGCTTCAGTCACTTTCAGCTACACAGATTATATGTAA
TTACTATATCAAACTACCTCTCAAAATGAAAAGAGAGATGTATTTACCGTTAACTCTAATAATGTGCATAAATTCACAAGTTGTTGGAGTTGAGGCAGAC
TGTTTAATTCTCTCTTTATCTTTTTATCCTGGTTACTATGATTTTAGTCATGATTTTGGTTTCTATTTGCTTGTATAGGAGAAGGGAAGAAGCTCAGAAG
CTTCTAAAGGAGGCACTTGGTACCCTTGAGGGACAGTAGAATGCTCTTTAGACTTTACACACACAGCTGGCAGAATTAGTGTCTAGAATGCTTTGAAATT
ACAGTATAGAAATCATTCAGTCCTAATGTGAAATTTTCTTTATTCACTTGCCTGAATTTTATACAGTGACAATGCTTTTATGTGGCAAGTGTCACAATCC
AGTGCCAAAAATTCGACGTTTCAGTCATCGAGGCAATACAGAGTTTCGATTAAGAGTGTGTAAAAAGATTTAGGTGACCTATCAAACATGTAACTATTCT
GATATTATGTTAAATTCTTAAAAAGTAGTCTCATCACTACTATTGAACATGTGATCTTCCTTATCTTTTGTTGCTGAGCGGTGTGAATAGCTCTTCTAAC
ATCAACGTGAATCAGCCTATACGCGTCATCGCGGATGTTGTAGAGCAAGTATTTAAAGGGATTGTGGCAAGGTCGACCATTTGAAAAAGAAAAGTCCACA
TAGACTACAGTAGTAAGCAGTGTTGATCAGCTGACGCAGAGTATCCTAAACAACAGCAACAATTACTATGCCTCAATTCACCAAGGGAGCAAAACGGTGG
GAGCTCCAATGTTTTGTTGCTGTGACATGAAAGATGCTATGGTTGTACAATCTAAAGAATCTACATTCAAGAAGCAACTGTGACATAACCCAGTAGATCA
GCTAACAACACACATCTATTGGCATTCGACGAACACTCTTAGACGAAAACCAGATTAACTGGAAAAAAATAGGAGTGAAGTGTACAATCTCGTAGCCAAT
TCATAAAAAATTCAACATTTTTGCGACAAACTAAAAGAGAGTGTTTACGAATTGCAAAAAGAGAGAAAAAAAAAGCATGGCATTCGAAAGAAAATTTGTG
TACAAGGATATTAACAAGTCCAAGAAGCAGATCTTTTCATGGTAGGCTTCATCTGTTTATCTTCTTCAAGTGATATCATACCCAAATGAGATGGATCTTC
CAGCATCATTCTAGCTACCAAGTAACCAGCAATGGACCATGTCTGGAACTTACGCGCCTGCTTTCCAATAAATCGACCAAGCTTTCCGTCGTAATACTCT
GGCCAGCTATCTTTTAGTAAACGCGATTCAGCTAGTTCAATGGCCCGTCGTGCTATTTGGGGTCGACCAGTCTTGATAGCTGCTGCAGTAAGGAGCCACA
GAAGAACTAGACACAAAAAACCAGGCAAATCAGTATTAGCATAAGTTTGTAAATGTCACGGTGCAGAACATGAAAAGAGTACTCCCTCGGTTTCATTTTA
TGTGAAAGTGTGACTGAGCACAGAGTTCAACACGTGATCTTAAACATGTCATGACATTTTTTGTGGCTATAAACCGTATCACTAAGGGTTTTTAAATATA
GAAAGGCATCATTCTTTTCGGAATAGACTAAAAGAGCAAGATTGATGCATAAAATGGAATATAGGGAGACATGATAGGCTACCAAAAAGTAGACAGATAT
ACTGGTCATCGTGATGCGAGATGACATAGCAAACTATTGCTAAATAGAATGAAGTACTTTTGGTGTTATATAAGAAGGAAGAAACTATAACCTGGCCAAG
TGCCACCATTGTGGTAACTCCAACTAGTGTTTTTAGGGTCGCATCCTGTTACAATTCTCCATTCATGGCCTTCCATAGCAGGATAACAGATTTTCAGCGG
CATTTCTCCAACTAGCTCTTGCCATCTTGATTCAACGAGATCCATTATGGCGGAAGCTTGCTCAGGTGTAGCCAAAGATGACAAGATTGAAATACAGTTA
CCCAAACAAAACCAACGGAAGTCCATGTGAGCAGGACTAACATTTCCGATGAAGTAACCACCACGAGTTGGCATGAAATCAAAAACCCACTCCGGAAGGG
AATCTGGCATCACATTAAACTTGTTTACTGCAGTGTGAGAGTACTCTTCTGTTTTGTAGCGGTATATATCATTCAGTTGTTTTATGTCGAGCCAATAGTA
ACTTCTCATGTGAAAGCTTAAAGCATGAAGTCGTTTAATTATTGCATCACAACACTCTTGGTTTTCTTCGTCGTGTTTAAGGAGAAACAAGGCACATCTT
AAGGCCATAAAGAAAAGTGCTTGTATTTCAATAGGATAGCCATAGACACCCTGGGAACAATATGAAACAAAGTGCTTATGACATGTGAGTAGTGGATATT
TTAAAGGAAGTTGAACTGCAATAATTGAGAATTTTAATATGCCCACAAATTTATTGAGAATATGAGAAAAGAGTACAAGTCTTCTTATTGGTCCAGTGTA
ATCCCACAAGTGGAGTCTCAGGAGGGTAGTGTATACACAGACCTTACCCCTACATCGTGGAGGTAGAGAGGTTGTTTCCGAAAGACCCTCAGCTCAAAGT
GCAGCACATCAAAGAAGTTATGAAAAAGGAGATACAGCAGTGAAGAAAACACGTCAATTAATAAGGAAAGCACTACATAGCACATCGAAATCAAGCGGTA
ACTGAAACACAATAGAAAACAGATGGTCAAACGCAAGAAAGTACGTGTATACGACTAATACTAAGACAGACACAGTGCTACCAGACTCCCACCAAGCCTA
ATCCCGCCAAAAAGCAAGACAAAGCTCAACTGCCTATTTCTTAACTTCAAGCAAATGATGTGAAATCTCAGCAGAACTCCTATTTGAAGCTTAACTTACC
TAAGTCAGAATCAGAATCACTGTCATTATGTACGAGAAATAGAAAATCAAGCACGTAATAAGTATGTAGGCTAACCAAATCTTGACAGATTATAAATATG
CATTTGGTCAATTATACTATTCTAGAAGTAACAGTTGATAGCTATCTCATATCTTGTCATCACTGTCATCATGTAATATTAAGTAGAAAATCAAGCATGT
AATAAACAGAAAACAAGGCATGAGCATAAGTCAGATCTAGTTTAAAAAACCGATAAAGAGCGGATAGTAGTACATCAGACTGACCATTCTGCGATCAATC
ATAGAGCATCCATCAGCGCACAGCAGGGTTGGGAATGTATCAAAACCTTCAGAGAGACATAATTCAAGAATCAGCCTTATACCCCTTTGGCATTCTGGCA
TCTCAGCCAAAGAAGTGTCCCCTGTAGACTTTGTGTATGCACGAAGTAGTATAATCCACCAGAACCCTGAATCAACAGGAGCAACTCTACCAATAGCACT
TTCACCGAAATCAGCAGTTATAGTCTCATAGTTCCTAACAGGATCATGAGACACTTTAAAACTTGCAGGCATAACTCCATCCCCCAACTTGAACTGGTCT
ATCTTCTTCTCCCGAGATTGGAGGCGCAAGGTTTTCAAAAGAAAATTCTTTACTATATCAGGTTCACCATTCATCAAGAATGCCAAAGCGCTGGGGACAA
AATCTCTGACAAAAACCTGCCAAATTTTAAGTCAGAACTGCAAATTGCAAGTAGAATGGTTGTCATGTACATAGAGAAAGACGACTGTGAAAGGATTTCG
GAAAGCTGGGCCCATCAGTAAGCTGGTTTTACCTCTGGAGAATATCTAGAATCTGGTTCTAGATCAGACGCAAAAACGCTCAAAGGTTCATTGGGGTTTT
AAGCGCAAATAAGCATGAATAACAAATAAGTGAAATATCAATTGTTTAGTGCCGCCTCGTCATAAGAGGTTAATTCACAATGATAAGTATGCCTTAGAGA
ACCTTGCTAACGACGCTGAATGCACAATAAGCGAGAAAAAGTGCTCAGACACATTTCGAGTCCCGCTTCATGGCTTAAATGCGCCTTTGACAACACTGGT
TCTACATAAGTTTTTATGTAAACTATTTGAACAATTCAGTCGGTCAAGCTTAGCTCATATTCATTGAAATAGCTGGGCCTGCAAACTATACCCCCTCTTC
ATCTTATCAGTCAACCGCAAACCAATCAGTTGCACTGATAACTATAGTGTGGACATAGGAATTCACCATTTTCTATTTATTACGTAAAGAAACATCTAGT
ACAACTTATCAGAGGACACTCGTCAAAACAAGTTCCATTGAAGCACATAATCGACCTGCTTCACGGGATATTAAATCACAACAAAATACATAAAGACAAA
CTTGTATCCATCTAAGAACTAGAACAATAAGCATTTACCTGATCATAGTTAAGTTCCTCAGCAGAATTATCTATAGCAGCAATAGTTCCCACAGGTTGAT
CTCGGAAGTTAACAATAGAACGCCTCAAAGCTTCCCATGCTTCGCCGATTATAGGATGCGGCTCATATCCGAAGGTTGATCTGGGTGTGTGTATGCCGGA
CCACCTTCCTGGTGAATACACTCCAACCATATTATCAAAAACACGAGAAGAGTTCTCCGAATTTTTGTATACCTGACGTGGCGGTGAATGAGTCATTGAC
ATTTCGCTGAAAGATCTTTCATCGAACGACCTCTTCCTTTCAATATTAACTTGTCTTGGCCTTTCCAGCAATCTAGCCAAATCTTCCTCGATTTCAAACA
AGGATGGAGCAGCTTCCGCGTGTCTTGCATTCCCATTTTGAGACACATCCACAGGGCTAGGCATCTTCCAATACTTCCAAAAGTCCTAGACAATAAGAAA
TCGAATCCAAAGATCTGCATATCACCAATGAAATAAGAAAACTTTTAAGAATTCGCCCCCGTAACAGAAGCTTAGTAAACACAAAGCTATATAGCTCAGA
CTCTCCAAAAACATCAAACAAGTGTGTGTCGGATCCTCCGAAAGGTTCCTCTTTTGGAGGATCCAATGGGCTGCAGCAACATTTTTGGAGAGTCCGAGCT
ACATCAAACAAGAACTTACATAATAAAGAATACAATCAACTTGTAATAAAGAGTGCAATTAATGCCTCTTATACTTGGAATACATTAAATTGAAATATAC
ACCAGATCAGAAAATCAACATTTTTTTCATTTACAAGCAATATTTATTCACTATAAGTTTGGTTTAATTCAACTTGAGCAAAATTAGAGCAAGTTCTTAC
ACACAATTTTAATTAATTAATCATAATCATTAACTTAATTAAACAATCAAAGTCAAACTACTGTTAGATCTTCTTTTACTTTATCAATTTACTTCTTTCT
TTTTAATTCATACTTTGATCAATCCAGCAAATACTGAAACCAGCACAAAATGAAAAATCTCAAATGCAGAAAAACCTTAATATCATCGAAACAAACAGAA
AAATGAAAAAATTAAGAAACATAGATAAAACACAAAATAAATAACCTAGGAGCTGGTAATAACAACCTCAAAGTATCGGCGGCGGCGGCGGCGGCTACGG
CGAACTTCAGTGAGATCTAAGGTTTCCGAGGAAGACACCAACCATGAACTATCAGAAAGACTTTGGGACACAATGGGTCTTTCACTATATACTATGTTGG
AACTATGTGAAAAAAAATTAACCGGGAAATGAAGGTCAAAAGACGAGTTGACTGGATATACCGGTAAGATTTTGTGCTTGTGACGTATGGGATGGTAACT
GACACGTAGGATTGTCTGGGAATATCCGATTAACAGTTCTGGGGTAATCTCCGACCAAACTTTGTCCGAAAATGGATTAGTTGTAATTGTAAATAGTGAT
TAAGGAAATAATTGTTGTTGTTGTGAACGATTATTACGATCTTAAGTATGATTAGTGATAACGATTAATCCCACATCCTCGCGACTTAATAAGTTTCATT
AATACTACCTTTAGTTTTTTTTTAAAAAAAAGGATGAGATTATTAATTTTTTTATCTCAACTTATGTTATTCACTTTCATTTTTAATTAATGTCAAAAAG
AATCTAATATTATTATATTTTGGCAACAATTTAATTTTAAAATATTTATATTATTTTTAATAAAATGATTTATAATCACATAAATATAAAAAATTTATTT
TAAATCGTAAATTTTAAAGTTATATGTCTAATCAAACTACCTCACATAAACTATGACATAGAGAGTAAGAAATAATGATCAACAATGAATTTTTCATTTG
TTCCTTTTTTTCTTACTTCAACAATGATGATATTGAAGTCGGAAAATAGAATATTATTTAGATAAAAAGTGCTTTAATATATGCATGATGATAATTTAAA
TAAAATAAATGACGAATGAAATCCAAAAAGTTCACTTACCATTAGCTCAAATATTAATGTTGGAGAATTAATAAATTTCATATATGGTAAATTTTCTAAA
CATTTATTGCTAAAGAGATTAACTATGAAATTATTAAAACATTCTTTTGTAGTTTCTAAGTAGGCAGATTTATTAAAATTTGTTGCTGCTGATGTTATTA
ATCTCAACGATTAGATGTGTTAATCGTTCCGTTTAAATTTTTTGGATGAATCAGCCCTTCTCTTTTAATAAAATAATTTTATTATTTTTTTATTGTTATA
TTGTGTGTGAGAGAGAGTTTAAACTATTAAAAAAAATGTAATTAATCTATGTACAAAAGAGAATAAAATAGAAAAATTCATGTAAAAGTAAAATCTTCAT
TTTATTTAACTTTCCTTTTTCGTTTAATTTTAATATTTTTATTCATTCTTTCTATTGCTACCTACTCCTTTTGTCCCCTTTATTTTTATTGTTATTCTTC
TTGCTTTGTTTTCAACGATAAGATTAATTTAGTCATTCTATGACTTCGATTTGCATGAATCTTCCCTCCTTTAAGTATATCGTAAAAAAATTAATTAATT
ACACCAAGTTGATTTTCTTTATTACTTAAGGTCCAATCCAACTTAGTTGAAAATTTATATTGATGTGAAAGCTGGTTTAATAAATCCTACGTGTAATTAA
GTGTCATTTGGACGGCGATGCTGATTTTTACAACGTGTTATTACGTGAAAATGAAATTATGTTAATTAAAAGATTAATGTCAAGTACTACATATCCTATT
TTGGATACCAACAGAAAATGTTCGATGCATCTTTTTCAAACTAGACCACCCCAACCTACCCATGTTTCACTTGATATATATATTATTGTTGGAAATAAAA
AACTTTTAAAAAAGTATATGAAAGACTTTTGGTATATTGGTCATTCATTATCTCAATTCTTATCTGGTATGAGATATCAATTCTTATTATATATTTAATG
TTTTTTAATGGAATTGTTTGTTTGCATATATTTTTTATATTTATTATAATGAAATGAGGTAACAAATAACATATAATATAACATAATATAAAAATTGATT
CTACAGAAAACTTGAAAATTATAAGTGTATAACTAGTAAAATATAGTTATATGTGATGATTGTTATAAGAATATCTTGTGTTCTGAATAAGCGGGTTAGA
AATTGATCGGCATATCGACTAATCCGTTGTATATGTTTGTCATTAGTCATTACTTACATTAATAATTTTAAAATCATGAAAATTCGATATGATTTATGAC
TAACCTAGCATGACACTTATGTTGAGTTTAACAAGAAGCCACATCTTTGTTATAATATTTGTCACAATTTTAAAATGTAGCATCTTTTTATCATTTGTAG
GTTTGAAATCATAAAAAGATGTACCACTAGTAAAAACAAACAAATAAATGTAAGATACAAGAATAAAAATTGAAATAAATTCAAATATAACATGAAGTCA
TATTATATGAAACGTAGTTAGATTTAAAAAATGATAGAAATCACATACTTTTAAGACAAAATTATCATTTATCCGTTATAAGTAGATAATTATAGAAATC
TCTTAAACTGATACAATAATATAAACATTAATAGTTAACTAAGATACATTACATTTTGCACATGATACACTATTCTGATGTACATTTTATACATGATACA
CTAATATGATGTGCGATATACATTAATCTGATGCACGAGATACATTAGTCTGATGCACGAGATACATTAATTTGATGCGCTGATACATTAATCTCATGCG
TGAAAATGAGGGATTTGGGGATTTTTAAAACTAATAGGGGATAATGGTAATAAGAGAACTTAAAAGTGAAATTTCGTCATTTTTCCTAATATTAATACAA
TATAATTTGTGAATAATTTAACACGATATGACGATTCTTGTAATATAATACAACACACTTAAGGGCCCAAAAGGAAGCAAGCCCAAGTGGAGGCCCAAGC
CTCTCGCTCCTACCCTGTAATTTGTGTTCGTTTTCAGAAAGCATATAGAGTGCTGTATTTGACCGTTGAGAAAATTTTCGAAACTCAACGGTTCTACGCT
CCATTGCGCTCTCTCTCTTTCAAACTCTAAAAGTTTCTTCAATCTGCAATGGCGAAGTCCAAAAAACCAAAAAATTCTTCCGATAGAGAAAAATGGAACA
AAGTGTTCAATGCTTTAGTTCACATGTTGACATCACAGCAGACGCAGCTTGAATCCCTTGCAAAAGAGAGAATGATTCTTGAAGATCGGATAAAATTACA
GAATGATCGATGGGTATCTGATATTCATAGATTTCAAGAACAAATTTATGAGGTTACTTTGATTTTCTTCTTGAATTTTGCATTTTTACTTATTTAGGGT
TTTGATTGCTTGGAATTTTAGGGCTTTTGATTAAATTGGGTTCTTTTGCGTTTGCAGATGAGGAAAAACTTTACAATTCAAGAGATGGAGCGCATGCTTG
AGGTTGCGAAATCGGAGTTTGTTGTTGGTTTGAAGCAACGAGATGTTGCCGTGTTCCAAAGAAAGCTCGGTGAGTTTATATTTGAAAAAGAAAAGAACTT
TTTCTTGCCCTAAGCTTTGTTTGGTTTATACGAAATGATGGAAATTTGAGCAAATTGTGGACCTTTACTTGCCTTGCTGTTTATTTCCCGACTCGTTGAG
TTTAAAATCAGGTAGGAAGTAGAGATTTCTTATTGCTATGCACAGGGACAGAGCCTGGTGGGAGCAAGGGGATTTATGCATATATAGCTCAGTAAATATT
TTGGCTCCGCCACTAGCTATGTAGAGTTCAAAGACGATAAATATTAACTTTGAAGTTGTCCTTCTCTTCTCTTTCTTTACCTGATAAGGATGGTACTATT
CATGATTACTGCCTTTGATAACTTTTATGAGCCTTATTTTGTGCTGGGGTGTCGCCACAAAGTACAGTGTCACTGCCTAAACAATATTGCTGTTTAAGAT
AATCAATTTGATAGTGGAGCTTGAAGTCTTGAACATACAATATCTTTTTCTTACTCAATATGGTTCTCTCAATATACTTTTATGAATCCAACCATGAATA
AAGTTGCATAATTTATTTTCTTTTGATAGCTTAGAAATCTTCAAGGGCTAGTGGCACTCGTGTTAGTTAAATTGGGAGGGAATTGAAACAGTTATCTGTT
ACGTCTAGTGGCGCACGTGTCATATTAGTTGGAACGGAGTAGAAACAGTTACATGTCAGGGTTTCTATTAATCCACCCCATTTCCCATTAGATAAGTTAA
ATTCTTTCAATACACTTTTACGAACTTAATACTGAAATAAAGTACATCATAGCACTTCATTCAGTTTGGAGAAGTTTATAAAAGTCCTAAGGAAGCAGAA
TGGCATACAGTTCCCTGATTATATGCTAACTTTCTCCTTCTACAGACCTTGGAACAAGAGAAGGAAAAAGAATCTTGAACAGAGAAGATATGGTCTTTTA
TAGCGTTCGTGCTTTTTTTCCTGTCATCTGAGGAGTGAGGGAGGGAAGGAAAGAAGGAAGGAGAAAATAAAGGGAAGAGACCTCAGGGTGGTTTTTTTGG
ACATGAGTGGCTGAACTTTAATTCCGAGACTGAATAAAGGGCATGTTACCTCTTTTTTTTCCTCTAGTTGACTCACTTTCTCCAACTCACTCAATTTCAC
TTGTACACATTTCAACTCTTGTTCTAAAATTCTCTTTGCATCTCAGCTCAGGGCACACTGATATTTCTTTTCGTGCATCTTCAAGATTGTCAAAGTGGAT
CATTTAAATTAGCAATAATGGAGTTTCTGTGTGTAATCAAAAAATTATGCAACCACATATCCTCTACACACTCGAACACACTTCTTTATGTATAAAGTTA
TCAGTTCAGTTTTTATTGCAAGAGGCTATTTTAGACTTTCTTGCTCTTGAAAGATGGCTCCCCATCCCAGTGTATCAGTAGCCTTTATTGTTCAAGGATA
GACATGATCTCTTAAGTTATATCATCCCAGCATTCAATTTGGTTACTTACTATTCACCTAAAAAGTGCAGAAAATGCAGATGGTGAACTGGCTGACTTCA
GAGAATGGTTTGACTACCTCTCTCAGAGATGCTCTGAGCCAAATGTATGTTGTTTCAATTGCCTTTTCTATTATGAATGTTGTTTCTCATCGCCTTTCTG
AGTTTTTAGTTTATTATTTGCGCTAGTAATAAAAAACTAGAAGATGAGATGTATGAATGTTCATTTGATCCACAGGATGTACCAAATGCTGCAACAAATG
AAAAGTCGGAGACAAGAAAGAAGGCTTGGGAAGATGAGGTGAGGAGGCTTAAAACAGAAAATGAGAAGCTTACTTCAGAGAAAAATTCTGAGATTTCTGC
CCTCTTGGCAGAAAAGAATTTTATTTGGAACCAGTTCAACAAACTGGAGCACGACATGACTGAGCAATTGAGGAGAAAATGTACTGAGCTAGAGCATGCA
AATGGTAAAATACAGGCATTTACGAGGAACATTGAGGAACTACAATTGTCCAACGCTGATAAGGATAATACAATTGCAATGTTAAGAAGTCAATTGGATA
ATACAACTGCAACGTTGAGAAGTCAAATGGCCAAATTGGAATCTGACTCCGTCACTAAGAGTGGAGAGATATCCAAACTTTCCACTGAACTAGTGTTGCT
AAAGAAGTGCAGAAGTGCCTCCGTCACTCCTGTGCTGCGTCGCTCCACAACTGGATCAGGACCTTCAAAATCGGGAGGCACGTCCCGTGGAACAGATCAG
AGGAATATAACTGTTAAAGTGGAAAAGCAATCTTCACAAGCCCTTGAAAAGGTAACCTTTTCCTGCAACTGTCCTTTCCTGTTACATAATTTGTCTGTGT
TAATGTTGTTGTTAAGGTTGTTCTTCTTTGAGAGGGATCTCGCCTAGTAGTTAAGTAAATGGCTATGTATCTTCACAGTTGTTTAATCTCATTTTAAGAG
CATGTTAGTATGTCAGAAATATGTTATGGCTTATGCTATATTGCTTGGATATTTCAAAAGTTTCATACATGTGTTTGATCCTCCAACACGAGTATAGTGG
CATTTTTGGAAGATCGAGCAACATAGGTCTTATGTTATGTAAGCTGATAGATGCTCGTTTTTTTTTATAGGGACAGAGAAGTTCAAAACGAAAAGCTGGT
AATAGTATCTTGAGTGCTCCAAATCTATTCACGTCCTCATTTAAGGTACCTAAATTAAAAATGTCATCTCCCTGTGTGACATGACCTCTGTCACCAGAAA
TTCGGCTTGTATCTATATTAGATGATAGATTTTCGGTACATATGTTCATTTATTGGATCTTGGTTCTTCAAGCTATGTGACAGTAAATTTCAGTCGGTAC
TAGATGTTGATGTTGTATACTAGAGAGATAGTTGCAACTGATTAGTTGCAACATTTTATTGAACTTGGAGACCTGACTATTCAAGTAAATGAGGATCAGT
TATTTGATTTCTGCATTTTCTAGTTCTCTTCTCAATCTCGCAGTCTCTTTCCATTCCTTTAGTACTGATATTACTAATGAATTTGTCTGCGCTCCGCGTT
GTGTATCAATAAATTTGAGATACTTTATAAATTTTCACGTGTATACATCTATTAAAGCTAAATTCAGTAAATTGACAAAATTTCAATCAGATAATGAACA
AGAGATATATCACAGCAGTCCATGGCTTGTTTTTGCTATACGTCATAGCGCTTTTTTTATTTTTGCTAAAATCCAAACGCTTTATTGCTAATTTTGGTAT
CGCTTGTTTTAACCACCCTTAAAGTAGGGATTGTGTTCAATGTTTTGTCCAATAAGGGGTGACGTACACGCGGAATTAGTTGAGCTACACAAAAGTTGAC
TGAGACACTATAATCATTAAAAAAAATGACTTAGTTGAGCTACACAAAAGTTGACTGAGACTCTATAATCATTAAAAAAAATGACTGAAAACACTCATGC
TATTGAAAAAATAATATAAAAAATGGGTTGGCATAAATTTATTTTTCGTATGACCACACGACTCAAGTTTTTTCTAAATGAACATTTATATATCATAGCA
ATAATATGAGTTATATCTTACGAGGCATAACAAGTTTGATCAATATTTCTTTATGAAATGAGCAATAAAGGCAAAAATTAAAGATCCTCATATTTGACTT
TGTTATAACTTATACAGAAGATGTGTATTAGCAATATGCAGATAAGATTAAAGAAGATAAAAATACATGTATATCAAACGATCCATATATTATTACTCAC
TGCATAAAGATTCATATATTATTTACCTCATAAAACCAAATATTGCCTCTCTAAACATTATTATCTAAAGAAATGAAAAACTCTTCCACCCTAATCATAC
AAATCCTAATCCCTAATCCTAATTATGTACAAGCTATAACACAATACTTTCGATACAAATTAGTATAACAACATACATGAAAATTACTACACAAACAAAA
AAAAAGGAACGCTAAATTTTGAACCTTATCGAGTGTAAATTCTGGATCCGTCTTAGCTCAGTATCGAACAATTTTTCAAAGTATACGAAACCAAGTAGAT
TGAAATGAGTCTTGATAATGAACCATGACCAAAAGCAACACCAAAAGCAAAGCAATTCCCCAAGGAGATCCACCTTCTTGGCTAGCCAAATGGTACACAA
CAGGCCTTGTAACTCCTCCATAAGGATAAAACCATCTATTACTATCAATCATTATGTATACCAAAAGTATGATAAGAAAAGGTAATAAGAAAGACATAAG
CTTCATACTAGCCTTTGATTTTTCTACTGTTGCTTTGTATTCTGAATATGTAGACATAGACATCAAGAAAATTACTAAGCCAAATAAAACTATCAAAGCT
AAAGGAGGTGCTGATATTGATTCTAGGGTTTGGTCTCTCCAACTAACTCCTCTTCTTTCTCCTATGAACCAACCCATAATGATATATCAATATAATTCTT
AATTTTGAAATAAGAATGTTTTTTTTGTTCTTTGGTTTATTTTCCTATATGGAGCAAAGAGGAATATGTGATTATATATAGAGGAAGAGAGGTGGTGTCA
ACCTTGTGTGGTTGGAGACAGATGGAGCTTTACTTTGGATGTGGTCTAATCTGAGGTGGATTTTAGAATTTAAAATTTTATGAGTTTTATAATAAGTTTA
TAAATACTTTATTTTAGGTCGAGAGAAACAATCTCATTATTTTTTACGAGATAAGAGAATAAGGTATGCACACTCAACTTGTGAGATTATACTGAATATG
GTACTATTGTTATTATTGATTTATGTAGTAACTTCACGTTTTTTGAGAATTTATCATGAAGGCTTTTACCACAACTTTTTTCTTGTATTCGAGTTTGAGA
CTGATAATATGAGTAAGCTTCAACATCTTAAATATATTTCCAAATTAATATACAATAATACCTAAATTTATAGTCAAAACGAAATATTTAATGAAATTTG
GATTAATACATGTAAATCATCATCTGTACAAAAGTAATTAAGTTCATGTGAACTCATAAACTATAAGTTAATTTCCCCTAGATTTTTGATCATATTAAAC
TCATTATTTTTTATGATATAAAGTATAATATGATGAATTTAGTATCAAAAATCTTAAAAATTGAACTCCTAAAATTTAAATTCAAATATTCGTACTTGAT
GTGGTCATAATAAGTTATGGTATAAATTCTGCCCTTTTTGGATTCCATCAGTAGAAGACCGTCCTTTCTTTGTTTAGATTCTACACTTTGAGAAAAGGGG
ATTGATTCAAAGATAGTAAGCAAATGGGCAAATAAATAAAAAGCAAAGTATATATTCTTTTTTGATTATTATTGCGTAAAGTTACAAAAAAATATCAGTA
TAATTGGTGTCTCACAACTAAGGTATTGGTCAATTTACTTGTCCATTAAGTCTAAAGTTATTCTGATTAATCACCATCTTAATACCACCTGATTAAACTA
TAAAACTATTATATAATATAATTATGATAGATTATTTGGGAAGTGAAAGTGTCTGAGCATTATAGAATAGAGACGTGTTATAATTTAGGATTTGAATTTA
ATAGGTTCTTTTCAAAATTCTTAACATATGTTATGAGTTCAAATATAAAATTTCTTGATATTTTAGTGAATTTTTAGATGCATATTCACATTTGGTATTA
ATAGAAAATTATGACGTTAGATAAATCTAAAAGTCAAAAGATTACACCCGCTCAAGAGGCTAAAATTCAACTGTTCTCAACTAGGAAAGCTATATATATT
GAAGTAAATTTAATTCGAATGAATACAATTTTATTATACATTTTTGTTAATAATTTCTGAGAGATAATTGAATCGAAACAATATATTTAATTAAATTGTC
TTAAATTCGTACGTCTGAATAGTAGCAAGAATGATCACAAATCTACCTAGAAAGGTACAACGTGTTTATTTGACCTATAAAAAGACATCGATACAGAAAA
AAATATGATTACCTCCAAAAGGCGGAAAGTATAACGAAAATCTTTTTCCATCCTCCTTAATTCTCCTTTTATAATTCTCACATTATAATCAATGGATATT
TTAATTCTCACATTATTTACTAGAAAATTAAAGATTTCAACGAAATAGTGTTATGTGCTATGAGACAAGGTGTATTTACTTTAGGGTATATAAAATTATT
AGAGAGGTCCTTTTGATATAAATTTAAAGTTATATTTATCTCATTTAATTATTGATATTAATAAATAAAAACTTACACAAATTTAAACCAAAATTTTTAT
ATTAATTATATGGGATGTATGATGTATCACTGATGAAAGAGAGGCTAAAATTATATCCTTTTCCATTAGGAAAAAGCATAAAAAAAATATTAAATTTAAA
ATTTTAAACTATTTCCTCAATTGATCATACGTATGTAGGGTAATTGAAGATTTATTTCATCACTATTCGCCTGAATTTTGTATATTTGAACAACAAATTT
GATGACAAATGGCATGCATGCAAGGATGCAAACGTATTATTTTGATTTAAAAAATTGCTCATATTTCATGATTTTATCGCAATCACAGAAAAAACTTTAT
GAAAAATATAAATATAATCTTTATAATCTTTTTTCATCTTCCTTTATTCTCTTATTATAATATTCATATCATAATTATATGTGACTGGTTTGTTCTCAAA
CCAAACTGACCCCTAAAGAATTGAATGTTAAGCATGATAAGTCAAGGTACATGAGAAAAATCTAGGTCCCAATAATGAACAAACTTTAGCCTAAAATTTA
ATGCAAAATATTATTACGATGAGTTAGGCAGCTTAAATTGTGCCACTTACTAATAATTTTGTGGATGAAATGAAATGAATTGTTTTGATTCAGACAATTG
ATTGAAATCTTTACATTATTGTTTTATACTTATTGGTTTTGCAATCTCCAAGTCAATGCATTCGATCAATATTGATATTATCTTCATTTTAATTTATATA
ATATTGTTTAATCTGACATAAAATTAAATAAAAAATATTTTTAGAATTTGTGGTATAATATGCTTCAGCATTTTCTTGAATGAACTGGAAACTTCAGCAT
ATTTATTTTTTAAAAATAAAAGGGACAAATAGTTATTTGTTAAAGTTGTTTCATACATATATAACGAACCAAATATGTACATCTTTTCCACTTTAATTCT
TAAAGTTTTTTTTTTTTATAAAAAAAAGAGACCTATTCAATAATTGAATTCTAGTACCATCTTGGGTTCATCCAACATCTTTGCTATTTGGTGAAAAAGA
GAAAAAAACCTTTGACATTTAAATAGGCAAATTTGTATAAGAAATACTATTGTATATATGGTTTATGGATCAAAGTCAATTTCTTGAAGATATATATTAA
ATTTTTAAATATTGTTAACAAAAATTTTAGTTCCGCCGCAGATCCTTTCACGAACCAGAGGGAATATGAATTAAGAATTTCTTAGATTATTCAAAATCTC
AATTTATTCTTCTTTTTCTCTTAACATTTGAATACATCATTTTACTCTATTAGATACATTACAACTTTATTGTATACAATATATTTGATACACATAATTG
TTGATACATAACCTCAAATCTCAATTATTTCAAACCTATTCAATATGAATCTAATTTAAAATCATGTATCATCATGTAACGTACGAATAATGACAATAAC
TGTGAGTTCTGAAAATTCTAGATTATTGTAATTCGGGAAACTTTTGAAATATGATATAATTAGCGTCCGGTACTTTATACATAGTTGAATCATGATCTAA
AATTCTGATTCTTAGCCCATTTCCTCCGTATTGGGCCTCTATCATGGATCATTTACCCAAAATTGGGCTTTTCACTTATTGGGCTTAAAACCCGAGAACC
TGGAATGCTGTCTTAGGCCCAAAATCAAAATTACCCCAATTGTCTCCAACTTCAAAAAAGCCAGTTAACCAGAAGACCAAATGCTTCTTCTTCGTTGAGA
AACCCTTCACACTTCACATTTTTACAGCTGATTTTTTCGAATTGAATCCTGAAAATGTCGTCTGAAGACTCAAAGCCAGTGAGGAAAGTGGAAAGTGACG
ACGGAGAAAGCATTGGGTCTCTTTTTAACAGCAAAAAGAAACCTAACAATAATGCCGCTTCAAAATCTCAGCCTCTCAAAAAAGCTAAGATTAAGAAAGA
AGAAAAAGATGATGATTTCGAAGAACCCATTTCGAAAAAGAGTCCAAAAATTGTTAAGCCCAAGAAGGAAGAACCTTCACCCGTGTCAAAGAAAAGTTCG
AGTAGAACTGATAAAGTTGGTATTTTTATTTGTGCATTTTTTGTTATTTTACTGTTTGATTTGTTGGTTTTTTAATTGGGTTTTTTGTGTGTAGAAAGTT
GTAAAGAAAGAGGAAGAGGATAAGAAGAAAGGAACCAAAAATGGAGACACCGTTGTGAAGAAGAAGGAAAAGAAAGTTTATGATTTGCCTGGACAGAAGA
GAGACGCTCCTGAGGAAGTATGTTCCAAATTTGCATGTTAAAAAAAACATTTTTTATGGTTTCAATCTGATCTAATGTTATATTTTTTGATTTTCAGAGA
GACCCTTTAAGGATTTTCTATGAATCCTTGTATCAGCAAGTGCCAGAAAGTGAACTAGCAGCTATTTGGTATAACATTCTACCTTTTAAATGATTTTGAA
TAAGTTATTCTTGGGTAACTCTCTTGTCGTTAGTGTTTTTGAGTATCGTGATGAAGCTGTCTCTATCTTCTTTGAGTTGGTGTTGGTTGAAAAAAATGAA
CCTTGAATATTATTATGTTCTTAAAGGTCAAATTTTGTTCTTGTCCTAACAGTGTGTGTGTTATCCACCTGGTTGATGCTTCTGTATTAGCTCATGCTTT
CATTTAGCGTTCACTTTGTCGAATGAGTAACTATTCTTAGTCTAGTTGTTTAGATGTGTTCATTTTCAAACTGAAAGAAGAGTAGGGGTAAGAAACTTCT
GTTTGTATCTGGGTGCCCCTTAGATGCATAGTGTATTTTTGCGTATTGTACAACAGATAGTGAAATATGAGGTGTGTTGCTTGAATGTCAACGTGTGTGG
AAGAGCAAGTTGGCTGGAAACAGCTAAAGAAAGCTTGTGAAGTAAGCAGTTCTATGTGAAAAGAATAGCCCACACTCGTAAACTTATATGTCATTTTTTC
GTCCCTTTTTTTTTAGTAAAGAAGCATCAGCATGATAGAAGTTGCATGCCTACAACTGAGATGCTTAGTGAAGTTGCTAATTGAGTAAGTATCCATTGGA
CAAGGAAATCTGTATCTTGACTTGGCCCTTTTCGCCCAGTTAAGTACAATACATATTTGGCCACCTTAGTCGTAATCTAAGAGGTTAAGCTTACTATGAT
CATCTAATGCGCTACTTTAGATTTGTTATAGGAAAAAATCTACTTTAGTTTGAATCTGCAGAAATCATCTTTCAAGTGTTTATTTGAACATAAGAAAAAA
TGAAATTATAAGTATATAAGCTTTGTTATAACTTCATTAAAACTTCCGTCTGGAATGAGAAAATGGATTGTTTCAACCCTTTGACACTATATGATGAGTT
CAGCTGACTTCTGACTGAAATTGTGACATATCTAAGGTGAAAACTTTTCTGGTAGTGCATTTTTCCACTTATTGACTATGGTTTGATATCATCCTTATGC
AAAGCACTGTGTCCCTGGGCACAAGCTTTTACATTGAGTGCTTGGGGGATTAAGTTAAAGTTGTCACCAAGAATAGTTTGTGATACTAATGAGTGTTGTT
AGTGGTTATAATGCAAATTAATATGCGTGTCTGAAGCTTAAGATGTGAGTTTAGACTGTTTAGTCAGCTCATTTGACATGATTTTGATGAAATATTGGTG
CAATTACTTCAACCAAAATCCCAGGGCTTACTTATGACTGTTCTGTTGCAGCACATGCGATGAAACTATTTAGCCCATTCTTTGCATTATCGTGCTTAGA
CGTCACTCAATTTCTTGAGATCTGCTGTGGATTGATGCTAAAAACTATGTCTAATGTTGCTCATCTAATCCCTGATACAAATTGTCACTCTTCCCTTTCT
GTCTCACTAAATCCACCCCGATCACCAAACAAGCATTAGAACTAACATAAATTGAAGTAGTTTCTCTAATGAATTTGGCAGCTGTCTCAGTCTATAAATG
TTAATAAAGCTGGCCAAACAATGTCTATGCATGAATGGTTCCTCCTCATCAACCCTTTTGACCATCACTGATGCTACAGAAAGGATCTCGATGGATCAAA
ATGTCTGCTTGCAACTGTTAACAACCAAATCCAGAGTTGTTCATGATGATTATAAAAACTACAACTGTCCCTTGCAGTTGGATTCAAGTAATCATATCCT
GATACTGTTGTTCTTGCAGGATGATGGAGTCAGGTTTGCTTCCAAAGGACTTGGCGAAGAAAGTTTTTGAGAAGAAACAAAAGAAGGCCCAGCAGCTAAA
GCTTGGTTCACCTCTGAAAACGGTTGTGACTGTGAAAAAGACCACGGAGTCTGTTACTATTAAGAAGACAACATCCTCGTCAACCACGCCATCAACACAG
AAAAAGAAAACACCAGATTCTGGAAAAACGGAATCAATGCAGCGGTCAAAGAAACGGAAGCTTAAGGATGATTCTTCTGAAGAAGACTCAGATGATGGTT
TCATTGCAACTCTTAAAAGCACAAAGAGACAGAAAGCCTCTTGATGTTTCTAATGGCTTAGTGAAATTGTAGATGAGAAATTAAATACTCTGTTACATGC
ATTTCAATTTCTCCATTATGTAAAAGTTGACCTTTGTTCTCTCATTTTCTCCATTGTGTTTTTCCAGGCTCTAAACTTTGAATACAATTAAAAAAAAATG
TATCTCAAACTTCATTCATTGCCCTTAAGAAATAGGGGCCAGACAGGAGCTTAATTACTTCGAGTATTTATGACTCTGATGGCAATACATGACCGGTGAA
TCTTAGCGCAAGCACTAGAATAGTTGAAAAATTCTAAGTAAACAATTGATATTTCATTTCACATAGAACTAAGAGAAAACTATCCCATATTAGCATTTGA
TTATTGAACATATAAGCTGGAAAATGAATTTAAGATAACGAACCACATCGGAGAATGAAGATAGTTATGGGCTGCTTGGGTAAAATAAAGAATGAAAAAC
ATACGATATGATAAATTATGATCCTTCAGGCAAGTTTTAACGGGATGTGATGAGTGGTCAATACTCGCATTAAAATATGTGAGAAGGGTGTCCAGGCTTA
GCCTTTTACGACAATTTGGGCGCTCTCAATTTTACCAATCTGATCCCTATGCTTGAATTATCTTATAATCCCCCTACCCCAACCCCTCTAAACACACCCT
CCCCATAAGTTAAATTTTTTTAATTTTATAGAACATTAGTTTGTTTTATAACTAAATTATAAGTTATTTACATTTTTTATTGGAATGATATAAACTATAT
AATTAGTGATAATTTAGACCAGATAAAGAAAAACTCAACCGTCTAGTATTTCATGTAGAAAATTCACAAACAAATTAATAGTTCAGGTATACTATCATTA
TCATTGAACAATTCGACCATGAGTGATGGGATAAAACATTAAATATTACTCCATATATCACAAATCATAATATTTAAAGAACAGTTTTGTACATTACTCA
TATTTCAAATTGTAGACTTTGATATTCACGGTTAATTAGGTAAGAACTCAGAATTCATTAATGATACATGATTGATCTCAATCTATGCCAGAAATCTTAG
AGACACACTTATACTATATGCTAAGGTCCTATTACCTCTAAACTTATTTTATTAATAATTTTTTATCCCTTTTTGGCTTACGTGACACTATCTTGTGGGC
CCAACGTTGATTGACTTTTTTTTCAAGATAGTGTCACATAGGCCAAAAAGCGATAGAAAACTATTTATAAAATAAGTTCGGGAATAATAGGACCTTAATA
TAATATAACTATATCTCTGAAATTTCGGGCATAAAAGGAGTACTTGTGCATTTTCCCTATAATATATAATAACATTCCTTTTTTTATAAACTAATTTTTA
TAATCACTAACTTTCGCAGAGATTATTTCATGAAACATTCGTACATGTGAAATAATTTCATACAAGTAATAAAATCAAAATAATATTCCTTTATGTATGA
TTTATAACAAACCAATATTACAATATTATATGTTTGTCTCTTCTCAATATTGGTTTGTTATAAATCATACATGAAGAATCTGAATCTCACTATAAAGAGG
TGATATTTTACTACCTCTTTGTCTATGGACTAGGTATTGAATAAAATTTTTATATCTCTCTATATTGAAAATATTTAGCAAGACACCTATATTTATATAC
GAATAAATTAAATTAAATAATTTTCATAAATATCATAAATAACAAATTCTAAACTACTAAGATATCTTATTCTCAATTTGTTATTATGTGCTCAAATCAA
ATGAATGATTATATATTATAGACGTAATAGCATTTTAGTTAATGTAATTTGTACTTCAAAGAGAGGTTTAACAAAGAAACTTAGGTTAGAGAATCCAAAA
CTTGGGTAAAATGTTAAGATTTATTGAAGATGAGTCAATAACAAATAAATATGAAATAAAAGACAAAATTTGGAGCATTTGTGGATATGCTGTACTCAAT
GATTAGTAAGTAAAATATCTTGTAGTAGTGAATAGAAAAACTGACACATCCCTACTTATTTACTCCACCATTTATGTCTCTACACTTCCCTTCTTTCTGA
TTCATTACTACAATTACTTGTTCAACAAGCACCTTTTCCATTTACTTTTTACAACATGATTACATAATTAGATAACATTTTCATATATTAACTTTATATA
TTTTAGTTCTCATTTATATGACACATATTTAGAGCGTGACTACTTAATAAATTGAATTGGTTGAGAATTATAAAGTTTCAGGTTCAATTTTATTTTGAGA
CAAAAAATACTTGGAGTTGGTGAGATAGGTATCCTGTTAAATTAGTTAAAGTACGTGAAAGTTAACGCGTACATCACAGAAAAAATAAATTATTTGACAT
ACTTTTTAATTTAATTACGTCCTAGAAATGATGTCACGTTTCTATTATTAAAAATAACTTAACTTGAAATTACATATTTATCCTTAGTAAAATTGTTTAT
TGCTATACAAATAATCAACCCGTTTTAGATCACAAATTTAAAATTAAAAAAATAAATAAAATCAAACCTTAAATTAAAATGAAAATTCTTTATTAAATTT
TTGCATCAAATTAGACTAACAAATTAAAATTGAAAGATTAGTATTTTTTTTTTTATGTTTAACCAAAACTGTAAAATATTAAAGAAATTAATACTGTATT
TCAGAAATTTGGTAGCACGTGAAAATTTGACTTGTTTAACTCTGTATGCATTTTATTGAAACAGGCTGTAGTCTTTGAGTCTTCCCACCTACCCCACCCC
CCAAACTTTCTGACACGCCACTTATAAAGAAAAATAAAATAATAATAATATTGAAAATGAAGAAAATTTATAAGAAAAATAAATATGATAAGTATTTGGA
AATATTTAAAGTAAATTATTAGTTTCAGTTTAAACTATTGATAATTTTAAAAAATTATTTTACTTAACGAATAAAACTTAGATACATATTGTTGTATCAT
ATGATATAACAAGTAACCTAAAACTCTAGTAAGAACATGAAATTCTTAATAAAAAACTGATAGAAGTATTAAAAATATTCCTAAATTTAATGAGAATTTA
AGGGTATATTTTACTCATATTATAAAACTAAATATTTAAAATTTAATTAGTCAAATAAAATATATTTTAAAATTGTTAATAATTTTAAAATAAAACTGAT
AATGCCCGTTTGAATTTAAAGTAGGGCAACTTTCACATATAGCAAACAAAAAATTCATATTTATATGCTATAACAAACTTTGCATAATTGCGCTCCATAT
GAAACATAAAACTGTATAATTCGCTATACATATACTCGTTTATAATTCGTTGGCCTAAATTGTATAATTCGCTAGCCTATTTCGCTGCAATTGTATAATT
CGCTATCCTATTTCACTGCAATTGTATAATGCACAATTGTATAATTCACTACCTATTTCGCTGCAATATTAAAGTGTATAGCAAGAAGATATATGTTTTT
CTTTCGCTTTATACAAAAACAGAAACACAATATATACACTTCTGTTGTATAAAGCTAGAGAAAATTGTATTTCACTTCAATTGTATAATTCGCAATTGTA
TAATTCGTTGACCTTTTTCTCTGCAATACTTGAAGTAAAATGTTTGTAAATTGTATAATTAAGTGTATAACACGAAAATATATATTTTTGCATGTGTATA
CACAATTTTCTCTCGCTTTATACAAAATAGAAACAGAATTATACACTTCTGTGTATAAAGCGAGAGAGGAGAGCGAGAATGGAGAGTGGCGAGCGAGATT
TCTGGGAAAGAGACGCTGGCAAATTTTAGCTAACGTTTGCTATGGAACACAATTAAATCAAACCTAGCTATTCCATTTATTTTAGGTTATTAATTTGCTA
TTATATACAATTTTCCCCTAATAATAACGTCCGTCGGAATAAATTAAGTGAAAAGAACAATATCCAATCATTTGATAATTTGAATCCACAAATTGATTAA
TTTAAATTGGTTTTTACAGTGCATCTATTAAAGGAAAAATAATTAGGAGAGATAGAAGTCCAAATACAAATTCAAAGTGTATTTTTTTAAAAAAAAATAT
TAAATATATTTACATATTAAGTTGAATTAATATTAATATTCATATTTCTAATTATTCAAAATTTATAAAATTAAAATTTTGCTCCACTTTTATTTCAAAT
ATTTCCTTAATATTAGGACTTGAGTCCAAAAACCTCTTATTATAGTCCTAATGTTATTCAGTTAATCTGATGCCAATGAAATTAATTTTAGGACTCCAAT
TTATATCTCTTATGACCAAATGAAAAAAGAAAAACTTTTCTTGACATAATTACAAGTAATTAATTACATTAGTCCCCTAATAAACTATTCAGATTAAAAA
ATAATAACAAATAATCATAATTAAGTAGTTAAACTTGTTAAAAGTACATGTTATACCATTGATTTGATGTATGCACTACTTTCTCTTGTTGACCTTACCT
ATTCTAGACTTTTCTTCATAATAGGACATATATTTGATTGAAAGTTAAAGAATTTCCTTTTTTGAATGTGAAGTTCAGAAAATGAATTTGAAATTAAACA
TTGTATATTTGTATTTTAAACACACATTCTTGAAAAATATAAAAAAATTTATGATTGTTTTTTTTTAAAAAAAAAAAAAAACTAACCAAAATAACTAATA
CAATGTATTATATATATGCTCATAATGTGTTATGTTTTATTTTAGGGAGTAAAACTAAATAAGCATTGATTAACATTGTAACATTTAACTTTTCATCATC
ACATTGATACCATAGTAATACATTTTGTATATATTTTTAATAATTATAAACTATTTGAATCAATCTAATTCAATCAAACTACAAAAAATAATGGAATTGC
AAAATAAGAAAATTAATATGAGATGAAAATAACTAAAAGCCATAGTGCAATGAATGTTTGACAGTTTATCTCTTAACTAGAGATCTTAATTTTTCGAACT
TTAATATGAAAAGAAGGAAAATCTTTAGTAAAAAACTAAAGAATATTCACTATTTATAGTATTGAACGTCGAACGAAAAATGAAAAGAAAAATAAGAATT
TTAAGAAGTAAGGAATTCTATTTTGTTCAAATAACTTGTTAGTTACATTACCATATGTAGGTTCATTCCCAAATAAAGAAAAAAAATAATTTTTTTTTTT
TTTAAAAAAAGAGAGGCTCAAAGCATAAACCCTAGACAACCCTCCCATCTCTATTTGTTTGCCACGTGTCATCAGCCACAAACTCCATGGATTTCTCCCC
CTTATTACCAAACCCCTTACCACTTCTCCATCTTCTTCTTCTTCTTCCCTCTGCTCTGTTTTTTCTCCCTCCTTCAGAACCGCCGCAAAATTCAACAAGA
ATGAAAAACAGCAAGCAGAACGAACTGTGTGATTTGTTTCGTAATCCATCTAAAGATGAAATTGAAGTAGTAAAAATTCTACTCGATCTCGAAAATCTAG
TGAGAGAAAGACAATATTGTTCGGTAATTTGGGGTTCCAAGAAGAGGAGATCTAATCGACGAATCGATTCTTCTTCTTCTCCCGTCGTCAACTCATCAAG
TAGTTCGAAAATCGATGGAAACGAAATTGAACCCAAAATTAAAGCTGAAGTTACTAGCCCTGCTAGCCCTGCTACTCCTCTTTCATTTTCCCCAAGTGAA
TCTGATGAAAAATCCAAACATTCTTCTCGCAGAAGCTATAAACGAAAGGTACTATTCTCAACCCCCTCTCTCTCTTCTTCTTCTTCTTCATGAATTCATA
ATTGTTAATTGATTTTCAAAATTGCTTTCATCGATTTCGATATCTAATATCTTTTTCTCTCTCTAGTAACCAGTTTCAATGCCTACCCTATTTCGGATAA
TTTTTGTTTTATGACATTTTAAACTTCGTTACAACAACAACAACGAATATCACAATTATGAATAACATATGCAGTGAAATCTCAGATTATTTTTGAAAGA
TCTTTGGCTATGAATTTTAAATCTTGTTGCAAAAAAATTGTATGTTTATGATTGGGGATTTGGTGAATGATTTGAGTTTTAAAATTGTTGATTGGTTTGC
AGACGAGGGAGGAGCTAATGGATAAAATAAAACAATTATCTCAATGCAGAGAATCGCTTACAGGGGTAAGTTTGTAAATTCCTTCAACATAAATTTAGTT
TTTTTTTTTTCAATTTTCTTTTCCTAAATTATCCTCTGTCTTTTTTTTTTAATTGATTTAATGGAATTTGTACAGGAAGTGGAGAATGTTCGTAATTACT
ACAATAATCAAAAAGCTTACAATATGAAGTTGAAAGCAATGAAAGAAGAGGTAAATATTCATCTCTATTTTTGGTAAAAATCTTTATTATTTTCTCATTT
TTTTGAGATTTGTGATCGTGGTTGCGTAATTTGTTCACAAAATTGATCATTTGCTACACTAATCAAATGAAAGAACGTTTTAATTTAACTCGTGATAGCA
TATTATTATTCTATTTTTGAAGTTTTATTATTAGCTTACGACAAAAAGTGTATAATTTAACTCGTGATGGCATATTATTACTCTAGTTTTTGAGGTTCGC
ATATTAGTTTATGTCAAAAAGTGTAAAATGATAACTTAATTAATATTTTTTTTAAGTTTGCTTGTTAGCAATCAGGTTAACAACCTTCTTCCGTATCGTT
AATTAAATACAGGTAACAAGAATGGTGAATTTCCAAGGGGGTGGTGTTAATTTAGGTCAACTTTACTCTAATCCTGGAATAGAGCCCAATCGTCAACAGC
CGTTCATTATGGATCAGGTTGCTTCAAGATCAGAAGCTATTCATAGATTTCAATACCCATTGGGCCAGCTGCAACAGGCCCAACATTTGTACTCAAATGG
GTTGGGCCCAGGCCCAATGGGCCTTCCTGATCTGAATGTTAAGGTGGAAGAGGCTTTCGCATTGGACCAGTTCGATATCGATAGAATGAATGTTGAAAGG
AAGGCCCAATATGCTGAAGCTAGAAGGAAGAGGAGGATTAAAAGAATAGAAATTAAGAACTCATCTGGTTTTATTAGACCACCAAGAAGGAGATAGTAGG
TAATTTTTGTATTTTTGATCCTTCCATAGAATGATAGTATTATTTTTTTGTGAGCGATACGGAAGGCCAATCGAGCAAAGCTCTATTTTTTTGCTTTGTC
CAATGTCGCTAAGTGAAATTGTATCGTACATTCGTTGAAATAAGTAGATGAGCTATAATGATGTACGAATACTTTTCATTGATCGTATAAACAAAATATT
CATGTCTTAGCCCTTAGGTATCTCGTGAAATTAATGTGTGCAAAAATTAGCTTGGACACCCCCTAATACACTTCAAATATAACCACTTATTGTTGGTTTA
TCGATATATTAAAGAATATCTAATTATTTTCGTTGATTATTGGACGCGTTGATCTTTGTACTATTCAGATCAGAAAGGCATAATGGATCAAAATGTCTCT
ACTTATATTGATTTTGTTTCTGTCCTAAGTAACTTGGATACTTAACAGGCCCAAATTTTAAAACTGGGCTATTAACTAGGTCCACATAAAACTAGGTTTA
GGGTTTGGTGACTGCTGCTATTTATACCAACACTGGAGTCATCCAGAACCAGCAGCTCAATTTCTCTGTGACTAAAATTTCTGCCTTGGCTATATGAAAA
ATGTTTGGCGTCTTTTCTTCTTCTTTTTTCTCGTATTTATGTGCACATCGACTAATTTCACGATGACTCTTTTCTCTCTCTGTGTTATTTTTTCTTTTAG
AGTTTGATTGAAAATTGATTGCAAAAAGGGGTATGCAGATGATGACAATATTTTTGAGGATATAAGAAGCTCAAACTTTATTGGAGTTTGAGCGATGCTT
TTTCCTAATACTTCCATGACTCTGATGCATACCTTATACTTATTGCATTTTTTTCTTTGTTGGCGAAATTATGTTCTTCCATGGTGAGATTGTATTGTTT
TTTGTTGGTATAATTTCATGGTCGCCTTACACTTGGATTTCAATCATGTGTATAAAAGAAGTTTATTTGAATGAATTTAGGTTTAATTAGGTCTTATGAA
TCTAACCAATTCAGTATGTTTTGTGCGACTTCTCATAATTAAAGGCCAAATACAGTGATAGATTCTTTAATTTGATCTCAATTTTAATGTTGGTTTTTTT
ATTCATAAGTTAGATCCTTGAAAGCAAGGGAGAAGCTGAAATATAATTAAAACTTGTTTTAGTTAGATGTTCAATCTAGATATATTTCGGTTCTCCCCTT
CATAAATCAAAAATTGAATCAAGTGAATTGAATAACTGGAAATAGAAACAATAAGGGTCCGCCCCTTAAATTAATGGAGTGAAATACCATGTTTTACTAT
TTAATTTGGGGGATGAAAGAAGCTGAATGTTATTTTCCTTTAAAAACATTGATTAGTTAATCAATTTCTTTGTGTCATTTTTTTATTGGATATTTTGTCT
GAAGTACCTTTAAGGCTCATGAAATCACTTTATTGATCTTCCGAAACGTGTATAATTTGGTGAAAAGTGCCTTAAATTTAAGAGAATTGGCTATATGTTA
CGGACTAATTATAACATGTACTCAGATCATGGGCTAAAGAGAAATGAAATCTTTCTTCCATGTAAATATGCAAAATAGAATTCCGGAAGAAAAAAACATG
AATCAAATGTAATAGAATAACTGCTGGAGGAATCATATTTAGAGGAGTACGGATGCTAGAATAGTATGTAAGAAACTGCAATACACCAACAAGTACAAGA
AGCTACTGTAATACAGTATATTCATATAGACCAATAAAAGACATTTCATTTCTCAACAAACCAAACACAAAGTTCAAATGAAGAGAAGACAATAGGAAAC
ATAACAAGTTCACTTGGCAGAAATTGAACAAACCAACAATATATCAAATGTAGAGAAGTTTTTAGGATTGGTATTGATCATCAGCAACCTCATCATCATC
ATACTCTTCCTCATCATCTGCTGTAGCATCCTGGTATTGTTGATATTCTGCAACCAAATCATTCATGTTGCTCTCGGCTTCAGTGAACTCCATTTCATCC
ATTCCTTCACCTGTGTACCAATGCAAGAAAGCCTTGCGCCTGAACATGGCAGTAAACTGCTCACTCACCCTTCTAAACATCTCCTGAATGGAGGTTGAAT
TTCCAACAAACGTGGATGCCATCTTCAGCCCAGTTGGTGGGATATCACACACACTAGACTTGACATTGTTAGGGATCCATTCAACAAAGTAGGACGAGTT
CTTGTTCTGCACATTGATCATCTGTTCATCTACCTCCTTTGTGCTCATCTTACCCCTAAACATGGCAGAAGCTGTCAGGTAACGTCCATGACGGGGATCT
GCCGCGCACATCATGTTCTTGGCATCCCACATTTGTTGAGTAAGCTCTGGCACTGTTAGCGATATGTATTGCTGTGATCCACGAGAGGTTAGTGGGGCAA
ATCCCACCATGAAGAAGTGAAGACGTGGGAAGGGAATTAAATTCACAGCCAATTTCCTCAGGTCTGAGTTCAGCTGACCAGGGAATCTCAAACAGCAAGT
AACACCACTCATGGTTGCAGAGATCAAATGGTTCAAGTCACCAACTACACGAGAAAATAGGCAAAATTAATCATTTGCTTACTTAAACTTGCAGATCATA
TTATTGGTTACCACTAAAGAGAAACACTTACAACTTGGAGTAGTGAGCTTCAAAGTTCTGAAACAAATATCATATAGAGCTTCGTTGTCAAGGACCATAC
ATTCATCGGCATTCTCCACCAATTGGTGCACCGACAGTGTAGCATTGTATGGTTCTACAACAGTGTCAGACACCTTTGGAGAAGGGAAAACAGAGAATGT
GAGCATCATCCTGTCTGGATACTCCTCCCTTACCTTGGAAATCAGTAGTGTTCCCATGCCAGATCCAGTCCCTCCACCAAGTGAGTGGCAAACCTGGAAT
CCTGATCCATAAAACAAAGAATACAAAACAATCAACTACCACCCCTCAATCAACAAATGGTAATAATTGTGTATAAAGAGGGTCACAAATAGATGCATTA
GACATAAAAGTATTCAATTAGATAATATCACTGTCCAGAAATTTCAAGACAGAAACAATATAAATAAGATCTTAGATAAATTTCCAAGAGTATAAGGAAA
AGAAACACACGACGATTGACTAGTATTACCATAAGTAAGATCCAGACACATCATAAATCTCAGTACTCGATCATGCACTCTAAGAGAGTATGAATTCTTG
TGAGATGCATGATGAGAAAGTTAAATTTATCCTTCTGCTAGACTATACAATTTTATGCCACTCATGTGTGTGCTCTATGAGATTCAGGCTTTATATGAAC
ATTCAAATGTGCACATATGCATCAGCATTATTTCTACCCTGAGTCAGACAAGTTGTTAACAGCAAATATAGGCATTTTCATCATAGAGCATACGATTACG
AATGAGTAAAAGAGACCTGTATATGACCAACTGTGCTACCATAGGTACATTCATAGAAACAACAAACAAGCATTAAACAAAATAAAACAAGATCAAATTC
GGTTACATCTAGGTTATATCGACTATAAGCACATACATCGGACCAATTAGCATAGGATTTGAAATGAAAATGAGGAAGAGATCTAGTATTGGCACTTGTT
AACTACCAATAGGAAGAATCAGTACGCAATTAGCAATAAAATCGAAAACAGAAACTAAAGGCACTGTCAACTATGAACTCATACATCGGGCAAATTAGCA
TAGGATTTTGGAATGACAATAAGAAAGAGATCTAATATATGCAGTGTGAACTACCAATCGGAAGAATAAGCAAGCAATCCGCAATAAAAACGAAAACAGA
AACTAAAGGCAACAGGCACATTCATAGAGGAAATGAACAAAACCTTGCAAGCAATCACAATTCTCCGCTTCTTTACGAACAACATCTAGAACAGCATCAA
TCAACTCAGCGCCTTCAGTATAATGACCTTTGGCCCAGTTATTACCAGCACCAGACTGTCCAAAGACAAAGTTATCAGGACGGAAGATCTGTCCATAGGG
ACCAGATCTGATACTATCCATCGTACCAGGCTCTAGATCCATCAAAACCGCCCTAGGAACATAACGTCCACCAGAAGCTTCATTGAAATAAACATTGATA
CGTTCAAGCTGAAGATCGGACTCAGCGGCGGTTCCTTTGTAACGTCCGGTAGGATCAACACCGTGTTCATCACAGATAACTTCCCAGAATTTGGAACCGA
TTTGGTTTCCACATTGTCCTCCTTGAATGTGAAGAATTTCTCTCATTTTCTCTTAGTTTTTTTGATGAAAAAAATTGATGAGAGGAATGAGAGAATAAGA
AGAAGAAGAGATGAAGATGAAGATGAAGATGAAGGGAGAAATGGGAAAGAGAGTGATATTTCTAGTGGTAATGAGGAGAGAGGCGGGAATACATAAACAC
GCAATAACTGATGGACCCTACATTATAGGCTGAGAAGAATATGGGTCCCCCGATTTTCACCACCGATATTTTTGGCATCCATTATTTTCTTTTTGTTCTC
TTCTTAACGCCCAATAAATTAATTTATCATCTCAAATAAGTATTTTCTTTTCTTTCAAAAAAAATGTGTATTTTTAGAAAAGAAATTAGTTACTAGTTAT
TATTTTTAGTAAATGTATATAAGATGTTATGAGAAAGATATATGTAATGTTTTGGGTGTTTTTTGATAAATACCTTTATAATTAAAGGAATTAAATGTGT
CTTTTTTTAAGGAGATGAATAAATCTTAATAGATTGATAAGTGGTAATGCGTATATATAAAAATGTTGATTTAGCGTGTGAATGCATTGACCATTTGAGT
TATTGCGTTGAAATGTAATATTCCTATGTTTTTTTGTTTGAGTTCAGTCAAATTCAACGCATTTACTATACATTTAGCTTAGTCATTAAATATAAAAAAG
AATCTTTAAAAGGACAAACAACACGAGATGAAATAGATAGTTATTAAACATAATGCATTCAAATTTATATATATTATCAAAAATAAGATTTATTTTTTAT
TTTTTTCGTCTATATTTGATGTATAAAACTTTAATTAAAATTAAATCACACACTGTAGGACCTATTACTGGATGGTGCTTTGAACAGTTTGAATTATAAC
CATGTTGAGCATGAAATTGTCTTATTATCCTTAATGTAGCTCCTCATATATATAGTAAAATGTTTAAATCGTGATCAAGTTCTCTACTCAACTTGATCTT
TTTCTGTTTTTGCTTTGATTTGAATTACTCTATTTATTAACCTTATTGTAATCACTTAACACACAAAGCCTACAAACTAGTTCTAGTTTAGATCCAATCA
AATTTTGTCAAAAAGTGTTGAAGAATATTTTGCGTTGAGTTACTAGAAACAATTTGGAAACTTAAACAATCATTTGGATCAAGAACTCAATTATTGTCAT
TTCATTACTGTTTTCACCTCCATTATTTCATTCACGTGGCTATGTTTCTTTTTTATTACTAATATATAAGTTTTATCACGAGCACAAACCCCACAGCCAG
TGAGGTATTTATGATATTTGTGGTGTTGACAGCTACTGATATTTTGTCTCAATTACTACAAGGTTTGTCTACTTGCAATATTTTTTTTCAAGTATCCTAT
CGTGATCACCACCTAATATTATTTTCACTATGTTTTTTTATTTATGAGATGCCAACTCCAACTATTGTACTAGATGGGGACAACAGCAGAGTTTTAGATC
TGAGTAATGGTACACTTCAATGCTTGAGCTCATCCACATAAAACTGATCTAAAAAAGATTCCTCATTACTTTCGACTCGAACTACTTTGAATGTGTTTTG
ACTTCATCAATTCGTTTTTGATTAGTCGTGATCAGCCAAAAATGCTAATTTAACCCTGTTTAAGACGATCTATCGAAATGTGACTGACAATCCAGAACAA
ACAAAATGACAAATAGGTAATAAAATTTACTTCTTTACCTTTTTTATAATGTTCAAGAGTATACTTGATTCAGAGGATCTGTAAAGTTTTTCCATTTGTT
TGAAAAGACTGACAAGGGCATGAATACAACACATACTTGTATCCTATGTTGCTCCGACTCTGAGGAGAACTCCAGATGTAGTGCATTTTTGGAGGATCCG
GCATGAGGTGTGGCTCTTGTTTCGGAGAGTCCACGACAACATAGCTTTTATCATAAAAGCCTATTCATTACAACAGACGAGAATCACAGAAAATGTTACT
AAAATAGAGTTCAGAAAAACACACGAAATTAGGAAGTTTATATGTCCTTTGGGGTCTTTCTTATGCACATCTAGAAACATTACAATACAAAGATCAACAG
CTAAAGACTTGAATACAGGACATCACCAAAATGTAGAACAAACGAATTCTTGTAACAGCTGCTTTCATCGATTCTGAAGCATGGATTCGTTGCAGTATTT
CTTGAAATTCAAGCATTCTTCCACAATGAAATCACTACAAAATTTGATTTCAGAAAGTCGTGTTAGTGACACAAATAGCAACCTTTTTCATCATAAAAGC
AGCAACAAGTGGAAACTTACAAGATCCGCTCAGCCATATCTGATGTTTCCCATCTGGGACTCCACGGGTACTCAGCAGTGACTGGAGACTTGATGGGTAG
ACCTTGAGAATTAAAGTGCTATACAAACATGCCAGTGCACAGATATGAGCACCAAGTCAATTGATACTACAACAACAACTACTACTACACCTCGATACCA
ATCAAGAAGCACAAACAGATGAGTAGAAGGGAAAGATGAGAAGTATGCCACTCCTATCACAGAATGGCGGGCAAGAATTGGGGCATAACCACTACATTTT
TTTCACAAAAAGGTTCTATGCCTAAATATTTACATGTTCATGAAGGCAAACTAAAAAACGCTCGAGTATTACAAACAACCATACCAAAATATCTAAAATC
CTGTCACGTTATCTTTCTTAAAAAAATAAATCCTGTCACGTTATTGAACAACAAGATCAACAACATAACCAGTGAAATTCCACAAGTGAGGTCTGCAGAG
AGTAGAGTATATGCAGACCATCGTACCCCAACCTCATGGAGGTAGAGAGGTTGTTTCCACCCTCAGCTCAAGTGTGGCAAATAAAAAGAAAAGGTACATG
GAGGAAAAAAATAAAATATAGTAAAGGTAAGAAGGCACCAATATAGTTCAAGGGGACCTAAACAAACTATTTACCTGGGAACTCTGAAGCATCAAACTTG
GCTGCTGCTTAGGGAACTGAAGTGGGATGGCAACATGAACCTAAAATATAAAGGATATTATAAGATTTATCTACTAATAATCGCTCATCAATAACATTTA
GATATAAGCAGCAGAAGCAAAGATAATCAATCAAGGGAACATGGTCTCCAGTCAGCATGTCAAACAAAGCTT