BAC Sequence – LE_HBa0305F14

>C01HBa0305F14.1
TTCCAAGTAGATAAGTAATCCTGACGCAGCCTTTCAGGCAGTTAAGAAATGAATGTAAACATTTCTTTACGGACAGACATATTACACTTCAGTCCAACTC
TAGTCTTTTCTGTTTTATAAAATGTTTCTTTAGTAAGCTGATTAATAAGTTCCACAAACTTGAATCTTTATTCTTCTCCTGACTCAACTGAAAAAGTGTT
TCAAAGTTTTTACTGATTTCTACTTCCTGTCGTGTAAAAAAAAAAGTTGTTATCAAAAGCTGTTTAAATTGTTATGATTAATATTTGACTTTTCCTCTGC
TTCAATCCCTCAAAATTTGATTAAAATGAACAAAAGAAATTACTCCTGCTCCTGAGAATGAGGATCGGGAAATCCCTGAAGAGGAAGCAGTTTGTAGGAT
CTGTCTGGCGGCATGTGATGAAGGCAATACTTTTCAGATGGAGTGCAGCTGCAAAGGTGACCTAAGACTTGTTCACGAGGAATGTGCAATCAAGTGGTTT
AGCGTAAAAGGGAACAAAATTTGTGAGGTTTGTAGACAGGACGTTTCTAATTTACCTGTGACATTGCTGCGGATTCCCAGTACTAGTCAACATGATAACA
GAGCGGAGCACAACAATTCTGGAAGAATAAGGTAAACATCACATAGAAAAAAGATTTCTTTCACAGAGCTGTTTAAATCCATATTCTGTTTTTCTTTAGT
TTTTGTGTTGATTTCACAGAGCTGTTTAAAGAAGTTTCATTTCCAGTTTCTCTTTGATTTTTAGAGTTGGTGGCTTCAACAACTGTCTTCATTTGATAAT
ACAAACTAAAGTGAACCCTTAGTTGTGAATACTGGGAAGAAGCTCTAAATACTGGATGATGGAGCAAAATAATTTGTCAGTTACTTTGTTTGTTTTTGAG
TCTAATCAAAATTGAAATTTCTGTATTGCAGTGCTTGGCAGGACTTTGTGGTGCTTGTTTTGATCAGCACAATAAGCTACTTCTTCTTCCTTGAGCAGTT
ATTTGTGAGTTCTTTTTCTTTTTCTATCTTTTGGGTATAATTTTTTTAAAAATTAACATTGGCTTGAGATTTCATCCTTGGGAAGATGCCAAAATCCTTG
AATGCACCTATTTCCATTTTCCAACTGCTTGCTTATCGAAGACTTGGACGGAGTAGTTCAATAGGACCTTTTGTTAGTGTTATTGTACTATGTGCCACAA
ATTACATTGATCAAGTTCTCACATGAGCCACCATCCTGTTTCCTCTACCATAAATCCAAAAACGCAGGGAAACGATAATGCTTCCCCAGTGGTGGAACTT
GGGTTTGTTCGAGCGAACAAAAGTAGGAGGAACTTAAAAGTTACATAAGTATGAAAGGGATGAAGAGTCATACAATTTAGTTGTTACTTGAGTAGAAGGC
TATAATATAATGTTTTTCTGTTCCTTTTTTTGAGGGGGTCGGGGGGGAACCAGCTCCCCCTTAGTTCTGCTGCTTGAATGCATGTGCTGCAGGGCGCAGG
CAAAGGAGGGGCAGAAGATACAGACTTCCTATATATAACCTGTAGGGGTGAAACTTATTTGACTTTTAAATCCAGAGTTTGATACTGGTTGCATAATATG
CACATTTTCTCAAAAATGGAGATGATTGAATAAGTGAGACATAGCCTAGTAGCAAAGGTATCCTCCAGCTCCAACCATGACGTTGAGGTTTCAAGTCATC
AAGGGAGCAAAGTGGATAAAGACATTTTTGCTCCTATTGAAGTGAGGTTTACCCATAGAGGTGGTAAATGAGCAGATTGGACTGAAGTTGGGTGGGTCAA
GATGGGTTGAATTTAAATGCATGGGTTATTGATCCGCCAAAAGTTACTTGGGTTGGGCTGAAATGTAGGTCAAAACTCAATCCCCGCAATTCCTACTAAG
TTTTAACTGTTTTATTTGTTCTTCACTTAATTTTTAGTTCCTATATATATTTTAACAAGATTTCTCATGGATCAGTTTAGGCTAGTTATCAACCCAAATT
TTTGATTGGCTAAAATGGGTTGAGTTAATAAATGGGTGAGTCAATAATCAGAAAAACTTGGGCGGGTTATGATTTTGGGTTAATTTTGCCACCTTAAGTT
AACCACATCCAAGAAAGAGGACATGATTGTGAAGCAGTGTACATAAGGCTGACATGGCTTCTCATCTACACTGGCCCCCATTTGAGAATCAATTTCTTTT
TTCAATGAGCTCCCCACTGAGCCTGGTTGGAGAGGATGAATGATGTGAACTTGTCTTTCTATCCAACATCCCGTTAAACATAAGACTACCCTGGTCTCTG
CAGGCATTTTGATATTACACTATGTTGTTGTAGCACGAGCCTTTGAAGCAACCATTGATGTTTGCGCTATGATAGTTTACATCACACCCCTTAGAGTGAC
GACCCTTCTCGCACCCTATTGTTAGAATCTAAAGTTTATTGGACTAATAATTTTGGCTATATACTTGTGTTAAATTAAGATATATTGGTCCAAATAGCTA
CTATAGGCTAATATGAGTGCATGAATTATTTAAGTCCAATAAATATGGATTTAATTACAGTCAAATTTCATTGGGTTAGTTCATTGATTTGGGCTATAAA
TGACGAGTCCATTATGCTAATCCCAAGATTTCATGTTGTTTCAAGGGCCCAAATTGGTGTCATGTGTCAAATGATGTTGTCCGCCAAATCAAGTAAAAGA
GTCAATAGGATCATGTCACATGCCAAAATAACACAATATGCCTAATCAAATCAAGGGTCAATAAGGGGACAAACTCTTTTCGACCAATCAAATTGAAGTT
GGCATGAATATTTGATTGGTCGGAACATGTCACTTGTACATGTGACTCATTTTCATTGGTCCTTGATTTGACTAGGCATGTTGTGTCATTTTGACATGTG
GTATAATCCTATTGACTCTTTTTATTTGATTTGTTGGACCACGTCATTTGACACGTGCCGGACCTCTAAAATAAGATGAAATCTTGGGCTTAGCTACTGC
GCTCGTCATTTATAGCTCAAATCAATGGACCAGCCCAATAATTTAGTCCCTCATAGTAGCTATTTGGACCAATATGTCTTGAAATTAATATAGCCAAAAT
TATTTTAAGAACAAAATTTTGATTCATACACCTGCTAACACAGGATGCTTCTGATTGTCCTTCTTTGTTCCGTCACGATTCAACAGCTAAGATGCTAGGA
CCTCTGCGTTGAGAAATAGTTGATCTCAGATTTTGTAATAGCTCGAAAAATGAAAAACTACAACAGAATACATTCCAGGTGACTAAATAAAAAACTGCAA
CTTAATGGCATTTTCTTAAGTTGCCTAAACTTTCACCTTGCTTAGGATGCAAAACAAGGTCAAAAGCTTTTTTATTCCTTGGTAATAGTCAAAAACTATA
CGTGGTTTGAAGAATTGATTACTTACCCATTCTCAATTAAAACTTTTGAGTTCGCGTGCCTGTTATCAGCTGCATAGTGATGTCAACACTAGTGGTGTTG
AATGCACATCCAACAGCTTTTACATATTTTTTTCTGATGTAGAAAGGTGAAATTTGATGCCATCATCTACCTAGAACGTTGTCTTTATATTTTATTATTT
ATCGAATAACATTTCACATTTCAAGTCTTTTCTCGTGAAGGTTTTTTTGGATAATGGTAAAGGTTTTCTGTCTCTTGAAGGTTCATGACATGAAAACTCA
GGCGCTTGTGATTGCTGCACCATTTGCATTTACACTCGGTATTTTGTCATCCATTTTTGCCATCATCCTAGGTATGTCTGAGCCCCTAAATTTTATTTAT
TATATACTAGCCGATTTGTGTCATAATATTTTCATTTGAAATGCAGCTATTAAAGAGTACATATGGTCGTATGCCGCTTTAGAGTTTGCTTTTTTTGCTG
TTCCGCTATATGTTTTGTACTCTATGGTAAGATGCACTCTAGCTATTGTGCAGTTAATATTTGATAACTCTTAAATATTTTCTCGTCTGTCCATTGAAGA
TCCTATGTCTTCTTTAACCATCATCAAATATTTCTAGAGAAAAACCTCTTGAAACCTTTGAGATCTTTACAGTAAATCATTTTGAAAAAATGTTACCAGA
TTCACAACTCACTCACCCCACACCAACCAAAACCGATGCAGAAAATAATACTGTCTAAAGAAAATGTGCACAAACATAAACGTTTTAGCAGATATGATAC
GAGGAGTAGTAATGCCCAAAAATCTTGTCTTTTCGCAGCTTCAATTGCAGGCAGTCTATTCTATAATGATAGCATCAGTTTTGGGCTTTGGTGCTACTAT
GAGTATCAACGCAATGTACATCCAGTACTATTCTTGGCAATTCCAAATTGCAGAAAGTTCTAGCCCTGTATGACATGAGTAATAACAGAGAGATGATCAA
GTTATATAGGAGATATTGAATATGCTTTTCTTTGTATTATTCTATCTTCTTTTCTGCAACGATCTTATGTGATGACGCGGTTGATACCTCAAGAAATCTG
GGCTCTGGCAGATAAATGTGTATACTGACATAGTTACTGTAGCTATAGGTAGCCTTCAAATTATGTCTGCTGCTGGAGAATATAGTTAGCTCAATGAGGC
TGGGACATGGCCATTACCAACATCTGATGCAACTGGTTTTGTGCCCTTGTTAATCTGATAAGGTGTTGTATTCTCTTTGTTTTATAACATTTTAGATCTC
TCTTATGTTTACCAGTTACTGTAAGCTATATAGTTTTCTGCTTTCGAAAAGTCAGTTACGCGCTTAAACTATCATGACCTTTAAGCTATGTAGTTTTCTA
CTTTTGAGAAGTCACTTACACGCTTGATAGTTTTCTGCTTTCGAAAAGTCAGTTACGCGCTAGTTTTCTACTTTTGAGAAGTCACGTACACGCTTAAACT
ATCATGATCTATTACACACTAATCTTGTTTAAAGTGAATGTAGTACCCCTTTCCAAAGACAATCTCAATTTTTGTGTGAAAAGGTGTTAACATGCGCTTT
GGCACATAAATAATATTATTTTAATTTTATAAAACTTTTTGTCCTTGGTATTTTCTTAGACTTTAGCTAAAAACAAAAACCCTAGGCATTCTTCCTCCTC
TCACCACACATTTCTCTCTTTTTGAAATTTCATTTCTTCCTCCATTATTCATACATCGAAGTAAAAAATAAGAAATTTGAAGAGAGAACTTGAGATGGTA
AGATGATTATGAAGTTTAGGTGATGTTAGCGGTGGCGATAGGCAGTGGGCATCGTAATTATTGTCGTGAAACAAATAAAAGCTTTTGGATATATAAAGTT
CTTTTGAAATCTTGATAATTCTGGTTGAAAATCAAACATTTCATTAGTAGCTGGTGCTCAAGCAAGAATAAAGAAGATAGAAAATTATTTTTCTTCGATG
GATTTTGAAAAATTTAACCAGTATAAATTATAAAATTATAATCAGGAATTTTATGCATAAATGTCATAGGATTTTCAATAGAAGTCATTATCTTTCTTAT
AAAAAATTTTCGATGATTTTCTAAGGTGAATCTTCCAGCGGATTTGAGTAAAAATCATGAACTTTAAGTTAAAATTATTAACTTTTCATTGGTACTCAAC
ATCTTCCCCGCTACTTTTTATTTCTTTTTAGGGTTCCTCTTTAAGAGTAGAGTACTAGATATGTTTCCATGACGATAAATTGAAGAAATCATTGATGGTG
ACAAATGACTAGGATTGTCAAAATTGAACCCAAACATAGGTAATCCATTTAATCCGCCCAGAATTTTAAGGGTTGGGCTCAAGATAAATTGGGTTCAATT
TCAACTTATTCATGCATAACCCATTTGAAGAGAATCCTCAATTGAGCCCAATTCAATCTCCAATTTCTACTCGCTTTAAAACTTTTTTACTAAGATATGT
TGCTATATTTAAGGTATGAATTATTATCAATTTAACATCTTTTAGGGTTTATCAATCCATTTGTTACTTTTAAAAAAAATAATCGTGAGTTGAAATTCAA
ATTGTAATTATAAAAGTTAAATATCAATATGTTAAATTATTGAGATTAATCGGGTCAAATGGGCGGATCAAGACCCAATTCGTTTTTTAGCCTATTTGAG
CCCAACACATTTGAACCCAAAGTAAACTTGGGCATGTCAAAACCTAACCCAACTTCTATTTCAACCCATTTTAATATCCCCAATTTCAACCCAACCTGCC
AATTTGACACCCTTAAAAATGACCATGAATTATCAAAGAATTCAAAATGAAAAATGTAAAAGCTTTAAAAAAAAATTGGGGCCACTAATAAAACTTTATT
AAAAACAATTTTCTAACATAATTAATATATTAAAAATTATAATACTTAATTATATAATGACCAATAAAGTAGTGTAATGTGTTCAAATTTGTCATTTTAA
TATGTATTTTTTTCTTCTCACACACCTTAAAGAAGATGAAGACGTTTTCTCCTTCCTACCACCTTCTAAGGAGGTATTAATATCACTTTAAAAAAATTAA
GTGTAATAGGTTACCACGATAGTTTAAACATGTTATTTGAAAAGCTTGCAATGCTGGTCATTATCAGAGCACACTAAATATGTCCCAACTCTAAGCAACA
AACTAGTGATCTAATGGCATTTGAATCAAAGTGGATTAAAAATCATCTGACTTGAATTCTCTTTTTGGATGTTTCATTATTAGTCCGATTCTGAAGACAG
TTTTCAAGATCCAACAGAACCTTGGGGGGGGGGGGGGGGGGGAGCCTAAATTAAACTTGATTACTATACATTAGAGCCAAACTATATTTACAGATACCTA
CACTTATATAATACACATGCCCCTAAAACAAATTAGTAGGCAACAACACTCTAAGAGGCAACTAAACCTCATTTGCATTTCGCAATAGCAAGGTATTGAT
TGTTATTTTTCTTCATCCATACTGTTGAACGAGTTCTCTTAACATGATCTGAGAAAAGATGGTACCTGCAACAAAGATATAGCCGGTTACAGAAGGATAA
TTGGGATCAGATGGTGCAATATTATGGCGGCACCACTTATAAGAAAATGAGGATTAGAATGAACTTCCCATATATTCACCCCAAAATACAAGAACTTCTC
ATTAATATCATAAGAAGTGTAGATGCTGTCGAGATTAAGAAAACACCTGTCAAAATCTAGTCTCTGAGTGACTATGCCATTCAGCAGTAGTTCCGAACTA
TACACTGTTGATCCTGTAAATTTAACGAGGGATTTGCATGATTATTAAAATTTAATACTACTATAACTTCTTATTAATTACTATACTAGGCAAAAGAATA
AGAAATTCACCTTTCTCAAGGAAGGGGATGCAAACTTCATAATCTTCTTCACATGATAAAACTAGAAGATTGTCAGGAATAACTTCCTCTTTCATAGCAG
ATCTACAAAGTCGCTCAACTGCCTGAAAAACATTTCGAACAGGTGTTAACAAGGAGGGGGGGGAAATATAAATCGAACACATACAATTACAGAGAGAAAT
GCCTGCAAAAATAAAGATTGATTATGAAATTCTTACATGGATGATGTTATAACAAGAGAGACAACACATGCTGGTAAACACTAACTTCAATTTATTGGAA
GCCCAAGATGTTTGGTGTACTTCTACAAAGAACCATACAGTAAGAGTTTCAAGATTTCAAATCCATCCAACTTTACCACGGACATCATTTTGAGCACACC
TCACATATATATGATATCCAACATATTTATTGAAGCTGGTCCTGATCCATCATAACTAAGCATGTTGCATTTAGAGAAGATTCCTAGTCTATCATATCCT
CCTGGCAATTCTAATAAAAATTTAGTTCTATATCAGGTATTCACAAGGTTACAAATCTATGAGAACGCAGACTGAACATTCTAAATCACTTGCTTTGTAC
TTGACTCGGACCATTTTTTCTTTCAAAGAGAAACTCGGTAAACTACCACATTCCAGCATCAAAGATCATTTTCAGGTTAATGGATAGAGTATATAGAATG
CCTGGTCTAAAATGGCTGAATCACAAAGTTTAATGAGTGGTAAAGAGTAGAGGTACTCACCAAACCATGAACTGCCTTAACCAAACTTGCCAATATTTCT
TTACCAGGCTTTGTATTCGGAGTGATAAAAACCTTATATCCCTGAAAACAAGTACTATGAGAAAAACAAGCATGACAGCTGCATCTAATAGCCACCAAAG
GCTGCACCTTTACCTGTAAAATGGGATGTTGGCATGCTCGTGCTAATGAAACTGGCATACTGAAGCCGAACTCTTTTTCTTTTCTTGCATCTCTCAGTAT
ATAATTTTTCTCATCAATAAGACAGCTTGCTTGTCCACAACTCTCAAGCCATAGATGTGTCACCACAGGTTTCCCTGCAGCAATAGCTTCTAGCATATTT
CTAGTGCGAACAAATTCATCAGCCATAAAATGAGTGGCATCGGACATAGATGACGCACTTGAGGCCCCTAACCGTGCTATGATCTGGAGAAAGAGATGAC
AAGGTGATTCCAGTTTAGAACATAGAATTTTAGCACAAACAAGGTAAATTCATATCCAAATTACCTTTTTTTGCTGTTTGATTATATCTGGATCAAGGTG
CTGACTGAACAAGATTCGAACATTAGTCATTTCTCGCCTCTTCCTGGAATCTTTCAAGGTGGAGTCAACTTGTGTTCCAGTAGTATGTAAGGAAATTATT
TCTCTCATAAGAGAGGACCTTGACGTATTCTTCCTGCACGATTGCTTTTGATACTCATCACCCATACATATAGGTGACACAGAACTCTTCAGGATTTTTG
AATTGGTGGGAGTGGTGCATGCTGAAGCTGGCGCTTTACACTGGTCTCCTGTTAAAGATTCTACTCCATGTGCTTCATCAACAGACTGTTTTGTCGCTAC
ATCAGCTTTCATATTAGAATCTTCTGGGGACTTATATCGAAGTGCTTTTGTATTTCCATCAGCAAAAGCATCACTAATGTTGGTACCCTCTGGATGTCCT
TTATTTATGCCTTCATTTGATAGCTTCTTCCGAGACCCTCTTCCTGAGGATGCAATACCAGAGGGAGTTTCAGGTGAACACTTTCTCTTTTTGGCACTGA
CATCAATTGAAGTACTTGTCTGGTCACCACTTAATCTTTTTGACCTTCTACAAGGTTGAGTAGTGGCCTCTTGCCCCATGGCAGGTATCTTTCGATGACT
TCTTTTTCCTTTGGGATGGTCTACAGCACAATGGTCGCCCCACATTAATTTCATATTTCGGAGATTGGCCGTACGGTCAGCAGCAAATGTACCATGATCC
ATCAAAGTCTCACAAGCATCTCCATCAATCCCACTTCTATTAGAAGTGACAGCAGCAGACAGACGACTTTTTAGTTGACTTTCTGCCCGGTTGTGCCTAG
TTCGATGAGCTATAGGTGTAAATGAGTCATGCTGCTGCTGCAAATGACAATTCTTGACAGACATGGAACCTCTGCTTTCTTTTGGTGGTCTTTCAACTTG
TCCGAACTCTTCTTCTTTTCCCCTTGAAGAATGGGATATCGTCATATTTGCCTTGATCATTCTCAATCTGGCTCCTTGTTCATCATTGCCTTGCTTCTTG
CTACTTTTCTGTTGCTTCACTGTTTCTCTACAGTGCACTTCAACTAATTTGACATCCTTCTGCACCGACAATCGTGTAGCAGGTCGAGTGTCAGAAGATC
GTGCTTTTTTCTTGGGGGACCTTTGCTTTAACAGACTCTCATCATCAACTCGACCTTTGCAGGAACTTTTACTCAATGACTTATTACATTTATTCTCATT
GCTAAAATCATTTTCCAGCACGGGAACTCTGAAGCATAATGTTTCCATAGCTTCGGCAGCCATTTGAGTATCTAAACCAACATTTTGCAAGTCTGGAACA
TTGTCTCCATCACCATTATCAACCATTCCATTACCAGCCCCCACAGTGAATTGTTCATCCAGCTCCTCAACTAACTTCTTTCTAGATCTGGACTTTGATA
GCTCACTTTTAACTCTCACTTTACTTGACATTAACCTTGAATCAGAACAGGGGGAGCCCTTAAACTTTTTGCAGTTCAACATATGCTTTTCCTTTGGTCC
ACAACTTTTAGATCCCCGTCTTAAGGGGTCAAGAGAACCATGCTTCAGAGGTTCAGTAGTAGGTATTCTGCCAAAAAGAAGTTCCTTTTTCTTCTGAAAA
AACTCTCCACCTCCTTCATCTTCGCGATTGTCATCCCAATCATATATCCCGCCTTCTGCATCAGCTATTCCAGCTGCTCGCTGAGCTAAATGTTTTGCCC
CGCTTGCAGCAGAGACACATTTTGATTTTCCAATGGAGGACTTCCCAAAGTCAAGATGTTGATCAAAATCAAAAGGATTGAGGCTAAGAAACTTGTCAAC
AGCTTCTAGTGCATTGGCCTGAGTTTCCTCTCCAGGTTCTTGAGAATCTAGATAACTTAAACCTGTCAATACATTATCAGAGTCCAACTGAGGCAAGTCC
ACTGTCTTTTGAAAATCATAATTTCCATCTTCTGGCCCTTTAGTTTCAATAAGTATCTCATCTCTGAAAAGTTTCCTCACAGCTGAACTACCAACCTTAC
ACCGGTATTCATTACCTACTTCCTTCAATTGTTCATCGTACTCCTCACAAGCATTCAGGTTAAGCTCTTTCCTGACTACAGATTGAGGTCTAACCACAGA
TGTTCCATTATGGTCTGCACCTTCCTGCTCCAGAGGATTTTCACTCTTAATAGACCGTGTACTTCCTTTTGTCCCTTTACGGCTCATGTCATAAGCAGCC
AAACCAGAAGCCCTGATAGATGCAGCACGGATTGAAGTAAACCCTCTTTGCAAAGATCCTGAAAAAATATACATAAATGTCAGAAGATCCAAAATTCTGG
AGCAACTTTGTTCTATAATGAATATGGACAGAATATAAAAGTTGAGAACAGAAAATGAATTCATCAACCACCTGAAAGTACTAACAATGAAAAGTATATT
AAGCACTTTCATGTAGAGAATAGGAGAAGAGAAATCTAGAGTCTACAACATAAAGCAGCGAAAGTGAAGCCAAGCTTCTCTTTCAATAGCAAAACATTTT
CTGGATAAAGCAGAAATGACCAACTGTAGTCGCATAGTATAAAACCAAAGTCCGCAATGTCATACTAACAGTGATATCAAATGCAAGACCGTTGATACAC
TGGCAAAGAATATACAGATCAGGCAAAGTGAAGAGACCTATTTACCATGAATTCTAAAAACCGGATGACGCAAAATGTCTCATCCAACTTTACTCTTGTA
GAAGAAGATTTGGATTAGTAGATTAAATTAAGGTATGGATAAAGAAAGGAAAACCTTTTGCTCAGGTATTGTTCCATTTAGATCCTAGATACTTAAAAAG
GAAAACAAATGCTAATATGATAGCTTTAGCCTACATGCATAGCATTGGAACTTAATCAAAATCAATATAGTAAAACCAATTCAACTGAAAGATGCTTATC
ATTACTCTGAACATCTGATTGTGCAATTGAACTCCTCTCACTTGTGTTGGAGTTGCTGCTTTTAGGCAACTTCACCTGGTCAATTGAGCTGTAGCTGTGT
TCCATTGAATCATCACCTGATAACTCTTGAGTATCACACAAGACCTCAGTTCCATCACTTCCTTCAGTATCACTATCTACAACTTCGATATTGCAATTTT
CAGAAGTCTGGATGCGTTTACTGTGTAGACAATCATGATCATCAACCAATTGGGTTTCACCATCTAAATCCACCTGTTGAGTTTCACCACCAAAATCCAC
CAATTGTGTTTCAGCACCGAAATCCACAACTTGTGTTTCAGCACCGTAATCCACCACTTGTGTTTCACCACCACCAATATCCAAAATCTGGTTTTCACCG
CAGAGATTTACTAATTGGGTCTCAAAGGCATCATTGAAGAAAAGGCCGTCATCAGCAGGAGCCATATTTTGATCATCCTCACCTTTAAATATAAAACAAA
TTGTATTGTTAGGGAGAGAAAATTCCAATCTCATTTAGTGGTCTTGCTTGAAAATTCCCTCTGAAGAATGGTATTACAGTGTTAACAGTACACTTAAATA
AAAGAAACTTTTTTCAATGAAGTAAAAATCCAAACTTGAGCATAAGTCCTCTGTCATTCTTTAGCAGTTAACTGAACACTGAACATAACAATCGAAGGCA
ACTGAATGAGAGCAATTTCGACAGCCTATAAGCTTTCCTTTTCGCAGTGTGATATTTTTCATTAATAAAAGACTCAAACTTCTCTTTTTCCTAACAAGTT
AACGTCATAGTGAAACTCTTTCACAAAAAAAAAAAAAAAAAACTTGCCTGGTAATGTATCTGGTGAAATTTGAGTGTCCACTGGTTGTGTATCGTCAAAA
ACCGAACTATCCTTTTCCGGGTAACACTTGTTCGCGTTCTTTCTACCGCCGCCAACCATTTTAATTCATCTACAATAACATTACAATAATCACAATAATG
TCATAATAAACAATGAAATTAATAGCAATCCGAATCAAAACCTTGATGATTTTGAATCTGAAAGTAAAAAAGATTATGCCTTTAAAGCACAGTACAGCAA
CAGGATAAAAACTTTTCCGACGCAAATCAAAAAATGTGAAAAAAATACTAACAGCATCAAATCGAATCAGAACATCGGATAAATCCGTCGGAGAAAGCCG
CCGGAGAAGGTGAGCGCGTGGGGTTAAGGGAGGGCGAGTATAGGGTTAGAGTTTGAAGGAGGGAAAGTAGGGAGATGTGGAAAATACCTTTTCATTTGGA
GGGAAATTTTAGCCCATTTTATATTTTTTGCTTTCTATACACACTCCACAATGTCTACTCTTTTTTTTTTCTGAAATTATTATCTGTAACTACATATGAG
CATGTGCAAGTACAAATTTAATATATACTATTTTATTTGTTTTAATTTATGAAATACCGATAAAATTAAAAGAGTGAATTGATTTTTAATAATGAATACC
AATGACCATTACAATACAACACATTAATTAACAATGACCAAACAAAGTGTTAGTAGTTTACTTTCTCTTTTATATCACCCTTATTAAATTAATTTTAGCT
AGCTTGATTTTATAAATTGACAGATATGTTAGGATAACTATTTTTAGTAATACTTGAGGTGCAAGTTAAGTAAGGTGATGTAGGAGGATGATGTGGAGGT
GAGACTTGATACACAAGTTATTTCAATAAGAGATAGTATCAAATATGTTAGATCAGTTATCCAGGGAAATTGGCTTGATGGACGAGGATGTTTGTCAGGA
TATTAGTGTAGCATAGATGAAATTGCAGTTCGTATCTGGAGTCTTTTGTGATAAGATGGTACTCTATAAACATAAAACAAGTTCTATGAAAGGTGAATAG
TAGCTATATTGTATGAAGCAAAATGTGTTGTCAATTAAAACTCCTTGAGTCTTTCAACCGATTCCCATTCTCCAGTAGTATCAATATAATTTCGGTTGCT
TAAGCCAATATAGTTACAAAAGTGGCTACAAGGGAGCAACTTAATCCCGAGCTAGATTCATCGATTAAATTAAGTTTATCCGACTTTTCACCTGTTTCCA
TAATTTTGAAATTGAAGTTATATATAAAAAAAATGAATTGACAAAAGCGTGTGTTCACCAAAGAATGTTGTAATTTCCGTAATTGCAAGAATTCTCCATG
ATTGAGTTAGTGTGAAGTCTACCGCTTCTCTAGCCTACACATTTAGAAGATGAAGGTGTTAGAGAAGAGGATATTTGTGATGGATGTGTATATTTTCTAG
TAGAGAAAAAATATGATGATATCCAAGACAAGATGGAAGTGACTTCGGTGGAAGATAAGATGCAGGAAGCAAGATTGAGATGACTCAAGCCCTGTGATGA
GGAGATGCTTGTATAACCTGGTGTGGAGGTATGAGAGGTTGGATATGGATGTACTCATAAAAAGCAGGGGGAACAGAAGAAGAATTGGAGAGAGGCAATC
ACCGATAAGACAGAACATGATGCAGTTGCATCTAACCAAGGACATGGTCTTAAGTAGGAATATGTGGAGGATGTGATTAGGGTAGAAAGGTCAGTAAGTT
TGAGTGCATTCGTACTAGTAGGTAGGAGTATGTTGTCTAGTTTCCTTTACTCGAAGTGCTACGCTTGTAGTCACTTAATTTTCAATTTTTGCTGATATTT
GTGGTTACATGTTATTCAATTGTAGTAATATTTGTGGTTACATGTTATTCAATTGTAGTATTGTATGTTATTGTTGTTTTCTTTCTATCTATTATCTCTT
ATACCGCATTACACTTTTCTCTGTTTTGTCTACCTATTATCTCTTATACCATATTACACTTTTCTCTGATATGTTTTGTCTAGATTCAATGGTTTATCGA
AAATAATATTTTTATCTCATTTTTAGAATAGAGATTGTAAAATATGTGTATACTCGATTTTTTCAGATCTCACGTTATGAAAATACAATGTGTATGCTAT
TGTTAATTTTTAGTAATGTAAACAACTAATATGAAATTGAGGAAGTAATATTTAATAGAAGCAGGGTATCCAAAATCATGCAAAAAAATTAAGCATATTA
AAACTTCTCACCTCACTTTGTGGGAATATTATTATTATTGATTTATCTAGTAATGTAAATAACTAATTTGAATTGATGGAGTAATTTATGGAGGCGTTTG
GTCATGACTTTTTTTTTTCACTTTTTCTTGGAGTTTAACTCCGAAAGGCCATAAAAAATTGGTTCAACTTCATTCATGTATTTAACCTGAAGTCGACTTC
CAAAATTTTCAAGAATTAAAAAAAGAAAAAATATATTTGTAGACATTGAGATTTTGTGCGACCCTACAAGACTCATTTAATTCTAGTAGCCTCTATAAAT
GTATTGATTCCAGTTATGATTATTGAAGACTACTCAACCCTAAAACGTAACTCATGTCTATATAAAGGGTAATATATTTCCTTGAAGAGACATATCGAAT
ATTCCAAAAATTCATCGAATATTCACAAAGAAAGATCAAATTCAAATCATCCTAGTTCGAAAGATATGTCACTAACAGTCGTTGAATGATGGATATATCT
TAAGTGAGAAGAATCAAGGGAGAAAAAAATTGTATCCATATTGATTTATCACTAAAATATTCTCGTTTCTTGAGATTTCGCTTATGATCAATTTATTTTT
CATATGTTTATAATTTGTTGCAAATAATGTTTAACTCCAAATTACTCATATAAAATCTAAAATAACTTCAATTTATATCCATGGGCAAACACATTTAACC
ACAAAATAATTGAAAAATTACATAAATATACAACTTAAAATATCATACAATTAAAAAAATTACAAAAAATTTCATTCTCTCTCTCTGTCCCTCATAATCT
GGGGTACGTGCCTCTCAATATGAATCATGTTCATAGTTATATATTCGATACACAACTATGAAGAATTTCATTATATTTTAGTACAAAATACATACACCTA
TTGTTATTTATCTGAAAGACTATGTATCTAGAGACCAATGTGTACAACGATAGAGTAGAGATTAATGTATTCGATAATATAGAAATATATATGACACAAC
AAAATTTTAAGCAAGGTATCAATTGCAATATATCTGACAATAAAGAAATGTACTGCGGAAGATGAAAAATAAGATATTTTTTTAACTGAGCAAACTTTCA
AAATAAGATGTAATTAGCCTCAAATATATTAAGTTTTTGAATTTTGCCCAAAATGATTATCAACCAAGAAGAAGTGCTTTTGGCTAGAGCCTACAACCAT
AAGCCCATAACCGTACCAAACTTTCAAATATGTCATTTGAAATGTAAAAATTAATAGTAGTATTTATAATGAAATATATAGGAGAAATATCACACTATTA
AACAACCTATGCATTTGAAATTTGTAAAATATATTCTCTTATTCCATAGGTGAATAAGGTTTTCTTTTTAATTAAAGGGAAAAGGGTCAAAAATGCCCTT
AACGTATTGAAAATGGCTCAAAAATGCCGTTCTTTCATCTATTGGATCAAAAATGCCCTCTCATCCACCTATTTGGATCAAAAATGCCCTTAGAATCAAA
TTTAAGCCTAAAATTACCCTTATCTTTAACAGATGCTGATGTGGCAAATATATATCTTTTAGTTAAATGTGTGGCATTATTTTATTGGTCCACATATATT
AGACCCACTTTCATTCATAATCATACCCATTAACCCAAACCCAAATCCAAACCCATTTACCCCACTTTCTTCATCTTTCTTCTAAAAATTATTTGGAATA
TTAATAAAATAATATCAAAACAATCAATACAAGAACATGATGTTCCAAGCATTTCTCTACAAAAATTCAAAGTCTTTCGTGAGCTAATTGGAGATTGAAC
TCCTCCTCAACTGTTAGAGGCTCCATTTTTTTTTTAAAAAAAAGTGATAAACAACATGGCTTGATTTGATGAGTGTCTTGCTTCCATGGGAGATTGAATG
TATGATTTTTTTTGTTCTCATTTCATCAAATCCACATTCTTTTGATACGTTTTGGGATACAAATTAAATTGCACTTATCTTCACTACCATAAAATTAGTA
GGTCAATTAAATTTTTTTTCGAGAGAATGATGATATATAGAATTTTTTATAACCTTTTTTTAAAGATTTGAATTTACCGAAAGAATTTGATAGTATTTTA
TTAATCCTCCAAATAATTTTATAGAAGAAAGATGAAGAAAGAAAAAGTAGGATCTTTTAGAAATGAGTTTGGATTGATGGATATGATTGAGAATGAAATT
GGGTCTAATTACATATGGACCAATAATCATAATGCCAACACATGAAATTTTAAATATTATTTTTGCCACATTAGCTTCTGTTAAATGGAGGGGTATTTTA
GGTTGAAATTTTACTCTAAGGGCATTTTTGATCCAAATAGTTGGATGGGAGGGCATTTTTAATCCAATAGATGGAAGAAGGACATTTTTGAGCTATTTCT
AATACCTTAAAGGTATTTTTGATCCTTTTCCCTTAATTAAAATGCCGCAACTTTTACCTGTTCACTAAATTTGTTATAAATAAAGGTTTGTTCTGATAAA
AGATAAACATATATTTCTTTTCGTAAACTTATATTGTAGGTTCAAAATCCTGCAAAGAAATAAGATTTTTAGTCCAGATGATAATGGGGCGGTGCAGTAT
GGAGTGAGGCTAAATGAGTTTAATCCGCCCCGCTCAACCGCCTTGCGTGTCAATTTTATTTCATTTTCAACTCACCCCACATAATTTTTTTTTCAAGTTT
AAGTTTGATACTAAAAATAAAATTTATAAAATAAATTTATCTTTTAGAGGTCAATTGAAAAACATGTAAGAGATTGTATTATTTTTTATCGAAACATTTT
CATTTACTATTCTTATAACGTGTAAAAAGTTTAAATTAAGTTTAAATCCACGTAAAATCCGACACAAAAAGGGGCATTCCAAGAATCAAACTCGGGACCT
CTCGCACCCAAAGCGAGAATCATACCACTAGACCAAATGCCCAATTTGTTTATTAAATTATCATATTATATTTTAATTTTCTAAAGAAGTATTTGAACTT
CACATCTTGTTTTTTTGGTTGGTCACAATATTTTGCTGGATTGTCTAGTAGGATGATTACAAAAAATAATATATATATTAACTTTGTGTATTACTAATAT
TATTTTTGTTGATATATTTGTTTTATTATATATAACACTCTATTATATTTGTTATCATATTATGTACAACTAATATAGGACATTAACATGATTAATGACA
TAATTATCGCTTAAAACTTTTTCCATCATTGGAATGAATGGGATGGACACAATTCCCATACACTTGAAGCAAACTAATTCTCATAATATATCCTTCAATG
TGGTGGTTATGGATGATTTAATTTTTTGCCTCATCTTCATATTTTACCTCTCCAAAAATAAGCTAGATGCCTTTATACATTTTGTTGGGTGGATATATAA
ATAATATTTAAAACTTGGTTGGATCAGTGGCGAAGTCAGAAATTTTAGTGAAGGGGGTTCAAAATCTTAGAAGTAAACATACGAATTAGTAGGAGGGGGT
TCGACATTTATTATACATACCTAAAAAATAATTTTAACCATGTATAAATAGTAATATTTTTTCACCAAGAAGGTTCAAAACTTCGGATGAACCCCCTCAT
TATACACTGCCTCCGCCCCGAGTTGGATGAGTTTGTTGCTTGTATCATGTATGTTTGGATGAGTTTGTTGGTTGTATCATGTATGTTTAATTTCATTATT
CGTAAATTATTAGCTTCATAAGATATTTTAGTTAAATTTCAGCGAAGGTATATAAGAAATATTGAAATCGAGAAAGGTCAAGTGATACTTTTTTTGGTCA
AGAATATAATTATTTTAGGCCTTTTTATCCTTATACAACCAAAATAATTATTACTCTAAACGTAATTATTTTCACGATGTTTTAATTATAACACTATCAA
AATAATGTAAATTACATGGGGATTAGCATAAAATTCGCAGTAAACTTATTTTTCTGCAAATATTCATAATAATTTCAAAAAAAATTCCATGCAATTGACA
ATTTTCTTATAGCGTATATTATTCATTATAAGGTTTAGAAAGATGAAACCGGACTTTAATATATCCCATCAATATTAAGGTAAAAACATTTTCTTCATTT
CACTTATTTTGTGACATTTTTGTATACACGTCTTAATTTTAACCCACTTATCTTTAATTATTTCTGTGAATTTTGTCTTCCCAACATTTTTTTAGAAGTA
TTAGTTCATCCTTGAAGATTATATATTATAATAATTGATTTGTAAAATTTAGTTTGGGTTGAAAAGATTATAGTTTAACAAGAGAAGAGAATTTGGAAGT
TATTAAATCATTAAACACATTTCCTTATTTCATTGTAACACTTTTATGTTAATTTACTTACTACGAAGTGTTCTCCCCTTATAGGGTACAAAATGTTAAC
AAAAATTTCAAAATGGTATATAAATTTTTATATTAATCAAAACGGTAAAATCGCTGCACCAACAACGACTTATCCCACCGGAAAAAGCAAAATCGCTGCC
TCTGCAGCGATTTTGCAAAATGTGATTTTCTTTTTTTAAAAAAATTGAAATCGCAAGCAGTGATTTATAGATTTTTTTTTTATAAACAATAAGGAGCGAT
TTCAAAAAAAAAAATTTAAAAAAATTAAGAAATCTCTGCTGGGGCAGCGATTTCATAAAAAAAATTTAAGGAAATCGCTGCCGGGGCAGCGATATATATT
TTTTAAAAAATAATTTTTTTTTAAATTGCTGCCTTTATTTTTTTTAGAAAAAATCTTTTCTTTTTTTGAAAAAATATTTCAACAATTCAATTAATATGAA
ATAGAGGGAGTATAAAATTGCCACAAAATTCTCGTAATAAAAACATAAAATATTGGTAAAAAAAAATGAGCAATTATTTCTGAACACACCCAAATTAATT
AGAAAACATATCTCAATACACCCTAATTATCTTTGTTGCTTTGGATTCTGTCGAGTCTTTTCCAGTTTCCAATAATAATTATTAGTAGAGTAATTAAAGG
GCTTTATGAGTACTTATCATAAATTCTACAAACGATGCATCTTGATTATACAACATTTATACTTATCAAAAAAATTTAGCATTATTTCTTAATGTGCATT
TTATTTGTGGTTAATTTTTATTTTTTTGAATTGCGATTTATAGAATTTTTTTTAAACAATAAGGAAATGCAGCGATTTCAATTATTTTTTTTTAAAAAAT
ATTAATTCGCTGCTGGGGCAGCGCTTTAAATTTTTTTTTTTAAATCGCTGCCCCGACAGCGATTTCCTTAGTTTTTTTTTATGAGCAGCGATTTCTTTAT
TTATTTTTTTTTAAAATATTTTTTTCCTTATTGTTTAAATTATTATTATTTTTTTAAATCGCTGTTTAGGCAGCGATTTTATAAAAAAAAATAAAAATCT
ATAAATCGCTTAATTTTAACTCACTTATCTTTTAATTACTTGTGTGAATTTTTTCTTCCCAACATTTTTTTAGAAGTACTAGTTCACCGTTGAAGATTAT
ATATTATAATAATTGATTTGTAAAATTTAATTTGGGTTGAAAAGATTATAGTTTTAACAAGAGAAGAGAATTTGGAAGTTATTAAACGCATTTCCTTATT
TCATAGTTACACTTTTATGTTGATTTGGAAAACATTCAAGCAACCCCAAACATAGAAAATATTTTTCCTTCCTACCCTAACACAGCCTACTTTGAAAATG
AATGCAATTAGGATATTTTTTCTTTTTCCAAATAAGAAGTGAACATTTATAAACTATCAGGAAAAAGAAAGATGTTAAGAAAAGTTCAAATTCTAGTTAT
AAAAAGCACAAGTCATATTCATAATGTTACATAAAGCTTCAAATACTGGTACTGGGATAGATAAATAAACTAAGAAAATATATCATAATTGGCATGATGT
ACAAACAGTTTGGTCAACAACTTGGACGCTTATTCAGGCTGCCTCTGATCAATCTGTGCACAGTAAATAAAGCGGCATTGCGGCTGGATCAAGCTCCCAG
AAACCTCGAAGACTGCCACCTCTCTCTTCTGTCAGGCGAAAAGCAGGGATTCCATGAGAGAACTTGAGATGGTCGGACATAGATATTTTCACTCTTCCTT
CTTCTTCCACTTGAGGCTTGTAGACAGACTTGAAGCCTTGTACCCTCACTAACAACTTCACTTGTATATAGCTAGTGGAAACGTCCACTATTTCAACAAT
CTCATACTCGCAATCTTCTAGTTTCTTACCTTTTATCTTAGCGCTCCAGTTCTTGTACACTGCCCAAACTTCGCCTTTTCCCGGGAAGATCTTGTATAAA
CCCTTCTTCAAAACCTCTGCTGCTACTTCATGTGAAAAGGTGGCGGTTCCAGTATATGGCTTCAGCTTACTGTTTCGAAACTTGAACTGTCCACACCCAA
TCGGCATTGTTTCATCATGCCACTGTGTTGTACCTTTAGGGGGTGGACAGGCATACAGCCATGCCACATGCAACACAAAATCAGGGAGAAGATCTATCTT
CTTTATCAGCCCATAGTACCTGGGTAAGCCGTCTTCATCACTGTACATCGCCCAATATTGACCAACTTCAAACTTCTCCGGTGATCTCTCAGCATCAAAG
CAGTAGAATATAGGTTCAGCAACCTGATCAGGTACTGATCCAACACACTTTTCTGCAGAATCCATGTGATCGTATGCCATGAAATTACCTCTCTCTCTCT
CGTCTAGAGATGAAGCAGAAATGCCTACTTGGTCAGTAGGTAAGGAAGCAGGGTCTAGTTCAAAAGATCCTTCAGGAACATCATTCCTCTCCATCCCTGT
CATCTTAAAAGAAGGAACTCTATGAGAAAATCTAAGCATCTCCTTTGCAGGAACTACAAATGGGTGTCCTGCTCGATGAAAAAGACAAGTGAAACCATTT
GCTTTCACCAACTTTACAACATGCACACCAATAGCATCAGCAAAGTCTGACAAGACCTCAACAAAATCATACTTGAACTTCTTCTTCCTCTCAAGACCAG
AACACCAGTTTAAATCCCAATCTCTAAAGATGGCCCAAGTTTCTCCTTGCAGTGGAAATATCTTTATGGCACCACAGCTATGTCTATTTATTGCACATAC
CAAATGGGAGAACATGGGAAGATCTTCAATGTCTTCCAAGTTTCCCTTTCTGAACCTACCACAAGAAGCTGGAAGGCCCTCAGACAGCCATTTGGTTTCA
TCTTCATTCAGCGGATCTGGCTCTAACCAAGTTATGCTCAACTTAAATGCAGGAGATACAATCTTGCTGATGACCGCATAAAATCTAGGCATGGCGTCTA
GAGAATCATAAATAGCCCATACCTGTCCAACCTTAAAGCAAGATTCTTCCTTGTCCTTGTCAAAATCACTAAAATCTGGATCTGCACATTGATATATTTT
TGGCTCAGCCATAGCAGAAGCCCCTACATCTGAGGGACAATCAACACTTCCTTTTAAAGGTAGATCCACTCTTCCATTTGCAGTCTCAGCTTCCTGCTCT
GTGTTCTGCAAGCGCTCTTCAGAGGACAAACTGTCCTTCAATTTCTTCTCCTTCCCCTTAGGAGTTGCTGCATGAGACAAATGCTGAACCTCGGATTCCT
TAGTAGGAGAGGGATATCCAACTCCCTTAGATCGCTTAGAAGGACCTTCTTCTTCATCTTCATCACTAAGATTATCACGGTGAGTGACATGCTGTCTACA
CCGTGTAGATCTTCGCTGGTTTTCCCTAGTGAGACATTGAGATTTCTGCCCAGGAACATGAGTGTCCACTTCAAAATTTGTATCTTCTGATAAATCACAT
TTTTCACTAGATTCTATTGATATCTTCTTTCTCTCTGTGTTTTTCCTTTTATATTCCCCTGATAATCCCTCCTTATTCATTTTTCTATATGCATTATCCG
ACTTTCCATTTCTATTAGACTCCTGACTAACCTCTGAGGGAAACTCTGGCTGTATAAATGAATTCCTGGCTAGGGTCTCATCAGCACCCTTCTTCTGACT
GGAAGTAGGCTGACTCCTACTGGTTCCGGGTGTTGCAACTGAATCATTCACTTCATAACCTCTGTACGACTTCTTACTATTGGGGCACCGCAACAATTGA
TTTAGAAATGTCTTATGATACTTGTACTTAATAGAACAGCATGGGCAGATAGTCCAAAAGGTTGGTTCGCTTTCTGGAGCTCCTGATTGAGTTACCTTGT
GATGTTTCCTGGTATCTGGCTGGCAGCTCTTATGCTGCATTGGTACTTGAAATCTCCCTGAAGGAATGTGTCTACTGTTGTACAACGTTCGTTTCGGTCC
ATCCAAAAGCACCGATATAGCTTCACCAATCAGTGAAAAGGCATCAGCTGCACCAGGGAACTTGTTCTTATCAGGATGTAGCAAGAGAGCAAACTTGCGA
TATTGCTTCCTGATAAGAGCATCATCAGCTGTTGGCTCTACTTTAAGAATACTATACCAATCTTTTTCATTTCCGAAAGACGTCTTCTCTGCAGAGCAAT
GCACCTCACAAATCGAAACCATCTGTGTAATGTTCTCCAGATCAGGAAAGAGCTTCTGGGCTTTAGATGCAAACTTTTTAGCTCCAACGAAATCTCTATT
TCGCATCATAACTTCAGCCATCCCTCTAGCCTTAATGGCCTCTTCTTTGTTGCAGTCCATCGTCTAGAATTTGATGGTCCCACTTTTATGTTAACCCTCG
GCTTCAGATGGTAGATTCCAGTAGAAAGCAAGTAGTGAAGAAACTGTAGTATTCACCTCAGCTGTTCAAGTTCATGTACCCTGAAAAGATTCAACATCTC
AGATTAACTAAGAAAGAGAAAACTAAAATGATTATTTGTTGAGAATTGACGTGCATGCAGCTACACATTTCCTTTCTAAGAAAAAAAATAATGAGAACCT
TCTAAGCAGTTTAAATCGTAAAGGATTAGCATTTGGCAGTGGAAAGGAAACATTGGAAGGGGTTGCCAAGAATGGGTCAGGTTTGATATCATAATAAATT
ATTGTATCATTTTATCTAATGAAAACATAATTCAACCCCAAAGTGATCAACAACAACATATCCACTGTAATCCCAGGTATGGGGAGGGTAGAGTGTACGT
AGACCTTAACCCTACCTCGGGAGGTAGAACGGTTGTTTCCGATAAATTGTTGGCTCAAGAAAAGCAAAACAAAGCAGTCCAGAAAAAGAAATAACGGAAG
TGAAGAAGCGATTATAAAGTGCTACATAACGCATAATAAATCAATATGAAGAAAAGGGAACAATAATTACCACAAAATTTTATGGTAATAGAAGTACAAT
GAACAGCATATAATAACACAAAGAGAAGGACAAAAATATACTTGCAATTACTACATCGCATCTAATCCGGAAGCTTCATTATATTTAATTATCTCTTCAC
ACTAGTTGCCAAGTTAATAATTTTCATTAGCAAAATATTGTCACACTAAAATAGATACTCATCCTCTTTCCAACTTTCCTCGATACGCAACAAAACCTAC
GATTTAACTCAAGGAGCTGTTAATTTCAATAATGCAGCATCGAAATAAATTCTCTACATCTCAAATTTGTGATAGAAAACTTTTCGATCTTAGATACTCA
ATTTAGACAGTTAACACACTTCTTACTAAAAAAGTGAATATATCAAGCACAAAATTGCTTTTTACTAAAAAAGAGTATGCATCAAGCTCATTTGACCTAC
CTACATAATACACACATGTAAATATGTGTGTGTACACATACATATGCGACATCATTATTATAATAATATATGCAGGAAGTAGTATACCAAGTATTAACTA
GCTTTGTCAATCCTGTCCATAAATTATCTTGTAATTTTTGGATATAGTATGAGTTAACCGCCTACATAGAGGAAAGACGAGTTGAAACCTGACCCAGAGG
GATGTCTATGATTGAAGTCTAGCCATAAAGTTAGAAAAGCATTTTACTTCTATACTCTTGACATCAAAAGGAATCCAATGTTTGTTCTTAATTTTTTACC
CATATTATGTGCTAACAAACAGGCTTCTACACACACTGCCATTATATTAGACCAAGAGTTCCTGCAGTCCCACCTTTACTTCACTTTACACAACATTTTC
TCTTACTAGTCTTACAAAAATAAGTAGAAGCAATGCGTACTCTCTTCATACCTCCTCTAATGTTAAATGGCCCATCTTGGATTTCAAACTCAACTTAGAA
GGAAGTTACACCAATAACGAGCATGTGTCAATTATAAACTAGTTGGGCTCGATTATATGAATCCTCTACATCCATTGTGTTCTACTAGATCCCATTGCAT
CTTATTACGCAATAGATTAGACTTTTGAGACAAATTATGGTTTCTCGATCCCATGACTAAAGTTCAACAGCAAAGATAGTTCAGCACGAGATGTATGGCA
GGTATACATCCAAGGTTCTCAAGTGTGTAATCTTTCATTTAATTTTCTTCCCGGTGCATTATCTACCTCCAACCTCAATCATAGAAGTTTTAAACTAGAG
GTTCTCTAAATGTCGCATTTATAACATACAAATATCAAACCAAACTGAAAGGACTCCTATAATGGAGTGCCAATAAACTAAATCAACCAACTAAAATTAA
TACATGGACAATTTACTTGTGCATATGTTGGCCCCCAACACTTTAAGTTTAATGGTAAGAGGATAGCTTATGATGTCTAAGTTAGGCAAAAGTAGCGGAA
TACAATCCTGCCGCAGACAAAAGCCTGGTATTTAACTGTATAGCGAGGGGCAAGCTCATTAACCCTCGAGTTTCAATCAGTGGTTTTCAACAACAAAAAA
AGCTTACTTGCATGTCTGTCACACCCAAAAACCCAACACTAATGTTCAAAAGAGTCTCACCATTCATGAATTAACAAGATCACAACTTTCACAGAAATTG
ATCAACAGACAGAAGAATGTAAATTGCCGCCATACCACAATTTTACAGCAAACAAACAAAAATGGCATAGGCAGAAACTAAAAGCAACAGAAACAGACAC
CCCTTTATGCGATTCCCAGTAACATGCAAACGCCAAAACACAAGACTCTCAGACAATGCACTTCGTCAAATTCAAGAAACAGAGAGGCAAAAAAAAAAAA
AACCCCTTCTCATCTACACAGAACTTGTTTAAACTTGCACATAAATCTATAATTCACCATAAAGATCAAAACTTTATACAGGAATCAAACCCCAAACCAT
CAAATAAAACAACCCCACAACCAAAAAACACATAAAAGATCACTCTTTGATGGAAACAAACAAGAACTTGTCTTTATTTCTTTACAAAAAAAAACATAGA
GTTGATGAAGAAACTTACATTGGTTTGAACGTGAAGTTGAAGATTTGTGCTGTTTGAGGAAAAAGGATTGGAGGCAAAGGGAGAGTTGATGAAATTTGTA
TAAACAGGAAGATTCTGAGATTATACATTAATATACCAAAAAGTGCCAAAATGTTCTTAGAGTTGGGTTTAATTACGGCTGTGGGCCTATGGCTCTTTTG
TTATTTTTGTCAATTTTGAGGGTAGATAAGGTTAGGACAATTCCAAATATGCCCACAGGTAATGCGTGAAGTGTTATTTCCTAAGTACTTGTTTTATTAA
TCACATTATTAAACAGGTATCCACAAAACTACTTTCAAAAAAAAAATAAAAAATGGTTTGATATATTTGAAATGTTATTTAGAACTTATATATTTCTGGT
TACAAATGTGACTGATATATAATTGTATATATGAGCTACGTTTATAACAGAGACATTTTAGTTCTAAATGATAAAATTAAAGGACATGTACATGTCTTTA
TCCGTTTGAAAAATAATAATTTGTGGTTGATTAATTCATTTGAAAAAACTTTTTGATTAGAGGTGTGCATCGATTGATTTGGTTTATCAGCTTTTAAATA
TGACAAAATGAGATATTTTTTTTATTGATTTTAGTTATTTGATTTTGGACCTTAAAGGTTTCGTTCTCGATTTAACCACTAAGAAAATGCTTATAAAATA
AATATATGACTTCTCCAACAATTTGATGCGACAAAACAATAATATAACTTTTCAAAACCTTCACAAAATAGAAACAATAATAACTGATACGAAAAGAATT
ATACAATTGCAACACAAAGAGAAATTAAGAGGAATAAGATTCTTACTTTGAGTTTTGATGTTTTATATTATGTGAAGTTGTAAACTCAAATTTATTGTGA
AGTGTAAATTAAAGGTCATAGGACAAAAATACTAACCAGTAAAGTATTGAGATTAGAATTTAATATTTATGGAGGTGTAAAATAATAAATGACTATATCC
TTAATAGGTTATCGACTTACTCAATAATTCAATATTAAAAAATCAAAACGGAATCAATAACTCGATGTATTTTTAATCAAACCATTAGAAGTTCGTTAAC
CCAATAATCTAATGGCAATAAATCAACAATATATTTTTTAATTCGATTTATTGATTAATTCAATTTTTGCATACTTCAACTTTTGATAAATAATTTGTGG
TTTACAACTTTTAAATAAAAAGATACCGTACTAACTTTTAAATTCAAATGAACAATGACAACTAAACTATAGCGAAAACATGATTTAGATATTATAACTT
ATCATTTTTCACTTTTAATGAAGTTTAATTGTTAGTCCTTTTAGCGTTAAAGCCAATGTAATATTAAATTCTTTTTTTTTCAAGCAAAAATTATATCAAG
AATAATTAAGTATATAAATATAAATACATATTTTATAAATACGATAAATAAATAAAAAGTTTAATACAAATCAATAGAAAAATGGGAGTTGTATAGCCAG
ATGAAAGGCAAATAAATTGGTTCATGCTATCATTTCTTTTATATTCATTCGAATTGATTTCTTCCTTTATTGCTTATGAAAATAAATATCTTTCTTTTAT
GTTTTCTAATACATTTTTTATAATAACTCCTTATGTTCTTCATTTTTCATTCTTCCTCTATTAGAAAAAAATAGGAGACAAAATTTATCAATAATAATTC
AATTTTATTTCGTTAACACAATCATATTCATCTTCAAAATCATATAAACTTATCTTTTTTCTCTATATATTACTTACGCATTCATTCACAAATTTTGATG
TACACAATGTTCCCGTATAACTTGGACATAAAATGTTAGTCAACTACAATTCATCATCTTAGGATTCTTATGTAATTTTTTAATTACATGTTATTATTCT
TTCTTATTCTGATTAATATATTGCTTTGTTTAAACCTATTATTTTATATGTATACGATGACACGCATATTTCTTTATTTTCTTAAATTTTGAATTGATAT
TAGAAATATTTTCTATACAAAGTTAGATTTATCTAAATTTTATGATAATAATAAAGTTCAAACGTTGAGTTATGCAAAACTTCAATACATAAAAAAAAAA
TATCATAACCATTTTCCATCTAAAGCCAAAAGAGGAGCAACAAAATTGGAAAGACAACATTTCAGAAAGCAAATTCCTACTAATGGGGATGAATAAATTG
AATTTTTAGAATTCCAATTATAGTTTCTTTTTTCATATTGAATTGTACTCACTTCCTTTAAAGATAACCTAGCTTTTTGTTACTATCAAAATAGTTAAGA
ATCATTGATCTCAAAAATCGTATACAACTTATATCATTAGATTTTTCACCTTTGATAAATTATCTTGATTATCCTTTTTCTTGATACTGATACTAAAATT
TTTAAGGTTGACTTGTAAGTATTAATTAGGAAAATAATATGCTATGCTACATGTATGCAATTGATCTTTCAACAAATCAATTATGTGGTTAAATTCTTAT
TAAGTTTGGAAACGTAATTTTCATACATGTTTTAAATTTTTTTACATGACAACCTCATTGGAGAAATTTCAAAACATTTGCAATTTGTATGAAATTGAAT
GCATTTATTTCCTACAATAAAGATTCTTTAGTCAATTTTATAGTTCCTCCTTCGCTCATATACTTGTACCCTTGTTTGTCTAGTGTCCAGGGTGATCAAA
TTCTTCTTCAGATTAGGAACATGATGGATTTGTATTGTAATAGTTCTCACGAACCCATCATGCCAGAGAACCCGAACTAACCAGTGCAAACTATTTTACA
AGTTGCATTGTTTCCCATTATTATGGTTCCTACACTTGTCTTATAACTACTGAAGCAATCTCTTTAGAATGTTATATGCAAAGTACAATCAGAGTATGAC
ACCCATTTGTTGTCATAAACTCCCCTATTGCATGATGTTGTCAGTACATATTCATCATCAAAATCATGAACTGCTCAATAATGGATGCACTTGCTTTTTC
TTTGGACCTTGACATAGGACAATCTCAAAAGTATCCCTTATTGTGACAACTTCGGCCGTCCGCATTCTTCTTCTTCACAAGAGATTTTGATCTGTACATT
GATTTTCTCCTCCTGTGTTGGCTAGTGAAGCCTCATGGTCTTGCAACAAAATACTCGACTCTATCTTAAATATGTGAAGACGTCGTTGTAACAATAACTT
TGTTGTCACTAACCGGTCTTGGTAAAACCCTTCAAGCCTTTTCCATAACTGTTTGGTCGTCTCCTCGGTACTTGTACTCACTTCACAAAGCACGTTAGGT
GCAAGATACACTTGGATTACGACACTTCAATGCATCTCGTTTAATCTTCTCCTTGTTGAAATCCGAAGTGTCATCGAGGTACTCTCCGTCAATAGCATGG
ATTAAACTTTCTCTCTGTAGTAACACCATCACATGGATCTTCCAGATATTGAAGTTATTGTACCCACTAAATTTATCAATTTCAAACTTCATGGAATAAA
GTAAAAATTTATAATTAAATTAATAGTTACACATTCCAAGAAGATAAATCTTTTAAAATTAATTAGTAGAAGATGAAATTCTCCTTCTTATTAAGTAGAA
TACGATTCAAATTTATAACTAAGGAAACTTAATTAGAAGGAAATAACTAAAATAACTAAAGTGCAACAATTGCTATTTAAATTTTGTCATTACATAATTA
AAATATTAACATTTAATTAAATAAATTAGATTTTAATTTATTGGAGAGACAAATTGACAATATTACTATTTTTACAATAAAAAGTTTGTTAAAATATATT
TTACATTTTTTGTTAAAAATATAATAGGAGGAATATTTGGTCGGAGGTTAAAAAATCTTCTAACTTCTTCAGCATTTGGTATGACATTTATTTTTTGACT
TTGGAATTTGGATTTCATGATAATTTTAATAAAAACTGTCTAAATATATATATATATATATATATATATATATATATTATTCCACAAGCACATATAAGAA
ATTTTTTTTACAAATATTTAAAATTATAGGTGCAAAAATGTCGTATTAATAATTTTAAACTAGAATATCTTGTAGGTGTTAATTGTGTGTTTTTACATGC
CTTATAGACTATTATGCTGATAAGTTAAAAATCGTGAAAATAAGTTAACAGAAGTACATTCAACTACATAAATGGAGGGGTCTTATCATAGTTTTAATTG
TTGTCTCTTGTATTCAGATTAGCATACCAGAAATAATAAAAAATGAAAAGAAGAACTATCCGAGTCCACAGAACCCACCGCGTGTCCTTGAGAAATTTAA
TCCCCTCAAGTATCTGAGGTTGCAAATTAGTTCCTCCTAAGATAAAATAGATTAACTATTAAAGAAGTAGCGGTACCTCAAACTTCAATAATTTCAACGA
ATTTAAAATAACAACAAAGAATCACACACACAAACACGACCGATCAATTTTATTTTGTAAGAAATATATGCAAGAGAAGGGAAGAATTCAGTGCAGATAT
ATGAGAGAAATCCTCTCTATTTATAGCCAACAAAGGGTGAAGGTCGTAACTTTTTGAAAATAAGACAATTTTTTTAGATAGGTCACAACCCTTTGGAAAA
GGCACAACCTTTCAGATGGTCACAATTCTTTAGAAAAGACACAACCTTTTATAAAGGTCACAATCTTTCGGCAAAGTTACAACCCTTCAAGAGACTCAAC
CCCTTATTTCCTATTCATACCTTTAAAACCTAAAAATCCCCCACATGAATAGGGAATGTCTATTGTTAAAACATATGTATGAAAAACTGTGCGAATTGTA
AATAAGGATTGATTGCATTTGGATAAGTGAGTTTTCCTTTGAACTTTTGATAGTAAACATATATTGAATATACTCGGTCAATCGGCAGATTTGATATCCA
TGAACCATCAAGCTTTGTTGTATACCTACACAATATAAGTCACACAATCAACCCTTGAAATGCTTTTAATTCTCATTGTTTTGTTCGTTTGAGCCATGAA
CACGTCTTGGTTTGTAAGTGCGTAGATAACTGGTCTTACCGAATTCTCCTTGAAGCGATTTACGCTTCACACTTATATAGGTGATTTCTTAATGTGTTAT
CTCGTAGACACACTATTTAATATACCCTGTATCAAACTTAGAAACCATTTAAAAGTCCTAATGTCTTTATCCTTGTTACTTGACATTGTCTTATCATGAG
AATGGACCATAAGAAATAATTTTGACAATGTTAAACCGTTATCAATGACTTTGTTTGATCTCCTTGAACCTAGATCTTGGAATCTCCAGTCTTCTAGGTA
GAGTTACCGCCACAATGACTTCTTCTCAGCCATAGTCTCATTCTCTTTGATAATCTATCAGCTCCTCTTTAGTGAGGCCTTTTGTAAGTGGATCCGAACA
TTATTCTTTGACTTTGTATAGTTAATTATGATGATTCACTAGAGAGTAGTTCTCTAACGATATTATGTCTACGTCATATATGACAAGATTTTTCGTTATC
GATCATGCTCCATTCCCTACCTATTGAAAATTAACTCTCATATTGTATGCATACAGGAGCTAAAGGTTTGGGCCAAAAATCCGTCAAGAAATTTTAGGTC
ACTCATTTTTTTCACAGGCCTTATATTTCATAGTAGAGCGAACGATACATTTTTGTTTGGACGATTCCAAGAGATTACTCCTTCACACAGAGTAAATATA
TATCCGCTTGTGAATTTCACTATATTTGACTCGATGATTCAATTTGCATCATTATATTCTTCCTATATGTTGAATATTAGTTATAATGCAAAACAATAGC
TTTTAAGTATGTTTTAAATACTCCAAAATTATTTTCATTGTCATTGAATGAGTTTGATTAAGATTACTTGTGAACCGACAAAATTTACTAATAATATATG
TCATATCTGATCACGTACACTTCATGATATTTATCATACTCCTCAATACTCTAGCATAATCCAATTGTAAGTCACTTTTGCCTTCATTCTTTTGAAGTAC
AAAACTCACATTTATTGGAGTCTTGACAATATTAAAATTCAAATACTTGAACTTGTCAAGTACCTTTTCAATCATATGAGTAACTTTAATGTCTTTCATT
TAAGTTACTTTCTAGAATATGCTTAGTAGAATTTATGTAAGAAATGTCCCTTTTGATAATAAACATGTCATCGACATAAAAATAAACAATGAACTTGTGA
TTTGGAGTGTCTTTAACGTAAAAACATTTATCACTATTTCGTTAATCTTAAATTCATTTGTCAACATAATTTGGTCAAACTTCGCATGTATTATTTGAGC
ACTTGTTTTTAATCCATAAAGTGACTTAACAAGTTTACACACTTTCTTTTCTTTATCAGGTTCCACAAAACCATGGGTTTGTTTCATGTAAATTTTTTCC
TCCAATTATTCATTTTACAAAAAATGTTTTCACATGTATTTGAAAAATTTGCAGGTTATATACCGCAAGTAGCAATTAACATCTGCATTAATGTAATCCT
AGATAGTGACTATTATGTATCAAAATAATCAAGGTTTTCTTATTGTCTAAAGCCTATGACAACAAGTCTTGCTTTGTATTTGTCAATGGTTTCATCAACT
TTCTTTTCCTTTTGTAGATTCACTTCGAACCCAACAATTTATTTCTTAGAGGAAGATCAACCAACTCTCAAGTAAGGTTGCTCAAGATTGAATCTATCTC
ACTATTGATAGCCTCTTTCCAGAAAGAATGAGTTTACATAGGGCATAACTTCTTAAAATTTACGAGTCTCATTTTCAAGAAGAAATTTTACAAAATCAAA
CTCGAATGAGGTAATTTGTCCATTGACATTTCTTACATCTCTGAATCTCTTTATTAAGTACATTCTCTTTTGGTTTGTTCCAAGATTATTTAGAGCCTTC
ACTTAACTATCCGACGGTTCCGACATATGAATTATAAATTGACAAGTTTTAATATTTGTAGCATATCAAATGAACATACAATTCAAAATCTTAGGTCTTA
TTTTGATCCGTTTGAAAATAATTTCCTCATTTCTATTTCTCATATGAGATAGAATGTATTGAAAATTGTTAGATCACTATCTTTTAAGAGTTATTGTTTG
TATATTCTTTTAAGGGGCGATAAGCAATTCTCTATCAGTGTACAACAAAGCCTGAACAAATAAAATTTTTCGTTGCTCCCTTTCTTAAAAAATAAAAGTT
TTTTTCATTTGTTGCTCCCTTTACAAACAAATAAAACATTTGTTCCTCTATTTTTGAACAAACAAACTTTTTATTGTTCTCTTTTGCTATAATGATAGCA
CCTCCACAAATTTTGTGATAAACCTGAACTTCAATTTTTTCTGTCAACGATTTCGTTAGATTGAGGTGAGTATGTGCAGTAATTTGATGGATGATTTCGT
TTTTCAAATATATCTCTGCGAAAGAAAATTTATATTCTCCGATATCTACCACTTTTAATCATGATAATCTTTTTATCCAACTGATTTTCAACTTTAATTT
TATATTGCCTATATTTCTATTGTTTCATCCTTAACATTAAGCAAATAGACATAACACTATATTGTGCAATTGTCAATAAAATTTATGAAACACTTTCTTC
CACCAAGAAATAGTGTTGACTTCACATCAAGTATGCTTGATATAGATTCAACACATACTTGACATTTTGATTTATTGAAATTTTTTTAAATTGATTAGTT
TTTGCAAGATTTTTGTAATTGACATATCCTAAGCATTCATGTCACAAATAATTTGATTCAAATAAGTAAGATACAAACAGAAATAATGAGTTTGAAAAGA
CCTTCTGTGAGGAAACTTTATCCAACAAATATAGTCACCACCTTGCCAGATGTCCTTTCCAGAAAGAATCTTTCCATAATAATCAATTTCTTGTAGAATT
ACCATGACCATAGTCTCTTCGGTCCAATAAGGGCAATATGACCCAAATGTTTGTTTTACAACACAAACATAACAAATCACTTTTCACCAATGTTCATGTC
TATTCAACTAGACATATATTTTCATGAAAAATCATAATATTTTAATTGACACTTTTTCATCAAAGAATACAATTCTTTTGAACGAATAATATAATTTAGT
GGCTTTATACTAGTCATACTATATACAAGTAAAGAGAGACTCAACGATCAAAATATCAATTATAAACCAAGAATTATGTGGGTATAACATAATACAAGAA
TGTCATTAAATTTCATACCTTGTACTTTCAAATTAAATTAGATAGTAAGTCTAATTTTGTCTTTACCACAAGTAAAGATCCCCTCACATTTTAAATATGT
TCTCAAAAATATTTCAAGTATTTAAGATTATTTTTCACATATTTTTTTCCATATTTTCAAATTGTAAACCATCAAAATATACATTGGCAACATGAAATCT
TCTTTTGAAAATTTAATTCATAGAAACACCCTTGCAGGTACAAAAATCACTAATTTTATTTTCTAGTTTTTTTCTCCCTTTTTTTTTTCATAAGTAGACA
AACTACTTAGAATTTAGAACACTAACAATAAAGATTCAATCTTTATACAACTTGTTTTTAGTTTAACGATGAAGTTTTTATATTCTTCTAATCGTTAATC
GAATGAACCATGGATTCTGATGGGATTTTATATTCTTCAAATCAGTTTCACATTCAGACAGAGTAATAAATAAAAAATCTTTTAATCTCCAGAAACCTCA
AATACAACACTATTCTAGCTAATGATGAATATTTTATCTTTTTAAAATCATTTAGCCTTAATATTCCTGACGAAGATTTTGTGCTCTTCAAATCACAATA
TTTATTCAAACAAAATATTTAGCAAATTGGTGAAATTTCTATATTCTTCAAACGATCGCACAACCTGATTTTTTCTTGAAGTTCTTATATTCTTCAAATC
AAAGGAGTAAAAAGAATCAGACGATTTTAGTCTCCAAAAGTCAAACACAATCAAATTTCATATGGAGTAGAAAACTACAAAAGTTTTTTTCTCTCCTCTA
AACATAATGCATATTAATAATAATAAAAACATATTTCGAAATCATCACATAATTACCATCTATCCTAACATTCATGAGATAAATCTCGTAATGTATAAAG
GATAGAAAAAGAAAATAATAATCAAGTGAAACAAAGATAGAACATGATTTTTACTCTCATTTATCATATTCTATCTATCAGCAATATTTCCATGTAACTC
ACTTTTCTTGCTATTTCTTTCCCTTTTCTCAGTTTCCATCATATTCCTATTTTCCTCAAAAAGACATTTAATTTCAACAAGAAACTAAACTCAAGTTCAA
ATATTGTTAGAAGACAAAATTTGTTCATTTACTTCTTCTCATAGTATTATAAAACCAAGAATATATGCACAAAATAACTTTCTCATTGAAAGAAAACTGA
AGGGGAGTAATGCTTGAATGCACTTAGGAAGAAAATAAAAATGATCTTACCCATCGTAAAAAAGTTTACTATAGAAAATATACTTGAATGTATTAAACTA
GTACTAATTCATCCCAAATCTCTTTTATCATATGATAAAATAATATTTTTTTCCAATAAAAGGAACAAAGAAATTAAAGTAATTTTCTTACCACAAAAGT
AACAACTTAAATTTCTTAATCTTGTTGTCTCCTATATTTAGATTAACAAATCAGAAATGAAAAGAAAAAAAGAGAACTATCCGAATCCACAGAACCAACT
GTGTCTTTAAGAAATTTAATCCCCTCAAGTACTCGAGGTTTCTGATTAATTTCTCTCAAGATAAAAAGGATTAACCATTAAAAAAATAGTGGTACCTCAA
ACTCAATAATTTCAACGAACTCAAAATAACAGCAAAAAAATCACACACACAGACAAGATCGATCGATTTTGTTTTGTAAAAGTTGTATGCAAGAGAAGAA
AAGAATTCAGTGCAAAAAAATGAGAGAAAACCTCTCTATTTATATCCAACAAAAGGTAAAGGTCGCAACTCTTTAAACACAACCTTTTAAACTGTCACAA
CCCTTTAGAAAAGACACAATCTTTGATAAAGGTCACAACCTTTCGACAAAGTTATAACCCTTCGAGAGAGTCTCAACCCTTCATTTTCTGTTCATACCTT
TAAAACCCAACATTAATCTCGACAAATAATAAGTGAAAAAATAAATACATCACGCTCCGATATTCTAGTAATGAAAGTGTTATTCATACATATAATTATA
TTTTGCCTTGTAATTTTGACACAAATCTCCTGTTTTTATTAAAGCTTCTCTAGTCTTCCACACACAAAAAATTGTATCATATATAAATCTTTGAAAGATT
TCTATTTATAGAAAAAAATATAGTTTTAGAATATGAAAATTCACTTATTGAAAGGTCAAGAGTTGCAACAAATTAAAGACAAATATTAATTAAGAACGTA
AAATGAATTTGAAAGATGAAATGATACATGTATCTATTTAATTTACATACTTCAAATACAATTGTTCAATGGTCATCCCCAAAGAGAAGTATTATAGAGT
AGAAATTCGTGCGGATGAAATGATACTTGATGTGGTGGTGGAAAGTGTACGTAACACAAATTGTTTTTTTTTTCAATGAAATTTTGTAGCCCTTGCAAGG
ATTGTTCAACCATAGTTGTGGACGAGTTAAAGGACATATATCCTCAAGACATCAACGTATCATATTTGCTAATACACTTGATAAAATACATTTTGAGAAA
TGTATTTTTCAAAGCAAGAAGCAGATTACAAAGCCAATGAAGATTGCAGGAACAAACGAAGATCAGTTGAAGAAAAGATCTGATACGGACTTGGATGGTG
ATAAAGAAGAAACACGATGACAGTCCCATAATACGATTACTATGGCCACCAAGCGTCTATAAGTTGCTCATCATCAAAAACAACTTCTTTCCAACTGTTC
ATCACAGAAATATAGCTATGAACCAATGCAAAATGAAACACAAAACATCAATGAAATGAAGAAATTTGAATCAAGCACAAGGAAAATTAAGCCGTTAATC
CTTGGTCTATGCCCCTTAATGCTTCAAACTAATTTCTTTTGAGACATAATTGAGTTTTTGAAATCTATAAAACTCTTCACATTTTGGTCTAGGATTAACA
AATGAAAAGTTTGATGCTTCAATCTGTAGACGGTAAATGCAGAGGCATTCCAGCTGGATCAAGCTCCCAGAAACCTCGCAAACTGCCACGTCTCTTTTCT
GTCAGGCAAAAAGCAGAAATTTGATGGGAAAACCTAAGATGCTCGGATACACATATTTTCTCTACTCCGCCAGTTTCTTCTTGTTCTTTCACTTGAGGCT
TGTAGACAGACTTGAAGCCTTTTACCCAAACCAAGAACTTCACGTCTACAGAATTATCAGAAACATTCACTATTTCAACAATCCCATATTCAAAATCTTT
TAGATTACCTTTTAGCCTAGGACTCCAGTTTTTGTATAATGCCCAAACTTCGCCTTTTCTAGGGAAGATCTTGTATACTCCGCTCTTTACAGATTCTGCT
GCTACTACATGTGAAAAGTTGTCTGTTACAGTATATTTGTTCAGCCTACGGTTTCCAAACTCAAACAGCCACAACCAGTTGGTATTGTTTTATCATGCCA
CTGTTTTGTAATTTTAGGGAGCGGACACCCATAAAACCATGCCACATGCAACACAAACTCAGGGAGAAGATCTATCTTCTCTATCTGACCATAGTACCGG
GGCAATGCATCTTCATCACTGTATATCGCCTAACATTGACCAATTTGAAACTTCTCCGGTGATCTGTCAGCAGCAAATCTGTAAAATTCAGGTTCAGGAA
CCTGATTAGGTACTGATGCAACCAAGTTTTCGGCAAAATTTACAAAATCAATGAAATTAGCTGTCGCTCTTTGGTCTATGGATTCAACAGAAACGCCTAC
ACCGTCAGGAGGTAAGGAGGCAGGGTCTAGTTCAAAAGTTCCTTCAAGAACATCATCCCTGTCATCTTAAAAGAAGGAACTCTATGAGAGAATCTAAGCA
TCTCATTTGCAGGAACTAGAAATGGGTCTCCAGCTCGATGAAAAAGACATGTGAAGCCTTTTGCTTTAACCAAGTATGAAACACGCACACCAATAGCATC
AGCATAGTCTGACAAGACCTCTACAAACTCATAGTAGAACTTCTTCTTTCTCTCAAGACGAGAATACTACAAACAATTGTGAAATGTAGATTCTAGCCTC
AATCAAGCAATGATATACTAGGCAATCTACATATCAGCTTCAGAAGATTCAATTGGATCATTCTTGGCACAGAAGAATGAGGAAGCAAAGGTAGAGTGTG
CTCTGGAACTCCAACACTTGGGTTGAACAAAGCCCTTAACTACATATGCATCTGATCATATATGTATTATCTATTCCAACAAATAATACAAAAGAAGGAG
GGTTTTCAATGCGAGATCTAAAAACATATCTCTCTGTGGCACCAGTACTAAGTACGCTATGGTTCGGGGCTTTAGCAGGTCTATTGATAGAGATTAATCG
TTTTTTCCCGGATGCGTTGACATTCCCCTTTTTTTCATTCTAGTTATTGTCATGGGAAGGAATGAAGAAAATTAGAGATCCAATCAAATATTGGTGATAA
ATCCCTCTCCCCCTCTTTTCTCTTTTTTCCCTTTATAGAATAAGGGAGGAAAGAGAAAGAATACAAAAAGTGGATTGAACTCTAGAGAACAGGCGGAAAG
AGGTTCATCAGAGTGATAGGGAAAGCTTATAGAGGGGGGGGGGGGGTCTTACTACGACAAGTGAAGCCAGGGTTCCCTTTGTTCGGTGTCCGGGGAAGAG
AAAGGAATCTATTCGGGAAGCGCTTACCAGCACCGTACCGAGTATCAACCTCCAGCAACCACCAGAACAAACTGTGAATCAGGAACTCAGATTTAGAAAA
AGAAAAATATCTAAGAGTGAAGAATGTTCTTGATATTCAAAAACTACTCAGTACAAAGAAAAGAGGTGCTATATATAGCTCAGCATCTTGTATTAGTAAC
TAAATTCTTCTAACAAACTAACTGACAATTGGTTATAAACTAACTTTATGATAACACTAATCTACCCTCATCCCTTTTAACAACTTCAACATTTTAACTA
AACTGTATTGATCATAAATATTTTCTTACCACAAATATCTCTCGATCAAATATAGTAATTTTCAAACATTCTTCTCTCGAGTGTGTTAGGCTTTACTATT
TATTCTCTGTAACAAAAAATACTCTGATTTATTAATATAAATATATCCCACCGCCGTGGAAGTTTACTCACGGGGTGTTACCACGAAATATTGGGTTTTC
TCTTTCTCTCTCGAGATCTCTCATCTCTTTCTCTTGAAAGTTCTTGTGTTCTTCATTCATCAAGTGTGTATGCGTAAATTCAATCCTAACAGAGTGAACC
GTAGCATACCAGTCAATCTATTCACTTAGCTCACATCAAAACTTCATAGCGACACAGAAAAGAAGACAAAACAACAGAGCCCTACTCAACACAGGATTTG
GATCAAGAACAAAAAAAGTAGTGCCTCAGTGGTTTAACCAAGAGCATTCAGGCCACCGAGGGTGTATAAGTTGCTCCTCATCAAATACAACTCCTTTTCG
ATTTACGACCACAGAAACAGAGCAACTGCAGTGTTATTAGAAGATCAATCTGTTTTAAGTTTCACACAACAGTACTATTTCTTTTCGTCTTATAAATTGT
GGACAGTAGTATCATTCACATGACTTCTATTTTTTACCAGATATAATATAGTTACGAATTCCTAAATGATGTTTGTATTCATGCTTTAAACTTCTGTTAT
ATATAACTTAGAATTTCATTGTTGTCTTTTATCATATTAATTTTTCACGACCTAATTCACCAGGCCATGCAAACACCTACTCTAACACCTAGATTGGAAA
ATCCTTTCACCCAAAAATAAATTAGGTCACTCGAAAAGAAAATAAATTACTATAAAAGCTCTCTAACACTTTAAACTTTAATAAAACCTTTCACATTAGA
CCAAAACACTCCCTAAGGAACTAGTCTAATTAGGTATAAGAGCTACTAAAAGAGTATAATTTATACAAGAAAATAGAACACAACTCCCACCATAAGAGAG
GAAAAATGAAAGTTGTTGGAGATCATCATCGTTTTCACCTATGAAACATCACAGACCCTCCAACCAAACTATACCAACTGTCATAACAAGAACAATATCG
ATACAAAACACACATAATGTATCTGATAGACATCATCGATTGATCGAACCTACCACGTAATATAAAGTAGACATTCAGAAGAAGCATGCAATATGAAAGT
TACCCCACCTTAAGTCTCTATTTACATTTTTTGACCCTCTCAGGTATATTGCCTATAAACTAATGCACCTTGATGCCTGCCTCCCTTTTATACCACCATA
ATATCAAGTCCTAGACTAACCCTTCTACAAGATAGAGATTCACGAATACAAGATCACCACTAGCCCTATCAACCAACCTACTACTCTCTCTCAAGTTCTC
ATGTCAACTTTGGCCCTTTCGGGATAGTGTACTCAGCGCCTTAGACCAACACATCCATCTTGACTCACATCCTCATTATCATGTAAGTTCTAAAAACACT
AACAACCATGATCGGTCCCCGCACTTCCACGATGCAACAAAAGCCTAACATAGTCCAGACTCCAACTTAATAGTAACCCGCAACATGTTCCACATTGTCA
CATGCAAGCCATACCTAAGATAAAATCACCTTTCATGCAAGCCATACCTAAGATAAAATCACCTTTCAGGTAACTCGAAGCAGTCAAGGATCCAACATAC
ATACATCCTATCATACAAGGTAAATCAGGTTCACTCATGGAACCATAAATGCACATACATGGTTCTATCAAGGAACCCACACCACAATTCATAAGATAAA
GAACCCCATATTTGTGTTGAAGCTATAAAACCCAATTCATTAGAAAATTCTCACGATTGTGGTAATACATTATGTCTTGATGAGTAGGATACAAGAGGAT
TATTAGTAGTTTCTATCATTCTTTACAACATTTTAAATGATTTAATTTGTTGAGTAGGAGTCTTAAAAGGATAAATTTTAAATTTTGGTTCTTATGATAT
TTTTAAGCATTCAATTTGGTGAGTAGGTGGTGTGAGAGTATAATTGGAATTTTACGTAATTTAATTTGATGAGTAGGAGCCAAGAGGGTAAACTTTGAAG
TTAAGTTTGTCGTTTTGTTAAATATTTAATTTGACGAGTAGGAGCTAGGAGAGTAATTTTGAGTTTTATTTGATTTAGTTGATGAGTTTGCCGGAAAATT
ATGCCGTGTGTGTAGATAAAATACTGTGTAATATTAAGATATATAACTAATTGAACACCCTAAGATATGACAAAGTCTATTAGTCTGGACTTCTGGTGGT
AAGTATATTGTTTTTTTTTTTTTATATATTTTCGATCTGTATTAGGTGAATTATTAAGTATATACATTCTCAAAAAAATAAATAAATTAAAAGATATAAT
TAAAAATTATTATCCACTATTATACTTTTCATTATTTCTAAACTATCTTTTTAGAAAATGTAAAATAGTTAAGAATCTTACTAAAAAAAAAGGTAAATAC
GGAAAAAAACTTTCGATAATTCTCTAACTTTAAACTATTCAGTTATTTGAATCACAAAAAAAGTCTCAACAATTCATTTAAAATGAACTAGAGGGAGTAT
ATTCAGAGCAAACATTGTTTTTGTCCATTAGTTTTGATTTATTCCGTTGATAGTTTTATAGTTTTCCTATGATTTAGTTACTAAGTGATATGTAATTTAA
TTTCTCACTCATCAGCAAAAATTTTTTTTACCCACTTTGCTTAAAAAAATTATCGACTCTTTTAAAGTTTGAACAATTTTGGTGAAACTTCTTGCTCCGC
CACTTTGAGTAGAAGCCAGGACCAAGACTGGTAAATTAATTTTTTTATTTAATTTAATTTGATGAGTATAGGAGCCAAGAGGTTAATTTTTAAATTTTAG
TTTTGATGTATTTCTGAAGTATTTTACTTGATAAGTAGGAGCAAGGACCAAGAAGGGTAATTTAGAATTTTATTTAATTTAATTTGACGAGTAGAAGTGA
AGAGATTAAATTTTGAATTTTAATTCTTGTCATGTTTTTGCATTAAATTTGATGAGTAGGAGTCAAGAGAGTAAATCTAGAGTCTATTTAATTTAATTTG
ATGACTAAGAGCCATACGAGTGAATTTTAAATTTAATTTAATTTGATGAGTAGGAATCAAGTAAATTTCAATTTTTAATTCTTGTGATTTTATCTTAATC
ATTTTATATAGAAAATACATTCTATCTTGACAGTTTTTAGAAATTACATTGCTCTTAAATATGAATTAATAGTTCAAATATTATAGCTTGCCAACAATTG
TCCGAAAGAGAGAACAATCAACATTAGGATCAACCAGGTTTACATTGAGAACAGTAGCGACAGACATAGGAGTGGAAACTCCTTTGCTGTCTTGCATATT
CGCTTCCTGGAGAAGGTCTTTTGTATACTTCTGTTGAGACAACAGCAGGCGGACAGAACTTCAACACCCAAAAAATAGTTCAAGTGGCCCAGGTCCTTGA
GAGAGAACAGTTGAGCGAGGGCGTTGATGATTTGTCGAACACCACGATCACTATTTCCAGTAACAATAATGTCATCCACATACACAAGGATGTAAATAGT
CAATCCTGAATTGTGAAAGTTGAACAAAGATGTGTCAGAGTCTGATTTACCAAAACCTTGCGTTACCAGAAAGTTCTTGAGCTCGTTATACCAAGCTTTA
GGTGCCTGTTTGAGACTGTAGATGGCTTTGTTAAGTTTGCAGACATGACTGGACAAAGTTGGATGCTCTAAGCCAGGAGGTTGTTGCATATAAACTTGTT
CCTCTTAATGACCTTGCAAGAATGAATTATTTACATCAACTTGATGCAAACACCAATTGCATCAAACAGCGATAGCGAGAACCAAGCAAATGTTTGTAGG
CTTGACTACTGGACTAAAAGTTGAATGGTAGTCCAGTCCAGGCCGCTGAGTGAAGCCTTTGACCACTTATCGAGCTTTGTACCTATCAATTGAGTCATTA
GGGTGATGCTTAATGCGAAAGAGCCACTTGCAGTCTACTACATTCTTAGAAGGGTCGTTGGGAACCAAAGTGCACGTATGGTTTCTCACAAGGGCATCAA
ATCCAGCTTGGATAGCAATATTCCTGTGAGGTTCACGCTCAGGGTCGTCTCAACCCCTAGATCACTAAAGCCATTACTTGGGGCCCCCATTTTTGAAAAA
AAACTTACATATATATGTTATTTTAAAAAAAATAAAATTATATGTACTATGAGTATTATGATTTGTACGAAGAAAAATTTCATATGAGATGAAAATAAAC
CCGAATTTTGTATGAAACAATTTGATGAAAATATGATTAGCGAAATCACAAAGTTCTTGAAGAATTTTTTAGAATTGATTGCTTTATATATATATATATG
TAGAGTAGATCAAACTAATTTTTCACTTCTAAATAGATTCAAACACAATTGAAGCATGTGAATTTTTCTTTTGATTTCTTATTTAGTGATAAAATATTGA
GATCACAAGATAATGGGAATTTAAAAAATATTGTCTTAACCTTGAATTTTCTTTAACGCGTAATAGCTATTCTGATATTGATTGTTTAGATTTATTTTTG
AAATAAAAATGTTGAGGAAAACAATATAAGTATAAGATAATGATCTAACGAAAATACTCAATCAAATAAAAAGACTTGATTCTTTTTCAAATACACATTC
TTTATAGAATAATATTAACAGTTCCTGAAACACAGTTGCCTCAATTGAAAGAAGCTGTTTTTGAAATTAAAATTCATTAAATCTTCTTTAAGATCTTAAG
AGAGTTCGAATGAATTAACTATATTAGCATTTGAAAAGGAATTATTAAAACAGATTGATTATAAAGCAATAGATTTTAAATAAAAATATATACATTGAAA
AAAAAAATTATTAGGCCCCTCTCTTAAGTTTCACCGAACGAGTTCCACATGCAATAGCTGGTTGAACTTCACATGTGAAACTCTGATCATTTTCCTTCAT
AGTGTTATCCCATGATTTGATTTGAAATTTTTTTAAATGAGAGAAAATATTTTGAAAAGGCAAATTATTTTCAAAAAATAAACATCCCTCGACAAAAATA
TTTTTGACGAAATTGGATCAAAGCACTGGTGGCCAGTAATATTTGTTGGAAAAACCTAGGTATTCTTAATGTTTGAAGAAGTATTTTGGTATATGGTCTG
AAGCTTATTTTTGGTACACATGGAGTTGAACGGGGCTGAAGCTTATTTTTGGCATATGGTCGAAGCCAACGATAGCATAAACACCCGAAAGTTCTTATTG
AATCAAATTTTGGGGTGTCTTGAACAAGTATTTCATGAGGGCATTTTGTTAGGATTGAATTCACGCACACACACTTTACGAATGAAGAACACAACAACTT
TCAAGAGAAAGAGATGAGAGATCTAGAGAGAGAAAGAGAAAACCCAATATTTCGTGGTAACACCCGTGAGTAAACTTCCACGGCGGTGAGGTATATTTAT
ACTAATAAATCAGAGTATTTTTTGTCACAGAGAATAAATAGTAAAACCTAAAATTTATATATATATTAATCAGACTCCACAACCTAACACATTTATCGTT
TAGGGTAATTTGTTTTTGAGATAAACTGCTCGACGGCACGCAAAGCTCCAAAAAATTGGGGGAAATGAGGCTTGATGAATTAAGGTTTTGGCGGTTTCAA
CAACATATCTATGATGTTGTTAAGCTTCAGCTACACGTTTAGGTGTATAAGGAGGTGAAACAAGATGTTCAATACCATGTGTTTTTAAATAAGGGAGATA
ATCCTTCAAATTCACCACCACCATCAGTGTAAATTGAGAGAATTTTTGTATTAAAGCGACGTTCAAGTAATGGATGTAGACTTTTAAAAACATCTTGAAC
TTCACTTTATTTTTCAGAGTATATATCCACATATATTTTGAAAATTGATCAACAATCAATGCATAATATCACTTTTTATCAATGGATAACACCGGGGAAG
GTCCCCATAAATCACTGTAGATAATTTGCAGTAGTTGTTGACTATGCAATGTATTTTCAGAAAAGGGCAACCTGTGCATTTTATTTGAATTGCAAGAATT
ACAGACTGAAAGAAGTTTTTTAATTTAAAATGGAATTGAAAACTTTGCTAACATTTTGTATAAACTATGACAATTTGGATGCCATAATCGTCGATGCCAA
AAGTCGATAAAAAGCCAACGAACTAATAGATTTATTTGAGGTTGAGATATGTGTGTAGTCTCTTGCGCCCACTCGTACATCCCATCTCTATTATGCCCGA
ACAACAGAGGCGTCCCCGTAGTCAGATCCTTCACAAGAAAATTAAGAGGAAAAATTCAATAGATGTATTGTTGTCATTACAAAATCTAGGTATTTGATGA
GTCTCGGGCTTTCTGGGAACGCCGTTGTAGGCTACCTTGTGAGGTATTACCTACCTGCTTTCGGTTGTTGTTGTTCTTTGAAGGTGGTTGACTGTTTCTT
TGAGCAATTGCAGCAGTAATTGATGGTGTTCGTTTGGCTTCTTCATACTTAACAAAGATCTCATGGTCAAGCAGTTTCTCATAAAATTCTTCATAGGTGA
TCATTGTTTCACGTGACCTGATGGCAGAGGAGAAAGTGTTATAGTCAGGACCAAGGCCCTGGAGGATTCTCACTGTAAGTTGCACATCAGTGATTGGTGC
TCCACCGATTGTAAGTTCATCAGCAATTCAACATATGTCACGTAGATAGTCAGTGACAAGCCTAGAATCTTTGGTTATAGTTGATCTTGGAGACTGGTAA
TTCGTGTATGTGATTTATTGGCGAAGGCCGTGTGCAGGGATTCCCAAGCTTTGTGTGCCGATATGGCTGTTGCAACAGTTGATGCAAGTGTAGGTTCCAC
CGATACTAAGATGGCATTTTGGACAACCTGATCTTGTCGAAACCAGTTCGTATAAGCTGGATTTAGAGTGCTTTCATTGTTTGCTGTAAATATGATTAAA
GGAGCAACAATTGTGCCATCAAGATGACCAAAAAGGTTATGTCCCTGCATAAGCATCAACATCTGTGCCTTCCAGGTGGTGAAGTTATGGCTGCCGGCAA
GTTTGATGGGTAATTAAGAGAGGCAAGGTTAAACTGCATGATGACAGTGTTGCTGGTTGTGCTATCTGCGTTATCAACAGTGGTATTGGGGGCCATTTTT
GCGTCAGGCAGCAGGTAGGGTTAGAAGAGAAAAGAGTTGAGATCGTTCTCGTGTGAGCTTTTAGAGCCCTGATATCATAAACAACATATAAGACTAGATA
GAGAGTGAGAAGACTACTATTTTGTTCATTAGCTGATGAAGAGTATATATAGGCATCGATACAATTATGATTCCTAAAGTGATACAACAACGAATCCTAG
TTATATTAGATGATAAATTCACGTTATATCTCTTTTAGAAAGTTGGGTTGTTCAAATAAGAAAATATCCAATCCGAATTTTTAAAGGGTGTTTTGGTCTT
TTTCATACGCTATTATTTTAATTGGTTTTTGGTGAATTAATTAAAGTTTAAAACTGAATTGGTTCATTTTAGGCAATTGGAGATTTACGCTAGGGTTTTT
GGAGAAAGAATGCAAGAGGAGAAAAAAAGGAGAAAGAGCAAAGTTTGTCGTTCTTGAAGGTGTAGCTTGTGAATTTTGACAAAGGTTGATCCCTCAAGAG
GTATGTGAGTCTTTCATTGCATTCGTTTCGTTCACTCACGCGCCAAGCATGTTTATTTCAGCGAACTTCGTTCTGGAAAGTTGAAAGTTGATGAATTTTG
AATGGTGTTCATGAATTTGTTTTTCGTTCTTGAATTGGGATGAATTTTAGAAGTTTCTAAGATCTTTACCTCGAATTTTAGAGGTTGTTTTAAGAGAGAT
TCATGGGTATATATGATGGGTATCGAAATCTAAAGAAGAGTTGAGAAGAATATCGAGTTTAAGTGAATTGGGGTTGGAAAACGTAGAAGGAAAAAGTTGG
ACAAGGAATAGGTAGTAGGAAAATTTTCTCTCCGCATTGCGGAGAGGACGCGGAATCCTCTATTTCAAAATTAAATTTCACAATTAATTATTTAAAAGCA
TCTCCGCGTCACGGACTTGTTCTTAGACGGTGATTTGTTGACCGTTTTTTATGTTTAGATATCTAAAATCATTTCTAAACATCACGAGGTCTTCCCTAAT
ACAAATCATGATCCTTGAATCCATAATTCAATTCTAGGAAACTAAGAGTCAAGTCAAGAGAAGTTCATAAAGTTTTCAAAAGTCTTTTACATATGTTGTA
AATTTATTTTAAGACTTAAGTTTGAGTTGAGTAAAGAGTAGAAATTGAAGTCACTTCTTCAAAAGTGTATATCGGGACTATGTATTTCAAAAGATTAAAT
GTTTTAACATTCAAACAAGAAAGGAAACTGAGATTTTAGAAAGAGTCTCTATGATAGTTTTTCATTAAAGAGGAAACATTGATTTCCAAAAAACCTATGA
GCTAGTTTTTTAATGAAGAGGAAACTGAGATTTCCAGGAGAACTTCTAAGCTATGTTTTGAGTAATTATCTCAAACCAAAGAAAGAGTTTTACTTACAAA
CTAATGAGTTAAAATATATTTTGGGAGTATTTGTCACTCCTCGAGCCTACACCCTTGACGTGGATGACACCCATTTACCATTGCTGACCTTCAACGAACC
CTTGGCATGACTTACTTAACTTAGCGGAAGACTTAACTCATTAGTAAAAAGAGAGCATTCTCATAATTAACTTAATTTAACGTCTTGGCCAAAATGACAC
TTAAGGCTCAAACATAATATCTGAAATAAAAGACACTTAACTGAACTGACTGACTATCCGTCTATGAAGCCTCTAAAAATACTATGAGAAATGTTGGGAC
AAACCTCGCAACATTATGAAATTTAAAGACCAGAAAACATGAAAAGAATCCTTCGAAATGCAAGGAGAATCACCATTGACTCTGAGTGCTCAAACTGGAT
CAATGATGCGCTGGATGCTGATCTTGGTTACCTGCGTCTGCATCATAAGACGTTACAGGCCAACTGACATCAATACATTGAATATACGAGTATGTGCGTT
GGAATGCTAACAAAGACTTCAGCTTGATTGGATAAGATGAACTTACCTTGGCTCTGCTCAACTCAAGAGATACTCTACTCAATGTATAAAGCAATTTAAA
ACACATCCGATATATATAAAGCTTGTAAAATAGTAAAGCAACTTAGCTCATCAAAGAAAATGCAATAACAAACTCAACTTTACTTATATATGGAATTAAT
ATAGTTTTGTATGAGGTTCTCTAAACGACAACCACCATCAAGAGCCTAAGTGGTGATATAGCGTCTCGCCTACGCTGCCAGAATTATCCTATACTTCGTC
GTCGCATAGGACATCCTCAACCTAGTGGACCCAGTAGCTTAACTTACGTGATCATCTAAAAATTATGACCCGCTAATAATACCTATGATGGCTATATGGT
TTACATGGATACTTGAGTTAATATGAACTCTCATCCCCACATCGGTGCTCAATACTACTTCCAAAATATACTTTAGCTCATGCTTTTGAAATAACTTCCT
TCCTTTGGGTTAAGATAATTTGTTCAACTCTTTTTTAGCTTTAAAAGACTCTCTTGGAATAAATGTTCCTTTTTCTTGTTCAAAACTCTGTTGGAAAATC
TTAGTTTCCTATTAACTTAAATGTAAAAACATTTATAAATATTCTAGGGAATACTTGGTTCCATCGTTTGAGAAATTAACTCAGCTTTTTACTCTTCACT
TGACTTGAAACTTTTGATCCTAATCGATTCTTTAGGGAATACTTAGTTCCCTTATATATTTTGAAGGAAAGACTTCAACTTTTACTCTTTATTTAACTCG
AAACTTGATACTTAAAACGAAGTTTAAAATGTTTAAATAAGACTCTTGGAAATTTTAAGAGCTTCACTTTAACTTCCTTCATAGTTTTAGACTTGACTTC
TTAACTTGCTTGACCTTGATACTAAATTTTCTTGAATTGAATTATGGATTCAAGGTTCATTATTTATGTTTATGGATGATTTCATGTTGTTTAGATGTAC
CTTAGAGTAATGGAATCGACTAGGAATTGTAGGTACATCACTTAGGAACTAGTACGAAAAGATAGGGAAATAACAGGGTGTCCACGAAGACTTGCCACTC
TGAGAGGCGCGGGGCACCAAGGCTTGATGGACATACACTGTCCTCAGGCGCTCTGGATGGCGTGACACGCCAGAGCCTGTCGGACAGAGTATGTCTAGGG
GGGATCTGGTTGGAGCGGCTCCCCTGGGCATGTCAGACGGGATATTTTATTCTTCTTTGATTTTCATCTCTAAATCATCTAAACTTCCATGGATATCACC
CAATCACTTAGGATCACTAATAACCTCAATTCCTAATAGATTTGACTCATAAAAAAAACCCAAAAACAGGAATCAGATAGACTAAATGCATGCTACAAGT
CAACCAACAAGAATTCAACAACTGTTCATCAAGAATTTCAATATTTATCATTCAATCTATTTAAAACTCGCTGAATTAAACATGTTGGTGTGTGGGTGAA
CGAATCCAACACAAAAAGTTCTCACATACCTCGATAGGGATCACCCCCGACGAATTCCACTTGCAAAACCTTAACGTTCTTGAAGGATTCTTGATCTTCC
TCTTCTCTTCTCTTTTCTCCCAAGCCCTAAGCGTACTCAATTTTTGTAAAACTAAATAAAGACTTAGTTTTACCCCTAATAAATCCTTATAACGAATTAG
GAAATAGTAGGGTGAAAAACCACTTTATTCTTACTAAAATTCGGATTGGACTTTCCTCAGTCCAACAACACAACTTCCGAAAGGCATATATCCCGCATAC
AATATCGAAAATGTGCAAACTCCGCAGCGTTGGAAAGATCTCTCCAAGGGCTTTCCAACCATATAAAGAACTGACCCTAACTCAAGCTAGAAGTTATTGT
CATTTGAAAATGACCATGATGACCAAAAACTCACTTTTACACTTAGGAAATTTTCCAGATTTTTTCTGATTCTTTCCAAAAATAACTATTCTTAGTTTCT
TTGTTTAGTCCTAGCTATTTCGATTTACGAGATGTTACTGTAGAATTGAGCATCAATATGGGGACGAGTTTGAGTTCAGAGAATTTAACGCCTCCATAAC
CACAATAAGATTTTTAAACTAACACCACTCATATAACTATGTGTCTAGTTTAGATACAAAACTCACTAAAATTCATGATCAAGTTCCTAAATTTTGATGT
CAACTAAATGTCAACTTTCATATTTTTTCTAAGTTTCAAACGTAAGATTAGATCTTCATTCCTCCAAATAAACTAACATTTATAATATTCATAAATATTA
TACACCTAATATTGAATTATTTATCTCAAAATATCAAACTTAATTTATAAGAAAAATCCAAATTTAATCAAATTTTACAAATTCAGTACGTGACCTTCAA
ACAAAGTCATTAAATAACTTTATTTCACAATTACATTATGTTTCCAATCATAAACTCATGATTACCCCCATTAATTTTACCCCACCTTTTTGACTTTCAC
GATCCAAAATGAGTGTGATGGCACTCGTTTTATCCCACCAAGACAAGTCAGCCTAAAACCCAATATCTAACAAAGTGCGGAAGTAAATGACAATCCAACA
ACAGTTTCTATTATGAAACCAAGTCATATTAATTCAATCCCCAAAACCAGGTTGTCACGTGCCTCTAATGTAAATATTAGAATTATTACAAAATGAAAGT
CTAAAATGGAGTTGTCTTTCAAGTAAAAACAAAGTCCATAAACTGGAGTAGGAAAGTTCGCTGAGATGACAAGCAGCTACCTCACAATCCTCCACAAGAT
GCATCGGAAACAAAAAGAATGACAGGTATCACGAAGATCCGGGCTCGTAACCTACAAAAATTTGTAGAAACAAGGGGTGAGTACCAAACCACGCGGTACC
CAACAAGCAAACCTCTAAACACAAGTTAAGTGAACAAAATACGGGCACTCCTTACACCCTATCTAAACTTCCACGCTACAGTCTAACAGTTTACAGTTTA
CCAAACACACAAATCAATAACCACACTCTATCAGTTTACACATTCTCAATAACAACTCAATATTCAACAGTCACAAGCTTCACAGAGAAATACTCACAAG
ATCAGCAAAACACGTGTTCAAGTTCATCAATAATAAAATGTGCAATGCGATGTCAAGTATAGTGATGCATGCATTCCCTAACGATACACACCCGCTGTCT
CTCAGTCCGGGACCCATGGGGGACATATCTGTCCATGCATCTGTCGCGGCGCACGACACGACCCTCGATAATAGTAACCATTGCGGCGCGCGATACATCC
CTCGAAATATAATACCATCGCGGCGCTCGATACGACCCTCGGAATAGTACATCCTCTTATCACAATCATGTCTCAGATACAATGCAATTGACATGCTCAA
ATGAGAAATGAGGAGATAACCGTTTTGATAACAAAGAACAATTTACAGCAAGGAATACAACACTAACAAATAAGCAACAAGTCTCCAAATCATTCTCAAC
ACCACACAAGGAAATACACGAATTTCATACGCTTAACAAGAGTTTAGAAATCCACTTTCCTTAGCCAATCAAATAATCACTGTATGACTTGAGTCTTTCC
TTTCCGTTGAGCTTCCGAATCGATGCAACCTATTCAAGTATATATTCACAATAAGGTTTCGGAACTAACAATACCCACACTATTATGTGTTTAACCTTGA
CCTAAAAATTCACCCAACTTTATAATTAAGTTTTTAATTATTGACGTCAATTAATATTTCAATTATCATATTCAAATGGTATTTATATGATACTATAAAT
CTAATATTTAATTACCTACCCCATGTACCAACACTTAACTCAGAAAGTGATGATAATAATAATTTTAATCCAAAATACCGATTACTCACGGAAGGAGCAC
AACCTCCGTTCCCAATAGTTCACTCATACCCCTTGAATGCACTTTTCCGAATACTTATTTTCCATCCACACATGTACAACAACCATTACACATTGAAATA
CTCAAAAAAAAATCAACTAATTACAATTATTTTTATCAGGGGTTCCACACAACAATTAATAAACTAATAATATATAATAATATCAATAGCCACAACACTG
TTTTCTTTTCTTTGTATCATATTTTCCCAAACCCTCTAGAAAGATGCACAGCATCACAAATCACCCCTTTAACCCCCACTTTATTAGCACTATCACTATA
CTAATTATATATAATAATAATAACAAAATAATGGTGCTTCCAGTAGTCCCAAAATTCCACGAATGACACACTAAATCATAATAAAACATTAACTACTCCG
CTAAATCAAATTCTCAATTCCTACGAAATTTCCATTTGACATAGAGTCAATATGACAAAACAATTGCGATAAATTGCTCTATTAATTGTTACCTGGAGAT
CGAATTTCTTCCCTTTCGACCCTAATATTATAAAATCTTAAATAACTGATCACTTTAGCCCACTAACTATCTATTAATTTCATTATCTATAATTACTCAT
AAATAAATTAACTCAAGTTATACGAATAATTTAAGTTTTCCAAAAATAAGTCATTACATTGACAACTTTGCAACCCTTTAGAAATCATTAATATTGTTTA
TCATGCCCCCACAAATCAATATAATATTGATTCATGTAAAGCTTCTTTTGACTTTAATAAACGAAAATAACTTAAGCTTTAGCTTACAATTTTTACCTGA
AGTGCGCAGTTATCCAATTCGATGCAGTTCTCATACACGTCGAGGTCTCGATCTTATGATTCTAAAATTACTAAACCCTATTAATTATTATATTACATAT
ATGAGTCTGACTTGAAGTATTCAATAATTTATAGGCTTAGTCCATTAATCATCAACTAATAAAAATGATAATTACCTACTAAATAAATAACCTTAGTTAT
CAAATAGTTTAAAATTTTCAAAAAGGATATTACGGATCGTTACACATAGAAAGCATGTTAAAAACTCTCATTAACAAATTGAAGAATGTTGATCTTCAAC
AACTGAGCGAGATCGTAAAGGCAAAATTGGACAAAGTTGAAGATGTGGAAAAGCAACAAATAGAGCGTGGTGTTGCATTTCCATATCAAATCCTTGGAAA
TGCATTGACTCCTTCTAAGGAGAAGTAAAATTATTCATCAAGTTTCGATGTTGGACAACCTAGGCCTTATTAAATTTACCATATTTACGATTTGAATTTG
ACATTTCAGTATATTTATTCTAATATGAAATGAAATAAAATTTATGTCTTTTACTGAAATTGGAATAAATTAAAAATTAACACACACTAAATAAATGACA
TAAGTTTTATGTCAATTCAGATTAGGATAAATACACTGAAAAGTAAAATCAAATCATAAGTATGAAAAATTTCATGAAAACCTATTTGTCCAACATCGAA
ACTTGACGAAAATGTTTACTCATACCTCCAAGGATTTGATATGGAAAAGAAATAACACACTCCATTTGTTGCTTCGCCACATTTTCAAATTCTTTCATGC
CTCCAAGATCTTACTGAGTTGTAGAAACTCAAGAATCTTCAAAAAAATTTAATTGGAGATTTCATCATCCTTTCTATGCAAGCGACCTTAATTTTTCTTT
TCATGGAATAACTTCTACTTTATGAATGCAAGAAAATATGGTGTAGAATACTGAAACCAATAGTATATTTATAGTGATCAAGTATCATATTTTTTGGTAA
AAATGAAATTGTGTATAATAAATAATTTTCCATAAATGGTAGAAGAATATTTAGGATTTCTTTTTATTTGTTTTCCACAAATGATAGTAGAATATTTTGG
ATCTCTTCTTAGATATTTTTAAATTTGAACGTTCTTTTGGTCAAACTTCTTGAATTCATAGTAAAATAAGTATTTATAAGAGTCAACTAAATTTTTTAAA
TCAGTTTGACTTTATGTTGTTACATACCATATTTGTTTTTAGCTCCTAAAATAGCAAAATATTGTGATACTAATCCTTATAATATTTTATTAATCACCTT
CAATTTTTAATCAATTAAAATAGTCATTCCTGATATTTTGAATCTGAAGATTTCACAAATTTTCAAATTTATTAATTTCTAAATTATTTAATTATTCAAG
TATTATATTAAATTTGTATTGGTAATATTTACTTCAAAACAATGTCATTTTTAAAAACAGTCTAGATGTAACCTACTTTCTGTGTGAAATGATTAAAAAA
ATAACACACGAATTAAAATTTGAAACTTATTTGGTTCCTACACAATAAATTAAATTAAATTAAATTTAAATACACCCTCTACGCTCCTACTCTTCAAAGT
AAAATTAATAAAATTCTAATTTTAATCTCTTAGCTCCTATTCATAAAATAAATGGTTAAAAATATAACCAGGATTAAAATATAAAATTTTGTAATAAAAC
TAAAGCAAAATGAGATAAGAAATATAGAGATGAAAGCAATAGAAATAGGGAGACAAGAGAAGAAAGTTTTTCTTATTCTTCTAAGTATTCAATTGGTAAT
TACATCTTCAAGCGTATCCAATATGAACATTTATGCCTCTATTTATAGTCTTACATAGAGATATATAAAAGATTAGTTATAAACCTGACATTAATCGTGA
AAGTTATGGAGACAGTAACCATGTATGTTATAGAGGAATATCAAGGGGGAAGGTTATGGAGGTATGGGAGTTACTATACATTATCATGTAACTAGGTAAC
TTTTTCACGATTTGTGTGATCATAAATAATAATTGCATTGAACTTTCAAATATTATTTTTACCAATATCCATAAATTAAAAATAATGGGAAAATAGGTTC
TTAAAAAAATATTAGCAATATTTCAACGTGAATTTGATTATTTTTCATTATCACATAACTCAAGAACATCTAATGAATGAATTATTCACGAAATAATAAG
TCATTGGTTCTTCAATCAACATTAAAATGAATGTAGAAGAAAATAAGAATATATATGTGTAAAACAATTTGTAATAAAAAAGAAACATTTAACAATCTAT
TCAACTCGAAAAACTCGGAAACACGAATCAAATCGACTAAAGGCATGCTATAACTCCACAACAAGAATTCAACAAGTGTTCATCAAGAACTTCAATATTT
ATCACTCAATCTATTCAAAACTCACTGATATAAACATGTTGGTGTGTAGGTGAACGAATCCAACACAGAAAGATCTCACATACCTCGATAGAGATCACCC
CGACGGATTCCACTCGCAAAATCTTAGTGTTCTTGAAGGATTCTTGATCTTCCTCTTCTCTTCTCTTTTCTCCCAAGCCCTAAACGTATTCAATTTTTAT
AAAACTCAATTAAGACTTAGTTTTACCCCTAATAAACCCTTAAACGAATTAGGAAATAGTAGGGTGAATATCCACTTTACACTTACTAAAAAATCCTGAT
TCAACTTTCCTCAGTCCAACAACAAAACTTTAGAAAGGAATATGTCCATCATATAATATTGAAAATGTGCAAACTCGGTAGCATCTGAACGATCTCTCCA
AGGGTTTTCCAACCATATAAAGAATTGACCTTAACTCAAGCTAGAAGTTATGACCATTTGAAAATGACCAAAAACTCACTTTTACACTTGGGAGTTTTCC
CCATTCTTTCCAAAAATAAATATTCTTAGTTTCTTTGTTTAATCTTAGCTATTTCGATTTACGAAATATTACAGTAGTATTGAGCACCGATATGAGAACG
AATTTGAGTACAAATAATCAACGTCTCCGTATACCAATCATGGATAGTAAAGAATCATACTTTTTAAGTTACTCCTTAAGATGATTTTAGTAAAAACTAG
TGGATCTACAAAGATAAGTAGTTCTATATGACGACAAATGATATGATAATTCTGACAGTAATGAAAAGACGTTTTATCACCATTGGACTCATAGTGATGA
TTGTTAGTTCAAGAAACTCCCACAAAAACTATATTACTTTATTATATGAGTAAAGTTTAGTTTTTTATTATATTTTCATTAACGAAATATGCTGGTTTTG
CAGTTTTATAAAGATTTTCATAAATTGCATGTATTTCATTGCTTTATTTTGATTTAATTTATTCACAAGTTGCTGTCCATCACTATAAAGAACAACTTAT
ACAGAAATAAAACTTCAAACCATCAGAAAAAGAACCCCACAAAATAAATAATAACTTGTTTGTTTGAGAATGCAAATGAAAGAGGAAAATTTTCAAGTGA
AGAAGTTTTTATATATAGAAAAAATTATTTAGCTTATGATAATACAGAATGTTTTATTGAGTAGGATACATGAGGATTAGTAGATTCTCTCATTCTATTT
TAACTGATTTAATTTAATGAGTAGGAGTGAATAGGATAAGTTTCAAATTTTAGTTCTTCTAACATTTATAAAGCATTTAATTTGGTGAGTAGATTCATAT
GAGAGTAAAATTGGAATGTTATTAATTTCATTTGACGAGTAGAAGCCAAGAGGATAAATTTCAAAGTTAAATTCTTGTATTTTTTTAAGTATTTAATTTG
ATGAATAGGAGTTAGGAGAGTAATTTGAAGTTTTATTTAATTAAATTTGATCAGTAGGAGTCAGGACCAAGAGGGTATATTTTGAATTTTAATTTTAGTG
ATATTTTCTCAAGTATTTAATTTGATGAGCAGGGTCAAGACAAAGGCATACATTATAATTTTATTTTATTTAATTTGATGAGTAGAAACTAAGAGGTAAA
ATTTTAATTTTAGTGAAATTTTCTGAACTATGTAACTTGATAAGTAGAAGTCAGGACCAATTAGCGTAATTTAGAATTTTATTTAATTTAATTTGACGAG
TAGAAGTAAAGATATTAAATTTTTTTTATCTTAGTTCTTGGAATATTTAAATTTGATGAGTAAGAGTCTAGAGAGTAAATCTAGAGTTTTATTTCATTTA
TTTTGATGAGTAGGATCCATAAGAGTGAATTTAAATTTAATTTAAATTAATTTGATGAGTAAGAATCACGTAAATTTCAAATTTTTAATTCGTGTAATAC
TTTCTTAATTATTTTATATAAAAATTATATTCTATCTATACAGTTTGTAGAAATTACATTATTCTTAAATATTATGAATTAACAATAAAAAAATCAATAT
TATACCTCAAAAATGAAATGATTTAAAAATTAATAAATTCTAAAATTTGTGAGATCTTCACATGAAAAATATCACAAATGAATATTTCAATTAATTAAAA
CATTATTGTTCTTAATAAAATATCATAAAGATTCATATCACAATTTATTGATATTTCAGGAGATAAGAACAAATACACTATGTAACAACAAATTTAGATG
ATTTAAAATTAATTTTAGAGTCTTATAAATACTAATTTTACTTTGAATTCAATATAGAAAATATGAAGTTTCAGATTTGAAAGTGAAATTACTTATACAA
AGGATGTAACCAGCAAAATGTAATAAATTATTGTATATAAAAGGAAAATTAGACTATGATTCTTGATAATAGAAAACAAATAAGAAGGGATCCAAAATAT
TATACTACAATAAGTGAAAAATTACTTATTGTGCATGAGTTCACTCTACCAAACAACATGATAATTTATCACCATAATTATACTCATGGTATCAATATTC
TATATCATATTTTCTTCAATCTCAGCATTGAAATTTTGACAAGGAAATATAGATCAAGTCACTAACATAGAAACGTGTTAAAAACTCCCATTAACAAATT
GAAGAATGTTGATCTTCAACCATGAGCGAGATCGTGAAGACAAAATTGGATGAAGTTGAAGATGTGGAGAACCAACAAATGGTGTGTGGTGTTGCATTTC
CAAATCAAATCCTTGGAAATCCATTGGCTCCTTGTAAGGAGGAGTAAAATTATTCATCAAATTTCGATGTTGGACCAACTAGGCCTTATTAAATTTACCA
TATTTATGATTTGAATTTTACATTTCAGTATGTTATTCTAATATGAAATGAAATAAAAATTATGTCTTTTGTTTGCTATGTATTAATTTTTCATTTACTG
ACATTGGAATAAATAAAAAATTAACACGCGCCAAATATAGACATAAGTTTTATATCAATTCATATTAAGATAAATACACTGAAAAGTAAAATCAAATCAT
AAGTATGAAAAATTTCATAAAACCTATTTGTCCAACAACGAAACTTGACGAAAATGTTTACTCATACCTCCAAGGATTTGATATGGAAAAGAAATAACAC
GCTCCATTTGTTGTTTCGCCACATTTTCAAATTCTTTCATGCTTCCAAAGATTTTACTGATTTGTAGAAGCTCAAGAATCTTCAAAAAAATTTAATGAGA
GATTTCATCATCCTTTCTATGCAAGTAACCTTAATCTTTCTTTTCATGTAATAACTTCTACTTTATGAATGCAAGAAAATGTGATATAGAATACAGAGAC
CACTAGTATATTTATAATGATCAATTATCATATTGTTTGGTAAGAATGAACTCATGTATAATAAATAATTTTCCATAAACGATAGTACAATATTTTATAT
TTTTTCTTATTTGTTTTCCATAAATGATAGTAGAATATTTTAGATCTCTTCTTAGATATCTTTTATATAAGTGGTTTGACTTTGAAATTTGGACCTTAAT
ATTCTAGTCAAACTTCTTGAATTCATAGTAAAATAAGTATTTATAAGAGTCAAATATATTTCTTAAATCATTTTGACTTTATGTTGTTACATACCATATT
TGTTTTTAGCTCCTAAAATAGCAAAATATTGTGATACTAATCCTTATAATATTTTATTAATCACCTTCAACCTTTAATTAATTAAAATAGTCATTCGTGA
TGTTCTGAATCTGAAGATTTCACCAATTTTAAAATTTATTAATTACTAAATTATTTAATTATTCATGTATTATATTAAATTTGTATTAATAATATATATT
TAAGAAAAACGTCATTTTTTAAAATAGTCTAGGTGTAACCTAATTTCTATGTGAAATGATTATGAAAACACCACATGAATTAAAATTTGAAATTTATTTG
TTCCTACACAATAAATTAAAGACCTAAGTCATCTCCAGCCACTCAAAGTTGTCCGCATAATTCATTTAGACACCTCAACTAATCCTTGTACCAATTGAAC
ACTTTATTTGTTCAAAAGTCATTCCTATTAGACACAAAATGCTGACATGGCAAAAAACGTGTAATTCACTTTCCTTGAGCGCGTTAATTTATTAAAAATA
ATATTTTTTCTTTTTTTTAATTTATACCCCTAAGTTAATTTTAAAAAAAATTAACAAAAAAGAAGATCTGTTCTTCATCTTCCCTATTTCTATCAACCCC
AACCCAACACAACCCCCATACCCATGCTCCAATGGTTATCTTCTTCCCCACCATTCTAATGATTTTAAAATTCTTAGCATCAGTGGTTATCTTCTTCCCC
CACCATTCTAATGGTTTCAAAATTCTTAGCATTTTGTTTCATTCTTTTTTTTTTCATTTTTTGGAAAAAAAACCTGCTAATTTAATATGTGAAGAAGAAA
AATTCGAACATTAGAGTTAAAAATTGATCGATATTCGTCTATCTCTATTTCGATCACTCCGATTGAACAAACATCGCCACTCATTAATTTATTAAAGATG
ATATCAAAAAATTCAGCATACTTTCAATTTTTCTTGGTCATGAATCTTAAAAACAATTTATTGACGTTTATTTATTTTCACAAAAATCTCAAAACAAATG
GAGAATAACAGATGATAGGAGATTAAATTTGAAAGGGAGGTTTTTATTTTTGTTATGGTGGCTGCCGGGGTTACTGGGTAGAGGAATGGATAAAGGAAGA
AGAAAGGTCAAAGGGTTAGGTGGGGGTGGGGGAGATTTTCTTTTGTTAATATTTTTGTGATTAATAAATAAAGGGAAACTATTTTTCATTTTTTTAAATT
AAAAAATTACATTTTATTGCTAGATTGGGTCCATGTGCCAAGTGTCATAATTTTATTTGTCATTTTTTAAGTCAAAGCGCGTGAACTACACACAAAATAT
TTTTAAAAAAAGTTTTCGTTTTATGTTCAATAGATACATATTCTTTAATATTAAAGTGTCTAATAGGTAATAGTCTTAGTTGAGGTGTCTAAGTGAATTA
TGCGAACAACTTCAAGGGGCCGCATATGACTTAAATTTAAATACACACTATAGCTTCATATTCATCTATAATAAGAGTAACTATAATTAGCACTAATTAT
GTGACTCATGTGTAATTATTTATTCATGTTTTCTCTATATATATCGGATGTACAACCCTTAATCAATAAGACTCATTATTATATCATGGTATCAGAGCTA
AGGTTAAACTCTTCCAAAACCTAAAAAAAAAAAACCTAACCTTCTTCTTCTTCTTTGTTGCTGCCGATCAATAACAAAACAAATTTTTTTTTCGGTTGCC
TCTCTTCATCAACAATGAGAGCCGATCCCCTTGCCACCCTTCCCTCAGGTGTGAAATTGTTCCTTCGCAATCTTCACAATCTCATCCCAGAAAAATTAAT
CGATTATAATTATCCAGCCTGGTCGAATAGCGTCAAGACGGTGCTCTCCGCAAATCTTCTTCTTGGTTGGGTCGACGGCACCGGCATAGTACCGCCAGTC
AATGTAACCGTCACGGACAAAGATGGTACAAACTCGACAGAACCAAATTCCGATCATATGTCGTGGTCTCTTATCGATACTCAAATTCATGCCTGCCTTC
TCGCTGTGATTAGCCCGCAAATTCAGAAGTACGCTCGTGGTTTTGCTACTTCTGGGGCTGTTTGGAATGCTCTTGCTACCCGCTTTAATTCCCTATCTAC
AACCCATGTTTTTCAGTTGCGTGATCAACTTCACACCCTTCGCAAGGGCACTCGCACCATGGTCCAATATCTGGACGAAGCAGCTACGATCATCTCTGAT
CTTGATGCCTTAATGAAGTTGTTCCCGAACGAGATGTCATCAATGCTGTTGTTCAGGGCCTGCTTGCTGAATTTTCCTCTTTAAAATAGCATATCCGATA
TCACGATGGTCTTCTCACACTAAATCAAATTTTGGGCTGGTTGAATGCAAAAGAATTAAACCTTGCCATGGAATCCAAATTGGCCCTCGCCGACTCGACA
GCTCAGCCAATCCACACTGCCCTTTACGTGGCTGGACAGCGTGGTGGGGGCCGTCCAGGCAGACGCGGCGCACACCGTGGCAGCGGCAGAGGACGCCAGC
AGCCCTTCGTCCACAATGGCTGTTCTGGCCGCAGCAGACCCGACCTGGAAAACCGACGCGGTGGCGGCAACAATCCATCCTCCAATCGTGAACTGCCCGT
GTGCCAAATCTGTGAAAAGCGAGGCCACGTGGCTCGCGTATATTGGTACCGCTATAACTAGCAATCTGCTCCTGCACCAAACGGCGGCACTCGTGCGATG
CATGCATCTACAAGCAACTCTTCAAGTGATTGGTATCTGGATACTGGTACAAATTCTCATGTGACGCCTGATTACTCTCAACTCCATAATCCGACTTCAT
ATTCCGGCGCCGACACAATCACTGTAGGTAATGACCAACCTTTACCCATCTCCAATACAGGTTCTGGCTTTGTATACACTCTCACAGGTACTTTCTCATT
ATCCACGCTAAATCACGTCCCATCCCTAACATCCAATCTTCTGTCTGTCTATCTGTTTACCAAAGAAAATAACTGCACTCTTCTTTTCAATGCCCATAAT
TTTCAGATAGTGGACAATTTAACCAAACAGATCTGGTACAAGGGCCGCTGTGAGCAAGGTCTATACACTCTTCCTTCCAAGCTATCTGCGTCAATCTCTT
CTTCATCAGTTGCTAATCAAGCCATTCGTTCATCAACCTGGCACCGCCGACTTGATCATCCATGTGCCGAAGTCACTAAGTCCATTCTGTCTGTCTTAGG
TTTTTCTTTTTCCACCAAGGACCATTGTGAGTCATGTTATGTAGCCAAATCAAGTCGTTTACCGTTTATCTTATCTAATACTAAGGCCACAACGCCATTT
GAATTAATACACTCTGATGTTTGGGGTCCAACCTCCATCTCCTCTTTTAATGGTTTTCGTTACTATATATGTTTTGTTGATGATTATAGTAAATTTACAT
GGCTTTATCCCTTAAAACGCAAATCTGAAGCATATTCGGTTTTTGTAAATTTTGAACGCATGGTCAAAACCCAATTCAACTCCAACATCAAAATCTTTCG
CAGTGACAATGGAAAAGAATTTTTAAACAATGCCTTTGGCTCTTTTCTCCAATCTCTTGGTATTGTTCATCACACATCTTGCCCCTATACTCCTGAACAA
AATGGTGTTGCCGAATGCAAACACCGTCACCTCATTGAAACCGTCGTCACTCTTCTTCATGAGTCTCATCTCCCTGCACCTTTCTGGGTCGAGGCGTTGG
CCACTGCCAACTATCTCATCAACCGCATGCCCTCACCCTCCCTCTCTAACACATCTCCTTATGAATGTCTATACACACACCGTCCAGATTACACTCACCT
TCGACCATTTGGTTGTCTTGCCTATCCTTGGCTACGCCCTCACACTCAACACAAACTTCAACCCAGGTCTAAACCATGCATCTTTCTAGGCTACCATCCC
ACCATAAAAGGATACAAATGTTTTGAACCCATCTCTCAAAAAACATATGTCTCTCGTCATGTTCGTTTTATCGAGGAGGACTTTCCCTATCCCCGGTTAA
GCTCCGTCACTGCCACGTCCAACCCACTTGGTCTTATTCCAATCTTTACACCGAGCTCACATGTCCTTCTACCGGCATCCATTAACCCATCTATCATACA
CACACCACCCAATCCCAACACTCTCATCCCATCTGGATCACCCACCACCCACAATCCACCCATCCCACCAACTTTCAACCCTCCTCACCAACAACCTCCA
CCAGCCGAAACAAAACCTCCTCCACCCCCACCCCCACCCCCTTTACATCACATGCAAACCCGTTCCAAATCCGGCATTTTCAAGCCCAAAGTCTACGCCA
CCACTTCACTTGCTCCCTCTCCCTCTGAACCTACTACCTACAAACAAGCATCCACCAACCCCCTTTGGTGTCAGGCTATGGATGATGAATACAGGTCTCT
TATTAATCAGCATACTTGGGAATTGGTGCCAGCACCCAGACATCGAAAACTAATTGGTTGCAAGTGGGTGTACCGCATCAAACGTAATGCTGATGGATCC
ATCTCTCGTTACAAAGCTCGACTAGTTGCGAAGGGTTATCATCAAGAGTATGGCATTGACTATAAAGAAACTTTCAGCCCAGTCGTCAAGCAGCAGACTA
TCCGTCTAGTCTTGTCTCTCGCTCTTCATAATAACTGGCCCCTACACCAGCTAGATGTGAGCAATGTTTTTCTCCATGGCACTTTCGACGAGGACATTTA
TATGGATCATCCGCCTGGCTATGTTGATTCCCGCCATCCACATCTTGTCTGCAAGCTCAACAAGTCCCTCTATGGTCTCAAGCAGGCCCCCCGTGCTTGG
TATAATCACTTCTCTTCTTTTCTGCAGGATATTGGCTTCTGAACGTGCACTCATGACACAAGTTTATTCACTCTCCGGCATCCTCATGGCCTAGTCATAA
TTCTTCTCTACGTTGATGATATTGTGATTACCGGCAACTCATCTGCTCTTATCTCCACCATCACTAAATCCATGCATCAAAATTTTCAGCTGAAAGATCT
TAGCCCTGTACATTACTTCCTTGGCATTGAATTACTTCGTACCTCCTCCAGTCTCCTACTTCATCAGTCAAAATACACTGAGGAGCTTCTCACTCGGGCA
GGAATGGCTGAATCTAAAACTGCACCCACTCCAATGGCTGTCCATCCACCATCCACCTCCGACAGCCGTCTATTCGACAATCCGACCCTCTATCGAAGCA
TAGTGGGTGGTCTCCCCTATCTAGTTGTTACTCGTCCAGACATTCAATATGCTGTCAACCGTGTCTCTCAATCCATGCACGCTCCAACTGAACAAAATTT
TCAGGCATTAAAACGGATTCTTCGTTACCTAAAGGGCAGCTTACGTCGTGGACTTCTTTTCACAAAAGGGAATCTAGAGTTCTCCGTCTACTCCGACTCT
GATTGGGCGAACGACAAGGATGATCGTCGCTCCACCACCGGGTACCTAATGTTTCTTGGACCAAATTTAATCTCTTGGTGCACCAAAAAGCAAACACGGG
TATCTCGCTCTTCCACTGAAGCCGAATACCGAGCTATGGCGGCTGGAGTTGCCGAAGCTATGTGGCTTTATGACATTACGGATGCACTTGGTCTTCCTGT
CTTTCGGCCAAAGATTTGCGGTGACAACGAGTCCACCATTTGTGTTACAAAAAATCCAGTCCTTCACGATCGTATGAAGCATATTGGGTCTGACTACCAC
TTTGTTCGTGAACAGGTCATGGTTGGTACTATGAGCACACATCATGTTCCTTCTTCCGAACAACTTGCAGACATACTTACCAAACCTTTTCCACCGGCTG
CGTTTCATTACCTCGCTACCAAGCTTCCCCTCGTATCCGTGGATCAGCTTGAGGGGGGATAAGGAGTAACTATAATTAGCACTAATTATGTGACTCATGT
GTAATTATTTATTCATATTTTCTCTATATATATCGGATGTACAACCCTTAATCAATAAGACTCATTATTATATCAATCTAAGTAAATTAAATAAAATTTT
AATTTTACTCTATTAGCTCCTATTCATAAAATAAATGGTTAAAAGTATCACAAGGACTAAAATTTAAAATTTTTGTTATAAAACTAAAGCAAAATAAGAT
AAAAATATAGAGATGAAAGCAATAGAAATAGGGAGACAAGAGAAGAAAGCTTTTCTTATTCTTCTAAGTATTCAATTGGTAATTAAATCTTCAAGCCTAT
CCAATATGAACTCTTATGCCTCTATTTATAATCTTACATAGAGACATATAAAAGGTTAGTTATAAACATGACATCAATCATGAAAGTTATGAAGATAGTA
ACCATGTAAGTTATAGACAAATATCAAGGGGGGAGGTTATGGAGGTTTGAGAGTTACTATATTTTATCATGTAATTACACCTTTAAGTTATGAACATCCA
CATTAATATATTGGAATATTTGCAGTTTAATTATAATATTGTATCAAGAAATACATCTGACAGATTATTTGCAGTATTTTGTAAATAAATTATTCTTGAA
AGTCAATGTACCAAAACATCTAATCAAGATCCATAAATCTAAACAAGAAAGAATACATCCCCAAACTAATAAACTATTCAACTAATTAGAACAAATGTCC
AAGTCTAGAAATGGTGAACATAGAGGAAAGAGAATCACATGGTAACCCAGAAGAATTGACTCACCCTTGAATTCGAAGCGATGATCACTGATCTTCTAAG
CAAGGTCTGTCAATAGTCGTGTGAAGACGCCCCATACTCAACAAAGATAAGAGCAAGTGTAGTATCAGTACACAACCACAATGTACTAGTAGAATCACAC
GGCTATCCCACTAGTGTAACATAAATAAGTCAAATAATATTATAAGCACATGCATATATATCAACATATACAACATTATCATCATGAAAAATCAACAAGA
CATTTCACATTATCATCACATCATTGGTCCTCTCACGGAACCCAAAACCCAAACAGTTAGCTTATCGGAACATGGCAATTGGATCTCATATTTATGCTGA
AACATTGAAATCTGATCCATTATTATGCCAAAATATGGAAATCCGAACCAAAGTTATGCCGGAACGTGGTAATCCGATTCAAAGTTATGTAGTAACATGG
CAATCTGATCAAAGTTAGTTATGCCGGAACGTGGCAACCGATCTCAAACACACACCACATTCACAATCACAAGTATAACATCAAGATCATACATTTACAT
CAATATTTCATGGCAAGCATCATTCATCTATATCATTTAGAACAAGTGTGATCAATATTACAACATTCATACATATGCAAGTACCACAATAAAGCAAGAA
CATACATACATCACACCAACATAGAATCACAATCATCACCTACCTCGAAACAAGCTTGAAACCCTAAAAAACTTAATCCTTCCCTTTTCGGATTCGTTCC
GCTTGTTCTTGGTCTATAAACTATCACGATAACACTGGAATCAATAACAATAAATCACTAATTATCCAAAACAATAAAAATTCTATGAACCTTAGGTCAA
ACAATGATCCGAACTAACCAATTTAGGGTTATTTCCATCATAAAATCTATATCAAATCCCTTCCCTTTCATTATTAACTCATACTATTACGTTTGACGGA
TCAAACAACTAATTCAGGGAGTAAAAAATTACTGGAAATCGCCTAGTGGTCGTTCCTAAGCTCTAAAAGTTTAAAAGTGCATAATAAAGATGTTTCGTGG
TTTATTAACGACTTTATTTCACGTCCTGTCCGCCATAGCGACACCTATCCCGCCACAGCAGCAACACCAAAGCAGCAAAATCCGGCGCCATTGTGGGATT
TCCAAACCAGTGAGCATACTAAAGAATCTCAAATCTCCATTTCACAACACACCTCTAACCCACGACACTCAGAAAATATCCTTTATGCTAAGATTAATTT
TCAGAGTTCTACACGTACGAATTTATTTTCGTAAAAGTCGCATAGGATTTCTTAACGAGTTATCTAACGACTCATTCAATCACAATTACAAATGGTTCAC
CTGATTGATACCAGATTTCTCTACACTTAGTGATCCGATTTCCTCCAAATTTATATAAGGTTAGGGAAATTCAAATACTACTAAAAAAAGTTTCAGGCCC
CAATTTTTCTCAGTTGACATTTCTATAACGACAAAAACCGGTCGTTAAACACACATCATATTTTTAGATGAAAAATATTGGTTTCTGACCTTGAACCAAT
GGTGATGGGAGAACCTTGTTGACTGGATGCATATATGTTAAATAAACTCATCTTTTACTAAATTTTATTTTTTATATTTGTTCTCATAATCAATGGTCTA
ATTATAATTGGAGGCATAAAATTTTTGCGAAACCAACCACCATTATCATTATAATTTTATACTTTGGAACTGTGTTTTTAATTTAACAATTCGAGCAAAC
AATCTTACAAAAATCAACTTGTAAGTTGATAACAAATGCACATGTGACCATACCATATATGTATCTATTAAGTCATAATAGTAAGTGATCCACATGATTG
GTAAACGGATCCATGTTTACCTTTTTACATGTTTCAAATAAGTTCTGAAGATACAATCTCAACCTTATCTAGTACAATGACCATTTTACCATGAGAAGAA
GAAGCACAAGAGAATTTTTGAAGAATCTTTATTTCTTCAATGTAAATCATGCGAATTCTTAATTTTTTTTCATCACATTTGAATCGGAAAGTTTTAGTTT
ACTTTTGCATGTGATTCCATCATCATGCCTATATTTGTATACAATAAATAAATATTATAATCCGCTTCGTTGTAGTAATCTGAAGATATTAAATCTTCTC
ATAATTTATAGTCTCACTATAATAATTTTCTTCTTTTCAATTCCTTCAGAACATAAAAAATTCTTTTGAGACTTACTATAATCTCAATATTATGTACAAT
TTTACTCCTCCTGATAGTAAAAATTTAGTCCTTTCAAATTCTCAATTAATTTTGTGTACTCTCACAAATATTACAACATCATTCTTATGGTGACCGTCTC
CTTCAAGGGGGAAATTATTACTGTTGTCATAGTTAAAATTACTAGGGGCAAGACTTGTTTCTTGATAACTAACGACAAATTTGTGTTGCCACATAACAAT
ATTTATTTTGGTCATGTCCAAAACCTTTATAGAAAAAAATATATTATCTTTCTTGTCCTTTAGTGGTTATAGTAAAATATACCACAATATTTATGATGTA
CACGAAGTACGTGACCAAATAACTATTTATGTCAAAGTACTTTTTTTTTTCCTCTCAAATCTCACGCATGGGTGAAAAGTGACATTTATTCAATCATACA
TGAACATGTCCTTATCAATGCGAACACAAGTCACATTGTCTTCAAGAACTGCATCATAACCATTTATACATTCTCCAAAAGTTTTTATTAGAAACTCATT
GTTATGCTTTGACATTATTAAATTTATGTAACTCGCCTCAACATCACTTTAAGGGTCAAATGTACCACCATTTTGTATTCCTTTATTTTGATGGAGAAAT
TACAAAAAAAATTCAAATTGAATTGCACCAACAGCAATGTACCCAATAATATTTCATACCCTTTGACGACTTAAAATTACCTTCACATTTGAAGGATCAT
CTTAAAAACACATGTTGTTCTTCCTTTTAATTATCACAATGATGATTATTAACATTTGACCACACTAATATTCAAAACATTCAATCACTTGTCATCTTTC
AAACATATTATGCACTACTACCACATTGATATAAGAGAATGGAGCAAACTTATTGGACAGATTTTATGACTTTTAGTCAAAAATATATTGATTTGTGTTA
GTCATCCCCATATCATCACTATGATACATTAGGACATAAAACTTGATGTCTTACACATATAAAGAAATCGTATGCTACAATTAATGGGACATGAAACCTA
CATATTATTTTCATGTTATACTAAGACTTGAATCCAATCTTTTACCTTTTTTTAGTGCAAAAACATTTAAATCTATGTTGTTATCCTTAACCAATAATAT
AATAGACCAAGTGTACTTGAACTCCCCTTCAAACCTTTAAAATACTACCCCACTTTGTAACTATTTGTATAATTAAATTTCTATAACATATGAAATATAA
TCAAGGAATCAGAAGAGCAGCACACTAATTATATTCTATTATTATCCTCCAATAAAAATAATATTCAATGCACCAAACCTTTTTATTGATTCATCAACTT
ATTGACACAGTAAGATGCTAAATAGTTTTCAAAATAAATAATAAATAGATTAAATGGAGACAGACATACACACAAAATAATTGATTATATTTGTCAACTC
CAAAATGAATTCACTAGTGATCAACTTTGTCATTACTATATTCCTTTACAATTTATTCCTTTTTTTAACGAGTACCTCAAAAATTTATCACCAATACTTT
ATTTTGAAATTCAAATTTATTGTTTACGACAAATATTCATATCATCAATTGAAAGATAGAATTTATCCATAAATTTTAACATGAAACAGGATGACCAAAA
AAAATCATAAATCAACAAGAGAAAAGTTGAAACATATTCCATGATTAATGTCATGTAATTTGCACTGCACAATATCTTAAGCCTAGAGATACTATTCACA
ACAGTACCCAGGAGATGGCAGTAAATATTATATTTTGTTATTCTTTTACTAGAAGAAGTTAAAAGTAATCACGAAAATAATATTAGAGATTCATGCTGAT
AACGTGTTACAAAACTAAAGCATAGTAAGACAAGAAATATAAAAGATGAAAGCAATAATAGAGACACAAGAGAAGAAAGTTTTTTTTATTCTTTCAAGTA
TTCAATTGTTAACTAAATCTTCAAGTGTATTCAATACGAACTAATGTCTCTACTTATAGTATTACATAGAGGCATACAAAAAATTAATTATAAACATGAT
ATTAACCATGAAAGTTATGGAGACAGTAACCATGTAAGTAATGGAGGAAATCAAGACGAAAGGTTGTGGAGGTTTGGGAATTATTATACATTATGATGTA
ATTACACCTTAAAGATACTCTATTGAATGTTTGATAATATGCCTCATTAAGATTATCATGGAGAAATTTCAAAAGCATTCTTCAATTTGTATAAAATTAA
ATGCATTTATCTAATACAGTAATTTAAATTGTTCTATTCGACACATTCTTTTCACTTTAAATGGTAAAATACAACATGAGTTATGATAGCTTCAATAATT
ATTTATTAGCATAAAGATCAGTTAAACACATTTGATGAGAGCAACTTTTTCCTTTTGAACTATAATTGCAATTTACATATTAGTTACAATATTACTCAGT
TGGAACATTCTTTCCACTTATATAATGAACTAAAAAAGATCTTTGATTCTTCTTCAGGTATTTCTGCTGGATCTGTTCCTTTATGAACTATAATTGCAAT
GTGCATATTAGTTACAATAGTACTCAATTACTTATTTTACATGAGTTCACTTTACCAAACAACATGATAATTGAGCACTATAGTTATACTTATGGTAACA
ATTTTTTCTACATCATATTTTATGACATTCTCAGTGTAGAAGTTTTGACATGGAAAAAAAAATCAAGGTCACTAACATAGAAAAGATGCTAAAAACTCCA
GCTAAAAAAATTGAAGAAAAATAATTTAAAACATCTGAACTAGCTCATGAAGAAAAAATTGAACGACGTTGAAGATATGGTGAAGCAATAAATGGAGTGT
GGTGTTGCATTTCCATATAAATCCTTGGAAATGCATTGGCTTCTTCTAAGGATGAGTAAAACTTTTCACCAAGTTTCGATGTTGACCAACTAGGTCTTAT
TAAATTAATCATATTTATGATTTAAATTTTACATTTGAGTACTCATATGAAATGAAATAAAACTTATGTCTTTTATTTAGTATGTAATATTTTTTCATTT
ATTGACATTGAAAAATCATCACACTAAAATAAATGATATAAATTTATATCATCCCTTATTATTAGGATAAACATACTGATAAAGTAGAATCAAATCATAA
AAAATGATATATTTAATAAAACCCATTTGGTCCAACATTTCAAAAAAAATTTACTCATCCCGAGAGGAGTCAATGTACTTCTAAGGGTTTGATATCGAAA
TGCAATAACACGCTCCGTTAGTTGCTTCACCACATCTTAAACTTCTTTCATGCCTTCAAGATCTCACTCGGTTGTAGAAGATTTTCAAACTTTTCTAATG
GGAGTTGTTAGTATCCTATCTATGTTAGTGACCTTAACCTTTCTTTTCATGAAATAAATTTTACTTTATGAATATATGAGACCACGAGTCTATTTATAAT
GATCAATTATCATATTTTTTTTGGTAAGAATGAGTAATTTTTCATAAATAGTGGTAGAATATTTTGGATCTCTTCTTATTAGTTTTCCATAAATAGTAGT
AGAATAAGTGCGTTGACTTTCAAATTTAGACCTCCATATTTTGGTCAAACTTCTTCAAATCAAAGTTAAATAAGTATTTATAAGAGTCAAAAATATTTTT
CAAATTATTTTGACTTTGTGTTGTTACATACTATATTTGTTTTTAGCTCCTGAAATATCAAAAAATCATGACACTGATCCCTATAATATTTTATTAAGAA
TGTTCAATTTTTAATTAATTGAAATAGTTATTAGTGATATTTTGAATCTGAAGATTTCACAAATTTTAAAATTTATTAATTATCAAATCATTTAATTATT
CATGTATATTATATTAAATTTATATTGATAATCCATATTTATGAATAATGTCATTTTCAAAAACAATCTAGATGTAACTTACATTCTATTTGAAATGATT
AAGAAAACACCATAAGAATTAAAATTTGAAATTTACTTGGTTCCTACTTAATTATAAATTTAATTTAATTTAAATACGCCATCTACGCTCCTATTTATCA
AAGTAAATTAAATAAAATTTTAATTTAACTCTTTTAGCTCTTACTCATCAAATAAATGGTTAAAAAGTATCACGTGGACTAAAATTTAAAATTTTGTTAT
ATAACTAAGGGATAAGGGTTTGATATACCCTTCAACGTTGTTATTTAGAATTGATATACCCCTCATTATGAAACTGACTCATATATATATCCCTACTTAT
ATACAAATGGTTCACATATATCCTTTTCCTCTAACGGAAATGAAAAATAAAATTCAGTTTAATCTTTTATTATTTCTTCAAAAATATAATCTAATATGAG
TATATGTCATCCTCCTCAAACATATATTTTCTTTTACCTTTTTTGTTTCAATGACTAATTTAGATTTATTATTTTGATGGTCAAATTTATTTATATTTCA
CTAATATTCTTGTAAAACTTATGATAAATGACCCAATTTTTTATTCAAATACAAAAATTAGATTACAATAGAGACAAAAAAATAGTTTTAAATTATGATA
TAGCCATAAAAAAATAGTTTTAAATTTTTTTATTTACACTAAGGAATGAAAGAAAAAATAAAATAAGAATTAGAAACTCAAATAATTATAATAAAAGAAG
TCAAAAATTAATTTATGTATGAAAAAGATTAAAATATACCTTAAACATTTCTAGAAGAATCAAATATACCCCTAAATAATTTTTAAGAAAATTAAAAGTC
AAAAATATAAATTTAAAACTATTTTTTTCACTTCCTTTAAATGAAGGGTATATGTGAGCTCATTTTGTAACGGTAGGGGTATATGTAAGCCGTCTGTATA
ACGGTAAGGGTATATATGAGTCACTTTCATAACGAGGGGAATATCAATACCAAATGGCAAAGTTGAAGGGTATATCAAGCTCTTTTTCCTAAAACTAAAG
CAATGTAAGACAAGAAATATAGAAGATGAAAGCAATAGAAGTAAGGAGACAAGAGAAAAAAGCTTTTTTTATTCTTCCAAATATTCAATTGATAACCACA
TCTTCAAGTGTATCCAATATGAAATCTAATGCCTCTATTTATAGTATCACATAGAGGCATACGAAAGGTTAGTTATAAACATGACATTAACCATGAATGT
TATGGAGACAATAACCAAGTAAGTAATGGATGAACATCAAGGGGGAAAGTTATGGAGGTACGGAAGTTACTATACAGCACGATTTAATTACTCCTTAAAG
TTATGGACATCCACATAAATATATTACAATACTCTCTCTTGAATGTATGATAATATGCCTCATAAAAACATTATAAGGAAAAAACATGTGGGAAAAATTC
TAGTGAAGGAAAAAAAGTATGTATAGCTTGTAATACGCATTGGTTGTTGCCTCATTGAAAGCTTTGCCTGCAAAACCCATTGGTACAAAACCTAAGCCAA
GAAAAAAAGAGTGCAACACGTATTTCCTTTAAAACTCAACATTTACTCCCTCTTATGGAAACACTACCTGATATCTCGGAGACAAAATATTATAATTTTA
TATCTCAACTTCTCAAATATTGATGCTGACAATCCTTAATGAATAAATTATACGAGATTATAGCTTGAATGGGCCTTTTGAAAGTCTATCTCTCCATTTT
GTCGAAGATCATGTTTGAAAAATACTTTTTGTGAAATATGTTTTGGTTCATCTCCTTTTAGTGTATCATTCCTTCAATTGAGCTATAAATTATTTTCGTA
TATGCTGACTGGAGTATTCTTTTTCAAAGGAAAATCACATAGTTCCTTAATATGGTAGGTCATGATTCCAACCAAACCCACTCCCGACTTACTTCATAGG
TTAATATTATTTCTACAAGATTTTCAAAGAAGTGGTTTCTAGTGTTTGATTATTTGAATGTCAAGATATAGTTATGCTTCCACATATAAATAAATATCTC
ATTAACGATCAAGATTTATGTGGATCAATAAATATTCTGCATTTACATAATCAAAAAAATTAACTCTCATATTGATCATTTCAATTTTATTGAAACTCGT
CCTTTGTTCTCAAAGAGAATGACACATCTTCTATATGTGTTGTGTCATTTACTTTGTTAGTTTCTTGGCATAGCTTGTATGATAATATGACGATCTCTTC
ACATAACTTTCGTCATATAGATCAAATAATCTTTTTAGCATTTACATAACCATCAATCTTTAAGTGCATCAATTGCATTAATACATGATATTTTCTAATC
ATTCTTATGAGATCGGAAGATTCTTTCTGTGTACAGTATTCTCAGAACCAATGGGTACTAAATGAAATTTTTTTAAGACCTCTTAAAAATCCTTCAAATA
TTTTCATTTTACCTTCATCATCTAGTTAGACATAATAATCATTCATTACACATATTTAGGTATTTCATCTATTGTCAAATTGAAAGAAATCGCAATGCAT
CCACCACCGAAAATATATTTCTATTTAATAATGTTGTTAAAACTCTTTATGCCCCGAGGCACAAACCATACTTTATATTTTATCGTTATACTTGCACATA
ATGATTCATTTGTACCCCACTGATATTATATCTTTAACTATGAACTATAAGTTCAAAAGCATCAATTTTTCAAAAACATCAGATTTCTCAATGAAACAAA
GTGTACTTGAATAGTACATTTTATTTGGCCAATTATTTATTTGTCCATATTATATGACAGATTTGAATTCAAGATCCTCGTCATCATTTATAGCATTAAG
TTCTACTTCATAATAAATATATCGTCGACAGTCATTTGACTTTCAATACGACATAATTTATCTAGATCTCTTCATTTTTTGTTGAAATTTTCCTCATGAG
CTGTTAATTTAAGTTGAGTTGGCATGATGATGCGACTGCTGAGGAGAGTAAAGTTTCATTTTCAAAATGAATATAACGGAATTAAGTATTTCCAAGAGTA
ACGTTACATTTAAAATGAGAGGAAACTTTGATTTCTAAATGAGTTCACGAGGAGTTTTGAGCACTCTCTTTTAAGAGAACATTTTGAGTAATAATCTCAA
AGTTTGAGGATGAGGGAATTTTTTTAAAACAAATGAGATTATATTATTGAGAGTAGTATTGATCACTGACATGGGAGAGAGTTCAAACAACTCACATCCC
CCATAAACCCTGTATGCCAACATGGGTAAAGGGTCATACTTTTTAGATGATTTCTTATTGCTTTTTAGCATAGCTTAGTGGATCCACTTAGTTGAGGATG
TCTTAGCAAGGTATAGGACAGTTCTGGCAGATAGGCGAGATGATGTATCATCACATAGCTCATAGTGATGGTTATCAATCAGAGAATCTCCCAAATAAGA
GTTACTATAGTATATTTACATACAATTGAGTTATTATTGTATTTTTACATACAATTGAGTTATTGTTGTATTTTTACATACAACTAAATTATTATCTAGT
ATTTTAAAAGCTTTTTATATATTGCATATTTTATTTTTGCTTTGTTCTTGAGTATTTTGAGTTGAGTATCTTTGAGTTAAGTACCTTGAGTTGAGTATTT
TGAGTTGACTATCTTTGAGTTGAGTATCTTCAAGTTGAGTATCATACCTTTGAGTTGAGTATTTTATCCTTGAGTTGAGTATCCTATCCTTGGGGGGAGT
TTGAGTTGAGTTGAGTGAGTTTGAGAGGTGGTAAGTATGTTTCTTTTCTATCCGTTCAAACTTATGTTTATGCTTTAGAATTCCCATTGCATTCTAGTAC
ATTCAATGTACTTGTGTCATTTGGTCTATATTTTTTTATGATGCAAATATAGGTATTCATGGTTATCAACAGATGTTCCGTTGAGAACACTTAGATTTCC
AGTTAGCTTTGGTGAGTCTACTTACTTCCAGGAGGGGGGGGGGGGGTTCCACTTCTGTAATAGTAGAGGTTTCATAGATAGTTTAAAAGTGGAGGAGTCT
ATCATTTTTTTCCATTGTTGTTGTAATGTTTTTGAGTTCATGAGGCATTTAACTAATACTTGTTAAATTATTTTTGATCGATTATTAGTTGAGTTTAAGA
TAAAAAAAATATTAAGTTATTTTTGCATCATGAGTTCACGTTTTGTTTTAGTAATGTTTTCCGTTAAGTAGTGAGTCAGGCCAAGAGTTCGCTTGGAAAT
ATTTTGAATGTTAATTACGTCCAGGGTGTACGTTCGGGGCGTGACAAAATGAAATATTTGTCTTTTAGCAAGCCTGATGATTCTTACTTATTGAACAAAT
TGTCTCAATTTATGCCTGCTCCATCTGAAGCTCACTGGAAGGTTGTTAAAACGTCTACTATGTCAATAGCCTTCGAATTGCTCCAAGCAGCAATCTTAAT
CTCTCAATGTTTTCTGATTGCTCCGAGCAGTAATCTTATTTTGAACCCCCTTATTGAAAATTCTGACTCCATCATATATATATATATATGTTAAATACAT
TTATATTGTATTTGATGGAATCATTTTTATAAAATTAGAACAAAATGGTTTACATTTCTTTATATATTTTCCAACTACATATTACACACGCAACGTGCAT
ACCTAGACACTAGTATAATAAAAATACACTCTTTTAGCCAAATATCAGTTAGTGATAGTGAACATCATATTGCTAGAAAATATAGAATTAACTAAAAAAA
TTAATTTTTCGGTAGTCCCTAGCCAATTTGTCTCTAAATAGCTCCTAGCCAATTTAATTTCCTATAATCCTTCACTAATTGGCGACTAAATAAAATTATG
AAAAAAATTATTGTAACTAATCTTTGTTTTCTAGTGATGGTATCATATCATCAAAATCGAATTCATCCTTAGGAATCTCATGGTTTGAACTACCATATAT
TCAAAAATATACTTACTACTAGTTGTTAATAATTTAGCCTTAAAATTTTATTTGGAAAAATTAATTCAATTATCATTGTGTTTTACAGGTGACACTATGT
CCTCCAAAATGCAAATGCTGCTACTTTTATCTTATTTCATTATATTTTCTTAAAGCAAAAATTAGACAACATATCTATTGAGTCAATTTCTTATTCAAAA
ATAACTAATTATCATTTACTACATAAAATTGCAAACGTGAATCGTTTCAAGTGAATAATATATCAAAAGACTTGAACATTGAGAGGAAGTCATATCTAAA
TTTTGGAACTATTTATAGAAGATTTGAGTTGATTGGAATTGAAATATTTTTGTCTACAATGTATAAATATCGTATAAACAATGTATATAGACGTATATAC
AGTTTTCATCTACACACGATTATATACTATTTTGTTGCCCATGCATATTGGTAAGTAACTCATTTTTAAACTCCCATCAAAAGCACGAGAAATGGACTAG
TAAAGTGGAACCTGGATTTATTAAAACACAAACTGGCAGTGCATCATGCTTACAACTCAAAAGTCATTGAACTCAATTCAAAATTTGTCTTAGTATGATA
CAATAATGTGACAACATTTAATAATGATGATGATAATCAAGAGGAATTTCTAAGTATGATTTTACAATGATGAAGCAATGTATACATCTCTGTTTAATGA
ATTTCCTCCCAAAATACAATACTTGTCAAAGAATCAAGAGTTCTAACATAGCCAGAAAGATGGTGGATTTTCCTGCCATAGATTAACTGGTATGTCTGAA
CATCCTCTGTTTCCGCAAAAAGTACGATTTACGTGGACAAAATTACTTCCTCTGAAGTACAAACAGTGGTAGATAGAGCAAACTCTAACACAATCATGTC
AGATTTAGGAGTAATAATAATTAGCAGCCCCGATTGAAAAGTGAAAGGGATCCTCTCAGTATGTAGACATTATATTCTTGAAAAGTTCCTTAGGAGCTGG
AGTTTCAAGACAAGAAGAAAAGAATAATCAGTGTCAGGTATGCCATGAACACACAATCGAGGAATGGACTTATCTAAAACGTACCTGGCAATCCTGTAAA
TCTTTCATATTGTTCATATGCCTGCCCGATAAACATTTCAACTCCTGTCACAATTTTTGCTCCACTCTCCTGAGCTTCTCGCAGGAGTCTAGTGATTTTG
GGTGTATAAACAGCATCGAAAACAAGTGAGTAGTGCTTCAAAGCTTCCTGTAATTAAGAAGTGGTAGAGAAGTTCAATATAGTCACACAAATTTAAAACA
ATGTTTTGTTCATTACAAATAGCATCAAGGGACATCAATTTGAAATAACGGGTTTTAGGAAATTGTGTAAATGGACATTAGACCTATCAACTCATAGAGA
CAAAGCAGACCCCAGATATAGAAAGAATAGCTCAGAAAATTATCATTTACACTGAGAAGGCAAATTTTGAAGTTCATTGCTGAAAGCAATTGAGTTAACA
GAACAAAACTGAAGAAAAAACTCATGGAAAGCTAATTGGTATCGGAACATTCAAGAGTGTTTGTATAACATTCATCCTCCTCATAGCTGTTAATAGTAAG
TTCAAATTACTAGAAATATATCTTGCTCGTGTTTAAATATATATATAACCAATAATAGTTTCTCATTTGATCTGTTTCACTTTTCAAAATCATAAAATTG
GGGTTATATCCAAAACCTGAGTGGCTAGTAGGTAGGTAGATAGATCATTTCTAGAGTTACATGCATTCCACAAATGGAGGATGTAAGGAGCTTCCTGTGA
ATAAATTTCGATTAACAGGTTGTGTTTGTGTGAGAAGTTGGATAAGGGTTTGGGAATGCCCGGTCCTCATCTAGTGACGTTGTTCGACCATAATCCTCGA
GCAGTCTTTCTGTTGCTTAATCATGGGGATTGGGGAGATACTGGTGATTGATTGAGTTTTGGTATATGCTTTGGTGAATGGATTCTGTTTAGGAGATTGC
CTTTGGGGTTATCATTGAGATGTAAGTTATGCAATTGCTTTCTTTTGCTACTGTACTAGCTTTGGTTTTCTTGCAGCTATTTAGAGATAGTAATGAACCT
TAGACTCTTAATATGGACTGAAGTTGCTTGAACATTCTTGGTATAGTTGAATCTTTTGATCTTGCTAAACATGGTAGTGACGGCGTCATACTTGTGGTGT
AGTACGTAACAAGTTCTTTGTTTGTCTAGAAAGTTTATGGTACGTCGTTTAAAATTATAATAGCTGAACTTACTCAACTAGTAATCCTTAGCACTATTAT
TTTCTATGTCTATTTCTATTCCTTGCTACATCATTAGCACTCGAAATATTTGTTTAACGAGCCGATCACAAATGTATCCTAAAACAAGTACAGACACTAT
TTTATTCTTATTCCATATCAGGCATCAACTAGACAAGGTCATATATATTAAGTCCAAATAAGTAACCTAAATAGAGAAACACACTTTGCAAAATCTTCAC
GGTCCTGAGATAGCCAAGGCAACAAAACTGTAAAACAGCCACCTTAAGGTGGATTATAAAGTAAGAATCATGCACTCATCCCTTTACTCAGTTCTCACTT
TGAATAAAGAAAATCAATCATTTAGTTATATGTTGGCAACTTTTAAAAAGCACATTTTGTGTAATTTTTACACTGATATTCAAACTTTAGTTTTATGTTA
TTGGCTGCAACTCACGAGCACAACATATAAATTTATGTTTTAGCCACAGATTATCTGCTATATTATATGTTCTATCCATTTTATAGCTATTTAGCTGAAA
ATAGTGCATCCCCATTCCTCAGCATTAAAGTTAGTTCTTTCTACTTCACAGAAATGTCAAAAATCTGAAACTAGTGCATTTTATCTTGCCTTATAGAAAA
TAAATACACAAAATGATTTCATGTGGCAGCAGCTCTTGAAATGTCGAATATCAACCCAGATCTTATATCAAACCCTCCAACCATATCCTATTTTAACAGT
GTCAGCAGCATTATTATAAGCACTTAACAGTGGATATAGCTCAGATTGAAAGCAGCAGACGATGATCTTTTACTGGTTTCTAACCAGAAGTCCATTTCTG
ATAGAATCGGTCTCATACATCATATATGTTTTATTTCGTTTTTCTTGAAAAGGAACAAATCACCAAAGTTCTTTACACATTTCAGAACTTCATTTAAACT
ATTTAAACCACTCATGGAACTATAAGTATCTTATCCAGAAGATATCTTAAAAATGAATGGAATTAGAGACTTCATTTGTTGACTAGGCGGGTTTCTAAGG
TTATGAAAGGCTAAAAGAACTGGTTTTTTAACATAAAGACGATTGATTTTGATATATATCTAAAAAAATTACACACACATACCCTTCGGGGTGGCCCAGT
GGTTTGAGCTTGGGACTTCCATGTTAAAGGTCTCAAGTTCGAAACCCCTTGCCAGCGAAAGCAAGGGGTTTGCCTTCTGGGTCGAGCTCATCGTAACAGC
CTTGCCTAGTGCGGGTTACCTCTCCTATGTGGTTTGCGAGCTATTGCATAGGAGCGGGGTTTTACCCTGTGCGCACCCAAAAGGATAGCAGCTGCGGGTT
TCCCTTGTCGTAAAAAAAAAAATAACATACAGATTCTGGGTATAAAGCTAATTGAGGTAATTCACAAAATATTCTTCAATTCCTCAAATATTTCTTCCTC
ACCTCTTTCAAGATTGCATATAAGCATTCTTCTTGAGAGTTTGGATGGTTTTCATCTATCTTATTCAGAGATCCTCATGTTTTCGTCTTCCCAAATCCTC
ATTTTCACAGAAAACATTTCCTTCTTAATATTGAGATTGTCATTTTTACTGATTGTGCTTTAAAAGGCACATCATCAGTTTCATCAGAACATCCCTCTTC
ATCGGTGCTCTCTTTTTTGGAGATTTTCCAGTAGCATGAGGAGTTTTTCTTCATCATTTTTCAATTTATCATTTATTGTAAGAACTTTTTTAGGTTCTAC
AACAATAGATAGTATTTTAGAAGCGTCTACTTCTTCAGATATCACTTCTTTAAATTTTCATCAAAGCTAATGTTATTAGATTCAACAACATGCTTTCTTC
ATGTTTGCAATTATAATCATTTTCATCTTCATCTGAGTCACTTTCTTCAGAGTTGTCACTCATCTTCATTTTTCAGGTTTCGCAAAAATAAAATCTCGCA
CATCTCTTCATCGATTCCTTGAGAGATGAGAGTGGATGTTCTTATATATATTTCTGCAGCAACATCATCTGCTACCTCTCTATTCAAGATTCATTTTTGT
GAAACAACTCCATGAGCAACTGCTTCGTTAGGGTTGACACCCTTCTTGGGTTCATTCCCTAATAAAATTATTTCAAAACCTTTTTAACTTAATAAAATTT
TGATAGTTCCACCTACTGGCATTCTCATAGTTATAATAACTAGTCTTGCTCATATCCATTTGTTCTAAAGATGACTAGAAAGTTCGAAAATTTTGAATTT
TCCACTGGTTCTACAAGACAAGTAGCTCTGAGACTAAATGTTAGAAATTCAGGAAGAGGAGCACTCTCAATCACTCAAATTCTTTCTTGAATACAAGTGA
AGGAAATGATTGTTCTTTACTTGACTCTACTTGCTTCAACCAATGATTCTAACCTTATCAAAAATGACTATTATATCTAGGTATTTTCTTGGACTATCCT
AGCATATACCTAGTTTAGTACATCTATCGTCGTTTAGTTCTATTCATCCCTCTTTTTCTCAAATATATGTATTCAGCCATACATGTATTCTTACATAAAC
TAATATCCTAAATACTGAACTAACTAAATTCATGTTGCACTTAAATCAAAAACTATTTTCTTCTAAGACAAAGTTCACATTTCAACACAACAATTAACCC
TCTTTACAACCACAGTCACATTTCAACACAACATTACTTGCAGCTGTTCCACTAATAAGATATGGACTCAATAACAAGTTCTTTTTATCTTAGATGAGTA
CAAAGAGGCAAACCTTAGAGATTGGTGTATCATCAACCTTTGGTTGCATGCCTATGGAGGTGGTATTTGCAAGAATCATATCATTTTCTGGATGGAAATT
GCTAAGCTCGTCAAGAGATAAGGCCTCAGCTCCAACAACAATAGCAAGTTCTCGCGCTCGTTCTTCAAGAAATCAGACAGAACATCAGTATGAAGTAACA
TAGTTGACAATTAATACTAGAGTAGAAGTACTAGGCGTGGTGTGAAGAACTTCATGGTCATGAGCTAGACAGAATTTCAAAAATGGAGTGTTGACCAACC
ATAGGTACGATTAGCAATCACCACCCTAGCCCCCTTTTCCTTTGCGCCATAAGCAATCGCCTTTCCAGCGCCACCAGCACCAATGACCACAAACAATTTA
CCAGCCAAAGGTGACCCAGATATACTAGGTTGTGAACCTGTAAAAGGAAATAATGAAGGTCAAACATTAAGCTCTATATCAGAAAACGGTGTTTGCAACT
AGGAAATGATTCTTTGACCTTGCAATCCTTCTTCAATGGCGGAAATAGCACCGATATAGTCTGTATTACAACCAAATAACTTCCCATCAGGTCGCCTTAT
AATACAATTGACAGCCCCTATTGCCTGCGGGATAGTCAAGAAACCAAGAAATTGCATGTGATAAGATAAATCATCCAAACAATTTGTAATACTGATCCCT
GTAACACAAAGCAAACAGAAACAGCTGAAAGTATTATAAGATCATGATATAGCTAATACCTTAGCAGTAGGATCAATTTCAGCACAGCAGTCAAGAGCGG
CTTCTTTGTGAGGAATTGTACAGCTGCACAACATTGAGTTGCATAATTAATTCTTAACATGCATATAATTGAACTTATAGAACATACCATGCATATGAAT
TATATTTACTAGGCATGGAAGACAGATAAAAATTAGGAAAAAGACGACAGGGGTGATCTCAATAAAGAAAAAGAGAATCAGAAAGAAAAACATAAAAGAA
AAACCCAGTAAATTCAACCCTGTGAGCATGCAGTATGCACATGTATAAGTAGATGACTCTTTTAAGCTGTGAGAAAGAGGGAGGAGGAGGATAGTGGGCC
ACTGAAATTTGGCATGACTACCCTGATGAGATATCTGATAGAATAACAGTTTCTGCTTTGAGAGCAAACCTGAATCCAGCAAAATCTAATGATGAATAAG
TCCGGAAAAAGTTTGCAATATCATCTACCAGCAAATGCATGAAAACACCATTAAACCCAACTGATCTGAAGGATTCATTATATAATAAAGGTGATTTGCT
ATGGCTAACTGGCTTCCCAATAATGCCAAATATTTTGGTATCTGGTCCCAACTGTCTGAAATTGTATAAATTCAGAAGATCTTCGACTGTTGGTTGCCCA
GGAGCTGAAACTTTTCCCACTTCAAGAGTACCAAACGTGAGGTATCCACCAAATTTTGGACAAAGTATCCGAGACATCAAACCCTTCTCTCCCATGACCA
TGGCTATTATTGGAACCTATTTAACAAAGTGCAGGAAATGAATTAATGTTTATCATGAGAAGCACTTCAGAATGCAACTATATTCACACAGGTAACTCAA
AAGAAAGAAAACGAAAGCCAGAGACTCAAGGGAGATGGAAGAAAATTATAAGCATACAATAAGCATTACAAATCCTAATAACAAATATCCATGTATGCAC
ATGAATAATATTATAGTTGCAGCAAGGTCAAACTTTTCTTATGTAGACTTTTCTCTCTTCTTTCTCCTCCCTCTCTTCTACTTTCAGATTACAAACATAA
CTTTCACACCGGTAACGGCTAGTTTCAACCAGAGACCAGACTGAGTCTCTCCATATCTCTCCCCTGTGCATACACCCAGACCCACCAGATACTACCAACT
TCCCCCCTTTAACAGCGAGAACCACCACCGATAAAAACCCCATCACCGAACAGGGAACCAAATCCACTGATCTCTCCTCATATGCAGAGGCGCTAACCGA
GGGTTCAAACCACAAAAAAGTAAGTATCAAACTCAACCCAAGAAGACGTGAAATTATCAACGGCAAACCAATAGTAGTGTTCACAAAAGAGGAACACGAC
ATTCTTGCTGATACCTGCAGACGGACTATCATAGGCAAAGTTGATAAAAGCAGGCCCCAGATTGACAAAATTAGGGAAAATTTTGCCAAAATTGTTCCTA
CCAAAGGGCATGTGAAAATTGGAGCAAAAGATAGCAAACATGTGTTTATTGATGTGGACGACAAGGATTATAACACCATGTGTTGAGAGAAGTTAGTCAT
CGGTTAGTTAAATAACTGTTAGTACAGCAGTTAGTCTGTTCAAGAAATTAGTTACGAGATTTAGTTGGTTAGTTAATTAATAGGTCATTAGTCTAGAACT
TACTAGAACTAACTGAGCTACAACGTTGTGTATATACGCACATGTAGGCAGTACTCTATGATCAGCAGTTCATAATATCAGAATATCTTCTTATCAATAA
CTCTGATTCTTCTTCTCTCTTTTCTTTCTGTATAACTAATATAGCAGGATCTGCCTAATAACACCATGGTCACTTACAACTTCATTCAACTGAGTGAAGG
ACATAGAATGAAAATCCAAAGATGGTCCACAAGATTCAAAACCAATCTTGAATCAACTCTTGCCCAATTTGGATCAACTTGTCGGACCTCACATGGCACT
ACTACGAATGGGCAGCATTGTGCCAAATAGTTAGCCCAATCGGCACCCCAACAGTGATGGACAGAGCTACGCAATCAAAGACTAGACCAACCACGGCCAA
ATTGAGAGTCGAACTTGATCTCACTAAACCTTAGATCAAAGAAATTCTAGTGAAGAAAGGAATTCAGACAGTCAGCTAGAATCCTTCATCCAAAAGACTG
ATTACGAGACCATTCCCCACTTTTGTCTACAGTGCATGAGTCAAGGACACACCAAAGAGAAATGCAGATTTGTACACTTGGAAACACCAAAAGATCAACA
AAGAACTCAGGAAACAGAAAGTACAGAAGCAAGATATCAATACTTTCATCACAAGCTCAAAACAAGCTACCAAAGGAAAACAGGATGACAAGGAGCAGGC
CAATAATAAAGCTGCCATTAACAACCAGCAAATTTCAACAAATAAAGAGGTAAACCATGTCACGAGCAAAATCCAAAACAACTCCATTGAAATGAATAAT
CCTATGGAGGAAGATTGGCACCAAGTAGAAAAAAGAAAAGGGCGAAGCCAATTCTACTGGACAAAAACAACAAAATCAAAGGAACCTAAAAGGCAAGGAA
GAAAACGTTAGGGCGCTGAAATTAGGACACAACAAGAATCCAACATGTTGAGTCAACTAGCAGATAATGAAATTTTGCATATGAATGTTGAACCAAATGA
CATTACAGATGAACATATCATGGAGCAACCACCCCCGCCCAGAGCTAAAAGTACAAGATGGGACAAGGAACATAACAACAAAACATGAAAAGAACAAGAG
AAAGAGTGAAACATCAGCATAACCTCCGGGTCAGAAAAGTGAGGAGTGATCTCAAGCACAACGCAGAAATGGGGACTAATCCAACCACAGGGAAAAAGCA
CACCAAAAGAGGCTCCAATAAAAAAGCAAGCAGAGATTCATGAGTAAAGTCTTCATCCCCAAAAATACAGAGTTGTATGGAGAAGCAAATCAGAAACATG
GAAATATTGGAAATACTCTACCAACACGACCTGCTATCAACCTGACTCAACAAGAAAAGGTCATAGAGACCAATGAACAGATTAGAGGTAATATTGTGAA
TCTCCTGGGAGATATAAGACAGGAAGGCAATCAAGCGGAAGAGCCCTATCCCATGAACCAGACCCGCCTGATACTACTAAGCTTGGGATAAACGACACAG
GAGAGTTACAACAAGACATAGAGATGGTGGATGGAGACGGTGTTGTACCAGGAAAGATTATGGAATGTCAGAATGAGAACTATGAAATATCTCACTCTGA
TGATGAGGCTACCAGAGGCAAAAAATCAGGTAACAACACTATTGAAGGACATCAAAACCATGACATCCAATTGAAACAGAACATCTCTTACAACCATAAT
CTATCCCCAAGAAAAAGCCACAATACCGGAGAAACACGCCTCTTTAATGACAATGCAACCAATCCTACAAGGATAAATAAAGCAACCTTACCCCTACAGT
TTCCAATGATTAATTTTTTATCTCGGAATATTAGAGGAATTGGATCAAAAGGATCCCTGGAGAGACTCCAAACACTCAAACTCCAACACCAATTTCCTCT
AATTTGCCTTCAAGAACTTATGGTGGACAGTGGAAAAATTGAGAATTATCAAAAAAAAAAAACTTGGGGTGGACCATGTTTTTAACAATTGCTCCAACAA
AATTTGGCTACTATGGACAGGTGATGTTATAGTTACCATATTGCAAGATAAAGAACAAAATGTTCTCATAAAGTGGATCACATCAACAGTTCACCATTCA
AGCTCCCTATAGTCTATGCCAAATGTGATGTTGAGTTAAGGAAAGACCTGTGGGCAGATTTGAGAACAGTGTCCCTTCACATAAATGAACCTTGGGGTGC
AGTTGGAGACTTCAATGTTTTTACTGACAAAGGAGAAAAACTTGGTCGCATACCTCACAGACTTGAAGAACGCTTGGATTTCATCGAATGCCATAACGAA
TGTGGCCTACTGGATGCCAGATACACAGTAACCGTAGTCAAACGGTGTAACAGGGACCCCCCCCCCCCAACCATACTATTCGGAAAAGACTTGATAGGCT
AGTCTACAATTCTAACTGGTTTGACGAGTACAACAGCACCACTGTCGCACACTTATCCAGCTCTTGTTCGGACCATGCCCCTCTTCTAGTGAAAATCCTC
CATGAAGACATCCAAGACATTAAATATTTCAAATTCCTTAACTTTTGGACAGATCACCCCGACTTTCATCAAACTGTCCAAAACAGTTGGGGATTGGGAT
GAACAAGTATATGGAACCCTCTTTACATCCTCCGCCAAAAAATCAAGAACACCACTAAAGTTCTCAGTATCTGGTCTAAGCAAACCTCTGGTGATATTTA
TAAGGAGCCTAAGAGATTGGAATCATTGATTAGGATATGGAAGACAACTGCATTGCTAATAACACTCCTGAGAATAGATATGAACTATCTAAATGTAAAG
CTGAGTTCATTAGATACCTAAAAATTCAGGATTATATGTTCAGAAAAAAAAAACAAGAGTCAGATGGATGAATGAGGATGATGCAAACACAGCTTACTTC
CATGCCACCATCAAAGATAACAGAAGGAAATTGAATATCAGAAGAATCCAGGATGATCACGGCAACTGGTTAGAAGGAGACCACTAATATTGCTGAAGGA
GCGGTCCACTATTATAAGAACCTTTTTGCTCAAATTTCTGATACTACTGATTTCAGTGCCCTGAACTGTATTGAAAGTTGTATCACTGAGGAAGAAAATA
ACAAGTTGAGTTTCGTTCCTACCGTGCAGGAAGTGACTAAAAGCATGCTATTTATTGATCCTGACAGTTCACCTGGGCCTGATGGTATTAGTGGAATGTT
TTACCAAAAATGTTGGGATATCAACTCTACTGAAGTCCACAATGCTGTCAAGGTTTTCTTCCGGGGATCCGCTCCTACCATGTTCTATACTCGCACTTGT
ATTATTATGATCCCTAAAATAGATCACCCTCAAAAAATTTCTGATCTCAGACTCATTAGCCTGTGCAATGTATCATCCAAGATTATTTCTAAAATCCTTA
ACTCTAGACTGGCCAATTTACTGCCAAAGATCATCTCCAAAAAACCAAAGTGGTTTCATAAAGGGAAGAGCTATCTCTGAAAACATGTCAGTGAAAATTA
CTTTTGAACATATAATTCGTTGAGAACTTTTGTATTTAAGAGAACATATAATTCTTTTAGCCAATCATCACCTTATCACTACTTGCTAAATCATTTCAGT
GAAAATTAGTTTGAACTAAAACATAATTGTTAACACATATAAGAATCCACCAGCCTTAACTAGAATCCAACAACCCAACAGCATATAACACGATCCTAAT
CGCATGATGTACTAAAAGGCCCCTTAATTGACAAGTGATATCAGGATGCCATTCATTTGATAAAATGTCTCCAAGGCATCAATTCTACTATCTACATTCA
AATTTTTCTTGCAATGGAAAAAATCATCAGATAAATTAAGACAATTTAACAAACCCCCACCATTTTCACCGGGAGAGAGAGAGAGTTAATTTGGAAGTTA
TTCTCGATTACTTATTTTTTAATAAGTTATTCTCAGCCATAAGTTTGTGCTGCTATACCTAACTTATTGGCATGTATGGCTTAATAGTTAATACAAAAAG
CAAAAAGCAGCCAGCTTCTAGATTCCAGTCAAGCAGCTACTATTATTATGCACCAAATCCAGCTGAGGAAAAACCATGATGGATCACCATGCATATTTTA
ACACAACTTATACAACTTGACTATACTACTTACGCCTCTTACTTGAGAATGAACAGTAATTTGGAAAACACGTGCAACATCAGTGATATCCTGTGCAGTT
GTAGCAAATTTCACAATGTCAGCTCCAGATGCCTGTATTCTTGCTACTAGATTGCCAAGATCCTCAGCTGACGGTGTGCTTTCATAGTTGTGAGAAGAAA
CAATAAGTTTGCATTTTGCAGATTTATTTCCATGTAGGGCATTGTTGAACTCGCCAATAGCCTAAAGGAGGAGGAGGAAAACGAAACAAACAGCATAAGA
AAAGCAATGATTGTTGATAATTGATGAAGCATCCGTCAAAGCAAAAAGGAAGAACAAATGAAGACTCAGTATGAGAAACGTTGATCTTAAAGTTAGCAAA
GCTTTATATATCAAATATTCCAACAGGAAGGGTTTCTTAGTTGGCAAAATCAATCTGTGACCGTAATATTCCTTCATGCAAGTAGCATCTCAGGCCATAC
ATCTCAAAAGTCATGCTCAAAGTCACAATACAAAACTACTCAAGTTTTTGGAGATCTGTACATCAAGCAACTAGATTGATTGGCCTTGTATTCTCCTTTT
TATACATATACTTGATCAATTCCATTGAGGAAACTTAGCAGCAGTCACTCAGGGAAATCTCATTATTCTTTTCTTTTTCTTTTTTAGCGGATAAGGTGGG
AAGGGCCATTTTAGCGTGAAATTTACCTTTAGCTCAACATCAATGTAATCAGCTCCCAACTCCATCGCTAATCGAAGTGCATCCAATCGACTCTTTTCAT
CACCAGCATACTGACCACCTTCCCAAGTGGGCCTTGCAAAGTAGGTAAAGTTCGGAAATTATTTATAATGCACTTTCCAATGTCGAGAAGTAAGAGAGGA
ACTACAAAATCAGAAAGTCGAGCTATATTTACATTTATATTGTAAGAGAACTAATATTTGTTATCACAAGTTAACAGACACTGCAATAAATTATATCATA
AGGTTGAACTCAGATGTCTTGTATGAAGATATAGAAGAGTCCTTGTTTTATTATGTCAAAAATTTATAATAGACATAACACCGAAATTCAGGACATACTT
ATCCTGCCTGTATTGCTAAAGTGTGGTTCACAAAATTCCCATAAGAAAACATGCATCACAAAAATGAAGCACAGGTTCTTGACAAACAAGAGTAGCAATG
TAAATAAAGAAGATGGCTTGTTAAGGTTATAATAAGCCAGATGAAAATAGCAAATATCTTCTCGAGTTCATGCAACTGGTGTCCTGAAAAAGCCAGTGCT
GAGAAAGTTAACAGGTCAAAATTTATATACAAAACAATCAGAACATAATTATATACAAAAGAACCTAGTGCCATTGAAAAATGCAATGCCTTTCTGAATT
CCTGGACAAATTAGATAAAGTAGCAAGTAACCATACCCTATGCCTTTATAGTACCGTATTAACAGTATCCCCTGCCCCACGCCCAAAACATAGCTGCAGG
TTGACGAACATGCATTGTATCAGTAGAAAGTGAAAAGGGACCAACCACGGAAAAAGTAATTGCCCTTAGGAAGGTCTAAGCTATGTTGCAGTGCTCCTTA
TATTTGTATCACCATGATATGTCCCACTTATGAGATAACACTAAGTATGTTGTTGTTGTACCAACTAAGGCTTATTCTCCTATTTTTTGGATTTCGAAGC
AAAACAAGGAATAAGGGATAAATCTTGATCAACATCCTTAATGTTGTTGGGTTTTAAAAGGTGTGAATGGGAAATGAAGTTTTTTCCCGAAAAGACACCA
AGAGAAAGGATGCAATTTGAATGGTACCCTTTCACATTGAATGGATTGTGACTTTTCTGATAAGACACAGTAGCAACTGTTCATACTACCCTTTGTTGAA
TATAAATAGTGGTTTTTGGAGGCAATGTTTCGAAAGAAGAAGATGTGGGATCCATGATGAAAACTGTAAGCTCTCTCTTTTGTTAGTAGTATTAGTTAAG
AAAGGATCTTATCACACTGTTGCCAGCTGAACTGCACCTCACAAGTATCACACCAGCAGGTGGTTGATCGATGGGGAATAGTCGATATCTTGATCAATAA
TACAGGTTCACTACCACCTTTTTTGTTTGTGGGAACAAGTCAAAAAGATCATTTAATCAATTTTGCACCGAGATAATACCAAGTTAACATTTGTGCTGTG
GCATTAAGCAACCAAAAAAATCTTTGCAACTTTCTAGTTAGAGAGGAACATGTTTTTACCCCAAATATACAAGTGAAACGATATTTTTTAATGCAGGCTA
GCAACAGTCATCCTAGTTTGCATCAAGGTTTATTATAATTCCCAATCAGTAAGTAGTTCTCTTATTCTTCTTTTTAGGTATCACGCGTGATACCTTGTTG
ATGAGAATGAAGAAGTCTCAGTGGCAGGAGGTCATTGGTTTCTCTCAATTTTCTGCATCGAATTTTCTGAATTTCTTCTACACATTTTCTTACAGACATA
ACTCTAGTCTTTGTGTGATTTGCTACTGACTTTGAGCTCGACGAAGTTATTGGCGTTTGAGGAACCGCTACACCAATAATAGCTATATCGATTTTATCTT
GAGTGAAAATAATTCATAACCTTGGGAACAATGAGGGGATTAAATTACTTGAGGACACAAATTATGTGGTCTCGGATACTTTTTATATAATTCTGTCTTA
CAATTCTTCTAGCTATAACAAAAAAGGACAAACTTTAACAACTCAATTCAGATATGTCAGAAATTAGGAATTGAAACCTGTAAGTGAAGAGAGTAGGCAA
AGGGCATTGTTTGATCAGGGTATCAATATCTGGGCGAGGATTAAAGCTTTTCAAGCTATCCACTCGAACCTCCACAAGATCAGCCCCACTAATTTTAGCC
TTTTGCATAAGAATCAACATTTGATCCACTGAATCAGCCATAATTGGTGCACAAATTAGAGTTTGATTCTTCCTCATTGCTTCACCCTCCATCTTCTTCA
CTCCAGAATCTACAACCTAACAACCCCACACCCACGACAACAAAAAAACAACAAAAAATCTCAAACACCCACAATTCAAGAATCAAAACCCAGAAAAAAA
AAGTGTTCTTTTTAGTTTTATAAGAGTAGGAAAAAAAAACCCAATGTGGGTTGGTAGAAGTGTTAACAAAGTTTGGTGAGTGGAGAAGAGAAAACCAACT
CAATTTCAAATTGTTAAATCATTTTTTATTATTTATTTTTGCATTATTTGAAAAATAAAGTATTAAATGACTCACCAACTCCATTGGCAACCAACTTTAG
AGCACACAGATGGGTAAACAACAGAAATGTAGCCTCAGCAGCCAGCTTGAAATATTCCAAGTGACAAAGATATAGATATATACAAGTATTTATATTTTAT
TATTTTATTTATGTATAAGAATTTTAAAAAAAAAAAAGATAAAGAGTATATGTGTGGTTTTTATTTAGATTTATATTTATATCATAGAAAATTGGGAAGT
AGGATAGGGTAGGGATAAATTATATTATATTTTATTTTTATGCTTTTTCCATGATTATAAATATTCTCCTTCAAAAATTTATCAGAAAAATAAAGTACAA
AATTGAATAATAATTACTACTATTTAAATGTTTTTAATAAGTACAATAGGTTGCCACTTGTATACAGTTTTAGTTTCATGGAATATTCTTTTTGGTGTTT
ATATTTTATTGTATATGCTTTTTACAAGATGCCTCTCTATCCGTATATACAGAATACTTATGAAATTAATAATGGGCGATTTGATTTTAGTTTTAGAGAT
GAAATATCATATTAACTTTTAATAACAAGTATTTTAATTAATAATTTAAGAGTGAATCGTATTAAACAAGTTAGATTTTTCAAAGTAAATACTATGTCAT
GTGTAATTTAAAGTATACAGAATTTAATTATGGATCTTTTTTATAATTATCGAAGTGAAATAAAATATTTCTCCATCTATTTCATTTTTAAAATTTGTTA
TATACCTTGCAAACTTATTTACATTGCATAAAAATATTTGTATTTTTAAAAAAATGATATAGAAATGTCATTGAATAATTACCCCAACTATAATCTAATG
CATGTACCTACCGAATATTTTATAAAATAATATTTCAAAACAAATATGGAATATAATTTTTTAAAGTAGTTTGTTTTTGCCCTCCTATATAGACCGCAAA
AATGTACCTTTAATGTTTATTACTACTAACCTTGATTCTTATTATTTGATGTTTTATTACCTTTTCATTTTGAAAAAGAAAAATACGTAATGTTTTACAA
AATTAAGGATATCTTATTTGTTTTTGTAAACATATTCATATTTAGAAATACAGTACAAATTTATTGAGGGTAATTTAATTTTTAAGAAAACATAAGGAGT
GTGTCAAAAAATAAAAATACTCCCTTCGTTTATTGTTTTATACATATATTTCAAAATTAAAATTTGACTCTCACTTGTCACGTTTAATATTTTAAAGAAA
AAATAATTATATTATTTTTCCATTTGATTGTCAGCATTAATTACTTTTTTCCAATATGATTTTCAAGATCTAAATTTATACACCAATTATATATATATTA
ATTAAATACAGCGTAAAAATAGACAAATAAAAATACACGATAGCATTGAATATTTTGTGTGAGAATTTAGTAGATTGAGAATGGGCCCAATTTAGGTGGA
GAATTTAGTTAGATCGAGGATGGGCCCAAATTAAATTGTCTTTGGTTGGACCATCGACCCAAATTGATTGAGAATGGGCCTAATTTAAGACAAAAAATGA
CGAATGACCATTATTATTGGCAACTAGAGGATTTATGGGTCAACTTCATACCCATTCAAATTTGAAGAAAATATTTATTCTTTATGACAATGATATTTTC
TTTTCACTTAAATATTTTTAATATATTTATAATATAGTTTTAACACATATTACAGAGAACAATTTATAAAACACATATAATACAAGTTCTATTGATAAAT
AACACATGTATCACATATTTTAATACCCTTATAATACAACGTGTCAATTTCTTACTATACAAGCATAATATATTTTAAAACAGTTATAATTCATATATAT
TGCATACATGATTCACTTTTAATACATATTACAGATTTATCATAATATTGTTATTTATTGCTACAAATATTAATAAATATAAAAAAAATATCGCTAAAAT
TAATAATTATTTATCAAAATGTGTAATTTTTCCTTCAAATTTGGGAGAATGATGTGTCTATATATACCTAATAATAAGACAAAACATATCAGGAATTCTT
TTGCAAAATATATGTGAAATTCTCACTTCAATTTTTTCTCTATGAAAATGGTATGAAATGTGTGTATATGCTCAATGCTTGAAATTTTTGTTCATAATTT
TGTATATAAAATCAATATATAGACGGTATTGCTATATGTGTCAAGTGTATAAATATTATATAAAATGTAGGTTAGGTTTCTACAAATTTAATATTATTAT
ATACTACTTCTATACGATATTCATACTAATTTATACAACTCCAACAACAAATAGAACTTCAAACATAAGTTTTATACAACTAAGCATACAATTTAATCCA
TAACTAGCTCAAATTTTATCCTAATTTCATACTCGAACTTTCTAGTTCTTTTGAGATATTATTCACTTGAAATGAAGTAAGTTTGCTATAAGTCGATTTT
TAAAACTTTAGCTTCGAGCTTCTTTAATGACGTTTTGAAGTAAATGATTTTCTTTGGCTTAAAAAGAAGGGATTTTATTCGTCTTTTAAAGGATTATACA
TACAAAAAGGAACTGATCACAGTTTCACTAACGTCTCTATCAGTGCATTAATTACAAAAGAAGTAGATGCATAAAAATCATAAGGCTGGTTTCTATTCAT
ATTTGAATTCTTTGATTTCCTTCGGCGGACTTCTATTTGTACTTTTAATTTTTGGATTTTTCTGTTTCTGTTTTTTTCAAATATTCCAAAGAATGAAAGA
GGTTATAATTAGAAAAAATGTAGAAACTCTTTGATATGTTGTAGATTGAAGTGATGAGGGATGTAAAACAACAAGATTGATGGATGTTATTGTTTGTTAT
TCCATATTATTGCACAATCCACAAAAATATAAAAAATATTTTTTTTCCTATATTGGTGCATGTGGAGCAGGTATATATACATGTTGGTTATATTTTTCTA
TAGAATAAGACAGACGAAGTAGGTGTAATAGAAGCAACCATTTGAAAAAATTTATTTGGTTTAATGCTTTGAGTTTTCAAATCTAGTTATAGTTTTAGAA
TTGTTGCTAGCATTATAACTAATGTTTGTTGCTTGAAGAGATTGTAGCTGCACCAATATCTTCAGACGTAAACCTCACAAAACATCATTCCACACACAAT
GTTTATGTAAGCCTTGGATCATTTTGCAAATACTCTGCCATCTGAGAAGTCAGTTGAAATACAATTTTATGAACAAAAACTGCAGGCACTGTAATCTGCA
AATTCATCTAAATTTTGTCTAGTTTTCAAACCATCCACTCAAATTTAAGAAACCAGCAAAGCTAACACAGCCCATGTTTTTTTATGGTTAATGATCGGCA
AAAACTAGTACAACATCCACTGAAAAGCAGCACTACAGTCATGTATTATGAATGGTTCAACCCCAATTCAAAAGGCGTCAAATGATAAATACATAGAAAA
CAAGGCTCAGCAGCTCCAATATAACTTTATTCTAAGACAGACACCACCGCTAGTTGCTGAATCTTCACCTCACCGGAGCAGTTAACCCTGGAGGCCAATA
ATACCTGACAAGAGTGACAATACCACATGTTATTACTACTACAAACATAATTAAGAACAAAACCAGGCTTGCCTATATAATTCTCAAAAAGCAAATGATT
CAACTTGTCGTTTGAAAGCACATTGACAAATGGACAACTTAGATTAGAAAGCAAAAGAATCTTGCATGTTTCTATTTTACTCAAAACAAGTAGCCCAGAA
GAATCATTTGAAAAAGAAATCAAAGAGATTGAACTAACCTATCAGCAATTGATCAATGTAATTACGACACATAGTTAAATGACTAAATGAGACACATAAA
TCAATGGATCTAGTCCCAGATGCAAGACAATTAGTACTTACCACAAGCAATCCTTCCGCCAGCATTTCCGGTGCTTTTACTGAGCTCATGTCCTCCTAAA
ACAGCAGGAAAATAAATTTCAAGTCAGATTAAGTGAAAGTGGGTTACAAATATGGTTAAAGTAAATTATATTTTAACCGTCTTATTTTTATTCCATGATG
AAAGGATTTTCAATGCTCCTACACCAGACACCAAATTTGTTTGGATGCAAATAGAATACTAAACCTCGTAGCTAAATAGAGCATAACTCTTTTGTGCATA
ATCCTAATCTCATATATCACTGTACGCCCACTTGATTATTTGCAACTATAGTCCACTTCCCTAATTTCAATTTTCTGAAACAAGTTGATACTTGGTCATC
CTCGAACATTTGCATTCGAGATCTCACAATTTGCACAATGAGGAACATATTCCTTGCAGTTCAACCATTCCAATCACACACACTAAAGGATATGTAAAAC
CTATGGGTCTTAGAGCCTGTTTAAAACTAAGAGCTATATACCCTAACACTCCAAAATTGCTTAAAAGTTATTTTGGCTTAAAGACACTTGAAATAAGTCA
ATCCAAACAGGCTCTTATCCAGCCTTAATCCTGAAGGATCTTGAAGTAATTTTAGATGGATAAAGCAAAGGGCTCACAATGACTTAACTCTAAGCAAAAA
TAGAACTCAATAGCTTATCATTGTAATGCATTTTCTTATTAGATTTCAGTCCACCTTTCTTACAATCAATCAATCACAAGTCTCAGCTTCAGGCTAAAAT
CAATTTATATCCAACATCTGCAAATGTTAGTCCATTTCTCTCTGTCCCTCCCCTTACAGAAACATTAAAAAAAGGTTTTTTTCTATTAGACTGCATTTAA
GAGACGAGACTTTTGACAAATACAGACAAGGTAAGTGAGAGGAGAAGCATAATTAAATGGTAATAGGTAACCAAGCATCATGGAGTGAAAGAATTTCTAG
AACAAATTGTCCAAAAAAACCTTGCAGACTATTTGTCAGCTAGTATTTTACAAACTGACCAGTGTTAGCTCCAAGCCTCCAACAACCCACATCTCACAGA
CAGTCCATACAATGTCCTATTCCAGATATGAATTCAACTACAAAACCTGTATAACAGGAACTCGTTCTTGCCCCCAGAGGTATGTTTAGTGGAAAGAGCG
CAACATGTGATGTGTAGATTAGGTGCACGTCATAGGTTCGAACTATACACGGATAAAATACTAGTATATAAGTGGAGAATGGTAGAGGGGCAGGCCATTA
TCCACCAATTGCACCACCAGCCCGCAGGAATTGCATGGCCATAAAAAAAAAGAAAAAAAGATAGCACCTATTCATTCCTTGAGAGAATGTATATGAACAT
CCTGATTCTTCAAGGAGATTTAACATCACTCAGAAATGCACACACCTGTTCCCGCTTGATTTTTGAGTCAGCAATTACCAGGCATTAATTTTCAGCTCAA
TATACGGAGAATGGTAAATTCTTTGAAGAAGAAAAATGAAATCTTATTGGTGCTTGGGAGATGTGAAAATGATAGAAGTGGCTCCTTGCTAGGGAGGTCA
TGGGTAGGACTGAACCCCTTTCTCTTTCACTTTGCCTGCTCTTATTTAAATGAACCTAGTGGATCCTTGCTAGTGTGGTCGTGGTTCAGATTGAAACCCT
CTCTCTTTCACTTTGCCTAGTCTTATTTAAATGAACCTAGTGGATCCTTGCTAGTGTGGTCATGGTTCAGAGCCCCTTTCTCTTTCACTTTACCTAGTCT
TATTTAAATGAGCTTTCATCGTTTTCTTCAAAATTAAATTATAAGATATGACACAATCACACCTAGACTTCTTCCTTCTCCAATCCATAATACTTTCCAT
TATAATACACCAATCTCCCAGATATACTTCTTGAAGAAAACACATTAAATGGAAATGGGGTTTTTATATGTCAAGCACTATGGACGAGTGTTGATGGTCT
CAAACTAAAATAAAAGGTTGAGTGTCAAGGTTATATGTATTTTATTTCTTACTTTCTTATCCTCTTTCATCTTTCACATTCTGTTGTAATAATAAAAGCA
TGTCGTACTCAGCTCATTAAAGTTTAGTCACTGAAGTAGAGAAACTAACCCTTTCCAAGATCATCAGGATCAGCATGAACAACAACAGCTCTTCCAATGA
TGGACTGTGGACCAGTGAGAGGAATCTGCAACAAATCAGCTTGCCAATTAGTTCAGGAACAAATATTAGAGCAAGTCTAAAGCTTAGAGTTCAACAAAGA
ATTTACCTGCTTGTCGGTAATAGTAAAAGATGCAGTACCTGAAATTTTTTGCAATGATTACATCGTTAGTGATGCTAACTAATTTGGAATTACGCAAGGA
GAGAGAGGGAGAGAGCAGCATTGACCTCTCTGAAATAAATTTTGGCTTCACTATGCAAAATAATTGTTGTTTTCGGGACAATAAAATCATGGGTAAACCT
TTACTACAAGAGAATTAATTTTTCCAAATGAACTATACATCATGTCAAACCAAAAACACTAGGCATAGATGATGATAAAAATCTTCAATTGCAGACATTT
GATTTGAAATGAATAAGGATAACTACAACCAGATTAAGTTAAATTATTAAACAAGGAACACTTACCATCTTCTCCAACTGTGATGTTACCAAGATCACCA
GCATGACGCACCTCATCTTCAGGAGCACCATGCTCCTTACCAGCAGGATTGTAATGTGGTCCTGCAAGTTAACCAAGAAAAAATTCAAAACTCAAAACAT
CTAAAAATCATTATTTGTCAGAGTCTCAAATAGATAAAATAAAATTACCTGTTGACATACAGCCATTTGTGGTATCACCAAGGGCATGGACATGGAAGCC
ATGAAGTCCAGGTTTTAGGCCAGAAATATTTCCATTAACTGTGGTTGGAGCTGTATGCATCACATCAGTTAGAGACCGGTCACCCATGATAGATGCATGA
AGAAACCATTTTACAATTATTAAAGTAAATTACCATCTCCATCTTGAGTGAAGAGGATGGTGCCACTAACACCTTCACTGCTGTTAAGGACGGCGACGGC
CTTCACCATTTTTGTATGTGATCTAGAAAATTATGATACAAGAGTCTGTTATCAAGGCTACACATGTAAGAGCATATACGAAGCACATTAATAAGTTAAC
ATGCAGCTCATCTCATAAGATGATAGACAACATTTCCATATACAAGTTTGGATTTATAGAAAATCGCATTTGGCCAATCAGTTAGAAACATTAAGCAAGA
AAGTCTTTCAGTCACAACCCAGGCAATATATAGTTCATCTCGAAAACAAGTCGATCACAAAAATTGACATCCAAAACCTTAGGCATTCCATTTCTTCATC
TCAACCATATAAGAATATCTAAAAGAGGTAACATACAAAAACACTTGGTCATGTTTGTTGTGAAATTACGAAAAAACAATCCTCTAGTTTTCCAAACAAG
CCCAAATGTGTTGTTTTTTTCAAAATAAAACAAAACAAAGAAAACACCAATTTCGTCCTAAAACACTAAACAATGTTATCTTCAACCCGAACCATCGCAA
AATCCTCATGTTCTCACCCAAGCCCCATAAGAAAGACAGTAAACACATACTTGCAGCAGGATTTGCTTACACACGCATTTTGCAGGTGATACAATTTATG
CCTATGCATTAGTCCAAATCGATAACGCAAATAATTCTAAACTCAAACTCTAATTAGATCGAACCACACATCCATAAAGGCGGAATGAGAGTAACGACAT
AAACATGTACAGTTAAAAATCCATAAAAAAAAATTGCAACTAAATCTTAGATCCGCCTCTTAGCAAGGTAAAAATGATATCCTAAGCTTCTCTTTCTCTA
TCTCCCTAATAAAATTAATATCTACTCAACAATAGGCCTCCACCACAATCAGCATAGAAATAAACTCAAAAGGCAGACAGCGACAGATTCAAAAGCGAAA
GTCCTAAAAAGAAGTCTAGATCTGCAAAATCACAAGTTGAATCCAACATTCATTCATCATAAAAGAGAGATCAGTTGCATCAAGAGAAAGCGAATCAAAT
GAATAATCAAAAATCACTATCGAAAACAGATGAAGAAAAAAATTGAATTACCTCAGGTCACCCTTAGAGAGAGAGAGAGAGAAGTCCAATATGAGTGCTG
ATAATGATGAGTTCGATAATTGTAAAGAGTGTTTTGCTTATATTGGAGAAAAAATGGACTGACTACTGACCTATTTGAGGGGTGGGTAGGTGGCTAGTGT
GTGATTAGCGCCGTATTCATTTTGCCAACGACCTCTACGTGTGCCTTTGGTCTACGTTCAAATCACGTGTTAGGAACTATCTAGAATGTAAGACTATTAA
GTCCAACAACAAATAACTCTACAAATTTTTATTTTAAAATTAAAACTTCAAAATTACATAGTCAAAAAGCAAATATATATACTAATTAATTAGTTATTAA
TTATGATTATAATTTCAGTTAATTATTATTGATGTTGAATATTTAATAATAATTATGTGGATTGAAATTTTGAGTTTATACAATTTGAAATTTATATAGT
AGAATTTGTACGATTTAATTTATATAATTATTTAAAAATTTAAAATTTCTTGTCAACGAAAGCAAAGGGTTTGTCTTTTGAGTCGAGCTCGTTGCGCTGG
TTTGCTTAGTTCAAATTATCTCTTGTGTGATTTGCAAGCTATTGCATTAAAACAAGATTTTACCTTGTGCACATCTAAAGAATAGCAATCGCCGATTTCT
CTAGTCATAAAAAAATAATAAAAACTTACTCACAAATAATATAAACAAGATAATTTAAATGGTAGCAGCTCGTCATTATACGTAAAAACTATAGTTATGG
GGCTTAAATTATACTTAAGACTCTACCTCTACAATATAAATATTCCTTTTATATGTTATCTTTGACTATTTTATTTAATATTGGTGCTTATTTAGTTTGG
TGAGTTTTTTGGTACCGAGTTTTAAAATTTAATATTTTCTTCGTTTACTTTTATATGTTATGTTATAATTTTTAAAAGTTAATCTGAATAAATTTTAAAG
TTAAATTAAATTACATAAATTTGATATTTTAAATTAAAAAAATTAGATATTCAAAAACTATACGAAAAATTATTATAAATTGAAATTTCTTTTGCAATCA
ATATGATGAAAAAGGTATATCGTAAAATGTTAATCAAAACTTTTATAGTTTGACTCTACAAATGAAAACTATGGCAATTAATATGAATGGAGATAGTATT
TATTTTTGATACATAAGCTTGATATATGCGTTCATCTATATATTTTATTTAATTTTTCTACTAAAATGGGTTAAGATATTTGGTGCCACTCATAACACAT
CGTGTTTTTAAATTATGATTTGAATTATCAATGTATGAAATTGGATTTGGACATGATAATCGAATTGAACTTGGGTATAAAAGTCAACTCATAAGTGTGA
AAAGTATGTTTGGATGTTAATTAAGGTAAAAAAAGTCTAGCATAAGTGAACTTGAAATTTTACCAATCAATTAATTTGTTATATAAATTAATATGAGTTA
ATATCTCATATGGTCACTCAACGATGTACTCTTCTCTCAAAAAGTTACTCAGTTTTCAATTTTCACTCAAAAGTTACTCAACTATGCACTTTTTTCTCAG
AAAGTCACTCAACTTTGAATTTTAACTCAAAGTCACTCAACTATCCACTCTTTCCTCAGAAAGTCACTCAATATATTAAATTGTTTTTTAATTAAAATTT
GTTGATATTAATTATTTATATAACAAATCAAAAACAAAAATACCATTTAAACCATTTAGTGATCCACCCACGTAACCCGACCCATTAAAAAACATGATAT
GACCCATTTTATTTTGTCTTTAATCCTAATTCAAGGTTTAAAGAGAGGGATTAATTTAGGATTAAAGATAAAATAAAATGGGTCATATCATATTTTTTAA
TGAGTCGGGTTAGGTGGGTGGATCACTAATTGATTTAATTTATTTTTTAAAATTTTTGGTTTGTTATATAAATAATTAGTATCAATAAATTATAATTAAA
AAATAATTTAATAGATTGAGTGACTTTCTGAGGAAAGAGTGGATAGTTGAGTGACTTTTGAGTTAAAATTCAAAGTTGAGTGACTTTCTGAGAAAAAAGT
GCATAGTTGAGTGACTTTCTGAGAAAAAAGTGCATAGTTGAGTGACTTTTGACTGAAAATTGAAAGTTGAGTGACTTTCTGAGAGAAGAGTGCATAGTTG
AGTGTCCATCTGAGGTATTAACTCCAAATTAATATTAAGATCAACTTCAAATAAACATATCTCAAAAAAGATGAAAAAGTATGTGGACCATAACCTATTA
TAATAAAGTATTTGAGTCTAATTTCTAAAACAACAAATTGTTTGTTTAGTACAAACATACTTGAAAACTAATTATACAAAAAAGTCCTTCAAGGATTCAA
AATGCTTGAAGAATACACAAATTCTAAAAATTTGTCTGTAATTTTCAATTGAATTAAATCAAGCAATGTTGACTTATTAAAATCGCCTTCATTAAATTTT
ATACGTGAAATATAAAAATGACTTGTTTATCTTTGTTATTATGAAAATTAGATTCTGTCATATTGCTTTACAAATTTGATTTGAATATTGATGAAATGAA
AAATATTTTAAAATATTTTGATGTTGAAGTACCATATTTTTATTCAATTGATATATATGGAGATACAATTTTACTCTTATATTGAGATATTAAAAGAAAA
TCAATTGCTAGTCATGATATAAATATTAGTAAAAATTTAAGGAATCCCATAGTGTAATTCAATAATTACATTCTGTTCCGACAAATTTAGTATTTACAAA
AAATCCCTTAAATTTGTTATTCTGTGATACTTTTAGACTCTAGTGATACATGATAAGTTTAAACTGTTGAGAAAAAAATGGGGAAAAAACGGTACAATTA
ATGTTGTTACTAAAACAGCTTAATTTAAGGTAACAGATCATTAATCACCATAAAATCAGCACGTAATTGGATATTAATTTCAAATTTTGAAAATCAAAGA
TTATATCATCTATTTTGAAAACATTTTTTGTGAACAATCTGTTAAATTTCGAACTACATTAATTTTATTGTTGTTACAATGGATTTTTCAAGATGAATAC
TTCGATTTTGATGAGACATTCCGGAATTTGGGTGAACGAATTGCAGTATGAAAGTTACAAAATCGATGGAATCGTTGTTGGAGATTCAATTTCGTTTTCT
AATCTCAAAGTAGCAATTGCAGCCGAGTTGGATATTGATGTATCAAGGAAAGAGTGCTGCAAGAGGGTAGAGATATAGGCAGTAAAAGTTGAAGTTTTGG
GAGGATTGGCATGTGGCTAATCTCTCTTTGCTGTGAGGTGTTGGAGTAGATCAATAAACCGTCGCTAAGAATTATCAGTAGATGAGCTTATACTAGTAGG
TTATGGAATCGTCTGTTCAGACAATATGAATGTCAACTCATAATAAATGAATAGCATAGGTGATTCATCGACATCGAGCTCAAATTCTGTGTTAATTTGT
ACTATTTCAGTTTTAGGATTCATTCTTCTGGAAGCACACTTGGGTTATAAGAAAGAAATTTGTACTTTGAAGACTTCTGTTTTTCTCCTTTTTTAATTAG
CCTTTTTTTTCCTTCCATTGTTTTGTGTTAAAATGACTTGGACTTTTTGCTGGTGTTTTAGTATTAAGACTTGAGTTAAACCATGATTGGGATGAGTGCA
GGTGAAATTCTACTCATATTGAGGACTCAAGAATTTTTTGGGTGAGTGGCATAGAATTAGCTAATGGTGAAATTCATACTACATGAAATTCTACTCATGG
TTTCAGTTTTCAGAAATTCATACTACATGAAAAACATGTGATACATGTCTACTACATGTCTACTACATGTATCAGTGAATTAACTAAAATATTATAACAT
GTGATACATATCTAATACATCTATCAGAAACATCGACTAAACAATATACACACTGATTCTATATGTATCATCAAGTATAGTTGATGACGCATTTATTAAA
CTTAGTGAATGATATATTATAACAATTTTCAAAACATGTATCAGTACATCAACTAAACAACTAATACCTTACTGATACATGATATCAGTTTTCAGAAATT
CATACTTCATGCAAAACATGTGATACATATCTACTACATGTATCAGTGCATTGACTAAACACTGTACACACTGATTCCATATGTATCATCAAGCACAGTT
GATGACGCATTTACTAAACTTATTGAATGATACATTATAACAATTTTCAAAACTTCATGATACATATAAAATATTATGATACACAACAAATTCATGTATC
AATTCACCATCTAAAACACTATACACACTTATTCAAATGTATCAGCAAGCATACTTGATTCCTTAAAAATTTTACTAATTTTAACAACAGTTTTAAGTAC
CAAAATACTAACCCGAGACAATGTAGGCCTAACAACAATGTTTGCTGCTTCTTTTTTCTTTTTTTGTTGTATTTTGACAACCTTTGATTTTGATGTTTCG
CCAGAGTCTTTGTTTGAATCCTTCTAAAGATACATAGGATCATGCACCTTTTTCCTATTTTCTTTCCAATTTTCATCGTCGGAATCATATATCCTTCTAT
TAATTAACGGATCCATTAATATGATGTAATAGAACAATTAACAAAAATAAAAAAGAGAAGAATATACGAATTGATGATGGATTAATAATAAAAAGATGTT
GGGTTTAAACGATTACAGATTAAGAAGAAATAGACGATGATGGATTAAGAATAAAAAGAAGAAAAGAATAAAATATGCTGGGTTAAGAAGAATGAAGATG
ATTATGGAAAAAAAAGAACTGAAACTTGATGGAGTAAGAACAAAATGGTAGAAGTTAAGGGAAGTTGTCCTGCTTCCTGAAATTTTTACTTTTTTAAATT
TCATTTTTTTGAATTTTGAAATTCAAAAATTTCAAAATTTGGTCTTTTATTTAAAATTAATTAAATTTAATAATTCAAAATCAAAAAGCTGATTTAAAAG
GTTGAGTGTTTAAATGGATAAAATTTAAAATTCAAAAATCGATTTAAGAGGTTGAGTGTTTTAATGGAGAAAAAATAGGCATTAAAATGGGTAAATGTGT
ATTATAGGAGAGAGAATGTAATGTATCTAAAAACTTACACTAAAATAAAAAAAAGGGGAATTATGTAATATTTAAAAAAAAGTAGGGAAAATTAGAGAAT
ATAAAAATTATAGTTGTGTATTTAAGTTATTTTTCCTAAATATTTATCCTAATGAATATTATCAAGTTTTTTTTGAATATATAGAGCATTCATCTCATCT
AGAGGTGTCAAAATGGACCGGTCCATATTAATTCAATCAAATCCTAATGGACTAGAGAGTTAAATGGGTTTGGGCAGGTTGACCATTTTAATAAAGGATC
AATAACATAGCAGCTCAACCCAGTCCTAAGCAAGCCACAGGTTGGGACGGATTGACCCTTCAACCAAAAAATAAACAATATTACTCTCTTATAAAAAGTA
TCGAATGTTGACCTCTATGAACACGACATCAATTCATACAAGAATTCATTTATAAATCAGATACTTCGGTGAATACTTACAAAAATATATTTATGAATCA
CACACTTTGGTGAATACTTACAAAAATACATAATAGCTAACATAAGATTTAGCGGATAAATGTTATCTTTCCAGCATTTCTTTCACAAAAAACTAGTTGG
TTTAAAAGATTTCCAGCAACACAAGGCAGCCTAAATACTTAATAAATCTAAATTTCTAAATATTACATGACTCGTTAATTAATGTTTTACAACTCCGCTT
CTACTTCCACCATCGATCATATTTGAATCAACATGTGATATTATTTTCTTAAGAAGTTAATCTTCATCTATAATTCACCATGCAAGATGATAATATAAAA
TACTTGATTTTTTATTTTTCAAAATATTTATTCATAAAATTTTTACAAATAAAACACTATTAAAAATATATATATAAATATTTTAAAAATTAATAGCTCA
TGGGCTGGCCTCTGGGGCGGGCTAAAAAACCTCGTTCATAAATGGGCCAAAAATATTAAGCCCAACCCCACTTATTTCAAAGATTAGGTTGAATCGACCT
TGCGGGCAAAGCCCATTTTGACGGCTCTAGATTCCTATCGATAAAAATGTTATCCATACATGTTTATTCCCATGAAAGATTCAGTTATTATTGTAGATGG
CAATCAAATCATACAAAGATAACTCACTTTATAAAGCAAGTCGGAAATGTACTTGTGTGAAGCCAACAATATTGTATGATAATGATGCAACTTTATCAAA
AGAATGGCGATGCTGCTGCAACATGCAATAGCCCAATTAAAAAGAGGATCCATAAAAGAACATAGAACAAAACATATTCAATCAAAACTTTTCTTTCATG
AACTCCAAAATAATGATATCAACGTGCAACAGATTTGTTCAATTATAAAGCTTAGTCACCAAATCTTTATCAATCCCAAATAATGATATCAACGTGGAAC
AGGTTTGTTCAATTAGAAAGTTTAGTCACCAAATCTTTATCAAGTGCAACTTTTGAAAAGATGGTGCACACGACTAGGATACGAGAATTCATATTTATGG
ATTGATATTCTCAAGTGCAGATATTATTTGATATAGTGAATTTGAATCCAAACTAGTTTTTTTCCCTATAGCTATGTACCTTAATCTTCAATGGGGAGGG
GATCTTTGTTAACACCTTGTAGGGTTGTTTGAACAACTGTCATAATTCTTGGACCTACATGACAACACTTTCTTCATTTTCTGTTTGTTTCTTTCGTTAA
AATACTAATCACTACTCTCATGGAAATTACCCATTTCTTTTAAACCAGAACAGAAAAAAGCAACCATAGATACTTACCAAAGGATGTCCTTAAATAAGAT
CAGTCTTACAGAAAATGAAACAAACAAGCATGAATGAGAGTTCCTCTCAGATGAAAGAAATCCTATTAAGCTCATTGGAACAAGACTGCAATAGAAAACT
CGATATAAACCATTAACTGATATGACTAAATAGATAAAAAGCAAACTTATAACCAAAATGACACCTCCTTCCCTCCTACCAAGCTACTACAACTCAACTT
TCTCTTCTCTTAACATTTCTTGGCGACGAGATCCTCAATCAAGTCAGCAGCATCTTGAACTGTTGCAATAGTCTGTGCATTCTCTTCTTCCACAGTGATT
CCAAATGCTTCCTCAAGTCCCATGACAATCTCAACCTGCACGGAATGACAATATCAATAACTAAATCAATTACAGCAAATCTCACACAATCCAAGCAGTT
AAAGCTACGTTATTATAGCTTAGGATGTTTTAGATGCAGAAAATAAGAATAA