BAC Sequence – LE_HBa0304I22

>C06HBa0304I22.1
TTGCTTTCAAATCTATTTATTCCATTTCAAGTTAGGGATTAAGTTTGATGACTTCTCCTTAATGACTTCTGTTTCTTATTGTTCTTTTTACTCATTAGTT
TTGTCTAAGTATCAATTTTCCTATTATCAGCTACCGGGTTATGTTACTTTTAGGATATGTCATGTATATTATCTCTAGATTACTTACCAGAAGCTTCACC
ATACCTTGTCTCAGACAACAGAATCCCTGGCAAAATCTCTTAAAGGAAACTTCGGTTGGCAAAAGCTAATAAAAAGAGGTGTACACACTCTGAAGAAGCC
ATTATATCAGGTTATATTGCATTTCAACCGTCTCACATTTAATTGTTTGTCCTGTTTTGAGTCATCAATAACATTTTATTTTTCTTGCAGTTATGTTTTC
TTGATCCTGGAATTGCTTCTGGGGAGGAGATTGAGAGCCTAAAGAATCTACACAGCATCCGTGTTGAAGCTTCGTCCTAAAATCTCAAGGATGTATAATA
TGCAACTAGAATTTCAGACAGTTATTTTAAAGGGGTGCTCTTAGCTTGTATGTATCAGTTCTGTGTACAGTCATTTTGGTGATGAATATAGGTTAACTGT
TTTACCATATATTTTCTGCAAATATTAGCTACTGTGACACTAAGCTCCTGTATATATTAAAATGAGAAAAAGATTTGGAGTTGGAGGTGTGTGTTAAGGT
CCCTAGTACTGGATCAGTCAATGGACTATTAAAGAGAAAGTCAGGCCGAACACACAGGTTTGACCTTGTTTAGTTCCTTGACTTGGCTATGATTGCTGAA
TTTTGGCAATACATTGAAGGAATTGCAGACATTGGAACTCATCAGAGAGTTTCCGATCTCTTCTATAGGGAAATTCATCCTGCTCTCAGATAGAGGGGTA
CAGAGTGAGTTAACTCACTGGTTGAATAGCAAGAGTCCTAAATTAATACATATAGGAAGAGTCCAAATTCACCTAGGAAAGTTCTAATAAGTGTTGGCAG
AGGTGCTTAAGCCCTGCAGCGAGACCATGTTGAGCACTTTGCCTCACTTAATGTGAGCTTCAGCGTCCTCATCAAGGTTCTAACACATACTTTTCCTTGC
CAATTAGCCTCTTTAGAAGAGTGAAACTAAACAATTGATATTTCACTTTATTGTTATTTTTGTTCAATATCTTTGTTCATATATTTTAATCTTGGACTTA
ACATAGATATTTGTATTTTTTCCTCCCGTTGTGTTTTTTTTTCATTTATGCCCATGGTTTAGCAGGCTGACATTTTTTGCGCTTTTGCTTTTGATAACAG
TGGCACTATTTGAAGCTAATTAAATAATTCAACACCTATCAATCCCATACTGGCCCTATCTGTTTTTTTTCTTCACCAAATGCAACAGTGCTATGACCAA
TAAGTTAATAGTTTACATGAGGGTGAATCCTACTGTTACCTTTGATGCAATTGTCAGCGTACATCAATACTTTTTCTCCATACTTTGGAGCCTTACAAAT
CTTGAATAAACACCTTCTGGTTCTGCCATCAGATTTGAGTGGCTGCCCTTCTCCACAATCTTACCTTTGTCCATAACAACAATGGTATCTGAATTTATTA
CTGTGGAAAGCCTGTGAGCAACAGTGATCTGTGTCACTTTTGTGATCCCCGAGCTGTTTAGTTTCATTGATTCCAGTGCACTCACTACTGTCCTTTCAGA
CTCGGTATCTAAAGCACTTGTTGCTTCATCCAACAACATTATTCTGGGCTTTTTGAGCAAGGCCCTTGCTATTGCTACTCGCTGCTTTTGCCCTCCAGAA
AGTTGAGAACCCTTCTCCCCAACAAGAGTGTCATATCCGTCAGGTAAGTTACTAATAAACTCGTGTATGTTTGCTGACCTTGATACTTCCACTATCTCAG
CTTCTGATGCTCTTTCACTCCCATAGCAGATATTTTCTCTAATTGAGCAGCTAAACAGGAGTGGCTCCTGCTGTACCAATCCAATCTGTGCTCTCAACTT
TCTAAGGTTGTAATCTCTTATATCCTTGCCATCAATCAGAACATTTCCCTCATTCGTATCATAGAATCTCAGTAACAATGCTACAATTGAAGATTTTCCA
GCTCCACTTTCCCCAACAAGTGCCACCTTTAATCCGGCTTCAATTTGTAGACTGAAATTGTTGAGAACTGTTACTTCTGGTCTTGATGGGTAACAAAACT
GGACATTTAGGAACTCAATTTCTCCTTTGATGGTTTCGGGTTTGGCAATATCTGGCATGTCTGGTACAATTTCTGTGCTACGGTCGAGGATTTGGAATAC
AGGTTTTAGTACATCTATGGCTGATATTACAGTGGGTATCAGTGTCCATAGTTCTGTAATTGAGGGCACAGTGAGGGAAAATATCTGGTATGCCCTTATC
CCATTCTCAAAGCTGGCTTGATTCCTGTCGACAAGAATTGTTGTGTACCATAAGGCAACTGCATGAGCTATGTTCCATAGGCAGAGAGAGATGCCTTGAA
TAATTCCAAATTTTATGCTTTCTGACTTGCCTTTCCTGAGTGGTCGTTTTAAGGACAGTTTGGCCTTCTCAAGTATCTGTTCTTCGTGGCAAAAAGATGC
AACAGTTTTTATATTAGTTGCAGATTCAGAAGTTAGGGCAACAAGTTTGGAGTGTGCTAGACTACTATCACCAGAAAATCCTTTAGCTGACTTTGCTTGA
ATGAGTCCACCGATGAAGTGGCATGGCATCACCGCCCAGGCTACCAGACCCATTCTCCAATTAACTTTCATGCTGACAGTTGTTGCAATCAATATGGACG
AAACACACTGGACAATGACGGACATGCGGTCAGATATTATGATCTTGACTGTGGATGTGTCACTGGCTATCTTTGATGTAAGTGATCCAATACTATTTTC
GGGCTTTTCAAACCAAGCTAATTCATTTCGTAGTGTGGCTGTAAAAAGTTTTTGAAATGTAATACGCATCAACTTTTATATAGGGGACAAATTCTTGAAT
GTTAAATATGCATTGAGAAAAGAGAAATGGAAGAAAAACGAAATGTAGATTGATGGATCTGATCTTCCAGGAATGTATAAGTAGGGTACCTGTGTACAAA
GCTTGCCTTAAATTTGTCATGGCCTTTTCTCCAATTACTCCAAATAAGTAATGCTGCAAAGTGTGAGCAAACAAAGAAACCACTCCAATTGAAGCAAATA
TTGCTGAATACAGAGCTACTTTCTCCTTTGAATCAGGATGATAATATGCCACTCCTATTGTAATGATGAAGAACCCAAAAACAGGTTTAGAGATGCCAGC
AAAAGCTGCTGCTAAGGAGCCAATAGTTGTCTTTATGATCTCTTTCTCGTTCAAGGCAAACCAGATTCTGAAAAATATGTGTCTTTCTTTTATTTGGATC
TGCTCTCTCTCAGGAAGTTCCTTAAGCTCTGTTTTGCTTTCATTGGGCTCATCAGGTTGCTTATGGTCCTGAGATGAATCCTCTTGTATGGAAATAACTT
TTGTATTTGTAGCCTCCAACCTATCAATTAGATGTATTTCATTTTAATCAATTAACCAGTCTGATATGTAATGATGAATATGGTATTGAGTTTAACCTGA
CCTAGTTTGACAATCTTGCGTGATGCTCTGCATGCAAAAAAGCCTGTTGTAGAATATACTTGTATCTAAGAGGTTATTATGTGTTCCCGTCACCACAACT
TTCCCATCCTCAACAATAGCTATCATGTCTGCATTTACAATAGTTGACATTCTGTGTGCAATTAAGATGACTGTTCTGCCTTGTGCTGCTGTCTCAAGTG
CTTGTTGAACTTGTTTCTCTGACTCTGTGTCAAGTGCACTGGTGGCCTCATCAAGCAAAAGAATAGGAGGATTTTTTAAAATTGCTCTTGCTATTGCAAT
TCTCTGTTTCTGTCCACCTGATAGTTGGAGACCCCTTTGCCCTACCTAGAGTAGGACATTTTAACACAAAAGCTAATTTCATTTTTTTCATGGGGAGCTT
TGCTATACAAGAATTAACAAATTGTTTCGGATGTACTTTGATCATGCTACAACTACTTCCATTTTAACTTATCATGCTTGGAGATGACAGATGAGCAGTA
AAATATTTTGGCTATTAGAGACAGAAGAATTAAGAATCCTCTATTTAGGCATTACATTCTCTTTGGTTCAATTTTTCGAAAAGGATTTTACAGATAAGTC
ATTTTGCCTTGGATCAGGAAAAGGCACGAGACTTGCTAGATGCACAGTTTTTTCTTTTTCCAGGTGTTCTCAATCCTAAGATGTGCCTTTCGGTCTCCCT
TTTGTTTATAGTGGTGGAGAAGCAGAAAATCCTTCTTTCTTAGATAATGAGAAATTATTGTTATTAATTTTGACAGTGAGGAGGTGTGTGGTTGGCTGTT
GGAGTTAGGAGAGGAAGAGGTATATGCCAAAGAAGAACTGACGAAGGTGATTAGATAGAATATGGTACAACTTCAGCTGACGATATGACATTAGATGGGA
CTGTATAGTGGTCGAGAATTAGGGTATAAGTTTTGTAGGTAGTCGAGTGTTGACTGAGGACATGACGAACACTAGTTTTTTTTTCCTCCAATGTATATTA
ATATTTGTAGCTGCAGTTGTTCTGTTATCTCTTTTTTTATTTTCTTATTTCTTGCATCAGCTAAATTTCTTTTGAGCCGAAGGTCTATCGGAAATAGTTC
CTCCATCTCAAAAAGGTAGAGGTAAGGCCACCGTACATTCTACCCTCCTCAGACCCCACTTGTGGAATTACAATAGGCATGTTGTTGTATCATTATTAAT
TTTCCTGTTCCTTCCAGCATTAAATTGTATCCAATTGATGGTCGCCACATATTTAAAGAAATTATTTAAATGATAATCCGTTATAGAATTGGTCAATCTT
GGACCCAAAGATGGATGACAGGGCTATTTGGGAGTCAATAGGTGGGCAATATGGAAGGAAAGGAACTCTAGAGCTTCCGATAGTTTGAGAATATAGTATG
CAAAACGTCAAACTAAATTGTCTTATGCTATTATGTTTTTGGTGTAATCAATTATACTCAAGTGATACTATTTTCTTAATTGATGTACTAGACTCAATTT
AGGAAAAGATAGTAGAATTTAAAGTACATGTTGTAAATACTGATCAGTGTACTGACTTTTGAGAAATAGACAAAGTTACCATTTCCAAAAAATAAATAAA
ATTAGGTGTTTGGCAGGGCTATTTGGGAGCCAATAGGTGGATGGTGGGTAGTTTTGTATCATTTTTCAATAGTTCAAGGATATTTTAGTCCCTTTTCCAT
TCTTCCTATTGAAATATATAGAACTGAATACCACAAACTATACAGACAGTTATATATCTTTTCTTTTTTTCCTTTATAAAATAACCTAATGAAACAGTTG
GTCATGTATATGAGTGATAATGGTCTGACCTCTGTCAGATATTGATTTGGTAGCTGGGATATGAAAGAATGTGCATTTGCCAACAAGGCAGCTCTTTCAA
TCTGTTGATCATTTGCATTAATATTTCCCATCTTAATGTTGTCTTTGATGCTGCCAGCAAATAGAGATGGCTCCTGGGAAACTACTCCTATGTTTCTCCT
GAGAAACTTCAAATCAAGATCTTTGATGTTGTGGTTGTCAAGGAGAATCTCACCTGATGGTTTTCAAATACCGAGTAAGTTTTTCAATTTTTGTGTAATT
TATCTATTCTATTTGATTGATGCAGTATGAACATTATGAAGCTTTTAGACATTTACATGTGAAACTTTCTTTTGTTATAGATGCTTCTGCAAATTCAGCA
ATTAAAAGTAAATAATGAATTTTTGACCAACCTCTCACGGGATCATAAAATCTCATTAGTAGTGACATGATGGTGCTTTTACCACACCCGCTACTTCCAA
CAAGTGCCACTACTGTTCCTGCTGGAATTGACAAAGAAAACCCTTGAAGAACTAACTTCTCCTGCCGTGATGGATAAGCAAAGTGTACATCCCGTATGTT
GATATTGCCATCTATTACTTCAAATGTTATCCCTCCTGAGTCTGCATCTATCGTGGGTTTTCTGTCAATAATCTGGAAAACTTCCTTTCCTGCTGCTTTT
GCTTGATTGAAGATTTGTATATCTGGTGCAGCATACGTAAGTGATCTGAAATTTGAAAAAGAAAAACTCATCTGGTTGCTGTTTTTAAGGTAGTTGAGTT
TCTTTGTTCCTGATATGAAGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNGAGGATGGCCATTCAAAGGGATGGAGGCACTGAATAGTAGAAGATACAATACGCGTTTGATCATAAAAAAAAAATTT
AAAAAAATAATCAGTTTATTTGAACCTTTGGATTATGCTGTAATTATATGTATCATTCCCTTCTGTTCTCATTTCTTATAACATTAGACATTTCACTTAT
GCTTAGTTACCAATAGATTACCACCTAAATAAAGAAACATTTAACACTCCACAAATAGTTCAAGATAGAGAAAAGAGGAATTATCTCAAATTTATAATTT
ATCTCAAATTTATAATAGCAAAAAAATTGTTTGTGTTACTTGACACATAAAATTTGAGAAAACTTGGTAAGAATTAACATGTCTGAAATTAAATCTCTTT
ATCATCTTATTCAAAGTCTAACACTAAAAAATTACTTAAAACTATTTTGGCAAAAAAAATAAGTTAATTAAAAGGGTGTTTAATTTCCATATTATAACTT
GATTAAATTTGAGTTCGTACCGAAAAAAGTATAACATTCTTTCTAACAAAGCAACTCCATAGTCCATACACCCTGAACTTTAAATTCGAGATATTACTGT
ATTAGTAAGAGAAATTTCTGTAATTATAAACTTATAAATTACAAATGATAAGTATGTGATTTTTGTTATTTGTTCGAAACTTTTTTATTTTATTTTCTGG
TGCTTTGGGCCGAGACAAGTTACAGGAGAATACCCTAATAACTCGAAAACACACGCTGAACTGAAGGTTCCCTATTGCTCCGCTGCAGCTTGAAGGTACC
AAACAATTTCTAACTCTTTAATCTCTTTTGCCATATATTCGATTATATACTTAGGTTTTGTTGCTAATTTGGGTGACTTCACTGTGAAATTCATGTATTT
TTGTGTTTCAAACGAGGTTATAGTTAGGTCAATTTCTATTTAATGAATTCTGCCATGTTTAGTCTGTTTGTTGGCGAGAATTTCTCCTGTTTATTTTTTT
TAAAAAAAAAAATCAGCGATTGTATTGATGTAACTTCGTTTTTGTTGGATCTGTTTGTGCGACTTGCTTTCTTGTGAAAGCTTACCCAGTTTGGTTTTGC
TCTGCACGTGTATGTATGTATATATGTATATATGTATGTAATTCTGTTAAATTGTTTGAATATCGCAATTCAATGTGTAAAGTAGGAATAAGGAGAAGTT
TGTCGAAAATGAATTGTTTTTTATTGCCTTTTGCTTTTACAGGTTATTTATATTAGTGAACTTAGCAAGATGAGTGCTAGACCTTTCTAGGTTTTGATGT
ATGTAGGCCTTTATGAGTTGATGTATGTAGTAAAATAGAATGTCATGTTCGGGAAGACATATTGTGTTGTCTTTTTTCAATTTCTCTTTGGAAGATTGGA
GCTTTGCCCCTTTTAAATGAATGCAAGCTGTTGAATTAATTGACTGAAAGTCCGTGGGAGTAGGGGACGTGCTTAGTGAAACATGGAGATGTTACGCGCA
CATCCTATACTAGTTACAAGTGATCAAAATCTGGTGGTAGGCTTAGACCGGGGATTTGTGCTTGTTTGAGGTAGCAGGCTGCTTGATGGATAAGTCGAGC
TGTCACGATGTAATGTGAGTTTGATCTAGAACCTTTGTTGTCAATGAAGAAACCATTTGACTTAAACTGAGTGTTTACTTGCATTTTGGTCTTGCTAAGT
TGGCATTGGCTTTTTTTGTATGCCGGCTAGTTAGTATTCTTCTGTTTTAACTATTGGGTTGTGTTATATGCTACTATTGTTGGGGTTCTTCCTTACTCCT
GCCAATCTTTGTACAGCAAAGTTCTCAACTTCTTATACTCTAGTGAAATCAAATTGTTGAGATGAGGAAAGATAGGCCAGCTGTTGCAAGTTCAAGTAAA
ATAAGATTCGATGACTCTGATGAACATGAATCTTCATCTGAAGATGAGGAGGAGAAGGGGATTGAGGAGGAGCTTGCTGATGTGACCTTTGAAGAATTGC
AGAGAGCACGGTCTGATGGATCAGCTACAGTGTATAGGAAGCTTAATTCGGAAGGAAAAAGTAGCCGAGCTAACAAGAACAGGCCAATGGAAATGAGTAG
CAAAAAACCAGTAAGCCGATTTAGGGAAATAATCCAAGTTCCTAAAAGGGCCACTCGTGACCCTCGCTTTGAGTCTTTAAATGGCCAGGTAGATGAAGAA
GGGTTCAAAAAGAGATACAATTTCCTTTATGAGGATAATCTTCCAGCAGAAAAAGAGGATCTGAAGAAACAGATGAGGAAATCAAATGACCCAGAAGAGA
GAAATGAACTGAAAAGTCGTGTTTCTTGGATTGACAAACAATTGAAATCGGCAGGAGTGAAGCACACTGAGAAAGAGATTCTGGCAGAGCACAAGAAGAA
AGAGAGGGAAGCTGCTAAGCAAGGAAAACGACCTTATTATCTCAAAAAATCTGAAATTCAGAAACTCAAACTTATTGAGAAATACAAGTCACTCAAAGAA
GCTGGCAAACTGGAATCATATATTGAGAAGAAAAGGCGCAAGAATGCTGCGAAAGACCACAGATTCTTGCCATATCGGCGCCCTGGTGAGCAAGAAAACT
AGTGAAATGACATGTTTGTATGCTGTAGCAAATTTGTTTGCTTTGTTTTTCTCCTCACAAATATGTAGAGAGCTTGCTTTTTAAGCATGACCATGTGCCT
TTTCTTTTGTTATCGTTCAGCTGATTTCTATGAACTTATAGTGGCTATACTAGCTGTATTCAGAGCTTGACAGAGATGGTTGAATTATAGTATTCACCCA
TAACAATACAATCGAGCAGTCCATCCTTCAAGTGACTCATTTTGTCTATTGTTGAATATAGTTACTCTTATAGAAATAAGTTTGTCCATTATTAGTGAGG
CTACATCCATTTCTTCCTAGTGTGGAAATCCATTAGACATATGTAGTGTGTTGAGAACAACTATGACGTCTAATATTAGGTGATTTCTTCACATATGTCC
CAGAATTACCCAATATCTAGTGGGATTCCATCTAATTAGTCGAGGTGTGAGTGAGTTGGCTTAAACCCCACCCCATTTTCACTTTTATATCATACTCAAC
TCTCCCGGTACCGGTCTAGTTCATGGTCAGGGATGAAAATTGGTTTCTCTCCTTGGGTGAAGGGATCATTGATCTTGGGTTGGGCTTCTTAACTTGACAG
GCCACTATTGCAATATGAGACACACAATTGGCTGGGCCTTTGTCCAAAAGTAAAGATTGAACTGAACTCAGGAGTTAGCATATCAGTTTGTTAAAGAGTT
TGCGAAGTATTTATTTGATCAAGTTCAACTATATTTGAAAATATACAAAGCTGTGTGGAGGTAGAAGGCCTGTGGGTCGTAAACTTCTTTTTTTCTGCAG
AAAATGATGGTATCTGGGGAATAAGCATCGGCTCGTTCTGTCTTTTATTAGATCATAATGACGTAAATTAGCATTTGAAATTGCATTCCCTTTTGATGTC
CCAACTACATATTGGATAATCATTGCAGAAAAAAAAAAAGTTATTCTGGTAGAAGTTAACCACTCATTGTTTTGACCATAAAGAAAATAATTTTGGTATA
TTGAGATAGTGATAGTTTTGGAAAAGAAAATTATTTGATCTAAATTGTAATACGTTTACTTGGGAAAACCCACAAGCTAAAACTTCAATTCTCATTCATA
CAAGTCTCTGTCCAAGAAAGGCCATCAATCATAATCATAATATAAAATATAAATTTATAAGATGAACCTAAAATGGAACCATCAACATCAAGACAAGGAC
AATGAACCAAATACTTCTTGAAATGATCATTCATTTTTGCCATTCACTAAGTTATGTCCCCATACATACTAGTGATTCAATGTATTTTTGGCTTAGTGCT
CAATTTGTTACTTTCATAAACAAAAATAGAATCAATAAAGCTTAGAGCCCAGTCGAGAGTGAGCTTCCTGATATTCTTTTTTCTCACGATCATTTTAACA
AAAAAGGATATGATTGTTAGGAAAAACTATCTAACGAAAATATTTATTTTACATTCTTGTTCATCCACATGTTTGTGTATTTCTTACTTTANNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAAGAAA
AGTAAATAAACAAATGCAAAAGAATGGAAAAAGCTTCAGAGGTTTTCAAACTCCATATTCAGTCGTCTTCTTCGATCAGCAGCGCAGAAATCCATGGCTA
TCTCGACACCATCATATTCATCCGACTTTCATCTTTTATAAACAATCTCATGTCCAACATGTAGCAATCTAATGGTATGGTTTATATAGTATTCAAAAGT
TAATGTTAAAAAACTTTTCAAATTCTCTAATTAAGTGTAAAGAATAAATTTTCTTAAATTTTAAAATTAAGAAAAATATTTTTAAGGTAAGAATTTGATA
ACTGAAGCTTTTATGTATGATTTAATGAGGGAGTGATTATATACTATGCTTTCATATTTTATAAAAATATTTAATAATATTTTATATTTTAAAATGAAAA
AAAACTTTACACAAAAAATCTGCAATAAATAAATAAAAAATTCAGCCCTTAGAGGCATTGCCACATCAGCAATTCTTGATTTAGATTTATTATATATATA
GATTTCATTGTAACAATATAGCTTCTTGGAACCAACTTTTAATCTTATGTTCTATTACATATTCTCTATACAATACTAACTTTTTTTTTTAATTTGGACA
AACAAACGATATTACAGAGAAGTTTGATCGTATGTATTGCACCATATGACCATTTAAAAGCAGCCCACACAGAGTAGCTAGTTTTATTCTATACATACTC
CATATTATACTTCCATTAATTAACTAAACATATCACATATTCATAGAACACAACAAACGAAACACCTCTTTCACCTTCCCTGCTAGTAGTATTTTCTGTT
GTGATGTTTTCTGAAACTTAAGGATAACTAGGCTTCTCCAGATCCTCGAAATCACGAAAAAATGTCTTTTGTTCCAACACAGAATCTACCGTGGAGAATT
GAGAACCATATTTTATAATGTGATCAGTAGCTGGCCCAAACACCCCTGTTTGGGGATGAGGAGTCCAGTACTTGTATTTGTCCGATTCTACCTCGATTAT
TTCATCAGGTACCCACGATGACACATATTCCTCTATATTCTTGTCATACACTGACGTGTGCACCACATTCCTGCACATAACATAATTAGATTTAAAAAAA
AAACAAATTGAAAGTAATTAACTCGAACTGATCAAGGACAGAGCTAGAGAGAAAGTTACAGGTTCGGGTAAGGTAGAACTTAGTAACCATAATCAAAATT
TTATTTTATACGTATAAATAAGTATTAATCCATAATAGTACAAGTTGATGTTTATAAGAATTCAGAATTCAGATTAGAAGAAATATGACATATTTGGAGT
ATTATATCTCATGAAAAATAAGAATGGTTATATTATTAATTAAAAACTAAAAGAAATCAACTATATTAAAGTTATTAACAATTCAAATTTAAAGCTTGTT
TTATTTTTGTTTTAGGCCACTAATATGCTTGAGCCACTGCTGGTTCAGAGTATACCTGCCAGAGAGCGCAGTAGATGATGAGTTGGCAGAATTTCGAGAA
GTTGAATAAGTTATCTGGTTCACAAATCGTTTCCCCAAGCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTAATATGAAATAATTTGAAAAAAAATGATCTCGAACATTTCCCATTGAGAATATTC
TCCGTATAGTAAAAAAAGAAATTCCTCAATTAAATTCTTAGAAGGTCAAAAAGAAAAATCATATTCATACAAATATAGTAGACCATCGGAAGTAAAAATA
CAAATATAACAGACCGAGAAACCAATTGAGCAATCTTTTTCTTAAATTTAGCGTTTGGTGATGAATTGATAAGTACTTAATCACTAAAGATTTTGATTTT
GAGTTCTATATATATAATCACTTATCGTAGGGACGGTTTTATCTCAAAATAAGACTTTTCAACGTGGATCACGGAAAAAAATTTAAAAGAAAAAAAGCAA
AAAGAAGTTGTCTCCATACAAATGATAAATATGTTTTCATCTTTAATCAAAGATGTCTGCTTCAAAATTCTGGATAAATAATCGCTTTTAATAAATATTT
TTTTTTATCTCAAAATGAGAATTTCTAGTGTGAATCTAAATTAGTCGTGCTTCAAAATGGGCACTCTAACACCTGTGGACACTAGGTGAAAAATCATAAT
CAAAGTAGAAAAAAAAAAGGTTTTGCTGATTTCTAAGTAAAGGAAGCGTAATTATGCGTAATCAGCGCCAAAGATGCCACACTTTAGGTTACTAATATGC
TTCTGTCACCCATAATCAAGAGAAAAATAGGAGACATTTGCTGGTGTAGGTAAAAGTGGTTCAGTTATCAATAAACTGATGGAGTTTTGCCCAGTAATAA
ACCTGCAGCCACGTGCTCTAAGTACCCTTCCAAGATGTCTAACTTAAGCTTCTTCCCTTGTTTAACTTCCAATACCATTTCTGGTGGCGGGTACACACAC
ATAGTAACATAGCCAAGTGGCCAAATTGCTGCATGCCAAGTATAAAGAACCGTGGGCATGCTAAAATAACCATTTCTTTATTTAAACATATTGTCCACAG
TAATGCCATCCAAGTGGAATTATAGAAAGTTTGAACAAGTCCCTCCTATGCGAAAATGAAAATTTATGAGACTTTCTTGTTAGAGGTCTTAAATTTAAAT
TTTTTTATAAGCGAAAGCAATGGATTTGTTTTTTGGATCGTCAAATCGAACTTACCTATAGCTGGATTACCTTTTTTATGTGATTTTTCAGTTATTATAC
AAGAGTGGCACCCAAAAAATTAGAAATAAAAATGCGTGCGACACTTATTCAAATTTACATTCATGCGTTAGGCCTATGAATACTATCCCCTAAAGAATTG
GTATTATCACTAGGAGCTCTTGCTTTCTAGGAGGCTAAGCCTATTCCTTGGTTAACCTATTTTTTTTTATTTCTGTTAAACATGAATTGATCGAATATTT
TATCCATTTTTATTTTTGTTTAACCTATTCATATCCGATCTGACCCATCCATTTGCCTGTCCAAGAAAGGGGTTTTGCAGATTCACTAGAATATATCCAT
TCTTTCAACGTCCAAATCTATGCATATAGTGCAAAAATCAAGTACTAACACTCTCTCGATTCAGAACCTATAACGTTTAAGTTCTGGATCAACCAGTGTG
AAACAAAGGAAGAGGAAGATCACCTTTTGCACAGTCTTCAACTAGTTTTCTTAAACTTTAGTATATCAATTGAGCATTGTTAAAACTAAGATTGTGGTCC
TAAACATAAAGTAACAATCGATATCCACATGTTGACCTAAAATCCCGTTGCCAATTGCAATAATATAAACATTTCTTTTACACTCAATTCCATCCAACGT
TAGAATATATGAAATAATATATTATTCACAAATCACAATCATATCATATCCCCATTAATTCCCACAAAGCCTTCCACTAATAGAAAGTTTTTCCATAAAT
ATCGACAATAACATAGACTTACACTCACAACCCATATAACAAAGTAGTCCTCTTGTGGTAAGTTTCATTCAATTACATATATGCAAAAACTTGTACTTGT
TATAATTACATCTATAACCTTTCCTTTTCTGTAAACTCTGTAACTAGTAAAAATATCTCATTCAGAAAGATTTTCATGATCATGTCTTATAATTAACTAC
TTAAGAAGTACAAGTTGAGTTCCTGGTGAAAACGACGAAAATCACATGCCACTCATGGCTCAGCAGAGTTCACTAGACTACAATGTGAGTTTTTTTCACT
TCTGTTTTAGTTGTTGTTAGTGATTTACAGTGTTTCTGATTGCGTTTCTGTATATTTTTTGGTGTCAAAAGGGTAAGCCAAAGAACAGAATTTTGACAAG
AAGTAGAAGGTGTTTCGAGCCAATTAGCAAAAATAATTTCACTTCTTATAGTCAAGCATCAGAGGTACCTAGCAGCCCTGCCAATGCAATGGAGTTCTTG
AGTCGACCGTGGAGTCCATCTTCTAGTGATCTCCTGCAAATGTTTTCATCAAGTGTAAGTAACCAACATTCTGCTGTGTCAGTTAGAAGCATAACTGAGG
ATTAAAGACTGTTAATCGTCAAACATATTCGTTTCAAATGAAAAGTAAACAGCAATTACTGTAGTTTATTTTTCCCTCTCTTGTGAGAATTGGTGCCTTG
TTTGAACATGCATGATAATGTCAATTCAAAACTGGAATTATAAACAACCCTTAACAGAGTTCTCTGCTTTTGCAGAATCTCTTGTTGAAAGACGCGGCAG
GCAAAGAGGATTATGAAGAACAAGATGAGGAAATACTGGACAGTTCAAGCAACAGAGCTTTTACCAATAAACAGTATATTAAGGTGATCAATCACAAACT
CTTTGCACCACCCCCACCCCCTAAACCGACACTTTGAAGCATCCACTACGAAAAATGATACAGTACAATGACTCAGAGATATTTATTAATAAAAGGTCTC
ACCAGTAGTCTTGGCTGGAAGTTACCAATTAGAATGTCAAGCTAACTATTACGTGGAGTTGATGAAATCGAGTCTCTAATGTTGTACTCATGCTATTTCA
TATGATAGGTGGACTTGCATCACATGAAGGGATGGCTAAAAAGAAAATCTCCGTTTTGGTTGTTTAGATCAGATCAAGAGAAGAAAGAGAAACTCCGATT
ACAAACAGCAAAACTACATGCTGTACTTTCCCTCACACAGCTTGCTTCAGGTATTGCTGGCTTTGCCAGCAATAGCAGTTCAGAAAGACGAGAATCACAC
CATATCAATTATGAGAGGGAAGGAACATGGAGCCATAATATGGGTAATGTAGTTGCTTCAGCTGCTGCTCTGATGACTACGGTATGTGCTGAGGCAGCAG
AAGCTCTAGGAGCAGGAAGAGCTCAGGTTGCATCTGCAGTCAATTCTGGCCTGGCCATCCAATCTCCAATGGATATGATTGCAGTCACAGCAACAGCAGC
CACATGTAATACTTAACACATATTTCTGTATTTTTTTTGTGTGTGTTACATTAGTGTTCGTTCTAAATGATGGAAGCTTAATGCTTGTTTACTAGGTTTA
CGAGGAGCTGCAATTCTTAAATCGAGAGCCATAGAGGATTCCTCTCCTAGGATCCCAGAGATGCTCACTGCAGGCACACGACTATGGATAATAATGCCCT
CAGGTAAGAATCAAATCTCCTGAAAAATTTCTTATAGGTGATTTAGCACTTGAGCCGAGGGTCTTTGTTTACTCTCTACCTCCATGAGATTGGGGTAAGG
TATGCGTACACTCTATCCTTCCCATACCTCAATTGTGGGACTACACCGCCTAAATATGTTTTGTTTATTACATCACAGGACATAAAGAAGACAAATGGGT
AACCCTGCATTTGAAGCAAAACCAACTGATACTAAGCCTCAAAAGGAAGTACTTTGGGACTCTAAGAGCTTCAAAAGAATGTAATTATCCATTCAGTTTC
TATTTATTACCTCAAAACTTGATGCTTCTCTTCTTTTTAGACTTTATTATAAAAGAACTCTTAATACTAAAAAAAACTTACCGTTGTCCAGACAAGCTGA
TCAACATCATAAAAGAATGTCTGGAGGCTCAAGACAAGTATTTTGTTAGCTTGATGACGAACAATGGAATCATCAAGCTTCTTTTCAAAGATGAAATGCA
ATCAAGCATCTGGATATCTACCATTTCAGGTGTCTTAAAGAAGCAAAGATCCTCTTGAGAAAGAGGTCTGATATATTGTACAAAAACGTTATGTCATACA
GACAAAACCAAGATTTGTCATAAACATAATTCTAATGGAGAGATGAGCCAAGATTTGAACTTTATACGTTCTAAATTTTAAAATTTAGTAATGTAATTAA
ATTTTTACACATATTTAATTAATGAATTTCTTAATACAATTTTAGGATTTGAACCAAGGTTATTAGATTTGACCAAATTACATCCTCCACCTCTGCATAC
TTGTAGATTTAAAGCTCAAGTGGCCTTTTATTTTTACTGCATACGACAACTAAGATCGACTGGTTAAATAGTTAGAGATAAGACNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGAATAGTTGGAATG
AATCAATCATGTGATGAATGATGATTTCTTCATCTCTGGCATCAATTTTTGTTGTGTTTTCCATTATACTAATCTCATAAAAAAGACCCCATTTTGAGGA
CCCTTCACTTCAGATTCAGAAGCCCACTTTCAATTTGGACACTTCTCAAGTTTTCTCCCTCTCTCTCCTTATCTTCACACTTGTGACTTAACTAATCAAA
AAGTTGCCTTTTTTACTTTGTACTGAGGCAATCAATGCTAACCCTGAACCCTTTTTCCTCATCTCTACTCTTTCTGTACAAGAATACATCAATATATATT
TTTATGGACTACTGTACTATTTTATTACTTTGTTTTTTTTACTTAATACTAATAAATGTATAAATGCCAAACCCCCATTTTGTTCCTTCCTCTTCTTGAT
TCATTTTTGGGGTTTCTGGCTTTCTCTTTCTCTTGACCACTAATGGCATCAAGTTCTTGAATCAATGAAAGTTGGATGTTTTTGTTGAACTAAAGAAAGG
TGCTTTGGCTGTGAATCTCAATAGGGTTATAAAGGTTTGATTTTTTTGATCTGTTTGAGTGGTTTTGTGGGATTTTCATTTTTACTGTACTTGTATGATT
GAACCCTTCTTGGAGAACCATCTTTTTCCTCTTTTGAGTGAGAGTTGTTTGCTGTAATTTTTTTCTTTGTTAATCTGGAAATTGGGAGAAAGAGAGAAAG
AAGCCCCTTTGCTAGATTTCCTTTGTGAAATCTTGAAAGTTCTTCAATTTGGTATCTTTTTCTGGTAATGCTAATTGAAGATTTGGGGAATGGCTACTTT
GGTACCTGGTGTTCTATTGAAGCTTCTTCAGCATATGAACACAGATGTGAAAGTTGCTGGTGAGCATAGGTCATCTCTGTTGCAAGTGGTCAGCATTGTG
CCTGCATTAGCAGGTGGGGAGCTTTTTCCTAACCAAGGGTTCTACCTAAAGGTATCAGATTCTTCTCATGCTACTTATGTATCTTTGCCTGATGAACATG
ATGATCTTATTCTTAGTGATAAGATTCAATTGGGTCAGTTCATTCATGTTGAGAGGCTTGAAGCTGCCTCACCTGTGCCTATACTTAGAGGGGTTAGGCC
CGTCCCTGGACGACACCCTTGTGTTGGAACTCCCGAAGATATAGTAGCAACTCATTCTTTAGGCTTCCTAAATAACAATGGTAATCTGTCTCCTGGTTCA
AAATCGCGAGACAAAACTAAGTCTCCTTCAAAAGCATTAGGTAATAGTCATGTGGCGGCGAAAGATAATAAATCTGCAGTTTCGAGATCAAATGGTGGTA
CCAAACAGGAAAAAGTGGAAAAAAAGAAGCCTACTTTGACTTGGTCGAAGTCCCACTTGTCAAAGTTAGCATTAAATGTAGTGGAGAAGAAGGATTCTCT
AATGAGAGTAAAATCATCTTCTAGCTCAAGATCAATACCCACATCTCCTACAAGTTGTTATTCATTACCGACTTCTTTCGAGAAGTTTTCAAATGGGGTT
AAGCTACAAGCAAAGGTTAAGGGCTTGGAACGTTTGGAGAAAGCAACAACTAAACCTGGAGTGGAGAAGTCTAGTTCTGTTCGTGGGGCGAGTCCAACAC
CGAAGAGACTGCTGGGTGGGAATCCATTGAAGAATTATCTTCAAGGACTCGAATTGGAGCCTAAGGCCCTGAGGAAGAGCTGGGAAGGGAATATGGATTT
GAAGAGTAGAGAGAGTCCCAGATTGAGGGTCAACAAGCATGATTTGAAGCCTGAACCGAGGAGCACTTCTGTAAGTATTCTGTTTTCACCCTACCTTGTT
ATATAATGTTTCTAACTGTTGGGGTATTGGTTTAAACTGATTAAAATGTAAATCCACTTTCCCTTTTATGATTCAGGGCATAGGCTATGATTGGCTTTTA
ATGAAGTGAAATTTTGATCAATATTCTTGCAGGATTGTTTTCTGCAAGCAGCACGCCACCTTAAATTGTCATTTAATTATTTGATTCTTGATGCATTTAA
TAGATTTTGATACTCTATGTGAATTCCTTGATGGCAGGTTCCAAGAAAATCAACTAGTGAAAAATTGACTAGTAAAGAAGATAACCGGGGAATACTTGCA
AAATCATCCAAAGAGGAAAATAAGGCTCATACATCCTTAAAGAAGTCCACAAATGGAGAGCCTGTTGATGCTGATAAATCAAGTAACCAGAAAATATCCA
AGGGAAGAAAGCAACCTGGGGAAGTCAATAATGGCTTACAAGACTTGGTCAAAGTTGCTGTCAGTAATAGAATTTTAGCAGATGGAAATGTTGCCTGGTC
TTCACTCCCATCTTCTCTCACAAAGATTGGAAAGGTTTGCCATTCTGAAGTGCTTGCATTCTTAACAGCTTGATGGCTTCTCCTGTTCACTCCTTAAATG
TTATTCGTGTATATTACATCTATAACCATGTCTTACCCAGAGGTTTCTGTAGCAATTAAGACAGTTCTAACCATGTTAATGCAGTTCTTGTCATGTTTAT
ATGCTGTGGTCTCAGAGTTATGTTTGCCTAGTATATTTCCTCTTTAGTTACAGATTTCTGAAAAGCATTTTCTGTTTTCCCATTTTTTCTAGTCACCTGA
TGGTCCTGTAGTTTAAAGGTTTTTTAATTTTTGAGTAGGCATGTGCAGCCATGTATTTGCTTGTGAAATCTTATCTTATTGGGCCATTAAAGTGCATTAT
CACACTGTTACCTTTTTCTTTTTTAAGTTTATTATCGGAGATTGAACTACTTATTTGATCTCTGAAAAATACCATTTTATGTTATAGGAAGTCATGAAGC
ACAGAGACGCCGCACAGGTAGCAGCCATTGAGGCTATGCAGGTGGCTTCGGCTTCTGAAAGCTTACTAAGATGTCTAAGGTAGTCCTGCTTCTTTTTTCC
TTTTATTTTGGAAAGTAGAGATTTAAGGTACTTCTTTTTGAGTGCATTGTAAAGGTGAATTTTAAGCGCTGAAATCAGTTTATTTGCTTCAAGTTTAGAC
CCTTGAGCTAGGCAGCATGTTGTGTGTGTTGATAAGGTAATATATATCGATGTTGTGGCCTGTGGGGAGAAAACCCTGTATACAAGTTGTATAAAACCTA
AAAATGGTTCTCTACCATAGACAATCTACACAATCAGGGAGCTTGTGAGTGCACCAAAAACTAATTAAAAGGGACTTCGTGGGTGCACCAAAAACTAATC
AAAACGGACCTCGTGGATGCACCAAAAACTAATCAAAAGAGTTAGGTTATATCATATATGGCTCCACACGTGGCTTAATTCTGTATAATCAGTTGCCAAC
AAATTCGAGTTGGCACCTGGGCCTAACTCTACCCCAAAAGCTAAGCTCATGAGGGGAGGTTTGTCCAAGTCCATATAAAGACACCAATTTTTCATCCCTT
TACCAATGTGGGACTTTTTTGGATGAGCTTAGCATGGGTGAAAAGCACCACTATATTCAACAATGTGGCATTTGCACCAGGAGTTAGCTGAATGGGACTA
TGTGCGTTAAAATCATGATCATCTTATCATCGCGATGCTGTGTTTAATTGCCTGTTATGGGTAGTGTTTGCGGGTGGTAAGCTGGACCTCAGATTGGTAA
CATAACAGCTTCGATTACCTATACCCTCTTGTGGACAAGAGTAGTTCACTGTCAATTTCTCATTTTACCATTTCTTGCCTAAAATACAACAAATGAACAG
TTCCGTCATATACCATATAGGTGAGGGGCTAGTTGCTGAAAGGGACTGTCAGGTATCTGATTATGGTTAGACGACTACCACTGCTAATCCTCAACTTAGC
TTATTTTCATCTATTCAGCAACCTTACTTTTTCGGGAATAGATTATAGCTTCTGTTCATATGCATGATTCTAGTCCTCCAGTTTAGGATATCGACTCTAA
GCAGGACGGTTGACATGCAACTGGATGAGCCAGAATATATTTGCAGATAAGACTCTCCACATGCCTACTGAAAAGGTTAGGAGGATTGATTAGGTTAGGC
GAACAAAATTCTGCCTTAGAACTGATTCTTTCGTAGGCTATTTTGGTTCCAGTTTTGCTGTTGGCGCCTGTTGCCCACCTAAAAAGAAAAGTTAATGTTC
TGATGCTTCGGCTTCCTTCACTTTTCAGTACTCCAGCATGGTCCGGTCATGTGAAGAGGAATTGTGTGGATTTACCCGTAAGGAGGTGTTACACATTGAC
TATAATAGAAGTTAGGAGGGATAGAGATAGGCCGAAGAAGAACATGAGGGAGTTAATTAGATAAGGAATGGCATAACTACACAACCCTAGATAGGAAGGT
ATGAAGGTTTAAAATTTGGGTAGAAGAATAGGAGGTAGCCGAGGCAGGGACTAGACTCCTCTCTGCTCCTTCACATGACAGCCAGTTGAAATGTGTCTCA
CTGGATTTATACTCTCATATAATGAAGCCAAAATGTTTACTAGTTTGTTTGGATAGCAATATTTTCTTCTTGTTGAATGAGAAAAGTGACCACCCAAAGA
TCTTCCGCCGTGCAATTTTCAGTAACGTTTTCTGGTTTGATCATTGTTGCTTCAATTTCAATTTTACATGGTAAAAGTTGGAGTTAATATCTATAAAGTT
CTTGATCATGCTAGCAATTGCATTTTCTTAATCAGGGTGCTTGAAATCTGACACGAATAGATTTTAGCGAAAAATGATATGAGATAAATATGATTTGATT
TTCAGCCTTTGAATGTTTTTCGTCATTAGAGTAATGTCTGTTTTCTAAAGTTAGAAGGAATCCACATTGTTATGGGCTTCTTGACCGAGTCATCTTGGAC
CTTTTGTGATAACAATGTTGAATAGATCTTTTTCCAACCTGAATTACTGCAAAAGGTAAAAGAAAGGAAGGAAAAATGCAATCCAGCCGGCCCCATTTTC
CACCTATAAATTACAGACCATACCTTTTTAATGCTACTACAGTAACTCTTTAACAAAAAGGAAGAAATATTCCCTTCTAGCAACCAATGGGCCCTTCCAG
CCAATAATGTTGGTTTTCCAGCAGAAGTGCCAGAAGGGATTAAGTTTCAGCTGGATGTGGGCAGGTCAGCTTTGTGCTCCTCGATTAATTCCATGGACTA
CTTGCCACCCAAGCTGCACCGACTCTTCAATTTCGATGTTACACCCGTGTCGGATTTGAAGAGCCCGAGCAACATAGCTTGCCACCTCCCACCAACAAGA
GGTATCAGGTAACTGATGAGTCTATCAAGGCTAACACAGATGACAAGAAACCATCTAGTGTTATCTCTTGGTTATCAACCACCTCATTGACCACTAGACC
ACACCCTTGAGTGCAGGTTGCTCTGCATCTTTTTGATGCTTTTGGATGAAATTCATTTACTTCATCAAGAAAAAAAAGAAAGGAATAGTTCTGTAGAATA
TTCTAGTTATGTTTCTAATTATTCATGGTAGACTGATTAGCAAGTTAAATCAATGTGTTGGGTTAATATCGAATAAGGATTACTTTGCTATCCTACACAA
ATAGTGGATCATGGTTCTTTCTTTTTTTTTTTCTTAGTTCTTTTTATGAAGATAATTTCATTAAATGGCATCAAGAAGATGAATAGCAAAAATATACAAC
AGAAGAGTATCTGCTTATATACAAATTTTACTGAAGAACTAAGGAGCATACATTATCCAAAAGAAAATTCAATACTAGTTACAGGGGCCTGATTGAACCA
ACTAAATAAATTGATCAGACATTTAGCTTTAAGAGTGTGATTAGGAGTTGAAATCCCCTCTAAGCATCTACATTTCCTCGCACTCCAGATGCACCAAAAT
ATAGCAGCAGACATCATTTGCCAATTCTTTCGATGGATTTCCATTAGCATCCTATACCCAGCGAAGTCCAAAGACTGATAAAAATATGCTCCAAATGTCA
GCTGCTGTTGTACAGTGTAGAAACAACTGTCTCACTCTCTCAGATTCCTCCTGGCACATATAGCATCTATCACTTTCTTAATGCTTCTTCGGCTAAGGTT
GTCTTGAGTAAGGCAGCCATCACACATTGTTGTCTAGATGAAACCAATTACTTATATGGGGGTTTCTGATTTCCTATAAGCTTACATGTCCATTTGTCAA
TCAGTTCCTCGTTGGATCATAGATTTGCCATGTCCTCTTTTGATATTGTAGGTCTATCTTTGGACCCTTCCCGTTTCTAATCTGTCCTGCACCTGAGAGT
TGACCATAAAATCTGATATTTTTATAAGCAATCCCTGAAGAGTCATTTAACTCCAATCCTGGATATCCCTTTTGAATTGTCCCGGCCATGAGTTATCTTG
CCAGTACTGTGCCACATTGGTGTTTCTATTATTGGCTGGTAAAAATTAACTTGGATATACATCTTTCAGAATCTCCGGACCATGGTTCGGTTTTAGGGGT
TATTATGAACTTTCAAACAGTGGTATCTCTACAATTTGTTTGTTCATCAGTGCATCAACTGAAGTTTTTTTTTATTACACAAATTTACAACTGCTGATTG
TTCAATTTCAATTGTTCAGCACATATTCTGAGTTGAGCTCCTCGGCAAAGGAAGATAACGCACAGCCTGCTGTTGAGCAATTCTTGGCGCTGCATGCGAG
TTTGAAGAATGTTCACCTTGTTGGTGATGCTTTATCCAAGACCATATCAGCTGCTGGTTCAGAATCAGATCATGAAGAAAACCCTTCTGAAGAAGCACTT
AAGGCTGTATCAGAAAAACGGAAGCAAGCAACTCTATGGGTCAATGCTGCGTTGGCTACCAATCTGTCATCATTCTCAGTGTATAGCAAAAAAGCAACTT
CATCTCCAATTGCCCCTTCAGCTCCCTCGCCAAGCCCAAAGACTATCGCTCTCAATCAACCTATGCTAGTCCTTGATAACTCAACCAAAAGTACTCTTGC
AAAACCTCAAGCCAAACCCCGCCCGACAATGAGTTCTAAGATTCAGTCATCAGGATCTCAACGGCGCTTAGCAGATGGGATAGCTTCTAATCAAAAGCCA
AAATCTCCTCCTCCAGCGGATTGGGTCAGAGGAGACGGTCTTGAAGAGGCTGTTGACTTAGCCGAGATGTTACGAGTAGCGTCCCAAGACTGGTTCTTAG
GATTTGTAGAAAGGTTCTTGGATGCTGATGTTGATGCCTCAGCTTTATCAGATAATGGTCAAATAGCCGGCATGTTATCCCAGCTGAAGAGTGTGAACGA
CTGGTTAGATGAGATCTCCTCTAGCAAGGATGATGAAAGTCCCCAAATTGCTTCTGAGACCATCGATAGGATAAGAAAAAAGATCTATGAATATCTTCTC
ACTCATGTGGAGTCTGCTGCAGCAGCTCTTGGTGGTGGCAGTGGCGGTAGCTCACAAGTGCCACCTACAATAGAAACCAAAACGAGAAAATGAGTTCTAT
TGCATAATGCATACTACTAGCAACTCACCTTTCATATTTGAAGCATGCTCCAATAGTCCTTCAACCGCCAAGTGGTTAAAAGAGCTGAAAGTTTTAGGAT
GTGTATAGATTCTAAAATTGGTCGAGGTAGAGTAGTTTAGTATATATATTGTGCAGACAGGGAGTTACATGAAGTTCAAGATTTCCTTTTTTCTTTACCT
GGAAACTTTTTCTCATAAATTATGACTAGCTCAAAGTCGTGAGTATATACTTATGTGAGTTCTGGAGAAAAGGGAACATGTCCTTTCTCCTTACCTTGAA
CGAGTAACAATGAACTTGTTACTGAAATTAACCTTATAGTTTGATTGATGACGTTATGCATCTCAGTGTTATCATTTGAAGTAGGAAGTTGTGGACTTGT
TGGAACTTCAAGGTTTTCAAGTTTCTTTCACAATCTTGCTAGGAATGACGGAGTGAGCTGTCCAAGCTTGGGTGGACAGAGTTGCCTGGTACTTGTGCTA
GTTGGAGGTAGCAATTTGGCGTGTGACTTCTTAGCTTGCTCGAGTTTGAAGTGTAATAATTATTGTAGTACCAGTAAAAGATTAGCTTCAGATCATGTCC
CATGTACTTATTTTTCTAATAACAAAAACCATATTACAACTGAGACAAGGAGTAGCAGATGACATTAAAATGATCATACAGTAAAGATAAGATTGAGAAG
TTCTTATTGGCATCCCAGTGGTAGACAAATATAACATATGTAGCTCTATGTAAAGGACTAATCTTGGAAATTGCAGGATAATCGTGGCGGTCCAAAGCAC
ATCTTGTTAAACTCAGGTGGATGAGTGACTGCAAGATTGTTCAATAGGAACTGGAGGGTCTGAGAAAGAGCCATTGAGAATTGATTTGGCTAACCAGACA
TTTGCAGCATCTGTGTAATGTACTCCATCCCAGCTAATGTACTTTGTGGGATCACTACATGCCTTCCCATGCTCTGTGCCATTCACTATAGCTGTCTGAC
CACATGCAACTTCAGAACCATTATTGTACCATCCACAGCAGAATTTCAATGGGTCTCCAAAACCTGTTTGCCCATAAAAAACAAAGCATAGTTGACCATA
TTAGTTTAAGTTCTATGTGCTGATAGTTCAAAAGATATTATATAATCAGCTCACTCATAAGGTAGCTCAAGGTAAATCTCTATGATAACATTCATAATTG
TTAACCTGATAAAAATAGTTACAAACTGGTATAATAGGTTATAAATAAAACACATTGATTGTGTAAACAGAACTTTCTATAAGTCCCAAGTTCGACCAGT
TGAATCAATCATTGATGCTTGCATCAAGGTAGATTGCCTACAGTTAGGGTACGTGCCCTTTCCCAGGCTCTAAATGAATAGGGATGCTTTGACTGCAGCA
GGCTGCTCCTATAACTGTAACTTCTAGGAGGAAATCAGCATAGGTTACAGTTTTGTTCATTCATTCAAAGAGTAGTGGGGTTTATTAACAAAGCAATAGA
AATTACCTTGTTCCTTCGCAGAGCTAATTAGTTGATACTTAGCTGAATAAATGTCAACATAAGTAAATGCAGCACCAGGAAGCTCTGCTCTTAAGTGTAA
TATCCTGTCCTTGAGTTGCTCGTTAAACTCACGAGCCACCTTGTTTTCGTTCTCTATGCACCCAATGCCATCCAATCCCTGAGGCTTCAATGGATAATCT
ATCACACTGTAGGGCAAACAGCCAATGGGACCTGTATTGTGGATCCAGAAATTCACAGCCCCTTCATAGTAAAGTTGCTGCACAAATCATGTATATACAC
AAACATTAGTAAGAAAAAGAAAAAAGAGATTCAATAATCAAAAGTTAGTATTTGTCTCCCAAATGTGTAGCATCTAAGCCAAATCCCAAGTAGAAAAAAC
ACGAGAGATGTTAGGTATATAAGAAAGCAAGCCTTATGCCTTAGTAACGCGTGTTAAGGATATGGTGGACACTGGACAGTAGGCTCAAAACCATATATAA
TGAAGGATGGTCAGTTAAACACCCTTTGTGAGAAATTTATACTATGTGTATGAGCTCTACGAAAAAAAAGAAAGAAAGAACATACATGAATTGCTTGAGT
AAAATTGTCTATGATTAGAGGAATGGATGCTCTGACTTGTGCTTCATGGGTATATTGAAAACCATAAGAAAGGTCATTCTGTCCAATGTCAAATGTGTAC
AGTGCCTTTGAAAAATCTTGTGGATTTGCAATGTTGACTTTTGAAGAAGACCATTTTGATTTATTTGGAACTGCATCAATAATGTCAATAACATAAACAC
TCATACAATGTAGATATTAGTAGAAAATTAAGACAATGAGAAGTTAAAACTCACTTGATAAATCAGAGAGCAACATAGTCCTTTTTTTGAATTGTAAAAA
CTGAGAAATTTGAACCTCAAGGCTAAAAGGACTATAACCACCAGGAAGTATAGATGAACCAGCTGTTGCAAAATTTGCACCATTTCTAAAATTTGCCATT
ACTGAATCTAAATATGGACTCAAGTACTGTAACTCCAACCTGTCAGCTACAACACCATGAAAAAAAAAAATTAACAACTTGAACTCGTGATCTCCTGATC
AAACACGAATAAGTTTTACCTATGAGGTCTATGATTAGACGACCATCGCACATTCTGCCCATGGGACTGCCAAAGAAAGTTAGTCCATTCGGTGGAGGCA
CTTGACGGAATGCTGCTGATTTTCCACCGGTATCCGAATTCGAGTCACCAAAATTATATATTGCTGGAAACACACACTTGTTACTAATTTCTCCATAAAC
TAATCCCAAGTATAATAGTAATGCTAACAATGTTAATACTAATTTCTCCATTGTGTAGTTGGTTGGTTTTTGAATTTTGTAACAAACTCCTTTTATCTTC
AAGTTTATATAAGATAATTTGCTTGCTTGATTAGATAATGTCTAGGCTCCTTGTATCATTTGAAGATGAATTCTTGCATCTCTTGACAGACATGCATCAT
ATTTATAACCATAACTATCAAACTATTAATACGTATGGCCTTAAAAAAGGCATTTTGAACTATATGCAAGTAACGTTTTATATTTATTAAGAGTTTTCTT
TTGTTGAATTACGATAATTAAACGTATATATAACTCTTCATATATGAGATTATCCAGTCAAGATTTTGTCGTTAATAATTCCATGAATCCCATTAAATAT
GTAATTAATGATTCTCAAATGTGATGAACTATGTATTTATTCACAAGGATGTTAGTAGACCCTTTTTTCAGGTTTGTTATTAGATAAAGATTTTGTAATC
TGAAATATGCAGTAGTTAATATATTACAACAACAATAGAGAAGGAAATGAAAAGCTGCATTTTTCCTTGTCAAGTTTTAGTTACAAACTTTACAGAACTC
ATTTCATACAGAAGCTTTTTTGGCAATATATTCTCAATTCATAAAACTGTTTCTTGTGACTCTCAAGGAGTGAACATTATGCCTAAGCAAATGTACTCAG
TGACTAACTAATAACTCTTTTACCATATCGATTTATTCTGCTATCGACGGTTCTTTCTCTGGTTCAACCTCCAAGGGCTCTAACTTCTCTGTTTTACCAT
CTTCCTTTGGAATAATAAGTCCATAACCCCCTTCTTTTCGTCTGTAAACGATGTTAATCTCACCTGCAACAAGCATAAAATCATTAACAAAATACCTTGA
AGCATTTAGAAAACTGTTTATGATGTTGTAAGGATGTTTCTCAGTACCAGTTTCCTCATTCCGGAAACCATAGAAGTCATGGTCGACATTTTCCAGCTGT
TCAATTGCTTCATTGACACTTAAAGGTGGCATGTCAAAGGACTTCTTACGAACAACCTGAAATAAAATATGAACGGAAGTGAATTTGAGAACAGAATTCT
GGAAACATTAGGCAAAATACCCAGTAAATCTAAATCTAAGACATTATAAACCATTAAAATGGTTGTTTATACTCATTTAGCGAATGTAGCAAATCTTGAC
GATCAGATCATTACATTTCAAGCTAGGATTTCGAGGGTGATGTCTAATAATGACTTGGTGCATCATTTAGTATTCAGCAGAACAGGCAGTAAAAAGCATA
AAAGGGAAGAGTCGAAAGTGATCTACAGTTCTACATCCACCCGACAGACAAGATTTTGTTCACTTAAAAGTGACAAAGCACGTTTCGTTGCTTGGGGAGA
TTGACAAAGCATGCTGTGAAACAACCGAGGCATTTATATCAAGAAGAGATTATGAATATCTGGCTACAGCATAGACTGCTCGGTTTGAGTTGAATAAAGA
CACAGGCATTTGATAGGCAGTGAGGGGATTTGGAATGGTAGAAACAGAAAGGACAAGTGTGTTCCATACAAAAAAAAGACAACCTTATTCTGGAATGGAT
ATTACACCTGTAATTTAAATTAACACTGTAACTGTAAAGATGAGCCTAATGTACATGCCTCAGTATTTGGCAAATACAACAAATGAAGAAGGGGAGTTCC
AGGAGAAAATGGGCAGGGGCATCTGCTATCACATAACTTAAGATCAGAAATCAGGATGTTTTAAGGCATACGCCAACCCTGTTCATACCTATGTTGCTCG
GACTCTTCAATAATGTCAAGGGGTGCGTGTCGGATTTGCCAAAAGTAGTGAATTTTTGGAGAACCTGAGACGGGTGCGGCATTGAAAGTGAAGAGTCCGC
GCAACTTAGGTTCATACTGCTATAAAGGTCACCAGATCTTCGTTCCTAAATGGTATTTCAAATGCTTTCTAGGTGAACCATTATAACGTAAAATTTCGAA
GTTTTTCCCTTTAAAGCGAAACATACCATACCTCCACAACAGCTAACAGTTATCTCCGTTCAAGATACTTGCTAATTCAAGGACTGGAATAAAATTTAAA
AACTGACACAGGAAATGAAGTCTAATATTTTATCAAGATCCTAGATTACGATACCCAAATATTGTTCCACCCATCAATTCTAATTCTACTCTGATCCACC
ATAAACATCAAACAAAAAGATGATAACCATCTTATTTATCATCGCATAATCACATAGTCTTGTTCCTGGTCTCTTACTACTTCTCTTCTGTAATACTCTA
AACATATTATGGAAGAATAATAGAACCGGAGTATGGCATCCAACGTCAAAAATGGAATACACATTAGCAAAACTCATTCAGATATTCTACTCAGTTAAAA
AATATTAATTGGGCAAAATATCAATTGCCAGCACCAGTAAAGCCCTTTAGTCACAGTGAAAAACATGTATCCTCGCTGTTGCTAGGAATTCAGTCAAGTC
TAAGCTAAAAGGCCATGCAAACTTGTAGTAACCAACAAAATTGAGTGCAAGAAGAATATTTGGCAAAACATATAAGTTCAGAGACAACCTCAGTAACAAA
GCCATCACTCTTGTCATCTTCAACTTCTTCCTCTTGGGAAAGTGTTTCAAGATCCTCTTGAACTAACAGCGCCTCTGGGTCCCTGACTTTCAGCCTATCG
AAGCCCTTCATGTGGCGACCACGGTCTGAATCCTTCTCCTTAATTTTCCGCAACTTTCTCTGTATAATTGATGATACCATATCTATACTTCCATAAATTG
ACTCACCGTCTTCCTCTGCACGAATCACTCCATGCTTTTTCGTAAATAGAGTAACCTATAGTTCAGGAATGTCAGTCAAGTAAATTTTGAATGATAAAAA
TAATAACAAAAACCTAATGTAATGAATTTTCAAGTTTTGGTGCACACTTCACATCTTCGAATTTTTGGGCCTTTTCCAAGCTCTCCACCTCGAACAGACA
GCCTAACATCCACTTCCCTGGCTAGATGGCTGTGCTTTTGAACTGCCTTACCCAACTTCTCTTCCACATAGTCCTTTACAGCAGGTGTTAACTGTAGTTG
CACCACGACAATAAGTCACCACCATGAACACTTTAAAAGCAAAAAAAATAAATTCCATTTGAGAAATCAATCTGCTAAGACTTGTTGTTTCATTGTGAAC
TAGCTATTGAAATGGTTAAAGTCCAACAAGCTAATTTTTTTGATGTCAATTCATACGTATTTTTTCTACAACAGCTACAACACAATCGCAATAAGTTTGC
TCAGCTATATGAATCCTCATTGACCATGTCCCTTCATTTAAGATCATCTCAAACTAACATTAAGCAAAACAAAATTAGAAATGACTCAATGAGTAATAAA
GATACTAGAAGCTCTCTATATTTTCTTCTCTGACAAATTAGAGAACCAATAGAAACACAGAACATGACTAAACTATAAATCCAACTAATTGCTATCACAT
TAACAGATTTTTCTTTCATTGTGCCCTATTTTTCACTGAAATGGTAGATCCCATCAAAATTAGATTTTGATACAGAGACATAAGATGCTAAAAGGTACTA
TTAAGTACGCAGATCTTAGTCCTACTTTTTCAGGACACACAGGTTGTTTCTGATAGACCTTATAGCACCTGAGCAGTCATTTGATAGAGGAGTATATTCA
AAATCAATTAACTATTTTTCAGAAAACCCAAGTTCCTATGAAGTACACTTTAGCAGATATAAGCAAAAAATGCAGGGAAATAATAATATTGTAAGGCCTA
AGGAGTGTGACCTCAAGATTTTTCCCTTGAAGAATGAGTTTAACAGAAGAAAGTGGACCATCCCAAGACATCCGGACCCCAAAGGATTTTGTCACCCTAT
TCCTGACAGGAACATTAATTTCATTCATCTTGAAAGCTGAATTTAAAAATCGTGAATTGGTAGATGACAATGTCAGTGACAAAGCTGGAGAAGCAGTAGC
GGGACAAGAAGAAGAATAGGATGAGGAACCATTTGGGTAGCTATGGAGAGAGTGAAAAGTTGTTCCCACGGAAGGGGAAAGGGAAAGAGTCGCCATTGTT
GTATATTGCAGGAACAGTAGTAACTGGAGATTTTTGAGTCAATTTATCGATTTAAGGAGTAAAACACTTCAAATGGGTTGATGAATTTTGTGGGTTCTTG
ATAAAGATTGGAACTTTGTAGGAGAATCACAGTTGCTTTGTTGCTCGGTACAGTAGTGTGGGACTGATGAAGAAGAAGAAGAAATGCGTTATCCAAAATG
AGATGATGGTTGACACGTGACCTTTGCATAATTTGCAAGAATGGTCCCCGAATTTGTAGTCAAATTTCATTTCTCATATATATCTAAGCTGACGTGTGAT
CACGAGATATGGAAATGGATAATATTCATGCCCATTTAGGAGGGCCCAGCCCATCCTTGATTTTTTCATTTTATTTTTTTTTGAATATTGTTTAATTTTG
AAGAAATATCTACTAATAATAAAAATGGAGGCAATTTAGTAAATAATATCTTGTATTTATTAATTATTTTTTAATGGATATGGAAATAAAGCTAAAACAT
ATTTATTTTGGGACCAATAGAATATATATAATAACCAAAAATAAAGGTGAGATGAAGCAAGTATACAAATATAGTATGTACGTATACATACATAAATAGA
AAGGGAGGGAATACCTATCGGTTGGTCTAAAGGTATTCAAATACAAACCTTTGGTTTAATCGAGTAACTTTCACATATATATAAAATTATATTTGTATGT
TCTAGTTATAGTTTGCATAATTGTGTTCCATAACAAACATAAATAGGTATATTTTGTTATATATATACAAAAGAAAAATAGTTGTTTAATTTCGCTATAC
ATATATAAAAGAAAGTAGTTGTATAATCTGCTTTGGTATACATATACAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAGAGGGAGTATATCTTATTATATTATCGAAATCAACGATCCTTTCCCGT
AGCACAAATGGAGGAGAGAAAAGATTATCTGAGAAAGTTTACTAATTTACCGAGTATTAAGTTAGAAAGTTTCTATTTCGCTATTTTATGGATAGATATG
ACATTGCTAATATCATTCTCTCTTTTAAAAAATCATGCAAAATTTTTCCATCAAATTAATGATTGTTTCGTGAATAGCCTGGATATTGACGAATCCACAT
TTCGGAAATCGACCTGATTCCTAAAAGAAAAATTAATCTTGTTGCTTCTATGGTAGTTCATCTCACATAACAAAATGGCGGCGCCATTGAGCCAAAACTT
TAACGAAACGAGCAAAGAGAGATTGATTCCCAAATATTCAGAGTATGGATTGGATCCATCATTTTACGTCGAACCCGAAGGATTTTGGCGTCGATTATGT
AATAGAATTAAGAAATCAGGTAGTAATGTTAAACAGGGCTATATCAAGGCAATTGATATGGGTCGTAAGGATCCTCGAAAGGTCATTTTTGCTGTTAAAA
TGGGTTTAACTCTTTCCCTTGTTTCGGTTGTCATTTTCTTCAAAGAGCCCTTATCCTATATTGGTACATATTCCATTTGGGCCATCCTCACTGTTGTCGT
CGTATTCGAGTTCAGCATAGGTATATTCAAATTTTATTTCATATTCCAATGATTCACTATTTGAATAAAAATGAGAATTAGTGTTCAAGTAGTAAAAGGC
AAATGAGCCTAAATAGAACCAAATGATGATACTTATGGCCAACCTGAACTACTTGGGATTGAGAAAGCGGATTTGTATTGATTAATATGTACTCGTATTT
AATTATTTAGTCCTGTTAGTCCTAACTGGTTTTGGGATTGAGGCATGGTTAATATATAGCTCATGTTTACGCAGGGCAGTAAACAGTTATCATGAAGTTG
ATGTGACACTTTAACCGTCTATTGTTCTTTTACATTAATGTATGTTACTATTTGAGTCTCCGTAGCTGATATACATAATCTGATTGATTTACAAAAAATG
CTAGGTGCGACACTCAACAAAGGATTCAACAGGGCTTTGGGGACATTGTCTGCCGCAGGACTAGCTGTAGGCATTGCTGAATTATCTGTTATGGCTGGAA
AATGGCAGGAGGTTGTGATTGTGGTCAGCATTTTTGTTGCAGGTCTCGTTTGAATTTTCGAATTTTACATCAAGAATATCTTTACTGTTGTGCGGAATTT
GAGATAATACGAGAAAATATAAACGCGAAAAACAAGACAACAGATTTACGTGGTTCACCAATAAATTGGCTACGTCTACGGGAAGAGAGGGAGCAGTTTT
ATTATGGAGAGGCAAAAACAGAATTACAAAATAGGGTTTGCCGTAGCGGGTCCGATTCAAGGCATTCAACAAATCTCCACCTTGACTTGAATTCTCCGAA
CAGATTCTTCAGACGCACTATGATAGTGCCAGGCCTCCCCCTCTTCCTCAGAGTTGCCCCGCAGGGCAATTAACAGCTTCTGATGTTGAGCAAGTCCAAA
CAGTGTTGAAACTTGCTCTGTGGAACCGACTTTGTGAACATATCAGCAGGATTATCAGCAGTTCCTACTTTCTTCACCTTGATTCTCTTCTCACTTCTCA
GAAAATGATACCTTACGTCAATATGCTTGGTTCTCTCATGATGGACTTGATCCTTGGCTAGACAAATTGCGCTCAAACTGTCACAATACACCGTAGCCTG
ATCATGACGCAGACCAAGATCACTAACCAGCCCTTTCAACCAAATCCCTTCTTTTGCAGCCTCTGTCAAGGCCATGTACTCCGCTTCCGTAGTAGACAAA
GTCACTGTAGGTTGCAAAGTTGCCTTCCAACTGACGACAGATCCTCCAAGGGTAAACACATAGCCAGTCATCGATCTTCTTGTGTCAACATCTCCAGCAT
AGTCTGAATCAGAATAGCCAGTAACCAAGCACTGAGTATCACCTCCATAAATGAGACCAACGTCAGATGTACCTCTAAGGTACCGGAAAATTCTCTTCAC
AGCCTGCCAATGTTCTCTCCCTGGTTGTCCCATGAATCTGCTCACTACACTGACTGCATGTGCTAAATCTGGCCTTGTACAGACCATAGCATACATCAAA
CTTCCTACGGCACTGGCATAAGGGACTCGTGACATGTACTCCTTCTCTTCTTCTGACTGTGGAGCGAACATGGCAGTGAGATGGATATTGGCAGCACTGG
GGGTATCAATGGGCTTAGATGAAGACATGCCAAACCTCGCCAAGACCTTCTGAATGTAACTTCTCTGTGACAAGAAAAGTTTCCTTCTCTCTCTGTCTCT
AATGATCTCTATCCCTAAAATCTTCCGAGCGTCTCCCAGATCCTTCATCTCAAACTCAGCACTAAGTAAACCCTTCAGCTTCTGAATGTCATACTTCTTC
TTTGCAGCTATCAACATATCATCTACATAAAGCACCAGATAGATGAATGAATCATCTTTGAGCCTATTGTAGTAGACACAACAATCATATGAGCTCCGAG
TATAGCCCAACTTCACCATATAACTGTCAAACCTTTTATACCACTGCCTTGGAGACTGCTTAAGTCCATATAAGGACTTCTTCAACTTGCAGACGTGATT
TTCCTTCCCTGGAACTTGGAAACCATCCGGCAGAGTCATGTATATCTCTTCCTCCAACTCTCCATGTAGAAACGCTGTCTTCACATCAAGTTGTTCAAGC
TCCAGATTCTGATGTGCAACTATCGCTAGTAACACTCGGATGGAAGTATGTCTGACCACTGGTGAGAAGATCTCATTGTAGTCCACTCCCTCTCTTTGGT
TGAAACCTCTGGCAACAACCTTGGCTTTATACTTGACTCCTTCTGCTGGTGATATACCTTCCTTCTTCTTGAAAACCCATTTGCAAGTAATAATCTTTCT
CCCCGAAGGCTGTATGACCAGATCTCATGTCTGATTCTTGTGTAGGGACTCCATCTCATCTCCCATAGCGGCAAACCATTTTTCAGAATCAGAACTTAAA
ATGGCTTCTTTGTAAGTAGACGGCTCAGATGTATCTACCTCTTCAGCAACCTGCAGTGCATAACCCACCATGTCCTCAAAACCATACCTCGTAGGTGGCC
GAACTCCAACCCTCCTTGGCCGATCTTGAGCTATACTCTGATGGATATCTGATGGCATAGATTCTGGAATATCAGTTTCTGTCTGTGGCTCTTGATCCTC
CTCTTCAGGTTCCTTTAAATCGCTCTCGTTCTGAATGACTTGAAACTCCACCTGTTTGTCAAGACTCCCAGTTTCTGACGTAGTTGTAGGCTTCACAATG
GTTCTAAGCAGAGAACTTTCATCAAAGACAATGTTCCTGCTCATAATAACCCTCTTTTCTGCTGGAGACCAGATTCTGAAACCTTTCACTCCATCTCCGT
AGCCCACAAATACTCCCTTTTTAGCTCTTGGTTCTAACTTACCTTCACTGACGTGATAGTAAGCCGTACAACCAAAAGCTTTCAGATTTGAATAATCAGC
AGCTTTTTCTTTCCGCCGTTTTTTCTTCCCTTTCCGCTACTGGTGAACAGACCGGAAGGCTGTATGTCCGTACTTGTGCCGTTAGCCTTATGTCGTAATT
CCCTGCTATGAAGGGCCGATCTGACTTCTTTCAGTGACACAGTATCTTTCCCAACAATGAACGATTGAACAAAATTCTCAAACGACATTGGGAGAGATAC
TAACAGAATCAGGGCAGCATCTTCATCCTTGATCTTCACATCGATATTACGCAATTCTAATAACAAAGTATTCAATTGCTCTAAGTGTTCCCTGAGTTGT
GTACCTTCAGCCATTCGTAAACCGAATAGACGTTGTTTCATAAGCAGCTTGTTGGTTAGAGATTTTGTCATGTACAAACTCTCCAGCTTCAACCACAGAC
CAGCAGCAGTCTCTTCATCCGAGACCTCCGTGATGACGTCATCCGCGAGATACAGCATGATCGTCGAGTGCGCCTTTTCCTCCAGAATCGCCATCTCAGG
AGTAACGACGGCGTTCTTGTCTTTCGACAACGGCGCCCAGAAGCCTTGCTGTTTCAACAAAGCCCGCATCTTGATCTGCCATAAACTGAAACTGTTCCTC
CCTGTGAATTTGTCGATTTTCACGTTCAAAGCAGACATCTCGAATTCTCCAAGAACACCGATTAACCGAGAGGCTCTGATACCAATTTGTTGTGCGGAAT
TTGAGATAATACGAAAAAATATAAACGCGAAAAACAAGACAACAGATTTACGTGGTTCACCAATAAATTGGCTACGTCCACGGGAAGAGAGGGAGCAGTT
TTATTATGGAGAGGCAAAAACAGAATTACAAAATAGGGTTTGCCGTAGCGGGTCCGATTCAAGGCATTCAACATTTACTTTTGCAATATGAGAAACTTCA
GACACATCGGGTTCAATCTTATTTCAAAACTTAGCAATTGAACAGTTGAAGTGTCAATCTTTCTATTCATTTAAGAAGATGGATTTCTTGCTGCTGCGAG
TAGAACGATAAGATCATATTTGAGAGGAAAAGGAAGTACACAAGTCTAAGAATCAGTCTCGAATCTTCTCCATTACCATTTTTACTAAGGCTACATGAAG
CACCAAGTAGAATTACTACTTATTTCTTCTCGTATGCATAACCATTAAACGGACAATCCAATAACACGAATAATGCATAATATAAAATTGAAAGCAGGTT
TGTACATGGTTACTACATGGCCAAAATCAAGGAAGGTGAACTGTTGCATATGTTTGAGACTAATGCATATCTAATGTTATATTCTTTTACCTGTCACTTC
CTCTCCTTGTGTGCAGCTTTGGTCTTATTACTTTCTCTTTTGATTTTCAGGTTTTCTTGCAACGTACTTGAAATTGCATCCTGCAATGAAGCAATATGAA
TATGGTTTTCGGGTATTCTTGTTGACATATTGTATTGTGCTGGTATCGGGAACTTCACATTTTTTTCACGCAGCTGTTTCGCGATTGTTGCTAATTGGAG
TTGGTGCTGGTGTCTGTTTGCTTATAAATGTTGGCCTCTACCCTATCTGGGCTGGTGAAGATTTGCACAAATTGGTGGTAAAGAATTTTAAACGTGTTTC
TACTTCTTTGGAAGGTGAGGAATTTCCTCAATATTCTTCAAATTGTCTTTGAATTTGTTGTCTCTAGGCTACTGCTTAACTGAATACCTGTAATGCTTCT
TGTTAGGTTGTGTCAATGGATATCTGCAGTGTCTTGAATATGATCGGATACCATCAAAAATCCTTCTTTACCAGGCCTCTGATGACCCTGTGTATAGCGG
ATACAGGGCTGCTTTGGAGTCAACAAGCCAAGAGGATTCTCTGGTGTTCATATATTTTCATTGGTAAATTTTGGGATAGTACACTATTTCTTTTATTACT
AATTTTCAATATTCCTGGTGCAGCTAGCTTTTGCTGAATGGGAACCCCCTCATGGCCATTACAAGATGTTCAATTATCCGTGGGCTGATTATGTTAAAGT
CAGTGGTGCGTTGAGGCATTGTGCTTTCATGGTCATGGCTATGCATAGCTGTATTCTTTCAGAAATACAGGTAAAGCTTCAATCTTCAAATCCTGCTTAA
CACTTGCACATCCTATTTTATTGCAGATGCTTTTAAAATCATGGACTTGTTTGAATTAGCTGATTCATTTTTACTACTAAGAACTTACGTTTTTATATCT
TTTATCAATTCCAAAGGTAGATTTTTCCTTTTGTAGGCAGCATCTGATTTGAGACAAATCTTCTGCAAGGAGATCCAGAGAGTTGGGATTGAAGGAGCTA
AAGTATTACAACACCTTGGAGACAAAGTTGAAAAAATGGAGAAACTTAGCCCTAGAGACCTTCTCGAAGAAGTTCATGGGGCTGCGGAGGATCTACAACT
GTTGATTGACCAAAAATCTTATCTATTGGTTCAGGTGGAGAACTGGGAAAATGCAAAACAAGCTAACCAGCTTGGAGATCCTGAACATATTCAGGAACTG
AAAGACAATGAAACTAAAGAGATGGGGATACACTCCTTTAGTGAAGCAGGCTTCAATCTAAGGTCTGCTCATACATTGAAACACATGGATACTTATAGTC
GAAATTCAAGTATGAATATCTCTGGTGCACAAATGTGTTCCACTGGAAACGTGTTCAATCAGATGGTGTGGCCTTCACGACTTTCAATTCTTGGAGATGT
GATTCTAAATGAACGTGAAGTACGTACATTTGAAAGTGCATGTCCATTGTCATTGGCCACTTTTACTTCCTTGTTAATTGAGTTTGTTGCAAGACTTCAA
AATCTTGTAAATGCATTTCAACAGCTTAGTGAGAAGGCAAAATTTAAGGAACCCGTAGATGCAGCAGAGGCAGCGAACTTCTAGAAATTTAGCCGAGAAA
ACTCAGTATCACAAGTTCTATTTGTGCGAATGCTCATCATGAAGATGCTATAAGCAGAACATCACTTAGGTACTGTTCTTAGGAAATGGATTTTTTGTTC
CAGGGCTCGAGATCACATAAAAACCGATTTGTTGAGCCAAACTAGAGAATTCATGTAGATGTGATTACTGTAGTAGACATAAGTTATTGTTTCATAAATA
ACTAATGCCCAGTTGGGACCTTTTCTTATGTATATTATGAAAGCTGTAAGGCTTTGATGAATTATTATCTGGAAACTGAAGTGGTTGTTATACATGAATT
ACAGATATTAAATTGCTTATCAGATATTCACTTGAAAGTTTTGAAAAATCATAAGCAAAAGTCATCTGTTTTACTTCCCAATACCTAATGTTGACAAAAA
GTAGTTCTTTTTTCTTAACAAGTACATTGTGGTTTCAAGGTAAAAACTTACCGCCCATATTATTCTTACACTAAAATCATAAAACTAAAATAAGCGTCTT
TTGATATAAAACCGTAACTGTTTAATTGCTTGGTCAGAATATAAATTATCATATATTTATTTTATATCCATTTAAATATAAAATATACTACCTCCATTTT
AAAAAAATGACATGATTTGACTTGACAGAGAGTTTAAGATTATAAAGAAGACGTTGTGGTCCTAAATTAAAATTAAATTAAATGTACAAAATCACCCTTT
GATCTTGTGATCTTAAACATGCCATGTGAAAAATTGAAATTAAAATGTTACAAAAAAAACTATCTTTTAAAACAAACTAAAAGAAAAAATGGTTCCTTAA
AACGGAGGGAGGAAGTACTAATTTATTCTTGATAAAATTATATGGATTGTTTCTCGTAAATAGTGTGCACTTTCTTACCATTAGAAATAATTATCTTGAA
TTTGTACCGTGAGTCAATTATTTTACTATTTAGCCAAATAAAATGAAGACGATTGGATTTAACGCCCAGTGAAGCTCTGACCAAAGAAAAAAAAAGAGAG
GTGGAATGGCTGGTTCTGCTACTGCTCATGGCTTCCCAACTAGCTTCTTGCTTTCTCCTCGCAGCACGGGACACTTTACTTATTTGCTATCATCACTACA
AATTAAACCTAAAAGTAGCAATTTCAACTTGCTCAACACTTGCCCTTTATCGCATTTATGTTCATCCTCGGCTAATGGATCTATCACGGATGATAATTTT
TTCCAACAAAACAAAAACTTAGATGTCAGTCTCTCTCTCTCTCACACACATATATTGCGTTCTTCTATTGATTTTTTGATTAATATTTTTTTGTTTCCTT
TTCTGTGTGGGATAAGAGCCAAGAGAGCAAAGGGTTTTGGAAGAAATGGAAGGTTTGGTAAACCCATTATTTTTTTTAGGATGATTTGGTGAAAACTGCT
TTGACGTTGTGTTTTAATCAGGAGAACTCAGCGGAAATGAGTGCGAAGGTAGCAAAGCTAGGGCTTGCGGCAGTTCTTGCTTATGGCATTATTGATGGTG
TCACATACACTAGTTTCTTTGTGCTTGCATTTATGGGCTATGAGAAGACCACCGGCAATAATCCTGCTGCAAATCTCCAATCTTTGTTGGGGGTAAGTAG
TAATTCTTAAATAGGTATGAAATATGCAATTGATAAAAGGGGGGAATGGTTTTTGCTTTGATTTAGAGAAATAGAGACTTGATTTCCTAGAATTACTTCT
CTTTTGAGCCAAGGGTCCTCTCTACCTCCACAACGATAGGAGTAAGGTAAGGTTCGCATACATCTTACTCTCCCCAAACCTAACTTGCGTTGTTGTAGAC
TTGATTTCCTGAACTTTTTAGTGCAAAGGTAAAAGGTACCATATTATGGAAATATGTGGTATTTACATTTAGGATACTGGATGAATGCTTATCATAGCAT
TTTCATTTGTCGTAGAATATCCACTTCAGTATTTACATACCGAAGTTGTCTTTTCCATTTCTTCAGATCAAAGTTAAGACCATCTTTTCCTTTTCACCAT
ATCGTGAGTTCCTTTATCTTAGATCTAATTTAATGTCATTCTTCTCCTCTTTACCAGAAAGAGCATCCAGAGTTAACAATAATACTAATGAGAATCATTT
AGCAACTATAGGGAACTCGGAATTTTCATGGTGCCTCGTGTCAATCTGCACCTTACTTCCCCATTGGACATGTGCTATTTTAATTGAGCACTTTTGTATT
TTCATTTCTCCTTTGCTCAAAAAGCACTCTTCATAACGGCAGATTATAATCGCAATGTGGACGGGAAATAATGTGACCAGGCCATTTAGGGTTGCAGGAG
CAGCTGCTCTGGCACCTGCCATTGACAAGGGACTAAAGAGAATACAGAGATACTTAAACTTTCCAAGTCTTGTATATGCTTTTGCTTTAGTGGTGACTAT
AGTTGCTGGGACATGTTTCACCATTATTGGTTTACTCATCCTTTCAAGATGGGGAAAGTGAACGATTCCACCCATAAGTTAGCTGGATATTTGTTGTAAT
CTGTTGAGTGTTACTTGTATCATTGAGATAGTCCTCTGACTATATATTTTTCCACTTATATGGTCTCGTAAAAGTAGTTGGAAACGTGTTTTTAGTTAGT
ACACAAATTTCTAAAGTTCAGAGTTACTTAATTGAATGACAAGTTAATGTTATTATATTTGTGTTTCTCTGCAAAAATAAATGCCCAAATATAAGGTTAA
TCGAAAAATACAATTCCCTATAGTGCCTATTCCTACTGTTTCATTTATGTTACCGGTATTTTTGCTTCATGCACCTACTCTGTTCTTCTTCTTCTGAAGT
AACCTTATAAATAGGGTCTAACTTGAAGTACAATTGTGATGAGGTCCAAGTATTTTAGGTTGTTGCCTTATTGGGTTGAAAATCCAACGTATATTACATC
TCGTAGTTCCTTCTGTATAGATGTGCATTAGTAGAGGACTAGAGGCTGTGTTGGATCACCATCCAGCATCCAAGACACATAAATATGTACACTCGATCAA
AATAGTTTTCTAAACTTGTAAATGAAGATTTTAAGTATTTATATCTAGTTGAAGCTTTAAAGGGAAGCGGTAGATTCCAATGGTAGATCTTAGACAGCAT
AGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNGGGAGAGTTGATTGCTTTGTGAACTATTAGTTCCATAAGCTCCAGTGACTATTTCGCAGACCGAGTAGCTAATCCTATTACTCCATATTATGAGCACT
CAATCGGATCTCTTTTGCTTTGCTATTTCAGGATATGGGTGGGTTGGGGTAGGGGGAAGGGAGACAATGATCCTCACAGTTTGAAATAAAATTTGATTAG
CTTTGCTTTTGGGTGCTTTTGACCTACTTTTAGTAGGAAGTTTTGAAATGAATGAATGAAGCTAGATAGTCTTGGTTTTTTGTCCACTGATTATCATTTT
TGTAGCAATGTGCTTCCATATGGTAGACTCGTTAATGTTTATCACGATATTATTTTTGTCTTAAGAAGTTCAGGGTACAGGTTTCACTGCACTAACACTT
TTTTCTCCTTTGTCCTAGCTCAGAAGCTCCAACACCAACAAAGTCTCTTTGTATTTTTGACTTTGAAGTTCATATTTGAAAAGAATGTAATTGTAAGAAT
TGTTTCAAATGATTGCAGATTTGTCTGTTGTAGAGTCAAATGACAACGAGTGGTTCTACTTCTGCCCGATAGACAGGAAGTACCAAAATGGGCAGCGATT
GAACCGAGCAACAGAACGAGGATACTGGAAAGCTACTGGTAAAGATAGAAACATAGCTACTAGAAAGGGGGCAAAGATTGGGATGAAGAAGACTTTGGTG
TACTACAATGGGCGAGCTCCTGAAGGGAAGAGGACCAATTGGGTGATCCATGAATATCGTGCAACTGACAAGTCATTGGATGGTTCACGCCCTGGACAGG
TAGGGACTGAAATCTTTCTTCTCTCTTCAATTTGAACTTCTTTTAATGTATCTTAGTTTTGGGATGGTTTTTGTTAGAAAAAGATTGTTTGTTCCATATG
TGAAATTATGAGTTAATCTAATCTACTTGAAGGTATATTTGGCTGTTTCTTATCTCAGAAAAATCACGTCTTGAGGCGACATTAATATCAGTAGTGTTTA
CTTAAATGGAGTGGCATATGACTGGCCAGTTTAATTGTAGTTAGTCCACTTATATTCTGTTAGGACAACAAGGGGTTGGGTGCAACATTTTATGGTGTAG
CCATGTAAAGCATATTTTTTGGCGGGTCCAACATTTTGTGAGATGTCCGAATCAACAACCGTGGATATTAGTTTAATCATTGGAGCTTACTGTTCCATTC
CTATTTTGTGATGTGGCAAATTGGGCCATAGTAGATTATTAGTAATCATTTTCCTGGTGCAGGGAGCCTTTGTGCTTTGTCGTCTCTTTAAGAAGAATGA
ATTGAAGCAAGCTGAAAATGTCGAAAGTTCACATTTTGATGAAGTTGAACATCTTGTTTCTTCTCCTGCTGTTGGAATATCACCAACCGATGATGGATTA
TCAGCAGTGGCTCTATCTCCAATCATGGAAAGTGAGAGTAATAAAAGTAACCCACCAAAAACCTCTGGATGCAAAACTCATGACACAAGATTATCTATTG
ATAGTTGTGGTAATAGTTGCACTGCTGGTGATGGTGAAGATTTGATGGTGGACATAACATCAGGACAAGTAAGTAGAGCAATTCCCATTTCTGCCTTTTT
CTTAAATATTGAGTTTTTCATTGCAGACAATTGGTTGAACTAATAGTGTACTTATTTCTTTGCTTCATATTTTAGCCAGATCTCCAGATAGAGGAATTGT
TGGGACTCTTTCGCGACCCTTCACCAGAGCCTATTGATTGGTCTCCGTTGCATTCACAGTCGCAGGTGGAGTTTGGATCTTCTATCTCACATGGTACCAT
GAGCAATGAGATAAACTGTGATCAAAAGGATGTCCAGTGTCAGAATGTAATAAATGATCTCAATACGAATGAGTTTCTAAATTCAATTCTTGTCAGCTCT
GATGAGTTTTCATATGAAGATTCTGAAAAGGAATTGAGGTCAATGTGGTTTGCCTCGAACAGTATTAACACTATAACAACGGCACCAGTTACGGATTCTG
GAACTTGTAGTGTGTTGAAGTCACAAGTCACACAAGAGCCAGTAAGTGGAACTCTATAGGTGTCTTTCAGTTTCTTGCATTTGTGAGTTGTCTCAAGACG
TCAGTTACTTGAAAATTATTAACTGTTTTTTAGAGAACTGATCTTCTGCTGCTACTCTTTTTGTCCTAGGTTAGGAGAGATATATTTGAACCTGAGCTGC
TGTTGGGAAATTGTGGAGAGACTGCATTAATGAGAGAGGTTAATTCTGTTGCAACCTCAGTGGACGAGGTGTTTGCAACACCTTATTTTCGCAATGATCA
CTCAATGGGGAATGTAGGCACTGATTCTGCTTTTGGAATAACACTAAGGACTCGGCGGACGCAGAATCAACCTGACAACAGCCAGCCCGGATCTGGAATG
CAAGGAACTACTGTTAGAAGAATACGTTACCAAGTGAAACTTCAAACCGGAAGAGTAGAGCGTCGCATGCCGACTGATTCTGATCAGGGTGGAGCAAATC
ATGAAGGACTGTCAGCTGTATCTGAGGTAAGTCTCCCTAATCCTCATGAGAAGAAGGGCTAAAAGGTGACACATTGACATATATTTAATAATTGGCATGT
GCAGAGTGAAAAGTTCTCCAATGAAGATAGTTCTTCTTTGAGTGCTGCTATCTCCAGTGATGTGACACAAGATACCATGTGCAAAGAATTAAAAGGGGAT
CGTCAAATGGCTGAAGACTTGAGGAGTGCAAATGTGAAAGATACAAATGCTTTAAAGAGAGCAGCATTGTCTTCGTTTTCATTAAGTTTCTACATATCCA
AGGTGTTCGCTGTTGCAAGTTTACTCATAGTCTTCTTAGGTGTTTGTGGATTCTTTAAGCTGAGACAGTCTGCATCCAAATTGTAGCTTCTTGTAACTGG
CTTAACATGTTTTGTTGATTTTATCTCCTTTTCAAATACTGCAAAGGAGCTAAAGTTGAGAAAACTTAGAAGTTACTACTAGTGTATACTTTATATTATA
ATTAGCTTGTTTTGTACATTACTAGCACTATATTGTGCAAGGAGATGTAGTTACTTTAGACTTTTTTCCAAAGATTTTCATTTGGCATTTTGACTTCACT
CAATATATATGGACATCTGCTTGGTCTTCATTTGCTAGAAAGTCGTTACATTGATTTCCCCTATCATTATATTTACTTTGGTTATTACAAATGTTTTAGC
CTGAATATTTGTTTTACAGGTATTCTGATTTAATATTCTTCCTGTTGTAAATTGATGAACGATAAAATAATGTGAAACATGAAATATAGACAATAGTTGT
AGAGTTTTTGTCATTCAAGTGTGTATTTGTGAAAGGTGAAGAGTAACCATTTATACGAGGAATAATACATATATTGGACTCTAAATTTGGTTTCAAATTT
TAACTTTAACCTTTAACTTTCATAATGCACAAACAAGCACTTTAACTATCTGACTTTTAAATAAATAAACACATGAGTCCTACATGGAATAATATACGTA
GGACAAAAAATGACATGTAGGATGATGTGTCTATTTGTTCAATTTTATACAAGTTTAAGTGTCTATTTGTACATATCCCAAGTTGAAGGGCTTAAATATA
ATTTGAAATCAACTTAAAATGTATTACGTCTTTTGATGATCGTACAAATCATCCATGAGTTACATATCTCAAGTGATACATTATTAGTTAGATACAAATA
TGATAAATGACCCATTGTATGAATATCCACTTCTCATGTAATTTTTTATTTATTATATAAAGAGTAGCTTATAATGTCGTCCATTTTAATTATCGTGTTT
TTTAAAATAAATGATTTGAAATTATTGTCATTTTTAAAAAAAAATCAATCTATAGAGCTATTATTAATTTTTATTTTTATCCTTATTTAATATATGTGGA
AACAAATTATTTGGTGAAAGATAGTACTCGTAGTACTATTTTAGATTGAGGCTGTGAAAAATAAAAATGATTTAGGGTGTGTTTGGTATTAAAGGAAAAT
ATTTTTCTAAAAAATGTTTAATTTGAAAACAAGTAGATTTTTTATTTATTTTCTCATGTTTGGTTGGTGAGTAGAAAATATTTTCGAAAAAGATTTTGTG
TTTAAGTTATGAATGAAAAACGTTTTTGAGAAATATTTTTATTTTTACTAGAGTAGAAAAATTGTTGAAATTGAAAATGCTTTTTAAAAATGGAGATGAA
ATTTTGAAGTTAGAAATATTTTTTTAAAAATAAACTTAATTTTTTTTTTGGATGTGTGTGAGGACTGGGGAGGCTGGGAAGGGTTGAAGCGTAAAGGTGA
AAAAATGAAAAAGTTAAAGTTGAAAATATTTTCTTAAAAACAAACTTAATTTTTTTTTTGGAAGTAGGTGGGTGGGGGCTGGCGGAAAGGATTGATTGTA
AAGGTGAAAAAAAAATTAAAATAGAAAATATTTTTTAAAACCTAACTTATTTTTTTTTTAAGGGGGTGGGGGCTGAGAGGGGGACTGATGTAGGGGATGG
TGGGGTCTGGTTCGAGGGTAGGAACAAAATAAATTAATTTTTTAATTAAAAAATTGTAAGATTGTAATTTGATTCTAAATGGATATTTTAAAAAATATTT
TTCTTAAATTTCGAAGAAAAATCATTTTTTTCATATTTAAAAAAATTAAGTTGATGCAGAAATATTTTATTCACCCAAACATGATAAAATTTGTACTAAA
ACACACCCTTAGTAAAAAAGAATTTTTTTGGTTAATATTTGTACTTGGTACGTTACCTCATTCTTCTTTTTTATTATCTCGGAGTTTAAAATAGGAAAGA
AAAATATGACAAGTAAAATAGATCACGTTTTCGAAATGTTAGAATTTCCAATAAAAGTCATCAGTCGTTGTAAACAACGATTAGATGAAAATCAACGTCC
GCAAAATCAACTGGCAAAATGTTCACATTTTCTCCAAGTTTAGTACTCTTATTGCTTTTCTGCTTCAGCTTACTGTATTCAGTTCAAAGCAGCTACTTTG
ATCAAGAATTTGTTAAGCAGATACTGAGTTCAGCAAGTAAAGATAAAGATTGGTTAGTATCCATAAGAAGGAAAATTCATGAATACCCAGAACTCAGATT
CGAAGAATATAATACCAGTGCTCTGATTCGTAGTGAACTTGATAAGCTTGGGGTTTATTATGAATACCCTTTTGCTAAAACTGGTATTGTTGCTCGAATT
GGCAATGGTTCTCCCCCTGTTGTTGCTTTGCGAGCCGATATGGATGCCCTTCCTATGCAGGTTTGTCCCAATTACTTATGTGCAAAAAGATTCAATTTTT
CCTTATTTACATAGCATTCCCTCCGTTTCAGTTTGTTTGTCTGATTTTGTATTGACAAGAAGTTAACAAAACTTTTGAACATATATTGAATTTACTAAAA
TGTCATATAAACTTGTGATGTTAAAGATGCTGTGAAAAGTTAGAACGAAAGACTTGTCAGAAAAGAAACAGATTTGTTTTGAAATGGGCTAAAAAGGAAA
GTAAGATACATAAATTTAAAATTAAGTGAGTATAATTTCTAAATGTCCTTCCACCCCTCTACCTCCGCCCTGAGTTGGGCTGTATCAAATCTAGAGGATT
CAATATTACTTAGATTGTTTTTACACTGGTTGTCAGCATGTCACAATCCTCCAGCTTTATTTGGAGTTATGACAGACTATGCTCTATGAAGATTATATAG
GGGAGTTATAAAGAGATAATTTGTACTGTGTATATTTATGTGTGAAATTTCTCTGGTATTGATCTCAAATGAATATAACCGTAGGAACTTGTTGAATGGG
AACATAAGAGCAAAATTAATGGCAAAATGCATGGATGTGGACATGATGCTCATACGACGATGCTTCTTGGTGCTGCTAAGCTGCTGAATGAACGGAAGGA
CAAACTTAATGTGAGTTCTTTTGATGTTTGGTTTAAAGGAACTTTACTCTTCACTAATACTGATTCATTTGGAATGTGACTTGTGCTTGTGATATGAGAA
CTGAACTATTTCAAGCGGTGAACAATGGTTGTGTTAACATCATGTGTTTCTGCATACTTTTCTTCTCTTCAAACTTCTAGAGGCCTCACAATTAGAGGGA
TAGTTTGATTCCCTGAATTCTTCCTTTAAGCTCCTAGAGACCTTATCAAGGCCTAAAAGGAACTTAGAGATTTACCCTTTTTCAAAATTATCCTTGAATC
TCCTGGCATTCAGAATCAGGACTTTCAAAAGTAGCTAGTTGTTTCCAGTAACAGCCGAGAGCACAATAATGTTCGTAACTGACATATCACCTTGTGAGAA
ATCACGTGGAGCACTAGTCAAAAAAGTTAATTTGCATTTTTATTGTCTTAATATCATAATTTGTCTTCTTTAGAACAGTCTGAACGATATGACCATATTG
TTCTTTGATTCTCAAAATCTGAATTTGGGTCATTCTTTCCTAGAGGACTAGTAGTGCACTAGGAAGGATGACCTAATCATTTTCGAAGGCCACTTACCAT
TTCTTGGATCTCTTTATGTATAACTACATATGCTTCATCTTGCATATATCCATCAGAACATTCTGTTTTGAACCAGACTCTTTGATCACTTGTCAGTCTG
TAATTGTCTGACTGATACTACTAGATTTTTCTTTTCAACTTCATGAGGATACATATGTCACATGACACTCCAAAATCACTGTCAAAATTCACCTAATCTG
CTTGGTCCTTTGTGTGGCAATCATATAATATCAGTCAATATCTCTTTTTGCTAAATTCAATATTATTGTAATTCTTTTGTAAACCACAAAGGGAACCGTC
AGACTTGTTTTCCAACCTGCGGAGGAAGGAGGAGCTGGTGCAAATCATATGATAAAGGAAGGAGCTCTAGGTGATGCAGAAGTTATATTTGGTATGCATG
TTGATTTTAAAAGACCTACAGGGGGCATTGGCACGAGTCCTGGACCCCTTTTAGCTGCCGTTTGCTTCTTTGAAGCAAAAATAGAAGGAAAAGGTGGGCA
TGCTGCACAACCCCATGAAGCTGTGGATCCAATACTTGCTGCATCATTTGCAATTGTGGCATTGCAGCAGCTCATCTCAAGAGAAGTAGATCCCCTTCAT
AGTCAAGTACGCACCTTAATCTCATTTTTTGTCCATTGAGTCTTCTCAAAGCGAGGCAAAAAAACATGTTAGCGCTTCGCCTCACTTAATTGTGCTTCAG
TGTCATCATTAAGGCTGTAACATATACTTCTCCTTGCAAATGAAGGGTCTCCAATATATATATATATATATATATATATATATATATATTGTGGTCTTTT
TTCGTTTGCGCCTTTTTTCGTTAAAGCCCGTGCTTTTGTGCTTAAAGACCCAATGGACCTAAGAGCTTTATTGCACCTGTGAAAACACTGGTCCAATCCT
TTGTCTTTTATTTTCCTTGAAGATGTTTACCTCATAAGAAGTGTACATAATAGTATGTTTAATATTATATAGGAACATGTATTCCCTTTACGAACATTTT
TTGTTTTTAACAACTCATTTGTTTTGAGGTGGAAGCTGTATGATTTTTGAGACCTCAAGCCTCGTTTGATAGTTAGTCTTACTGATATGGAAATACTCAC
TTCTGCCTGAAGGTTCTTTCTGTTACTTATGTCAGAGGTGGATCAGCATCAAATGTAATTCCATCATATGTTGAATTTGGGGGAACTCTGAGGAGTCTAA
CAACTGAAGGCTTGTTTCAACTTCAAAAGAGGGTGAAAGAGGTACTTTGTTGCATCTTGGCTCTTGTTTACTATCAACATCTACCAACTAGATTTTCTGG
CTGTTTCCTTAACGTGTAGTTTGTGTTACAAATTTAGTGATTTTTTGTCCATGTTTAATAGCCTTAAACAGATTGCCTTCTTAGGCCATTGGAAAATGAT
GGGTTACATGTACCTATGTAATGAACTAACAAGATTAAGGAAGACTTCTTGAACACGTATCAAAACCCTTTCTCCAGCTAAATGAATGACCAAACTAATG
GCGTTCCTGCAGTTACCTTCCACAAGTAGGGTACGGGGAGGGTGGAATGTACACAGACCTTACCCCTTCTTGTGTAGGCAGAGAGACTTTTTTTGATTAG
TCCCTCGGCTCAAGGCCAGCATAAACACAACATATATGGAGATCACTATTGAATCCTTCATTTCTTGATATACTGTTGCAGTAGATTCTAATTGTCTTCA
ATGTCCAGTATCGACGAAAATGCTTCTAGTTCTTTCTAATAAGAATAGAACCTAGACTTCTCGTAGTAATTTGGTGCACATTTGAAATACATATTTATAT
GAGCCTGCAGGTAATTGAAGGACAGGCAGCTGTGCATAGGTGTAAGGCGTACGTTGACATGAAAGAAGAGGATTTCCCAGCATATCCAGCTTGCACAAAT
GATGAGAACTTACATCAACATGTAGAGAGGGTTGGCAAACTCATGCTTGGTTCGGAGAACGTTGGGGATATTGAAAAGGTCATGGCAGGTGAGGACTTTG
CCTTCTATCAACAAGTGATTCCTGGGGTTATCTTTCAAATAGGGATCAGAAATGAGAAGTTGGGCTCTACCCACGCCCCACATTCCCCACACTTCTTTCT
TGACGAGGATGTCCTTCCAATTGGAGCAGCAATGCACACAGCCATAGCAGAGATGTATCTGAACGATTACCAACATTCCACTGCAGTTTAGATAATAACA
TTATTGTTTGATGGTCTCTTGAGTTCCATAAATGTTCCAATTACTCGTTCATTCTGCACATTGTCTATAATACAAAATAAATAAGCAAATCTAAAGCGGT
GATGACCATCTGTTCATGTGGCCCATTTCAATTTCTTGATGCCATAGTTGCTCTTGTGCTCTTTAATAATTTCCCTTATGCTACAAGGCATCAAGTAGTT
CAGTATGTAACATACTACATGCAGTTACAAAATGAATAATGACAGTGGTCTGACACTGTATATGCAAAATCTAGTGCAAGTTACTGTTTTTTATGGCAGA
AATTGATATTTATTCATATTTTATGGATTTCTTGATGCATAAAGTTACTGGGTTCGACAGAACTCCGTTGACTAAAGATTTTCTGTTGATGTTCTCCTTT
TTATTTTTGCCCCTAGGTGAGGGGGCAGGGGTTTGAAATGTAAAATTGAAAGAAACCCATGTGAGACCAACTTTGAAGAATGAAGGTCTTTACACTCAAA
TCATTAGTACTTTAGCATCCCCAAAGTTTCATACAACCCATTTTTGTTCAACTTACCAAGTTGTATTGCTAAATTCTTTTATAACAGTAATATTCGGGTC
AACTTGCATACACTTCGATTAATTTTATCAAATACCTACTACTACCTCTACTAACACAGATAGATACCATGTAACTCTGTCCAACTATCACTTAATGATT
TACCTCCAGTGAGATTTAAACTTGAAAACTCATAGTTCTCGACCTACTTTATATTCTCTGTGCTATTTATATNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGTTTTTCTCATTGCTGCTGCGACTTT
ACAAGTAAGTTCATATTTCTCAACTTCATCATCTGTTATATCATGCTATTTTTTTTGTTAAATCCATTCTCTAGTCAATTAACTTTAATCGTTTAATTAC
TAGTTTTAATTCCAATTTTTATTGCTTATACGTATCAATTTCCCATATTTATCTTTGATTGTTTGTTGTTGTTTGTGGGGTTGTTGATTTTTGTTTTTTA
ATTTGATAAAATCGGTTAAAGTTTTTGTCTTTTTTTGGATCCTTTGAGTGTTTGTGTCTGTTTTACATGGGTGAATATCATCAAAAACTACTATGCCTTA
ATCCCGAAATTACATGGGTTCTTTTTATTTTGGGGGAGTTGTATATAGATTTTGTTTGATTTTTGTAGAGTTTTCAGGTGTTTGTTCAATTAAATAGCGT
CCCACATGAAGGATCAAATCGCCAGTTGGTTATCTGTTTTGTTTATGCATTATTTGGAAGGTATAATATACTGGACCAAGTTGTATATTGCTGAGGACCA
AAAGATAGTGGTGGCATCTGTTTGAAAGACAAAAAAGATGGATTTTCGGAGTAACTTACAGGGTGGATATGGAAGATTTGAGCAAATACTTGCTCAATAT
CTTCTAAAAAGCTTGCATATTATTTTGAACTTGAGGGTTCCTTCGATAAGAGCGTATGGTGGGTTTGAAGAAGTGAAGAGGAGTGACAAGTGGTTTAATA
TGGTGTTGGGAGATCGTCCTGCGGTTTTTGAAAACTTGAATCTGTTGCATGGGGAGCCAATGATAATAGATATAATACTTGTTCAAGATAAAGATTGTAC
TTCATTGAAGCACAGTTCAGGTAAAGCATTTGCAGGGGCATATACAGAAACCATTATAGAGAGGTGGGTCGTGCAATGTGAAAATCGGAGGTCTATGGTT
CCTCAAATGGGTGATTCCTCTTACAAGAAAATGTACAAGAAGTCTATCATACTACTTCGTTCCGTTTATTCGATGTTGAAGCTCCTGCCTGCATTCAAGG
CCTTCAGGAAACTATCTTCGTCAAGTCAGAGTAGTTGTTTTGATATTAATTTTAAGGTATCTTCATTTAGCGAGCCATTCTCAAGGGCAGAGGAGGAGAT
GATGAAACAATTTACTTTTACTTCAGTTGATGCCCAGCAAGGCCGTCTTTCCTTATCTGTGACATATCGTGAAAATCTGGTGGACTTTAACCTGGAGAGT
TCTGCATCCTTTCCACCTGAGATCATTACAGATTATGTTGGTAGTCCACTCACTGATCCTCTGAGGTCATTCCCTTTGAACTCGACAGATAAGGGTGTTC
ATAATACTTCATTTCCATTGAGAAGGACACAGTCCTCTTGTTCAGCACCTGTTCAGCGCCCGCAGAGTTGGACAAGTGGTCTCTTCAGGGCACCTTCTTT
ACCTCAGCCATATGTAGGATCTCCACCTTTGTACCATGCACCATATGAGCTTTCAACTTCAGTCAGTAATGTATATGGACAGAGGATTCCACCTAACTAC
AAATATTCAACTCACCAGAAAACAACTAGTTTTGATGATGACCAACTTTCCCCTCCATTTTCATCATCACCATCTCCACCCACATATCTTTCAGGTGCAA
ATCTTGTGCAGACTCATTTGCGTTCAGAAACTGATCCTGTCAGTATCCCTCATCCATTAATAGGCAGAACTTCCAGACACCTATCTCCTAATTTGTCTGA
TCCAAACAGGCATTATCTCCCACCTATGTCACCTAGATGCACAAAGCATGATTCTTCATCCCATGAATCCCCTTCTGGAATCAGATCATCAAGGAAAATA
GATTTGCTAAGGGTTCCAGAGTCAGATACTACTAATCCTGGACAAAAGGTGAGCAGTTTCGATTTCTAGTTTTCTACTAAATGTGTGCATTTTCTGATTG
ATATTTTTATTTTGAAAATGATATCTGCTTGAGCCTTCTTCAGCCAGCTTCTAAACTTTTGTTTGTGTGTTTCATTTTCAGGTGCCTACAGATGCTAGAG
ATGATTCAGGACGGTTCTCAGGTGTGCTCTCTTCAAGTGATTCACCACGTGTTGGAGTTTCTAGAAGTTCTAGCAGCAGATTATCTTTTCAGGATGACTT
GGATGACTTTGATTTTTCCTGTCCTTTTATAGTTGATGATGTTGATACTTCTGTTTCCCGAGCCAGGTAATTTTGCTAGAGCGTACTGTATCTTTTGAAG
TACTCATCTTCTTACAAACCTTACTTCTTTGGATTCATCTTTGTTGAAGTTTTTTTGTCATTGGATAATTGGTTTTTATAGAAGCCAACTATGTGTGGTC
AATTAGCTGTTGTCTAACAGGTTGGACATAATAAGAAACTGGACTTAATGTTGTTTTGAGAATTGAGCTTCTGATGAAACATTGATGAGAATGTTAGCAT
TTGATCTATAGAATGAGGCCGTGTAGCTATCACTCTCAGGGATACATATGAATTTTCAACGGAAGTTCTTTTTTAGGTTTTAACTCCAATATGCAAAAAG
TCTATCAAGTAGAATGGCCTCTCTCTTTTCTCTTAATGAGTCACTGGAAAGCTATTGCAGTAACATGGTATAGATAATGAGGTTGTAACGTCAGTGAATT
TAGGTCCATCCAATTTTTGCTTGACATTACAATTGTAGTTGTTCTCCCCGAGATAAAAGGCTTGTGTTAGCTATATATTATCCTGCTTTCATTTTACTTT
GTCCTTAAAGGTGTCCACTTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNTTTTTAAAAAATGATGTCAAAAATTTACTATTAATTTATCGGAAGCAAATGTCGAAATTATGAACAATGAACAAAT
AATAAAGTTGGTTATGAATTTATTAATAACTTTTTAATCACACTGTAAAATATAAAATATCAATCTAATATAAAACGAAAAGAAATAATTAAATCTTAAG
AAAGTAAAACTATTACTGAAAAAAATAGCAAGTTTCTTTTCCCTTCTATATTACCATTACTATTTATTTATTTTTTGAGTGAATATATATATTTTTAAAA
ATATCCATGAAAGTTGCTAAAATAGTGACAAAAATTAGGTAGCATATTAGTCGGTGGAGTTATATATCTCACCCCTTTAGTATGAGCATTAATGATATGA
GGGTCCAAAAATTTTCAATTGTCATTATCAATTGTTATTTGTTGAGGCTACATGAGGACCAACGTTCAAAATTCTACTCTCAATATGACATTATAATCTT
TTCGAAAATAGTTGCTTAATTGGTTGATTATTTAATAAGATGAAGATTTCTTCGTAATTAATTTCCACTCCATTCTCCATTTTCCTGTCTTTAAACGTAA
ATAAAAACTCGATTATCTAATTTATTTTTCTAAAAGAATATGTTCAAGAAGTTAAATTTCTGTTTGGAATCTAATTCTTGGTTTTAGATTATTTTTTTTC
CCTTGTATTTCATGGTGGCATGTTTTTCTAGATAGTATTGAAAATTTAGGATAATCCATGTTTTTTAAAAGTAAAATTTTAGAAGGGAATATTTTTAAGT
CTTTTGACAATAATGTCATCCAGAAATAAAGCACACATAATGCACTCTCATGATCTGTATTTAAGATTAAGTTGGAATAAATTAAAATCAAAGATTTTTT
TTTTAACTTATTATTTAATTTTTGACAAACAAATAAAAAACATCATCCAAAAAATATTTTTAATCTATTTTTCATAAATATTATTGAGGTAAGATATGAC
GGGATGGAGAGAGGTAGATTGGAAGGGGTTGGGGGGTTGGGGGGCGTGGAGAGGGTAGGGTGTGGTCGTGTGTTGCTGGATCAGAGTGAAGGAGACAATC
GCTGATGAATTTTACTTTCTCTATTCGTAGATCACGAGTCATTCCTAGAAATACATTTTTACGAACCAATCATGAAAAATTAAATGTAATTTTTTCTACT
AAATATTAATTAGTAATATGATAAAAATAATAATGAACTTGTTATTATAATGGGTGAATAATTGCATTTTTTTATAATACAAATTAAATGTATAAACTAC
TTTATTATTTTTTTAATGAAAGCATGTCGTTAACATGAATAATATTCTTGCTTTACTTAATTTCTTACCAAATATAATGGACTTTTTTAGCTTTGAGATA
TGCTACTAATCATAATTAGTAAAGGCAAAAAGATGAAGAAGCTTCATGCTTAAATCTTAACTAACTTTACGCTAATCATTGGTACAACAACTTCTCAAAT
TTAATTAATTAACTTCACTAAGTACTTTATTCTTTATTTTGCCTAATAAAATATAATTATGAGTTAAAGACCTTTTTTTAAAGCAGGTAAAATATCATTA
GGTCACTTGCCATCAACTCCACCTGTAGATATTAACTTAAATTGCCTCTAATCCTTAGGGTCCACCATAATTAGGTGATCTAAAAATGTTTTTTTAGTAC
ACTTAATTATAAAGGAACACAAATTTAGAACCTTATCAATATTTTAAATCGCATCGAGAATCGAGATATACTTTTTGAAATATTACATGCGAATTCACGA
GTTAATAGTTTAATAAATCTGAGAGAATTGGTAATAAAAATAATTAAATTGATCAATTCCAAATAAATTAAGATCGATTATGTGTATGTTCAGTTATCAC
AATTCATGTTGCTCGATGCTTCGATCATTAAAATAAATCTAGGTCTAAACATTATAAAAAGATTAGTGTAATTCTCAATTATCACATGGTTATCATGTAA
TTGTTTTCTAGTCAATACCAAATATTTCAATTAATAATTGTAATCGCAACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAATTCACCGAAAATGAACAACCTATGGTCCACGATTGTAGAGAACATG
ACAAATCCCACAAATACCCCTCACATGCATCATCTTATCTCTCAATAAATTTTTATCTCTCAAAAATTTAATTTCCATATCCACACTACATTCAAAGCAC
CTCCCCAATGTGTGCTTGTTTGCACCAATACATCTCTCACATTTATTTATAGCTCCATCTTATATACTGACCTTTTCAATGAACACACACACACATATAT
ACAACAACAAAACCAAAATTGTTAGAAAATGGTGAATTACAAGGGGGGGAAATTGTTGAAGCACCAAAGGAACAGAGTTAGCTTTTCAGCTAAATTGCCT
GAAGATGTTCGCGGGGCGTTCGCGGATAGTACATGTGTTGTGAAGTACTCAATGGATCCATTGACAGATATAAAAGAATCTATAAAAGAGATGGTGAAAA
ATGTTGGCATTAAAGATTGGAAAGAGATGGAGGAATTGGTGTACTGTTACATTGTTCTTAACTCTGAAGAGGTGCATTGTTTTATAAAAGAGGCTTTTCT
TAGTTTATGCTCTTAGCTTCCTTCTTATATAGGTTTTATTATATGCTATTCATTTTTAGCATTTTTTTATGTTTGTTTATTTTATAGACAATGTGAACGG
ATGTTTACACGATTAATGCAATTTAAAGTGTTGTGAGAGGTTATTATATATGTACACCTCGTTTTAGTAGTTTTATGATATTTTGTTTAATTCCGAAAAT
TTATGTTCCCGTTATTCCGAAAATACCACTATCTTGAAGAACAAGACACAGTATAACATAACTTGAGGAAGAAACTTCATTTTGTTGCTATTTGCTCTTA
CTCTAATTATCTAAAATTTTACTAACCCGTTCTCCAATCGAATTTCAATATGAATATCGGAAGATCAAGCTCTGTGAACAAGCTTTGGCTGCTAAATCAT
CACATTCATTCACGAACAATATCCACAACAACTTCTTCTCTAGTTACGAAGCAAACCTCCAAGCAGCTGCCGTCACGTCACCTATCTCCTTCCTTTACTT
CCACTACCGTCCGCCATTTTTTCTTCCGTTCTCGAGATCCATATGCCAAGTAACTAATTGTTGTTTTTTTTTCAAAATTTCGTATATGTGTGATTTTTGA
TTTTTTGTGTTGTGATGAAGGTATCACGTTCGGGTGCCGTTGAATTTGGGAATTCGTATAGTGCCTGAGAAAAAGGCGCATGTAGTTGAACGATTTGGGA
AATATGTGAAGACATTGACTCCGGGAATTCACTTTTTGATCCCTTTTGTTGATCGAATTGCGTATGCGCATTCTCTCAAGGAAGAGACTGTTCCGATACC
TAACCAGACTGCGATTACTAGAGACAATGTTAGCATTTCGATTGATGGTGTTCTTTAATATCAAGGTTTAATCTCTATGAGTACTTCTTATACTTTTTGC
GCGAATTTCTCTTGAAATTTTTAAAAATGCTGGAGATTTGTAGACTGTATCCAAAATTGGCGTCATATGGAGTTGAGAATCCATTGTATGCGGTAATTCA
ACTAGCACAGACAACTATGCGTAGTGAGCTTGGTAAGATCTCACTTGATAAAACCTTTGAGGAAAGGGACACTTTGAACGACAAAATAGTGGTAAGTTTT
TTAATAGAATTTTATGATCAGAAAATAATAGGGGTTGGCCTTTTGCACTTTCACTGTGAAGTGTGTAATTATGACATGTTAATTGTTTTAGCTCCGCGTT
TTCCTTGCAGCTGGCCATTAATGATGCTGCAAAAGACTGGGGACTGAAATGTCTTCGTTATGAAATAAGTATGTGGCATGTTCTACTGATTCCTTCATTG
CTTACAAAAGCAATTATGGTTCTTCATTGATGAATATGTATGTTTCCTCTTCAGGGGATATAACTCCACCTCGTGGGGTTAGATCAGCTATGGAGATGCA
AGCTGAAGCGGAACGTAAAAAAAGAGCTCAAATTTTTGAGTCAGAAGGTACCAGTTCCTCACCCTGATTTGAGCAATGTGAAGTAATTCATTGTGCCATA
TGTATGACACTTTAACGTATCAAACTTGATGTGTATTGTCATCTAAAATAGGGGAGAGACAGGCAAATATAAACATTGCCGATGGAAGGAAGAGTTCAGT
GATCCTTGACTCAGAAGCTGCAAAGATGGACCTGGTCAACAGAGCACAAGGTTGGTAAAAGATGTTGCCAAGTGTGTTATCTCAAACTTGTTTTATAGAT
TCCCTCACCCATACTATCTGGTGAATCAGGTGAAGCTGAAGCCATTCTCTCTAAAGCACAAGCTACGGCAAAAGGAATTGCGTTGGTGTCACAAACCCTT
AAAGAGCATGGAGATGCAGAGGTGAGATCCCTAAGTTCATGCCCGCGTCTTTTTACCATGACGCTGTAATGAGATTTTGGAGAAAGATGTGCTTGATTAA
TTCAACAACGAATACATTTGATTGTGTCAATGCCAATAAGCATTCTCACTCACGGCTCTTTCATTACTGGGTATGTAGGCAGCAAGCTTGAGGATTGCAG
AGCAGTATATCCAAGCCTTCAGTAGCATCGCAAAGGAGGTGAAGCATAATAAATACGTTCCAATTTAGTCCATAATCATGCATTATTGATTTGCTAATCA
TTTTATTTTATGTGTTTTAGGGCACAACATTGTTACTTCCTACAAATGTCTCTGATCCTGCCAGCATGGTTGCTCAAGCTCTTCACATTTACAAAAACTT
AACGAGCAAGAATGTTGGCATTGAGCAAACTAAGTTGAAAGTGAGTGATTCATTTGAAGTAATCAACAATGACAGCTTTATTACTGATAAATCGACTAAT
GAAGATGACGAGACTGATGGAGATGACAAGAAGGATCACTAAGCGCTTTGTCTGACTCATCTATAAAGTAGCTTCACTTTTTAATTAGCCATTATGGATT
ATCTAGGTTTATATTCATTGACAGTCTAAGTAGATCTGGTCAATGATAGGATTCCTATTCTTTATTATGGACTTGCTTCCACCATTTGTTCGGACTATTG
TGTTACTAAGAATGGATATAAAATTACATGATTTTGAGAACATAACGAGTAACTTCATGCAAGCTCCGTAAGCTTTTGACATCTGATTTCAGCATTTTAT
ACTTCAGTAAGCAAAATATCATAAGACGAAATGTAAGAAGCAAAGTAGCAAACCAATCTTCTCAATTTAAGCTTATGAAAACGAATTAATCATTCAAGTG
TATCTCCTCTCGTTATTAAGTAGAAAATACTTGCACCATTTCAATAAGTTGGTAGACATAAGAGTATATCTTAATAGTTTAAGAACAAAACAAATAAACT
CCACCATCCCAAGCCCACCCTGAAAAGCACAAAGGAGATGATCACCAGACTCCTGACTCCTATCCTCCTGCAAAATAATTGAGTTTGAAAATCTTGAACC
CGCATAACATGTTATGTTATTTTTATACAGCGGCGCACAAACCCGCTCCACCCTCCCAACATAATTTCTTAAAAAACTAAAATACTGAATGCGGTATGTT
TTTAACTTAAAATTTCTAATTTATTAATAATTGTGTAATATTATTATTTAACTGCTGAAATTAATAATAATACTCTTTTAAACATGTCTGTAACATTTTT
TTTGATAGTTTTGAATTGATTACTAACTTCTTCTTTTTTCTAGTTTTTGGCCGTTCCAAGCAGTTTTTTTTTTCATAATACTCTTTTATTCATCATATAG
CCAGTGCATAAAACGTGCAAAACTGGTATGAAATGTGAGAATCTACGAATTTAAAAGTTCTTTTCAAACCCGCCCTGCCCCACATGAATTTTGAAAAAAA
TCTATTTAAACCCGCCCCACAACGACAAAAGCTTTAACCCACCTCGCCCCACAAACACCATAACCTGCTCCGCTCCCCCCATCCCCCACCCCCACCCCAA
ATTGCCATCCCTACGTAGATATATCTGCTCAAATACTTCTCTAGCTGCAAAGCACATAAAACAGAATACACTTCATCCAAAAAGGGAAAAATTATTTCTT
TGACGGGTGATCGTGTCTTAGAATCCTCAATCAAAAGAAAGAGCAATCAACTATATGCTTAACTCACACCCCAGGAATCCCTAGACACAGAGATGAACTT
AATGCAAGCTGAAAACAATTGAGAAAATGGTTTATGTTGGATTGGTTGGGTTTGACCCATTGCTCAACCGATCTAGGCCTGAGCATACTTTTGACATATT
GAGTCATGACTCTTTCGTTAACTCAAATTGTTTTCGCCAGCCCAATGTAATCAATGTACCCATTATACACCTCTAGAGGATTCTAATTCATGGAAATTCC
TCCCAACATGATTTCTTGAAGTCTACCAAGGGAGCATTTATTGATTTCCCTCTGAAGTTATTGTAAGAAAACTAACTGATAACTAGCAAAAGGAGGGATT
TTTAAAGTCTAGCAAGGGAGCTTATGTTGCTTTTGCTCTGAAGTTATAGTACGAACTAGCAGATAACAATCTAAAAGAGGTAAACATCAATATTAGATTG
AGAATAAAGATCATCAAATTTCTCATGTAATCAAACTCTTCCTACCTTGCTTTCAGCACAATCCATAAATTGAAGCTCTAAACATAATCATTTGTGCGAG
GAAATAAAAACAATTAGGCCATAAATTAATAAAGACCAAGATACAAAATATCAGAATCTCCTAGAATTTTATTGATCGCAACAATAAACAAATAATAAAT
CTGAAACCAACCGTGGATTCCGTTCATATATACAGAAAATACAAACATATATCCAGTAAAATGGATGTTAAAATAACACTATCAGATCTAACCTCTACCA
CATAATGAACAAATCAACTTGACAGAAACCGCAAAGCAACAAAGTAGACATGATCAAGCTAAAGAAGCCCAAATATTAAAGAAATACCAAGAAATATCAA
CCAAACAATATGAAACAATAACAGAGCCTGACCCGGAACTGCACCGGACCCTCCATTTCCCACAGTGCAAGGTCCTAATTTGGCAACGCGAACACCAGCA
CAGTGAGCATCGGGACAACCACACCAGTAGGTAACTCCATCGACACCGCAAACCGGGTCGGGTCGGAAGCAATTGATGGGGCAAGAATCGGTCGGAAATG
GAGTTCTAGGGCATTTATCTTCGTCGTCTTGATGAGAAGGTAGTGGATTTAAACCGTTTAAACAGACAGTAATGGACAAAAAGATGACAGCAAATAGCAG
AATTTGGAGATGAAATTGGGATTTTCTCAACTCTGATTTCATTGATAAAGCTCCTCTAAAGTCTAAGAAGCTCAATTTCACCAAAATTGATGATACAGAG
AAACCCTAATTGAGGAAATCGTGAACCCTAGAAATGATTCAAAATTGGGGGTTTTATGCTGTCAAAAGGAGAAATTTCTTCCTTCTTATCTTCCTTGTAT
GACTCCGTCCAACTGCAGACAACTAATGAGAAATATTCTATGTATATTTCTCCTCGTGAACTTTCAAAAAAAATACGTTTGATTATAAAATTTTATAATT
CAAAAAACAATATAATTTATATTTACAGTGTTACAAAACTTAAAATTTCAGTTTACGATAAAACATGATTAAACACATGTGTGTGATAATTTTATTTGAG
AAAATTAAAATAAATAACGTATTATTGGTGAATTATTTAGGTGGGTCCAACCAACGTGTAATTTTTGCAATTTAATTTTGTTATTTTCATACGCTAGCTT
TGATGCATTTGAAATAGTTTAGTTTTAAGCATTGACAGACTAATTGTCTAGGCTGGTATGAACAATCCATGTGAGTTTGGGCATTAATGGAATTTTCATA
TTTGAAGTTCAAGTTTGATTCTTTATAGTTTTTTCCACTTTAAGGCAATCTCTCACTTATGTTTATTAGCTTTTTTTAAAAAATAAAATAAAATATTATA
TGATCAATCACAATTCACAAGTAAGGATTCAATTATTTTAGTCCATGTTCAATGGAACGGCATTATTCTCAAGTCTCGATCCATAAAATAATATTTTTGA
TATTCGTGTTTTGCTTAATGTTAATGTTTGTCTAAATATATTTGATAATAATATATATTAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACTAAGCTAAACCAACTCCTTAAGTCATGGCAACATT
TAGCCCAAAAAATACAAAAAGTAAGTGTAAATTATACATTTGCTTTATACTTCCATTGTATGCCATTAATCTTTTAATGGCAAGGTTAATCACAATGAAT
TAATCAAATGTTAAGGATCAAGCACTTCCTTGAGCCAAGTACCTATCAAAAACATCCTCTTTACCTCTAGGTAGGCAGGGGCAGAAAATTTCATTATTTA
CACATAGTTAAAATTATATTTTATGTATATATATCTATAACAGATGTTGAACCATTCAACTTCTTTATATATTTACTTCTTTGTATTTTGAACCCTTTAA
TGAAAATCCTTGGAGGTAAGGTAAGCCTCTGTACACTCTATTCTCGTCAAATCTCACTTGTTAAGGATCAAGTGCTTGTTTTACAAAAAATACGAAAAGT
TGCATAGCAAATGGGCTACTTTTAGTTCAGTTGCTCCAAATAGTTGATACCACAAAAGAGGGTGAGAAGTAAGAGTTACCAGTACAATTGGGAAAAAAGT
CGGAGGGATCTTCTTGTAAGAGGGTGGAGCAGTAGTCTTTAGAGAGATCTAAGTCAATTTCAAAAGTGCCGTCAATGGAGGAAACAAGTGTGAATCTCAG
CAGCTCTTCTATGCAGTCCTTCAGTTGCAGTGACGCTCCAAATCCCGGAGATGCTGGCTGAGATTCCATTTTCATCGACATGGATCTTTATTGACTCAAT
TCCCCCATGCGTTCATATGTTCCTGTGACCGGCCCTTTATTTTTTCCGGTGTCTGTTTGTATCGACTTATTTTAACTGTTCTTAAATCAATAACAATTTT
AAAGTGTTTTTGTAAAGTTAAACTTATTTTAAAGTCCAAAGCCATAGGTTAGAACTTCTAACTCGTGACTTTTTGGTTATAAGTCAAAAGTTAATTTAGA
CAGACCCTTAAAAAATTATTATGATTATAATGTGGGTAATCAAACCAATCAATTATAAGGTGAAAATTCATTTTACAAAAATCAATTGGGCTAGTAAAAT
TTTGAGGTGGAAAAAAATTGAGAAATAGATGCATTTCTTCTTTGTTTGAATTTCATACATGCCATTAGGGGTTTGTCCCAATAAACTGGCTTGTTTTAGC
TTTGTTAACAACAATAAAAAATCTCCTACATTGCTATGTTAGGGATCCCTTTGATCTCCTACATATACTTTTCTAATCCCTACAATCTGTTAAATATGTG
AAATTCTCTAAGCTAACACCTAATCAGATGTCATTTTTAGGTTATTGATCTAGGATTAGTATCAACCTCAGCTTCTTTAACTTTGCCTAATTCTATCATA
TCTACTGTTGCAGAAGAATGAGGCTTGATAGAACTATCAAAGTTGTGATGATGATTCTGCTCATGGTGTGCTTCAAATGTCCACATGAGGACTAATGCGA
CCATCACTGTTGACAGGAAAACGAGTCCTCCCCATGTCATATGCGCGTTTTTCTTTAATGGTTTGCAGTGGTAGTCAAGGATATCAGAGAACGAATCATA
CACTGTGTCGCATTCTGCTAGGCTTTCCATTCCAGGGTACACATCCAGTATCCTTTTGAGAGCAGTTGTATATGCCTCGATGTTATTGTAGTCCCTAAGC
GGAATCAAGACTCCACCAATACAGTTTTCGTTCGTGCAAGTCAACATCTTGATTATCTTCATACAAGAAGAGAAAATTCCGTCAAATCAAATGTAACTAA
GAACAGTAACTTTGTGTGAAGGAAACTGTGAATTATAGCCTTTGAGTTATATATACCCGAGGGAGGTCTCCTATCCTGATTGCGCTAGATGGACAGTTCT
CATCAGGCTCGTAGTTATAGTCAGGTGGACCGGAGAATGGATTGCAGATTTGTGCAACATTTCCATAATTTGTAGCTAGTTCTCGATTTACCTGCAAATT
TCCATGTTATCAAGACTAGTAAACAAAAACCTTATTGCTCTAAATACCAGTAGTATTACTTATTTTGCTGTGATACTAAATTTTACCCTGTTCACTACTC
GATGAATCCCTTCACTGACTTCATGTAGAATTGATTCTGCAGTGAGTAATTCATTACAAGGGAGGATGGAACTCAAGCTATTGTTATAGGGATTTATCTC
GAAACTTTCTAGAGCTGTGCATGCGTCTCCAGCAAAGCTACAATAAACAGATGGAATATGATCATCAGTACCCGTACAATTTTTTAGATGAAACACAAAA
CTTGAGTAGTTATTGGAAATCGTTTTCATACTTACTTGTCTAGAAAGAAATAAATCCCGAAAAATAACCAGCACAGAATTGTAAAGATCCAACACACTGC
AATCAGCCTGCATGGATGAGAAAAATGTTTCAAACATTAGAAACTATCGGAGTATTGCCAAGAACTTGGAAAGTGTATGTCAGGTATACTATATCTAAAC
AGGAGGCTAAAGTGATATACTTACAGGCGAAGATTTCTTCTGAATTTGAGGATTCCAAATACTGCAATGAAAAAGATTTTGCAGCTTTAGTCAGAATTAG
ATATTTAACGACAGCCCTACTCAAAAATACCAGGTGCGGATAAGTTTTTAGTCACCTGTTAGGGCAATTTCAAGATTCTTTTGAAATAATATCGAACAAC
AGGAAAAGTCGAGTTGGATTTAGTAGTAACCTGTTAGGGCAATTACAGCAACCAAGTTGAGTGAAATGATCAATGTAGTTACTATATACCTGCCAACGAA
AAGTAGCATGCATGTCATTTTTTTTTTCTAGCAACAGAAAATGTATGCACTCGAAAGCACACACTAACTCTAGATCCTGGATTTGCATCTACTAGAGGAT
GAAGACTTACAATATGTCAAGGCCTTTCATGATTAAACGCCTATTTTCGGTGGCTTCCCTATGTATATCAGCAGCCTGTCTGTCAAGACTTCTAGAGGTG
GGAATGAGGAAACGAGCAGCCTCATGACGTATATCAGTATGTGCTAAGTCAGTGTACATCGCTCTCAGGGCTCCAGTAGTAGTGTATATAGTCTCCGATG
CCCCCTCTGCTGTATCAACGACAATATCCACAACTGTATTTGTTCTCGAACGAAGTTTTGCATTCCCTCCTAATGCCAGGCCTGTAGCTGTTCTGCAATA
ACAGTGAAAGTATCTCCATTTTGTAACCCCTTCCACTATAAATGAAACCAAGGATGCAGAGCATATATATATATATTTTTGGTACCTGTTTTGGGCTTAA
CAAGTAGTCTGTTTGGTCAAACTTGCGAAATCTGCTTTTCGAAAAAAATGTTTGACTAATTTAAACATTTTTGTCAATATTAGAGTAGCGATTCGTGCTT
GATTAAGGTTCTAAAAGTACTTATCAGAAAAAAGCTTTCAACTTCTCAAAAACAGTTTCTGCTACGACTCAAAAAAGCCCTCCTTACCACTCTCAGAGCT
CGAACCCTAAGATATTTGGTAATATAGAGGAATACTTACCATCCCACCACAACGAGTGGGTGGTGGGGTGGGGTGGGGGTATTTAAGTGAAAGAATGAAG
TAACTTACATAGCTAAAATTGTGAAGAAAATAGCTGAGAAGGTCAGCCAGAGATAACATTGTTTATAACAAGTTGATTTCTTCTTAAACTCTTTGTTTTT
CCTATTAGAGCAGCAGCAGGTAGAGGCTAAAAGAAATACTCCATATCCTAAGCCACACAACAGCCATATCACTGCAATCACATAGCCATATATACCTGTA
AAAATTGTGGACTGCACAAGAAAAAAAAAATTGAAATTTCATGTTAGATGTTATTTTTTAATCCTATTAACTCGTATCAGGTCACACAAAGGATATTTAT
AGTTAAGTGCCATGATGGTATAAAAAATTTCTAATACTGACGATATATATAACTTAAAACACGTTAGGATAATATATGCAAACTCACACTCCAATAGTGT
TTATTTGTAATGTCAAATCCTCCTTCGTATTTCTTGAAATTGTTCAAAGGATTTATTCTCACTGTATCATCTGATTGCTTGGCTTCTGAAGCATAATCTA
ACTCAACTAATCTTCTTTCTGCATAATCAACAAGTCAATTTATCACATTAATTAATATTAAAAACAATATTTCTTAGCAATAAGCTTAATAGAATAGCTA
GTTATAAGTATATTATAAATGTATTGCATTATTACTACAATGCTGGAGTCGATACAATTGACAAAACTGTACAAGACAATTTTCCAAAAACAAAAACTCA
AAAAAGTGACTAGTAAACGTTATTTCTAGTCATACAAACCAAAACGAGAAACCAAACGGGTAACGAAAAAAAATTAATATAAAAAAAAATTGTTACCTGG
TGGATTGGTTGATAATCCTTCAAGATTAGTGAAGTGAAAGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGCTTTGTGATTACTATTTGGTATATTAGGGCTCAGGCATAATACTAACCTAGCGAA
ATTTGAGGATAAGCTTTGTGATTGCAATTAGGTATATCAGGCATAATACTAACCTAGTGAAATTTGAGGATAAGCTTTATGATTAGAATTTGGTATATCA
GTCTTTGCCTTGGGCAGTGATTTCAATCTATCTTAATGTTCTCTCTATTTTCCTTTGCACATGCGATATTTGTACCGTGGCAAGTGGATCCTGAAAGCAT
TGAACCAACCAGTTTCCTCAACTTCCAAAGTCTATTTTAGTTTGCACGTAACCATTTTGACCAAAATTAGCTGGGAAGTTACAGAATAGAGGATAAAATA
TGACTAGGCAACAACGTATTGTCTGGCAGTTTATCATCACTATTACTGTTATCTCTATGACTGTTACATGCACTTGTAGAAAGGGATGAGCTTGATAGAG
GTACCGGGCCTGACACAATTCTAAAGACAAAATTAAGAATAACAAGAAGAAAGTAAAAGAAACAAAATAAGATAGAAGGGTAGACACAAGAAATGAATCA
AAGACAACCAATTCAATATAGAAATGACCTCCTTTGAATATCCTATCATACACCTAAACCAATTAGAAAGAACTTTGGGGAACTATAAATGTTTGATAAT
AATCTACCTTTCAAGATAATAACCACTACTTTTACTAAATAGAAAAAGGAAGATACTTGCTATTACAATTTTACCCTTAGTGAAAGGCCTTGTTTGATTG
TCTTCCCTTGGGATGAAGTCCCTAAAATTCATAAAGTAGCATGACCAACTTGTTCTTTCTCCTTTCTTTCATCATCCTGAGCTATCATAAATACATGGAA
TGATGGCATCCTCGGGAATCGGGACGGCTCCATAATGCACTCAGGGGTGGAGGCTTTTACTTTCTTGTAATGCAGTACCCTTTTCAAGTATTTATTATGA
AGCAATCAGTAATTTGCTGCAGTAGGTGGGGATGTGCCATATTGTTTCACTTCATGCATCTTACCATTTGTTTTTGTGCTATTGAGCTTGGTTATGTGGT
AGTTACACAGCCTTGGCCTAAAACTTCAGGCTGTGCATCGAGTGCTATCAGACTCTGACTTCATTTTTCAGTAGTCTTTTGACTTCTTTTTACCTTTCTA
CTTATGCATGCTTCATTAAATTGCAAAATACAACATGCATCATGCAACTTAGGTTGCATAGTGATTCTAAACGTGTTGGTCCTCTGAATTGCAGGAAGAA
TCTCAGCTTGCTAAGATTACACGTGATAGTGCTAAGATTACTGTCGAACAAGTTCATGGCTTAATGTCGCAGGTACATGTTGTTCTATTCTTATTTTAGT
CACACATCATTCATCTAGCTTTAATTCTTTGAACATTTCCATTGCTGAATAGAATGTCTTGACACTATGTATTTATCCTTGGTTTGCAGGTAATTAAAGA
CATTCTTTTCAATAGTGTTGGTAAGTCAAGCAAGTCACAGACGGAATCCTCAGGTCCCGAGCCCATGATCGAAAGCTGAGAAGTTCATATTACTATCAAA
TTGGATGTAGACCAATTTGGTGCAATTTCTAGGTTTCTTTTTGCAGTTGACTATATACATCTTTGACTCTATTTGTGCAGCCTACAAAGAGGTGATAGTT
TACGATGATTGGCTCTCTTAGATATCATGACTTTTGCTGTTCAATGTTATGGAAGATTTCGTCAAGTCTTTCACAAGTTCTTTTCCTTTTGTTAATTATA
AGTTCAGTTAATCGACATGTTTGGTTTGGTGCTTCAAAGGAAAAATCGGCTCTAAGTGAAATGTCTAAACCATCACCGTCGTTTGGTTGGAAACAAGTTA
TTATATGATAATTGATTCTGGGATAAGTTATTCTACCATATGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATCAAAAAAGAATAATTTTTTTTATCTGTTATATTCTCAATTAATTAGTTTGAT
AAAAATAATAAATTTATTATATCAATTATTTTCTTAATAGGTGTGTCAATTTAAAAATAGAGCGTAAGCTAAATTCTTAAAACTAGCAGCTTCCCAAACT
GGGCTTGGCCCATATACTGATTTTTCCCCTGGTTGTGACGAATAAAATGGAAAAATATATTTCTTTTTACCAAATATATTTTTTAATGAATCTAGTTGTT
GCTTGTAAAGGTATCTTATAAAATATTACTATATTTTAAAAATCATTTAAAGTTTAATTAAGGCAGAATAGTATAGTGGATTCTCGTACTTGTATTGGAT
TGTATTATAAATTATTTTACCTAATTTTTTGTTATTTCGACTCTTGAATTTAATAAAAATAAGATTTTTAAATTCCTCTGACCATGTGTGTATTTCACTC
TCCCTGACATGTTATATCCATGTCATATATATTAATGTCAAGTCATAATTTTCTTCATAATAATTTTATAGTAAAAATATTAAATAAAAGATAAATTTAT
AAAAAATTATTTTATCAAATAAAATAAAATAATTATTTTTGTATACCTTTCCTCCACCTTCCCTAATCCACCATCACTATCAGAACTCCACCATCTTCAT
ATCCCCATTTTTTTCTTCTTCGATTTTTTCACAATCCAGCAATATGATGTAGTCATGAAACTATTTTACCCCCACTAGTGTCATTTTAATTTATTATTGA
TATTTCTAATCCTCCCTATTTTCACTATTTCATCGCCAAGCCGGCGTCGTAAAATCTATTAGAATCAAATTGTAAAATCCAATATAGCATTTTCAATTTT
TCGGCATGGATAGCAATACAAACTTGTCGGAACAAGGTAGAGGATCTCATCGATGCCGGAGAAATTGATGGAGCCATTGCATCGTCTCCATTTTTTATGG
CGCCGTCCATTTTGCTGGCATTATCGTCATTTTTACCGTCGAGATCAAAGTAACAACAACCTAAGTCATCTAACAACCAAGCCACCTAACAACCAGATTT
AACCAAACTTTTCATAATCCAATGCTAACTACTATTTCACACCCCAAATTATTTACAAATACAAGAATAATTTTGACACCAAAAGAGGTCAAGTTACCCA
TTAGAGATATGAACAACTCCACTATTTTCTAATTTTTATTTGCTTATTATGTTTAAATTTTTTTGCCCAATTTCATTTTTTAGGTAGGGTAACAAAAAAA
ACAAGAAAAAAGTTGAAAAGGAGCAAGGAAAGGGAAAAAAGGAAAAGTGATGATTGAAGAGGAAAAAAAAGGAACGAGTAGGAAAAAGAAGAAAGAAGTG
AAAGAAAAATAGGTTGGAGTTGGGGTTTGACCGAAAAAAAAAGATAGTGTGGGGAAGGAGATGGAGATAGTGTGGAGAAGAAGATTGAGTTTTTTTCTTT
TTAAAAAATAATTTTAATTACTTAAAAGTAAAAGTTGAAATTTCAAATATCATATGTTCACTTGCCTTTGCAAGCGTGTGACTACACTATCTTGCCAATT
CATCTATATTATTGTCTCTATATTAATGTCACATAAAGATGATCAGTAATTATATTGTGTTATGTTAAATATAAGTGTCCAGATGACAAAAATCTAAGTA
GAAAAGTTTATAATATAATCTGATACAAGTATAAAAATTCATTAGACTATTCTGTCTTTAATTAATATCAATGAACTTTAACAAAATTATTCAATTGTAC
TCTCCCCAAAAAGAGTAATATTGAACTAGATGAAATCAAAATCATACAATAACTTTGTCTATGAGACTATATATTAATAGGGAACATTAAACCGACTCTT
GGGGATTTGAATCTATTGTAGGATTTAAATTGTAACCTATTAGCCTGTACCTTGAAACTACAAATCCTCGACTTCAAATTTCCCTTCAATTCTACTTTCT
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
AAAAATCATAACTCAAATCACTTCTCTAATTGTTCACTGATTACTGCTGCCCAAAAGTTCCATTTTGACATGCAATCGCTGACCAATAATACAGCAGCAC
AGATAAAAGGAAAAAGGGATTTAAAAAAGAAAATGTGGATGGAACTAACCAGGCAAATCCCAGGGCTCGAATTTGCAGATATCAATTTCACGAATAACAC
CCACTTGATCATGACAACCATTGATCTTCAAGCACAAATAATGATTGATAAGCTCCTCATCCGTAGGACGAAAACGATATCCAATGGGTAAAGTATTCAA
CGGTGGAACTTCCACCACCTGATTGCCCACCGGAGTTACAGTCATTACCAAGATCCAAACTTTTTAACACAGAAAACGAAGAAACTTTGATGGATTTTTT
TCTCAAAAGTAGATTCTGTAAGGTGAATCGAGAAATTCAAAGTAGAAAAATGAATAAAGGGGTCGATGTGTAAAACCCTTTAATTGAATGAGATGAGAAA
TGGGGGAATTTCCCAATAGATAATACTACAGAACATGAAACATCGCAGAAAGTGACATAACTGATGTAGACTTGATTTACCCAAAATCAAACCGCGTAAC
GAATACCGCGTAGAATCAGATTGTTACAGTCACTGTGGCAACGATGAAAGTCATCAGTATTCAGTCATGGCGCCAGTAGCAGACCTACACGTCGGATCAA
ATCCTAAATTAATTGCCACCATTTCAATTTTTATTATTATTATATTTTTTTTACCATTATAAATTTCACTTTCTTAAAAAAAATTATTATTGCAACCTTT
AAAATATGTCATAAATTATTAGTTTTTTTTCCAAAATATTGATAGTCTTGAAAAATACTATGTTATTCAACTAATTATACGTAGATACAATCCACTCATG
ATCTACTAAATGACATAGTATCAGTAAGTAGTGTCAAACTCTTATAAGTTAAAAAAAAATATTAAAAACGCCTCTCTATATATTTTATTCATAATTATAA
AATTGAATATACTTAAGTTCAATTAGTTAAATAATATTCTTGATCAATTAAAAGTTAGGACTATCTAAAAATATTTCTAACCAACTGAAGTTAATTTAAT
ATACCTCTATTAAATCTAAGTTAAAATTTCTAAGGTAGAAAAATATAAGTGAGAAAGTCATATTTAACAATAAAAACAATTATCGACCAATAGATAATGA
AATAAAATATAAAATAAATTGTAAAGTTTCTAGAATCTACTTGGACCGGGCCATTCCACAATCAATCCTATTCCTCTAACTTATATTAAAGGATATATTC
TACAAGTCACAATTTTGAAAGAGTCTTTTATAAAATTTATTTTTTTAAAAAAAATATTTATTATTTATTTATAAGAAATATTTTTATTTATAAGAAAATT
TTTATTTTACATGTAAAAGATTTACAAAAAAGTTCTTTTTTAATTGAATTTGAAAATGATTATAAGAGATTATTTTTGTGAATTTCGGCTCATCCATATG
TTTATGTCATTAATAGGATGAGACATGTTTATTTATCTATTTATATTTACATTATAATAATTATAAGTCTGTAATATGCTCCCTTGTGTATGAGTTTAAT
TATTTTTGGGTCAAACACATAGATATTCTTCCAATTAATTTTTTTTTTATAATCATTCACAAACAAAGAAATAAAATAGTGAGGTTAGTCAAATATCACA
AATACAAAAATTGAATTAATCAATAAATAAAAAAGTAAACCAAAAAAAAAAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTCCTCCAATTTTATATTTCAAATCTTTCTATGACTAGCAGATT
CATAATACTTGTCATTTCATAAAATCAATACATAAATTATCACATTCTTTCCTTTTTATCTTTGTGAGTGATTAGCCTTGAAAATATAAATTCGACTAAC
TTGGAAAAATTAAGTAAATAATTTATGTTTTCATTATTTAAATTAATTAAAATTAGTCAATATATATTTATTGATTGAAATCTTGAGTTCCAGATAACTA
AACAAGGATAAAAAAGTAAAATTATATTATTTCTTAATGTAATTGGAAAGTAAAAATATGACAAATAAAATAAGATGAAAGATGTATTTTTTTTCAAGAC
ATTATATTTATTATATTATATAGTAAAAATAATTTTTTTTAATGAACATGTAATATTAAAAGGTATTATTAGATGGAAGGGCGGAGTATGGGACGGTGGT
ATTATTAAATACAAAATTGTTCCCGTGAACTAATTATTAACCATTCCCCCTTAGGAAGGAAACATTCCGAATCTCAAGACAAATCTAACTCTTTATTCCA
ATAAAACTCGACGCCGAAAAAATGTAGGAATACACACACCTTTGCAATTGAACTGAAAACAGATCTAGACTTGAAAAGGACAGCACAGTAATTTTATCTA
ATATTCCCTTTATTCTTTATATACCCAAATGATAATTCCCTTTTTTGATGTCATTCTTGAGTTTTATCTTTTTCACTCCGCCATGGATGATGACTCTAGC
TCGTCAAGTCAGTCTTGTGAAAGAAATGAAACAGTGAGATCAAGGTGGAATCCGAAGCCGGAACAAATCGTAATACTTGAATCCATTTTTAATAGTGGGA
TGGTAAATCCTCGAAAAGACGAGACAGTTAGAATCAGGAAAATGTTGGAGCAATTTGGGGCGGTTGGAGATGCAAATGTGTTTTACTGGTTTCAGAATCG
GCGGTCAAGGTCTCGCCGTCGTCAAAGACAAATTCAGGCGAGTCTTAGTGCTGTTAGTAACAGTAATGAAGAACAATCTGCAAGGTCTAGTGATGGCGGT
GCAATTCAATTTCAGACTAATTTTGTCCCCTCCTCTGTTTCTTCTTCTTCTTCTTCGCTTGGAGGTGTTGTGGGAAATGCAAATGATGGCCTCTTCCTCT
TTTCGGGTCCAATGGGAATTGATCAAAACTCTTCAATCACCTCAATTTTGTGCTCACCGACAGACAATTCTAACTTGAATTGCTCTTCCTCAGGTTCTAA
AGATCATTTATGAAAACATTGTTTTAAATTAATTACAAGTTATAGCTAGGATTATTGTTGTTGATGTTACTTTAGCTTAGTTTGTTCATGTTTGAATTTG
ATAAACACTATGAGAATTAATAGAAGATATTGTTACGAGATTTGTGAAGTAGAATGATCAAGTTGAAGACATATTTATCAAATTTAGGCTAGGATCGAGT
TAGTTATATACATAACGAACTCAGCATATGCACCAACTGGAAGGAGAGTGATATTCGTAATACGACAGTAGGCATGCAGGGAAGATTATATTCACTGGGA
AAATTGTGTTATTCTATTTGTTTCTCGTTACTGTACGCCCAGTAATTCATACTGTAGCTTCTTTCTCTGCTCTTGCGTTTGATCTTCTGCTCATTAATTC
TTCTTTTTCACTAATTAAATCCGAAGTAGTGTAACTGCATACTGTTTTGCTATTCAGTTATGTTTCAGCACATGTTTATGACTGTCATACTGTTACAGGG
TTTATCACAGTTTTTATTAATGGAGTAGCAGCACAGGTGCCCAGAGGGCCACTTGACATGAAGGCTATGTTTGGCCCCGAAGACTTAGTCTTGTATCATT
CCTCTGGGGTGCCACTCCCAGTTAATGAATATGGTTTTGTTGTTCAGAGTTTGCAGCATGGTGAAAGCTACTTCCTGGTAAGCTCTCATCAACCACAGGT
AGCGGGTGGAAGGGTGTCGAATAAAAACATGAATTAGTATACGTGCACCCAAGCTGGCTTAGACACCTTGCTTATTAAAAAAAATGTATATTTTGATGTT
TGTTGTCAATTGATTTTCTCATATTCTCTTTAAGGCTTGTCCATGCATTTTACTATACACACACGTAACGTTATATATACTGTAACGATTCTTGTTAAGT
CACAGTCAATTACAACTCTTATTGAACAATGTAGTTGAGACATGAAGCATAACAATGTTATCCCTAATGGGCACTTCAAGAAGCAGACTGATATCCGTGT
GAAGACCTGGTTCAATCAAACAGCGCACAAGCAGATGAGAAGAATTGGTATATAATTCTGGTTCTTGTTTTAATTTTGCTGTCATTTACGCAGCATGGCG
AACAGATTTCTGACTATTTTTTGTTTAATCCAATTGCAGCAAGGCAAGAGATGGCTGTGAAGATCCCCCAACAACTGTTGGAGCTCTCCACCCTGTTATC
CATGGTCAGACACTCAAATACAACATGAAAGTTAGGTCTGGTAGAGGATTTTTCTCGAGGAACTTCAGGTATGTTTGATTGAGTTTTATGGCCTAATTTC
CCATAAAATTAACTGTGAGATGAGCATGTTCTGAGTGCGAACTGCCAGGCTGCAGGCATATCCCTAAGAAACTGGCATCAACAATTGGTATTGTTGTTGA
TCATTGTTGCAGGAATCGTTCACCTGAGGAGCTTCAAGCTGATGTCTTGAGGACCTACAGGGCCTAGTTTATTAGTTGTCTTAATCAAAGGTAAGATAGG
TAGTAGCTAGTAACTGGAAGCATAAATGTGTATACTTGAAATGTTTTCCCTGTTTGTTTCCTAATTGTTGCAACTGCATTCAGGTTGGTGAGTGTGCCCC
CGAGGAATTGGCTACAGCAACACAAGTTGATGCCTACATGCCTGTTGTGCGTGACAAGCCATCTGTAGATCTTGTTAAGGTTACTGAAGATATGAAGTCA
TTCAATGCCTATACGAGTGGAACAGACGAATGCGCTCTAAGAGCGATTCCCTCAAATTGCAAATCCTTTTTGTTGTTCTAATAATAACATGCTCTAGTCT
TTAAAGAACAGAGCACAGAAGCGCCCACAGCTGATTTGGATGTTTTCAATCAGAAAATATTGACAGAAGAGCTTGTATACAAGTAGAGGCGGTGTCAAAT
ATTCAGATAAGAGAATTGAAAAAGAACATATATATGCTAATGAGATTTAGCATATTTATATTTGAATTGTTTTAGTTTATCCCGCAACAACAATAATCTC
AATGATCAACTAAGGACATGTAAAATCTCTCTTATTAATATTGTTGTTATCGTTAAATATTATTATTTTAGAGGTTTATTTCTATTTAGAGAAAACAATG
TTGATGATGAAGTTGAACATAATATAATAACTTTAGAATCAGTTATGCGTAAAAAAACATTTATTGCATTTTAGAGATCTTCATAATTTTTTTTGTATAG
AGAATTATGGATGTAATAAAAACAAGGGAAAATATAAAAATATCACCAACCTATATTCAAAATCTTAGAGAAATATTTATACTATATTAAAATTCTATTA
CCCCTGAATTTATTTTTTAAATAATTTTTTACTTCTTTACAGTTTACGTGGTGCTATCTTGTGGTTCCAGCGCGTGTTGATATTTTTTTAAAGCTAAGTC
ACGTAGTCGAAAAGGGGTAAAAAATTATTTATAAAATAAGTTCAGAGGTAATAGGACTTTAGTATAGTCAAGTCTGTCTCTGAGATTTCGGACATAAATT
AGGGGCTACTTATGCATTTTTTCTGATATGGACTTTTGAATTATTTATAAAAAAAAACACAAGAATTATATTTCATTAAATTGTTTTGAATATTTTTCTA
ATTTTAAAGAATTATTAACTTATATTTGTACTCACTTCGTTTCAAAAATAATGTTCTAATTTGACTTGGAACCGNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTAGCTTATGTTCTTCATCGTCTTC
ATTCCATTGCTTTGAAATTAGATGTGAAACCACCCTAAATCATCTCCTAATTTCCTTAAATTTTAGATATAGGCTTCTCAACATGTCCAACCTTTTGATA
TATTATCCACTCAAAACGGTGCTCATTTGTGGCAAGTCAAATTGTTAGCTCAAGCTTTTAAACCAATTTTAATGGAGGTTTCAAGCTTGTCGATTTTCAT
AAAATTTTGGGCATCACAACCATAAACTCAATCAAATTCAATGTATTCAATTTTGAAATAATTAACAAACATCTATGTTATTAATAATATTTTTCAAATT
AAAGATCCAAAATACATTCATAAACTTCAATTTTTTGTCATTAAATTGTTTTTTAAATAATAAATCAAAAAGGAAATAGACTTTAAAAAAAGTTTTAAAT
AAAATTTCTGCGGATAGTGAGTCTCACCCATTAGCATAGATGTGGTTATGAAGTTTTAGGGGTATAATAATTCTTGTTTTAAACAGTTCAGGGAGGTGAT
AGGACACCCGTAAAAGTACGAGTGTGTAGTTGGAATTTCGAATATAGACTGGAGGGGCTTTTGACCATTTTGTATGAAAAGGGCTACTTTGATATTACCC
TTGTTTGCGAGCTATGTAGATAGAAGTATTTCTGACAATAGAACGTAGAATCCTTTGAATATTTATAAAGGCGAATTAGAAATACAAAGAATTTTTGTGT
TACTATTGTTGTTGTTTTGATGAAAGTAAAGGAGCCTCAACAAATGAATCAACTTGATTAAGCCTAAAGATATGATTGAAAATTAAATCTCAAAGCCCAT
TATTTTATGTATACATTATTTACTTGATAAGTAGAGAGTTATTATTTACTGGGCAACAGTTTCAGCCTCTTTTTTTTTACTCAGCTGGCTGCTGCTCTTT
GGGCTCTTCTTTCACAGCCTCAACTTTGACTTCCTCTGCTGTTTCCTTTTCTGCTTCAACAACAGCCTTTGTCTCTGTGCTTGCTTCCTCAATTTTAGTA
TCCTCTGTTGACACATCAATCAAAGGCTCTTCCTTCTTTGATTCCTCTCCATTTTTCTCCTAATTTCATAAAAAAATATATATTGATGTTTCAAGAGTAT
TATTTTCATATATGTGATTTCGAAACATGATAAAAAGGATTTAATCACTACATCAAAAATGATCATTAGCGGAAAAATTAATTGTTAATTGCTGCTAAAG
CACTTTTGTATATGTCTCTAAAGCCTTTAGCGACATTGATTCTAATGACACTTAACTAATGCCGATAAACACTCTTCATTAATGTTAATATTTATTGTCG
CTAAAGATTGTTTTTGTTGCAGTAACTCATACTTAGAAATTGTACATTTCAAAAAAAAAAAAATGTCAAACATATAGTTGAACGAGAAATCAACCCTTTT
GCCTCAATGATGTATATAAGGGTAACTCAGTGCACTTAGCTCCTCGTATGACATAACTACATTGAGTCTATTGTATTTCTGTAGAGTGCGATTTTCATGA
CCTGAATCTTATCTTACTGTGATAATTCTTACTATATATATATTTTTTTAAAAAAAAATAAATGAAAAAGAACATGTATATTTATTTACTATCTCCTTTT
CAATTTGTTTGTTTGATTCTGAATTTTGTGTTCTTAAACTAAAGGTATGGAGACTGTACCAAAATACTTTTAAGCATGTCAGGTGAAAAATTGAAATTAA
AGAGTTTTCAAAATAGGAAAGAGGTCTTTTTTTTAAAAAAAAAACAAATTAAAAAAGAAATACGACAAACATATTAGATTGCATACGTTCATGACTCATT
ATATTTAAATTCTGAATCCGCCTATGAGCAGAAAACAATGAAGTCCATATATATATATATATGTATACTCAAGTAGCAAAATGCAAGAGAATTAATACGA
AAAAGATACCTGAGGAACAGCGTCAGCCTTAGGGCTGACAGATTCCTCGACGGGAACAGGGGCAGGGGCTAAGTCCCTGTCCAAATCCTTAGGTCTGCTC
GCACAAGCTCCCATGTTTGTTAGAGGTGAGCGAGAGAGATGGACAGGAAATCAAACTTGAGAGAGTAATATTAATATTGAGGAATTAAAGTTGTAAGGCT
TGTAAACTTTATTAATTTTGAGGCTGATTTTAGAAAAAGGACATAATGAAGGTTTTATAGATAGGCCTCCTGTTTTCTTGCTGTGGACACAACAGAAAAA
AGCCTTTTTTTTTTCTACGGGCAAAGCTGATTATTAGGCAAAGTGAAGGCCTCCATTGTTGTTTTTAAAAGAGTTCGTTACAAAATATGGTTGGTGGACA
TTTCGTCATTTTTTGAGGAAAAAACGCAACTGGTATTCGAAATCCATTCGATTCAGACTAATTCAAATTTATGTCAACTTAATATAACTTAATTGCTATG
AATTAAGTGGTGAATGTGTAAGTAATTAAATAATTTGCTAGATTTTCACTTGTTTTGATAAAAATTTAGGAAAAATGATAGAAATCCACGTTTAAATTCT
CTTATTACTATTATCCCCTATTAGTTTTATAAATCCTCAAAATCACTTATTTTTACGCATCAGATTAATGTATCAGCGCATCGAATTAATATATGTCGCG
CATCAGATTAATGTATTATGTATAAAATGTACATCATATTAGTGTATCACGTATAGAATGTAATGTAATGATTAATGTGTCTCGCGCATCAAATTAATTA
TCAACGCTTATATTATTATATCAATTTGAAAATTTTCTATAACTATAAACTTGTAAGGGGACAGATAGTAATTCTACCTTTACAGTATATGATTTACGTT
CTTTTACCCTAAAATTTTATCATATAACCCCTAATTATACGTAGGTGGTGGCACTATAGTCATTTCACACTCTCTCTATTAATTTTAACTTTTTTTTCNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGA
TGAAACAGTAAATTCTACTGAAAGAGTGTAAGAATGCTTGTTATTTGCCTGTTGTGCTATATATGAGTTGGTGTTGTCAATATACATAGCGTTTGATGTA
ATATGCATTTAGTGCTTGATGTATCTTAGGCATATCTGATATTTTAAAGTCTAAAATTCGCTTGAGTGAAAACTTTGTTTAGCTAACTGTATTGGGAATC
ACACTCACTTTTGTTTCCTTTTTTTAGCTAGTGTGCTCAAAGGAAAATTCGACTTCTAGGAAAGCTGCTTCCTTTTCTTAGCAAGTGTCCTCGAGGGAAA
ATTCGACTTTAGGAAAGCTGCCATCTGCATAAATTTTCCTTAATCATTTGATAAAAACTCACTCTGTTTCTCTCGGAAAAAGAAACCACTTTGTTTTTTG
TTGTCGGGTTTGTTATTGATATACCTCTTGGTGTAAAGAGGAGTAAATTGATATACCTCTTGGTGTAAAGAGGAGTAATGGTGAGCTAAAAATTATGCAT
GCAAGATTTGACTCGCGGTAAGTGATGGTAGAGTACTTTAAATCAGGACAAGTTCGGGGTTTCAAATTCCCTTTAAGTAGTTTGATATGGACCTGTATTA
ATTTTATCACGCCTTAGATACATTATGTTAGGGCTGAGATGTTTATACCACCAAATTGTTGTGGACATCTATCTTCATTTCTTTCTTTCTTTCTTAGATT
TTCAACTCAACAAGTATTTACTGTTCTGGTTATGCAGAGAGAACCTTGAATCCAGAAAGCGCCCAGAAGCCTCGTCTAGAGTATCTGCAACAACCAGAAA
ATCTCAAGATGCTGCTGTAGGTGCCCTTGTTCACATGTTGAGAACTGCTCCTCCGCTGCGTCAAGATTCTACTTGCTATACTACAGATTCTATAGAGGGA
GAGGTAGAGGGGGAAACTGGCACTGCATCTCAGTTCTATGTTCCTAGGAAGGCATCAGATGCATTGGAGGAGCTCAAAGCTTATACTGAGTTGAAAGATA
TGTTACTTCCCAAGAGCACGACCCGCTCAGACAGTGAGGATGGGAGCTATGCGTGATGTACATATATACTTGTTTGCTAAGTAACGTTAAGGAGTGTTTA
CTGTGTGAGAGAAGTGAGGACTAACAGATTCTGTACATAAATGATGAGAAATGGCAAGTATGATAGTTAATATGCTGCCTTATTTTGACACTACTTGAAA
ACATTTGTGTTTCGAAGAAACAAGTAGTAGGTATCTTAAAAGAATATGCTCTATTGAGTTCCTAATAATTATTTTTTTTACTATAATATCTAATTTTATC
CTCTAGTATTATATTATCTACATGAGTGAGCTTTGCCACCTGCGTGAATTTGGATTAGTCAGGCTTCAGCATAGAGTATTGGACACAGTTGGCGCGAAGA
TGAGGTAAAAGAAGAGTAAGTTGAGATTAGAAGAAAAACAGAATAGAGACGTTTTGGTATTTTGAAAATGTGATGGTGCTAAACTATCAATAAGACTGAA
TTTTTGTATTTTTTTTTTTGGTTTTCCAAATTTTAAAGATTGAAGCAAGGAAGCTGGCGTTTTAGGTTTATATATTGTAAAATATAAGAAGTAAACTACT
AACATTTATAAAAGAACCATAAAATAAAATTAATAATTGAATCTTTTAATAAACAAAAATAATAGGCAATAACAAAAAGGGAAATATCTATATTATTTTA
ACATAAAAGTGAAAATGAAAATAGGAAGAAAAAAAAGGTGTGCCAAAATAGTAAACATGTAGATTCACCTTAGAATATAATTTGGTATGGTTTGGTTTTC
AATTTAGCAAAAGATACATATTTTTAGTTATGTCACATGTTGAATGCGATTTTTTTTATAATTTTTATCGTGTAATTAAATAAGTGAGTTGTTTTTTTAG
TAAAATTTATTGGGAAGAACTAATAAGTGTATTAAAGGTAATTAACAAGATCCACTTCACAACTTAGATTTTCTTTTTCTACTCAATATTCAATATTCAC
ATTAACTCTAAATAATTCAAGGAAGGGCGGACTGCACGAAGAGTCTTTTGAGAAATGACTCGTGGGGAGGTTAGAGCAACAGATCTTTGGGATTTTTTTT
TTTGAATTAGTTTATTTTATTGAATGGGTCGTTGTATTCTGTCAGGAACGCAATATCATTTTTAATTTGATGTATTTCGAATGATTAAATACATCGCTGA
TACAAAGCGATATAGAAAAATTCTTCTTTATCAATAGTAATCGATCATAATATAAAAAGATCAACTTCTACTCGCCAACACACAATCCTTGTTAGTTCAA
TGCTTTGATCTCAAACCGCGGTACAAGTCATATTTGTATCTCTTTTTTCTTGTGACTATGTAGACCGGACACAAAATTTATTGTTTAAACAGTATTATAA
ATTATTTATGTCTAATTAATTACTAGGAGTACTACAAAAAGTTAAATTGAAATTATTTTTTTCAAAAAATTCAAAATTACGTTGCCCCATAGGGTTTATA
AAAAGAGGAAAACTGGGAAAGAGAAGAGTTTTCCCTCCACAATCCTGCCTTTTCACGGAGCTCGATAATGGCCGATTTCTCAGCTTGCCCTATCTGTAAT
CTCAGAGTTCTCACCTCTGAACTCGAAAGGTGATTCTATTTTTGATTTTTTACGTCCTATGTCAATTGCTATTTATTTTTTGTTTCGAGAAAGTTGAAAA
ATTGATGGATTAACACAGGCACGCTAACAGTCACTTCGACGATGAAGACATTGACAAAGACTTCGAATTGGCTCAACAAATTGCCCTTGACCTTGCCTGT
ACCCCTTCAAGTCCACCTTATATCCCGGTACTCTTTTTTTTCTTCTCTTTGTAAATTATTCTGTTTTATACTATATCATCAATCCCCGAGATTTAATATA
CCAGAGTACCAATTCTGATGTTATCTAACTGCGTCCATAGAATTTTGAAGTCACACTGGTACTTATTTGGCTGCAAATCATTAGAATTTTGGAAAAATAA
AGTTATAATATTCTCACCTTTTTTAAATTGGTATATTTTTGCTTAAAAATGGCTTGTTACTGGAAAAAGGATAGAGGGTGACAGAGGACATTTAAAAGGT
GTAGGCTTTGTTTACTAGCTCTAATTTTCTAAAGCCTTGTTTTCGTGATTATCAGGTTGATGATGACATGCAGTGTGAAACTAGTTCTCGAAAGGATCGC
GAGTGTAGTATTTTGAAGTATGAGGCCAAAAATTGCAATCATGGAGGGAAAGATATTGATGAAAAAGCAAGGATTTTATCTAGTGTGTACCTTAATGAAA
CCCGACCTCAGATTGGACAAGGGTTAATGGATTTGTTGAAGAACTGTTTAGAGTTGGAGACTGAAAAGACCACCACTATTTTGTGTGTTAATGTTGATCA
TTTCCAAAGCAGCCATTCGGAGGATTTTGGGTGGGGTTGTGGCTGGCGTAATATCCAGATGCTTAGTTCTCACTTGCTTAAGCAACGACAAGAAGCAAGG
GAGGTCTTGTATGGAGGTTCTGGGTTTGTACCTGACATCCCTTCACTCCAAAGATGGCTTGAAATTGCTTGGAAAAGAGGCTTTGATAAACAGGGATCAG
AAGACTTTGATCGAGCAATTTATGGCAAAAGAAATTGGATCGGAACTACAGAATGTGCTACGCTCTTCCGTTCATTTGGCCTTCGTGCCAGGATAGTGGA
CTTTGTAAGCCGGGAGATAGACATTAGGTCAAGTGGAGTTGGTAAATGTGTGGGCAACATGACACCACAAGTTTATGGACCAATGGATGGATATCTGTCC
AAAGGGAAAAATTCTGTATCCAAGGCTGTTCCGATTTCGTATGATGTAAAGGCTAAGCCTAAGGTCCAGCAGGCACTCATTGATTGGGTGTGGAATTACT
TTTCTGACAATAAATCCAGGAAATACGGCAATCATGGTATCCTAGTCAGTCAAAAAGCGTAAGTGAATTTAGTGAGTGACTGTATTTCCTTCATTAACTT
GGATGTATGTGATAATCTTTACTTGTGCATAAATTTTCTTGGTTACTGATCTCTTCTTTCATCATCATTCTCTTTTTGGTGATGGGTCTCTTATAAGCTT
CGTTGAAACAGGCCTTTGTACTTCCAGCATGATGGCCATTCAAGAACCATTGTTGGGATTCAAATGAAATGCCAGAGAAATGGACCGATGCAGTACAATC
TATTGATCTTAGATCCAGGTCATGTAAGTATTTGCACATTTCATTCATAAGCAAGTCTTGTCCTCGAGGTTCTATTATTGCTTTGGTCTTTAGGGCTTCC
CTATATTGATGGCAGTATTTGTATTTTTACTTGAAAAGTGTATGTGAAATCCATTGTCTCCCTTTCCTTAGTTAAATGGTCGTAATGTTTTTTTTGTGTA
CTGAAGATGTAAAAGCATATTATGTTAGATGGCGGGTGAGGATTTGGAAGCTTGCCTTATGCTCCATAAGTTCCTTTATTGGCAATTGGCTTTCGTTGTT
TAACCTGCTTATGTATAATTGGTTCCAGGACCAAGCATGTAAGGAATTTTAGACTCTTGCAGTAAATATATTGTTTAGGGTATTCTTAAATTACCAGTCC
ATCTAAAAATATGTGGTCTTGAAAATCACATATGAGAGATTTGTGATTGTGCGTGCTGCTTACCTTTAATAGAGTTGTGCTGCAAATGTGCACACTTATA
AAAGGATCTCCATCAACTTGGTACAATCTGTTCCCTTTTTGTTAGTTTTCATCACTTGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCAGTGTTAAGAAGCTGGTTTCTCAGCCTTCCATCGATC
TGAGTTCCATGCTATCCGTGAGTATGCTTTTAGCTCTACTTATCTTGACATTGAAGGTGTAAAATTTAGATCATGTCAAAATGACATAATGCTATCATTG
AAGTTGTGTTCTCCTGTAAGTTAGAAATGATTCTTTCAGATATTTTTGTCAAAAACATGCTTCTTATTGACTCGCATGTCCCTACAACTGTATGTGCTTT
GATATTGCATGAGATGCCCTAGGTATAGCTGCTTTGGGATCAAGCACAAATTTTAACTTCAATTATCGTTAACACACTTGTCCTCCTACAAGTGTATGTG
CTTTAGTCGTGCATTAGTTTGCCCTTAGCATAGCTGCTTTGAGATCAAATCCAAATTTTAACGTCTGTGTTAAGACTACTAAGTTTCATATATTGTTTCA
GGTGCATATAGAGATAGAAAGATGTTTGTCAAGTCCTAATTCAGAGTCTAATTTCGTTCAGGAACTGAGCTATGCTGGTGTTCAGAGGCTTTTAGGATTC
ATATATACAGCTGGAACAGTTTCTGAGGCACTTCCACCGCCAACATCTTCTCTAATCTCATCATTTCTGTTGCCACATAATCCAAATGTATGAAACTATG
TTGGTTTTCTCCTTGTGAAATACTCTCGGACAAACTTCTACTTTGTTGTGAATAAGCTGTTTTTATAGTTATTATGATTATTGAAAGTAAAGGATTATTG
AGATGACATTTTTTTAATAGAAGTAAATTGAGATGACAGTAAGATGAGAAAGAAGAGAGAACTGTATCGCGTTGCGTCTGAAGCTCCATCAACCTCTTTG
CCACATTTCTTGGCTAATAAAAGCAAGCTCTTCCGCTTGCCTTGTTGTACGTCAGTAGGACACCAAGAAGTAGATAGAACTTCAAATGTCCACTTGATCA
AAACAGGTGACAGGAGTTGGACTGTTTTACTAAAGCAGGTTCATGCTCCTTATTAATGTCCATCCTATGTAAAGCAATACCATTTCTTCTCCATTCTGTT
ACTATTTGTCTTAACAAGATGGGTAAGGTGGACAGTGGATGACATGTTGAACTATTAAAAGTAGGAGAACAAGAAAGTAGGAAGAGAAAAATCTCTGGTG
CAGGTTATTTTACATATTAGAGTAATCCTGAGGTATCTAGTTTCTGCAACAGGCTAAAGGTTGTACATTGACTGATGGAGCGAGGGCATTGTCAAAGCAC
GTCAACAGGAGCAGTGACAAATACTGGGGTAGTTTTTCTGGAAGTGGTTAGTTCCTCACTTCAGAGCTCTTCAACATGAACATCCTTGATTTGCATGTGA
GGTTCTAATGCTTGAGTTGTGCCTGTTATTTTTCTTCTTTTACGAGTACATTGTTACTTCTGGAAAGCAATTCCTGTTATCACCTGCTGCATGATACCAA
CGATTCATGTGCTACTGTCTCGTGTTTTTCACTTTCCAGATTCTGATAAAAATAGGAATGCCCTGGATGTCATCAGGAACTTAATAACGTGTTCCTGCTG
GATGAATATTCATATTGTTCCACCACATGGTGTTGTTTTTGAGATTAGAGTTGCTAATGGTTACGGTGCACGGTGGTCTAAAGATGGAAGTAAGGTACAT
ATACTCTGATTAGTGCTGAGCTGAGGTTCCTTTTCACCATTCATGAAAGTTTATATATCATATAACATAATTCTTACAAGGTTTCTGATCACTTATCAAT
GAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNTGAAAACATATCAAAATACTTTTTTTATAGACATGATGTAATATATCAAACATTTCAATATTGACAATGTCCGCTCCTACTTTATATATTGTAGTA
AAAATATATAAAAGCACTTGACAGAGAATCTTTTAAAGCGGTAGTCAAAACGAACTGTTAGATTACGTCACGTCTTTTGATATATAATACATTGGAGCTC
TCTATTCAACTTTGTGTGGATAATCAATCAATTGTTACTTTTCAAAAGATTAACTACACTCGTAAAAATAAAAAAATATTGAGAATAAAAAGTTCAATGG
TCTTACTTTTAAATTATAATAAAACATACTAAAATCAAAATTTAAATATTCTGAATTTATCATCGAACTCAAAATTCATTTTAACAACGTGCAATTTCCC
TTGGGCCTTGACCAAGACCTTTGCATAGCTTAAGGCGTAAGGTTCTTCCAATCCTTTTCATGATATTAAAATACAACAAAACAATACACTAAAATTTGGA
GTCTAATTAAACAAGGTACTTTTTGTCTGTTTATACTTTCTTCCCACATACCAATTGTTAATTAGCTTAGAAGGAAAAAAGATTGAAAATGACATTTTTG
TTAATTATTGTGTTTGGTCCAAAGACTCAATTGTCTCAAAACTACTCAAGAGGCAATATTGAAATCATGTACAAATGTAATCACACGTTTCAAAAATAAG
TGATGTTTTAAAATTTTAAGAAGAAATTAATCTTCGTTTTTTAAAAATAATTTTTGTTTACATAATCAAGAACCATTAGCTAACTTAAAATGTGAGACTC
CTTTGAAAGTAGGGAAAGTTGTATATATAATAGCAAATTAATAACCTAAAATAAATGGAGTAGCTAGGGTTTGATTTAATTGTGCTCCATAGCAAACGTT
TGCAAAAAATTGCCAGCGCCTCTCTCCCAAATCTATCGCTCGCCACTCTCCTCCAATCTATCGCTCGCTTCCTCACTTTTTATACAAACACAAGTGTATA
AAAATTGTTTCTAATTGTATAAAGCAGAGAAAATTGTATAAATATATATATATTTGTTCCCCTCTCTCCCCTCTTCCAGATCTGGCTCGCCACTCTCCCA
AATCTCGCTCGCCACCCTCGCCTTTCTCACTTATACAATAGAAGCGAAATGTATACATTGCGTTTCTGTTTGTATAAAGCGTGAGAAAATTATATATACA
CATGCAAGTACATATATTTTCGTCCTATACACTTATAATTATACAATAAAAGTACTCCCCTGCCCAGTTTCTTTTGCCTTTATCTCTTTCTCGTTTTATA
CAATTTTCAAATTGTATCTAATTTCTCTCTTTCTCTAATTCAATTGTATATTCCTTGTCAAGTCTCTTTTGTCTTTCTCTCTTTCTCATTTTATACAAAT
TCAAATTGTATATAATCGTTCTATACACTTATAATAATACAATTCATTTTATACACTTTGTTTTTATACAGTTCTATGTCCAAGTGTCTTTCTCTTTCTT
GTTTTATACAATTTGCTTCAACTGTATAGATATAGCGAATTATATAGTTTCTATGTTTGCTATTGAGCGCAATTATGACAAATATAAATTTTTTATTTAA
TATATATGAAAGTTACCCTTGAAAATATGTCTCAATTAAAAACACCACTTATTTTAAAATGAAGTAAATATCACGATAGATAAATTAATGATCCACCAAG
AATAGACGTCTCACTTATGGGAGTAGGTATACGAGCAATGTACCACTTTAAATTCAGGTAAACATGAGTTAATATATCTNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAAAATGTAAAACTTATTTT
GTTATATTTAAATTATTATAAGATATAAAAGTGATATCTTTTATTTTAAAAATAGAAGTATAGTACAAAATTGAGTGCCTTTTGCCCAACTAGTTTTAAT
GGGTTTTCGAATTTTATCTATTGTTTGGTCATAAATTTGTTATATTTTTTTTTTTGAAATTTAAAATTCAAAATGCTGTTTTACAATTTCCACATCGATA
AATTAAATAGAAAAAAATATTGTTGGGCTGTTGTTACTGTGTAATTAGGTTATTAATGAATTAATAAAAGAAAATTATTGGATTATTGGTTCGATATCGA
ATTTTACTATTGGGTTATTGGATAAATCGATAATCCAATAAGATAGTAATAATTTATTATATTACCCTCCCTAATAATTTAATATATAAGTAGACACTTC
AACTATATCAAATTATTAATAATCTATCTACTTCACACTATACCGCTTTACTTGCTTTTATTGTTTACTAAAAACCTAAGAACTACCGTAAGGTTTCACA
ATTGTAACTTTTACTTTTAGTTTTAGTCTTGTTGGACTAGTTGATTTTAATTTTAGTTTGTAATTGTAGGTTGTAGCATTTGCAAGTTTGTAAAGGTCCG
TACTATGTTGTTGGCGGTGACGTGTAATTATAACCTTCGTACTATATTTAGCTTAGTAAGAAGTCATATAATATTTTACAAATATTTTCTTATTGGGTAA
ACCGAGAATCGAACCGATAACTATCAAAAATCTATAAACTGAAAACCGATAAATAATATCTTATTGATTTGTTATCGGATTAGCTTATTTAAAAACCAAA
AATCAATATACATAAGATCGAATCGAACCTACCGATGCACACTCCTACTCTAAATTACCCGAAATTCCAAAATAATTATAATTTTCAATTATCATTTTTA
ACTTAAAATCAAATAATTATCAACGCTATTTAAAATAATGGCACATCCAAACAACGGAATTGTTTTTGTTACCGTCTTCGATTTTTAACGCGATCGACAT
GTGTAAAGAATTTAACCCACCACTTAAAAGAAATGGTGTGGAGCCAAGTCCGGTTTTCATTATGTGTTAAGCCCCAAATTACGTCCGAAACACGTTGGCA
GTCTCACGTATATTTTACGTAGTTAATGTGACGTTTATTTTACGCGTCACGTTTATTTTACCGTCCTATCCAGTACTAATTTAATCAAGTCAGTAAAATG
TGAACCCATTAACACTAATTAACATTATCGTGATTTGGTTCACGTGAAAAAAACCAAGCCCACAATATCTAAAATATGTATATATATATTAGCTACTTTA
AGCTTCAATGACATTTTAGTTCTTGTATTATTACATCTCTATTTTTGTGTTCTTAAACATGATGACAACAACAAGTGTTCTTTCTAGTGGATTCAACCAC
TCAACCCTCCCTCAATCTTACGTTCGACCTGAATCTCAAAGACCTTGCATGTCTGAAGTTGTTGATAGCGACGATCTTGTCCCAGTCATTGATATGTCTT
GTACTGATAGGAACGTTATCGTTCATCAAATCGGTGAAGCTTGTCGTCTTTATGGGTTTTTTCAGGTTCTTTTTTCGTACATTCAATCCTTTCAGATGTG
TTGTTATTCTCGTTTCAATTCATATAGCAACATTAGTGTTTTTTAATCACATTTTTTTTTCAAATGTTTAACTAGTAGTTATTTTGGATTTTTTTTATCA
GGTGATAAATCACGGTGTGTCGAAGAAGGCGATGGATGAAATGTTAGGGGTAAGTCATGAATTTTTTAAGCTACCAGTTGAAGAAAAGATGAAATTGTAT
TCTGATGATCCATCTAAGACTATGAGATTATCAACTAGTTTTAATGTTAAGAAGGAAACTGTTCATAATTGGAGAGATTATCTNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGCTTATGTACCTTCT
CTCCGATGGTGTCCTGTATGAGTGACATGTGGTTGCTTATGCCTGTAAGTACTTTGCCAGTAGTTAACTCTGTATCAAATGCCCCAATATCCTGTCTTAG
CACTGTGTTTAGAAATTTCAGTCTTAAACGTGCTACTTGTCTTTGACTAGCATACATCCAGCATCCTATCTCTGCATATTCCACATTACCACTTTTTAAG
TACAAAATTTATGGAGTTGAGTTTCTACTATTCCAAATCATTGATATTTTGAGTCTTGCTTATTGAAACTTTAGTATGATAGTAGTAAGGTAGTTACCCA
GCACTCCAGCTGGAAATGTTGCGAAGGCCATATACCAGACATATGGGACGACCTGAAATTAAGTAAAAGCAGAACAGCTGAGTTAGGACCCTTCTCCAAG
TGAATATGTATTACACTTCCAAATACTTTTGTTTCAACTTTTAACTTCAAATATTGTCTGAACACCTACTTCATGATTTTTGATATGCCAGTAAAGTTAG
TTATACCTTTTTGAGTGCTCTAACCATAGCTGCTGTGTCATCAATATTGTTTCCAAATGCATCAAGTGCTTTGCCTAGCAAATAATAGCCAACAGGCTGG
GCAAGTCCATGGACAATGGAACCTAATGTCCCTAAAGCCATGAGTGTCCAGTCAAGTGCATCTGCTTCACTTAGTAGTTTGTGAAATGGCAAAGTCTCAG
ACGTAGTTTTCTTAGTTTCATCGCCCGTATCCTCAGTTTTTTCTCTCTGCTCATCATGATCATCAATGGCTTCTCTAACTTGAGCCATCTTTCTTTCTGT
TGCTTTCATGCACACGTACTTGCTCTATTTATATGCATGTGTTTTAACATATATTTAATACAAATATGTAGTTAATAACGTCCACGAGGAATATTTGCTG
GGATATACCTAAGGAAATAATATACAAATATAGTAAAATCGATCATGTTTTCTGACCTTATCTTATATGGTATGTAAACACAGATTAATTAGTACGAGTT
GTTGTCAAGTAGTGTTGGATCAGTTATATATTAATCAATATTCCATTATCAGGCATGAGATTATCGACAAAAGAGTTTAGTCTAAGTAACTTTGTTTATA
TTTTTTGTTCAAGTCTGAGGATTAAGCAGTTATAATATATTCAATTTTCTTTAAGATTTGAGTCATTGGACCAAGCCTCTCATGTAACTGAGGAATCCAA
GAAGCTAGTTCCCATAGTTATGCGTCATCTGCTATATATTCGTTATTCTGCGGTATATTCTATGAAGTATAATTGGTTTCACTTGCTTTTGATGTAACCT
AATTACAAATATATTAGGGTGACATTTTAAATCGATCGGGAGTATTATTTTGATCCAATAATGTCACGTTCAGGTAAAGGTTTGTTAGAAACAATCTCTC
CACCTGAGGATAGGGATAAGGTTTGTGTACATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATTTTTAATTATTCACTTTATGATTAATAGGGGTAAAATTATAAATCCACTATGTCAATTATTAA
TTTTTTAATAGATGTATCAATTTAAAAGTGTACAAGTAATTAAGAATCGAGAGAGTATATTATCTTTGTAATTAATTCCTTTTGAAAACATTTACATTCA
TTTGTATAAATCCACTGAAAGGTTTCAAGACGCGAAGTAGTAAAATAATCTACATATTTATGATTTCTTAATATTCATGGACAGATAAACTAATATGAAA
TACACACACATATATATATAATGTGATTCTTTTTTTATTAATTAAGTTTTCAAAAATATGTTTTTCTTACATTTAATGATAATAATTTAATTTTAAAAGA
CATTTTATTCATACTAAAATAATTTAAATAAGATAATGCTTATACTATTTCAATATTGTGATAATTCAGGTATAAAATTTATATTTTTAATATTTCAAAT
GCCAAATTCAAGAAACTAGGATAATTTTGGAATCGGCACTAGGTAAAACTTACTTGCATCGAATATATATGTCCAATTAATATATTCATATCATATATTT
TAAATTTATAATTTATTTAATTTAATCATAATTAATTAATATATATTTACTTCACTAAATCACTTGAAAAGTGTAAATTACGTTAATTTGATGTATATAG
CCGTCCACACTTACAACACCGAGGTATGCGTTACTCCGAGTCTCCGACCAAAAGAGTGAAAGCCCTAGTGTTTTGGACCGGGTCGTGTCTATTGGGCTGA
ATGTATTGCCATTTATGAGCCCAATAAAAATTGTCTTATTCATTCATCTCTTTTATTTTCTTTTGAACTTTTTAGTTACTTCCCTTTTTTCTTCTCATTT
TTATTGAATTTACTCAATGTTATGATTTTACTTTGTTTCTTACACTTTCTTTTCCCTCCCAAATTTTTCTCCCTAAATGAAATTCTAACATTTTTTTTAC
AAAAAACCTTGAATGGTTTGCTGTATTTTTATGTACAAGTCACCTAATCCCTCCTATGTGAATAAACACACGCACACAATTTTCATTCATTACTAAAATT
CATTGTTTTCTCTCATTTTTTTTTTATAAAGATTTAAATCTATACGCTATTGGAATAAATAAATCTGCATACTATCAAGTCATTCAAATCATATTTACAA
ATAAATTTTCTGTGGACTTAGAACGTGAATATGATATCTGTCTAAAAATAAAATATTGTGATCATATTAGAATAAATTAAAATAATTTAATTGTTTTACG
CTAGAACTTAATTTTATAATCGGTAGGCTGTAGCCGACATCCCTAATGGACAGCTGCACGCGAGGCTACAAGATAATATTATTCACCTTCATTTTTAATT
ATCATAATCCTATTATCTAAAGTTAAATATAATAATTTTAATTAGTATTTATAATATATTTATTTTATTATATTAATATATAAAAATTATAAATTATAAC
ATTCTTTACATAATTTTTTAAATATTTAATTAAAAAATTAAATTAATATAATATAATTTAATTTTTAGAAAACTCAAAAAAGAAAGTAGGACAAAAGACT
CCACGACATTGGAAACATAACAATCAATTGTGCAGCAGAAACCCATGCAGATTAGTTTAGTGCATATGTAAGCCCTTACATCATTAACTTAACATTAATT
AATTTTTAAATTTAAATATATTACATTCACGTGATATACGTGAATATTTAAACAAACAATATAATTTGATATTTAACAAAATGTATATACGTACAAATTG
TACAGAAAATACTATACATAGTACAATATTTTACATATTAATAGAAAATATATCGTAAAATATTAGTTAAATTTTTTGTATCATTTGATTCTAAAAAAGA
AAACTATGATAACTAGAAGTGAATGAAAGAAGTATATAGAAAGATAATTTTACTATATTATATTTGAGTATAATAAATTCAGTATTATAAAAAGTCAAAT
TTGATGTTTTAATTTACAAGACACAACAAATATTTTACAATGATGTTTTTTTATCATATCAATATACAAAAATATTGCTATTAATGATATTTTCGTAGTG
TTTTTGAATATCTAATTTCAAATTAACTTTCTAAAAATGCTATGTGGTGGGCGAATACTAACTACTTTGCGAGGAATATGTCAATGTCTATACTGGACGA
AAAGAATACTTATATAAACACCTTTCTTGTTTCTTCATTTACTACTAAAAATCATTTAACAATACAGATATTTCAGTTCAGTTCTTACTAAAAATGGCTT
GTGAGTCAAGATTAGAAGAGCTAAATTTTGTTTTGGTACCATTACTTGCTGTAAGTCACATCATACCCATGGTAGACATTGCCAAATTGTTAGCACAAAG
AGGCGTGATTGTCACTTTAGTCATGACGCCTCTTAATGCTATGCGATTTACTGCAGCAATTGATCGCGCCATTGATTCTGGACTCCTCATTCGGGTACTT
CATCTCCGTTTTCCAGCCAAGGAAGCGGGATTGCCTGAGGGATGTGAAAGTGTCGATCTTCTCCCCGGTCTAGCTTATCGAAGAAATTTTTTTACTGCAA
TTGATATGTTACAAGACCAAGCTGAAAAATTGCTTCAAGAGATTCAGCCTAAGCCGAGTTGCATTATTTCCGATATGCATATTGCTTGGACAGCTGAAAC
AGCTGATAAGTTTCAGATTCCGAGAATTATTTTTGATGGAATGAGTTGTTTCAATCAGTTGTGTATGCATAATTTGTATATCATGAAGGATCAAAACAGA
ATCCCTGAATCAGGGCATTTTGTGATCCCTGATTTGCCTGATACAATTGAAGTAACTAAAGTTCAGCTACCTGGAGCGTTTAATCCCCCGCCACTTCACG
TGCAAGACTTTCGAGACAAAATACGAGCAGCTGAAATAAGTGCCTATGGGGTTATAATCAATACTTTTGCGGAGTTGGAAGAAAATTATGTTGATGAATT
CAGAAAACTTAAAAATGGTAGAGCTTGGTGTGTAGGTCCTTTGTCTCTCTGTAACAATGAGAGTCTAGATAAAGCGCAGAGAGGGAATATGACGTCATTT
GACGAAGAGGAACGTTTGAAGAAATGGCTTGATTCATGGCAGCCTGAGTCTGTTGTGTATGCGTGTTTGGGAAGCCTTAGTCAGACCACAGTTGTACAGT
TTGCGGAGCTGGCTTTAGGCCTGGAAGCATCAGGTTATCCGTTTATTTTAGTCGTAAAATCAGGGGAAAGACAAGCACCAATAGAGGAATGGATATCGGA
AAATGGATTTGAAGAAAGAATAAAAGAGAGAGGGCTTTTGATCCGGGGCTGGGCACCACAAGTAGTAATTCTATCACACCCTGCGATTGGTGGGTTCTTG
ACTCATTGTGGTTGGAATTCGTCCCTTGAAGGGATTAGTGCTGGTGTGCCTATGATCACTTGGCCTTTATTCGCGGAGCAGTTTTTAAACGAGAGATTTT
TAGTACATGTCTTGAAGACGGGCGTGAGTGTTGGATCTCAGGAAGTTGTGCATTTCGGTGAGGAAGAGAAATATGAAGTCCAAGTGAGCAAAGAAGAAGT
GACGAAAGCCATAAAAGAAGTGATGGACAAAGAGAAAAAAGCAAATAATAGGAGAATAAGAGCCAAAGAAGTTAGAGAAATGGCAAAAAAAGCTATAGAA
GAAGGTGGATCTTCTCATCTCAGTTTGACACTACTAATCAAAGAAGTACAAGAATTCAACTAAACCAATTAGCTTAAAATGATTATGCACAAGCACGCAG
TGTACTTTCTTTGATTTTTATGTTTTTGGTAGCGCAAGCGAAATCAGGGAAGGGATTAGAAAGTGAAGAATCAAACCCTCACAGGTGAAATTCAGACAAC
CAATCAACTGAACTACTAAGATTCCCCAATTATTTTTGTACACGAATACGACAAGACACAGTTATATATTAATTTTGCCAGTTTCAACTTTCAACAATGA
GTTTTATATTAAGTATAATTAAGTGATTGGTGACTGTATTGCCACATAAAAGGAAGTGTTGTCTCATAATGTAGTTTGCCAAAATTCAACACGCATTACA
ACATATCCCAATTAAGTAAATCTTACTGGTGCTCGTTCAACTTTGTTAGCTGACTTATCTCATGAAATGTCGAGTTGCATATGGTCAGAATTTCTTGATA
ACTTATATAATTGCTCGAAGTGCCGTAATGGACTACTACACTTGAGGCTACAAGATTAACTTAGTGCAGATTAATTTAATGCAGATGTAAGCCCTTACAT
CATAACATTAAGAAGTACTAACACTACTAATATAATATAAAAGTACATTTTATCTTTCTTCATTTGCAACTGAATCATATTAAAGATGGTTACAGAAACA
GAGTTAAACTTTGTTTTGATACCATTACTTGCTGCAAGTCACATCATACCCATGGTGGACATGGCAAAACTGTTAGCAGGGAGAGGCGTTACTGTCACTC
TAGTCATGACGCCCCTCAATGCTATCCGATTCACTGCAGTAATTGATCGTGTCATTGGTTCTGGACTACTCATTCGGGTACTTGAACTCCAGTTTCCAGC
CAAGGAAGTAGGACTGCCTGAGGGATGTGAAAGTGCGGATCTTCTGCCAGCTCTAGCCTTTCGAAGAAATTTCTTTGCTGCAATTGATATGCTACAAGAC
CAAGCTGAAAAATTGCTTGAACAGATGAAGCCTAAGCCAAGTTGTATTATTTGTGATACTCATATTGCTTGGACAGCTGAGACAGCTGATAAGTTTCAGA
TTCCAAGAATTATTTTTGATGGAATGAGTTGTTTCACTCAATTATGTATGCATAATTTGTACGTCATGAAGGATAAAAACGAAATTCCTGAATCAGGGCC
TTTTGTCATCCCTGATCTGCCTGATAGAATTGAAGTAAGCAAAGGTCAGCTGCCTGGAGCATTCAATCCAGGAAAACATTGCATACAAGATATTCGAGAC
AAAATACGAGCAGCTGAAACAAGAGCCTATGGGGTTGTAATCAATACTTTCGAGGAGTTGGAAGAAAGGTACGTTGATGAATTCCGAAAACTTAGAAATG
GAAGAGTTTGGTGTATTGGACCTTTGTCTCTATGTAACAATGACAATCTAGATAAAGCTCAGAGAGGGAATAAGACGTCAGTTGACAAGGAGGACAGTCT
AAACAAATGGCTTGATTCTTGGCAGCCTGAGTCTGTTGTCTATGCATGTCTTGGGAGTCTCGGCCGTATTACAATTGTACAATTTGTTGAGCTAGCTTTA
GGCCTGGAAGAATCAGGTTGTCCATTCATTTTAGTCATAAAAACAGGGGAAGGACAAGCACCAATAGAGGACTGGATATTGAAAAATAGATTTGAGAAAA
GAACAAAAGAAAGAGGGCTTTTGATCCGTGGCTGGGCACCACAAGTATTGATCCTATCACATCCTGCGATTGGAGGGTTCTTAACTCATTGTGGTTGGAA
TTCGACCCTCGAGGGGATCACTGCTAATGTGCCTATGATCACTTGGCCTTTATTTTCCGAACAGTTTCTGAACGAGAGATTCTTAGTGCATGTCTTAAAA
ACAGGTGTGAGTGTTGGATGTCAAGGAGTTATGCATTTGGGAGAGGAAGAGAAACCTGAAGTCCAAGTGAACAAAGAAGAAGTGACTAAAGCCATTAAAA
AAGTGATGAACAAAGAGAAAGAAGGAAACGATAGGAGAAAAAGAGCCAAAGAAGTTGGACAAATTGCAAAAAAGGCAATAGAAAATGATGGATCTTCTCA
TCTTAGTTTAATACTTCTAATCAAAGAAATACAAGAATTCCAACTCAACAAATCTTGAATTGAAAATGCACTAGTAGTATGGAATGTACTTCTTTGAGAA
TTATAGTGTGTTATACTGTTCAACAATTTGTTTGAGCCCACAAGTTACTTGTGTGGTCTTAAGAAAATTATAACCGCGGCCATACAAATTACAGAACTCC
AACAAACTCAAATGGCATAGCAATGAATATAAGCACAAAAATTCTCCTCTTCATTACCATGACTCAATAATTGATATAGCAAGTCCCCTTCTAAAATGAA
ATGTACTGCCTGGCAATTATTGGATTTCTCTCACCTCTACACATGTTACACGAAATTCTGACTGTTAATGGGACTTGTCTTTCATTTTGCTCCTTTTTTC
CTAACTTTAACATCATATAAATAACCAATTCTTTATCATGTCATGAGCGTCTAAATGACATAATAACTCTTCACAAATATGTGGTGAAGAGTTTTCTGAG
GTGTAGAATTGGCACTTAAATATTAACTGCTGGAGTTTGATGGATATCAAAAGTACTCATTTTTTGAAAAACTTGAAGGAGCAAAACTACTCAACAAACT
ATAGCCTTTTCAGTTCTTATTGAGTAAAGATGACAACAGTGCCAGCATTAGCAGAGCTAAACTTTGTTGTGATACCTTTACTTTCTACAAGTCACCTCAT
ACCCCTGGCGGACATGGCTAAATTGTTAGCGCAGCAAGGAGTGACAGTCACGTTAGTCACGATAGCTCTAAATGCCGCCAGATTCACTGCAGCGATTGAT
CGTGCCATTCATTCTGGACTCCTCATTCGGGTAGTGGAGCTCGAGTTTAACGGTAAGGAAGCAGGACTGCCAGAGGGGTGTGAAAACCATAACGATGTGC
CTGGTCTGAACTATCGAAGACAGTTCTTTGCTGCAATTGATATGCTGCAAGAACAGGCTGAAAAATTACTTGAAGAGATGAAGCCTAAACCGAGTTGCAT
TATTTCTGATGCATATGTTGCTTGGACAGCTGATACAGCTGATAAGTTTCAGATTCCAAGAATTGTTTTTGATGGAATGAGTTGTTTTACCCAAATGTGT
ATGCATAATATGTACATTTTGAGGGATCAAAACAAAATTCCTGAATCAGGGACTTTTGTCATACCTGATTTGCCAGATAGAATTGAAGTCACAAAAGCTC
AGCTGCCTCCACATTTCAATCCTGCAGGAGCAGTTTTCATACAAGATATTCATGACAAAATAAGAGTGTTAGGATCGAAAATAAGCAGGTGTAAACGCGG
AAGCTAGCAAAATAAACCTTGAAAGATCATGAGTAAGAAGACAAACGAGAAATATATTAAAAGACACAATTTAACGTGGTTCGGTCAATCAATCTACGTT
CACAAAGGAAATTAGCAATTCACTATAAATAGGAGAGTACAAATACAGAGGTAAACAACCTCAACCAAATTCACTCAGAATACATGGGAGGTTCATACAA
GTGATAACGTATCAATCTTGTGACCCACAATTTCTCCTCCTAACCAAAACTCTCAAAGGCATTAAGAGTATAATGTGAATGCTGATTAAGTTAGAAAGAA
CATTCATCTTAAACCTTTTTCTACAAAAAAGAATTAGTGAATCCAAAACCTTTTACTAAAAGGAAAACCTATTTATGGTAAGAAATCAGAACAAATAAAA
CCCAACACAGCTAAAAAAGAGCATATGGGGTTGTGATCAATACTTTCGAGGAGTTGGAACAAAGGTATGTAGACAAATTCTGAAAACTTAAAAATGGTAG
AGTTTGGTGCATTGGAACTTTATCTCTTTATAACCATGACAATCTTGATAAATTTCAGAGAGGGAATAAGGCTTCGTTTGACCAAGAGGACAGTTTGAAG
AAATGGCTTGATTCTTGGGAGCCTGAGACTTTTGTGTATGCCTGTTTTGGCAGCCTCGGTCGTTGTGCAGAAATACAATTTGTGGAGCTTGCTTTAGGCC
TAGAAGCATCAGGTTATCCATTCATTTTAGTCATAAAAACAGGGAAAGGACAAGCACCAATTGAGGAGTGGATTTGAGGAAAGAACAAAAGAAAGAGGGC
TTTTCATACGCGGGATGGTCACCACAAGTACTAATTCTATCACACCCTGACTCATTGTGGTTGGAATTCAACTGTCGAAGGGATTAGTGTTGGTGTACCT
TTAATCACATGGCCTTTATTCGCGGAGCAGTTTCTTAATGAGAAGTTATTAGTACAAGCATTGAAGATTGCTGCGGGTGTTGAATCTTGATCCAAGGAAT
ACTTGATCCTTTGTTTGTTTAGTAGTTCAAAGTATGTATGTTTGTAATTACCCAGAAATTTCAATTTCAACTTTTATTCACACAAGACTTCAAACTACAA
AAGACAACAACAGTAAAGATAGTCAGAACGCCCTTCGTTGAAAAATTATATCGAATATATAGGCAAAATATAATCTAATATCTAGATATATTATAAATTG
AACACTCTTCACATAACAAAGACAAACAATCTAGTGGTAAAGACAGAAATTTTAATTATTTAATTATTGTGCACCTACTCTATCGGTTATGTTCTCCCAG
ATTTTCAAGTTGCACCAACTCAAAATTCACATCACTGCCTATCTAGATCCCGGAAAGAATCAAAAGGATAATATTGACAAATTACGCTTTAATTAATTAA
TGTCTTTAAATATCTTTATTAAAAGGTGTGTCATGTCCCAACAATCCATTTATCTAGGACTAATTAGAGTCGTTAATTTGAACTACGTCGATCGATTGAG
TAGAGTTGAACTAAGATTTTTGAAGCCTATTTAAAAGGGAAAAGGGTTGTATTTGCCCTTATACTCTTAGAAAAGGATCATACTTGCCTTTCGTCATACT
TTTTTGATATATTTACCTTTGTCATCAAACTTTAAAGCCATATTAATCCTCCTTCCATTAAATCTCCATATTTTACTTAATATCTTTTATGTTGTGCCTA
TGTGGGTTTTATTTTTATCTAATTAAATCAAAATATTATTATATTCATTTAAACCCACCCTCATTAAATTAAACCCCATCCACCAATGAACCCAGGAANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTT
TGCTTTGATTTTTTTTAAAAAACAAAATTTGTGCATATATCAAAGATTTTTTATATATAGTTCTTGATTTGAAGAATAATGGATGAAATTGCTATAAATG
ATTTTTTTGGTGTATCAATAAATGCAGTGATAGGAATGATTTCAAGATGGTGAAGAACTTTGGTGGTGTCATAGATTTGATTTATGTTGTTGTGAAGAAG
AAAGAAAATTAATAAGAAATTAATAACTAAAAATACACATTTATTATTTGTGTTGGTTTTCACTCTCTCTAAGAGAGTGAGATACACTCACTGTGCCACG
TAAGCATCTAGGGAGTAAATTATTTCAGTTTTAAACAATTCAGGAGGGTGATAGGATATTCGTTAAGTTGGAGTATGTAGTTGAATTTCAGATATAGACC
GAAGAGCTTTAGACCATTTTCTCTATGGTCGCATATCTTTTTACACACAAAACAAAATTGATTCACTTCCAAGATTCTATATTTTCTCTTCTTAATATTT
GTTTCAATGGCGAATGCATCCTTAAAGTTACCAAAGAAAGGCATTGCTTCTTATTTAGGCTATCCAAGATCCAAGAAATGCTAAACCCAAATGTGACATT
TTGCGGCTAATGAATTTTGCAAATTAAAAGCAACTTCACACTTTGGATTTTGTATCCAATATGTTCAAATTCCTTCTTCTTTTTTTTTTTTGGTTAAATA
ATTCGATATACAAATATGTTAACGATGAATCATTTTTTTCCTATTCTATTTCCTACAAGGACAGGACATTAGAAAAAGGCGATAAATAATATGCTTATGA
ACATAATTTCCAGTAAAACGATTTCATTTTCATTGCTTTTGTGCTCGTTCTTTTCTTACACTTTTGCTTACAATTTCATTATTCGTAATAACTGTCCTTT
TACCATATGGCCTGGTACACTGGCTGGTGCGGGAACTCCTCCACTTCCCGCGACTGGCTTTCGATTAGATGCAGGGCAAAGCATCACAATTCCAAGTGTA
GCTGGTTGGTCAGGGAGAATATGGGCTAGAACTGGCTGCACTTTTGATGCATCAGGTATTGGCTCGTGTCAAACAGGCGATTGTGGTGGGAAGCTTGAAT
GTAGTGGGCTTGGTGCCACGCCACCTGCCTCCCTCTTCGAGATAACTCTTGGCGTGGGAGACAACAAAGATTTCTATGATGTTAGTATTGTTGATGGCTA
TAATTTACCAATGGTTGCTCTACCTCAAGGCGTCAACGGGGGATGCAATGCCACTGGCTGCCTCTCAAATCTTAACATGGGTATTTTCTCATCACTCTGT
TATATCAGCTCTAAATCGCAAAGTTAAGGGATATATCAATAGATTGAGTTACTTTTTTTAGAAGAATAATTTCGTTTTTTTTTAACAAAATGGAACAGGT
TGTCCAAAAGAACTTCAAGTGATGGGTGAATATGGAGGAGAAGGGAATGTGGTGGCTTGCAAGAGTGCATGTGAGGCTTTTGGTTTAGACCAATATTGCT
GTGCAGGACAGTTTGCAAATCCAACAACTTGTCAACCATCTTTTTACTCAACTATATTTAAGAATGCTTGTCCAAGGGCTTATAGCTATGCATTTGATGA
TGGCACTAGCACTTTTACATGCAAAGCTAATGACTATGCAATCATATTTTGCCCAATGAATGGGTACTCTCTCAAAACTTTCATCATCTTAAATGTTCCG
TCCATTCCAATTTACGTGTAACTCTTTTCGTTTTAGTCTGTCAAAAAAAAATAATGTAATCTATTTTTAAACTTCATGTTCAGTCAAATATCGTCTTGAA
TTTTGAAACAGGGTAAAGAGGCCTAATGAAGAAGGATCAACAACTCAAGCAACTCAGCCTATTGAAGAGAGTAAAACTGGAAAGTTTGCAGAAACAATGG
CGTCAACTTCAAACATTATACTCCTTCCTTTTCCAATGTTGATTCATATGTTGCTAATTTTCAGCTTACATCTCTTAGCATCTATATATTATTCACTTAT
TAAGATAAAAAAAAAATGTTACTTTTCAAATACAATAAAATGACTATGTCATTCACTTTTTTTTTTTTGAATCTTGAAAAACATTTCCCTCAATGAGTAC
ACCACAAAAGATTAATCTCAAATTGCATGAATCTAAACCTTAAGTGGGCCATAAATAAGTATGATTTGGTATAAAGACAGCTAATTTTTTATTTTTTTTA
AAAAAAGAGAAAAGTATTGAAAACATGATTTCTGAGTTTGACACAAATTATAGTTTCGTTTTTGAAATGTTGACAGCTTTAAAAATAATCTCTACTCGAC
TAACTAAACTTAGATACACCCACGATCTGTCACATGAAATAACAAGCAGTGTCAAACTCTAAACTCGCTTTTAATTAATTAATCTCAAATTGCATGAATC
TAAACCTTAATTAAACCATAAATAAGTATTATTCGGTATAAAGACAATTCTTTTTTAAGAAACAAGAGAGAATTGTTGAAAACAGGACGTCCGAACTTGC
CACAAATTATTTATTCCATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNTCAGCCTAATGCCTTTGTCATCAATCTTGGTGATCAATTGGAGGTAAACACGTCTTTCTCTGTTTCTGTTTCAATTTATG
TGATATCAGACTTGCACATCGTCTGAAAATACAACTAATTAGATAAAAGAGTATAAACTTTTAGATGAAATAATTATTTATCGTGTGTGCAGGCGTTGAG
TAATGGGAAGTATAAAAGTATATGGCATAGAGCTATTGTAAATTCAGACAAAGCAAGGATGTCTGTGGCTTCTTTTCTCTGTCCCAATGATTGTTCCATT
ATCAGTGCTCCAAAAACCTTAACTGAAGATGGATCTTCTGCAATTTATCGAGATTTCACTTATGCTGAATATTATGAAAAATTCTGGAGCAGGAATTTAG
ATCAGGAATATTGTTTAGAACTTTTTAAGAACGATGGAACCTAGTACTTGTATGAGTTTATTACTTTTGTATCGACCTAAGTGTGGTTGTCACACAATTA
TGTTAGGAAACAATCACTTGATATAGTTCAGATATGAAATTCGCAAAAAAAAAAATGATACTTCAAGTATGTAAAACTTTTTTTGTTCTTTTTCTCTGGC
ATTATCATCTTTGGAATGATATGTGGAGAGTGTGCTTCCATGATATCATGAAACTCCGAGAAAATAATCTCCTATGATCACTTACAATTTGAATAGATGA
AAATGATCTTTCGAGTACCTGTTATTATTGGTTACGTTATGCAACATGCATTAGGATTTTCATCGGAGAAGAGTTGAGGAGGTGGGATTCTTTCAATCAC
ATGAAGTGGTTGACAATAATACATCATCTTATTGATGGTTTCTTCTCCTCCTGATGCTTTGTTTCTTTCTTCGAGTTTCTTAGCTTCTTCATCTGGATTT
TGTTCTTCCTTATGCTTCCGCGGTTCATGTTGAAGTACAATTTTGGCCTGCTTTTAGTTCGTCTGTAGACATAGTCAACGAGCTTGTTGGCGTCTATGCT
TCCTGTTACAATTACCTTCCCTGAGGTCAGATCTGTTTCCGCGGTTCTCACCCCTAAATTAATCATGAAGAAGATATAATTAAGTGCAAAATTCTAGACA
TGGAAGTTATATTACTGTCACATTTCACATCTACTAACTTAAAATTCTGAATCCGCGTACACAAAATGGTTAGGTAAATACACGAAAGGACTCGTTTATA
TACCTCTCATTTTTAGAATCTTTCTTTTTAGCTGTTTGGCACATGCCTCACAATGCATGTTAACAATTAGCTCAACTGTCGTCAATCTGTTAACCTGAAA
AGGTATTAAAACAAGGATCAAACATTTTCATTTATGATCTTTATGTATATTCTTCAGCGGAAAATTATACTGTACCGAGTAAAAAATATTTACCTGTGAA
GCAACAACTCCAGGAATAGGTTCATCAGCTAGTGGTAAAGGCGAAAATACTTTTGCTGTTCTTTTTGTTTCCTTAACAATGCTGGCACACACTGCTTGTG
GTTCGATCACTCCGCTTATTGTCACTTGGTTTTGCTCCATATCTATCATTACTCTGTCTACCCCTGCTTCATTTTAATATAGATATGATGCTTTTCTAAA
ATAACTTCAGAAGAAAAAAAACGCAACAGTCAAGGTGCATGCAAACTGACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCATAATTTATATATACTCATGTATTAGTTATGTGGTTGTCCAGTTTT
ACACATGAAATTTATCTTGTAATTACTAATCAAACGTTCATAATATGACACTCACATAAAATTATAATTTGCATAAATCTTCTCTAAATTAACTATCAAA
CGACTTGTTAATATTCATCTGGCCTATATTGCATGTTTTTCTTTTCATATTTTATGAATCTGTATATAAAGAATTTAATTCATTTTTTTAGTAAGATTAA
AAAGATATCTCTTCCTATATTCATACTTAATTGTTATACAAAATCGTTTGCTCGAAAAAATTCATCAAATTATAATTTTTTCTTCTTTGAGACCATGATG
AATGACGTTGTGTTATAATTAAGTGTAGTCACTTAGCTCATGTCCATCGCGAGCAATAACAAAGTCAGAAATATTTTAATAAATACTTCTAATTTGATAT
ATGTTATATAACAAATAATTTTTTATTCATATAAATACTTCATATTATTTTGGCCTAAGTCATTTCGAGTCACTCAAAGTTGTCCGCATAATTCATTTAG
ATACTCAACTAATTCTTGTGCCGATTGAACACTTTATTTGTTCAAAAGTCATTTCTATTAGACACAAAATGCTGACATGGCAAAAAATGTGTAATTCACT
TTCCTTGAGCGCGTTAATTTATTAAAAATAATATTTTTCTATTTTTTCTCTTAATTTATACCCCTAAGTTAATTTTTTTAAAAAAAATTAACAAAAAAGA
AGAAGAACAGTTGTATTCTTCTTCTTCCCTATTTCTATCAACCCCACCACCTCACCCCAACCCCCATACCCATACACCAGTGGTTATCTTCTTCCCCCAT
CATTCTAATGATTTCAAAATTCTTAGTATCAGTGGTTATCTTCTTCCCCCACCATTCTAATGGTTTCAAAATTCTTAGTGTTTTGTTTCATTTATAATTT
TTCGAATAGATTCTTTTCCCCATTTTTCTCTACCTAAAAAACGAGATGAAGTAAAAAGTTATAATTAATAAAAAAGCTGATGAAAAAAAATTGTCGGATT
AAAGATGGAACTGTACAGGGAAGGGGGGGGCGCCATTAATGGAGTTAGAGGAAATGTAAGTTTTGTTCCAGTTGAAGGCAGGAAAGTGGGTGTTTAGGTT
TTACTTTTTTTTTTCATTTGTTTTACTTTAAAATAATTTTTATTTTTTTTTACTTTATAATATAATGTTTAAATAATTTTTTGGATTAAAAAATAACACA
TGTCATTATTTGATTGGTCAAATTGACATGTCAGCGCGAGTGTATTTCACACATTCTCTATTTTTTGTTTATTCTCGAAAAAATGTTCAAATGGTTCAAA
TTCAAAATGGTTGAAGTGTTCAATAGATAGTACGTCTAGTTAAGGTGTCTAAATGAATAATTGGGACAAATTTAAGTGACCGCATATGATTTTGGCCTAC
TATTTTTATACGCACTACGTATAATATAATTTTATGACGAATAATATAATATTCAACTAGGTGTACGATGACATTGAAAAGTGGAAGCCACCAAATATAT
AAATAAAATCTCGTCCTTTAATTATTGTTCGTTATATCGATGGAAAATATCTTTGTTTAACCCTACATGTATGAAAAGATCTCTAGCACTGATTCAACAG
TGAACTTTTTTCTTTTACCAAAATTAAAATTGGATTTCCTAGGTCACTCATATCCTCTTCTTTGGATATGCAAACAAACATGTCTACATTGACCAAGTTA
AAATTTCAAATTCAATTTTTAAAATTTAATAAAATTTGAATTTATATAACAATTAATATATATTCAATAGACAAAAATAAATATAACTTTACACTAAAAT
TATTAAGTTGGAACGAGTGGATAATTCTAACTCCGTTCCTGTCTCTATCTACTTAATAATTAATTATAGTTCTAGAAAACGTGTTATTGATATGCAGTAC
TAGAGAATAGAAAGAAACATAGTCATAAAATGGGGCAAGCTATTCATAGTAGTGTGAATTATTTATCGTTGAATAAGAAGGAAACTGACGATTGGAATAG
GTCCAACGTAATGCAGTTGACTGACTTGTCTACAACAAGTGTTGATGAAGAAGGAAACTGAGGATTGGAACATGTCGAAGACTAGTGAGTTACAACACTT
GCTGTAGATAAGTCAGTCAACTACATTGCGTTGGACCTGTTCCAATCGTCAGTTTCCTTCTTCTTCAACATTTATGACCGTTTTGATCTTTTCAATCATT
TCATTTTATTTGTTCTCGTTTAAAAATAATAAAGTTTTTTAGTAACTTTTTAGTTTCAATACATTTGAAATTGTAAAATTAAAAAATATTCTAATAAGTT
TAACATGATTTGAATTTATAAGTATTAGTCATATAAAAACAAATAATTTTTTCACTTTTTGCACATCATCAATTCAATTATAGGTATCAAAATGAGTTAT
AATGCAGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNATAAATCTAACATAAACTTTAGTTATGTGCTACTTTGCTTTTTCAAAACTTTATATTCATTCAAATATTGGTTTTATTGTTTTAAAATATG
TTATTTTAATTTATTTTATGTCTACTGAAAAAAATAATTCAGAGAAGATGATTTTTTCTATTATATAGGAGCACTAGTTTCAACATGTTAATTTTCTGGC
ATTAAATCAAAATGTTAGGATATTAAGATCTTCAAACTAAAATTGTTAGATAAACTTGTTTACAAAAAAGTTGTACTTCTAATCTTGTCATTTGGACTTC
AACAAAAACTCTTTAAGTTCGTTATCTTTTATTTATCTACATTTTTCAAAGAATAATTACAAATAAATAAAAATAAGGTAGATAGATATAATACTGTAAA
TTTTAAGAAAAATAAATATTAAAAAATGAAATTTAATTTTTTTTTAAAGTATCCAATAAATAAATATACATATTTATTTTAATATTTGCTAACTTGACAA
AGATATATTAATAATTTTAATTTCTTTAATTATATTAAGCACGTATCACAAACCACGCATAGGCTGCATTTTCACACTATTTACGTGTCCAATGACGACC
ACATTTATTGTTTGCTGATTCATAACGTGGAGTCGTTTTAATTTTTTTCAATATTTTTTATTTTTGATATTAATTATTTATTTTAAATATTATGATAAAA
ATAAGCATTTTTTGTATCTAGGAAGTGTAACAGATACATTGAACCTGGACATACTCGTTGTGTATAAAACCCAGTCCAACTCCACCCATTTTTTTTTTCG
CATCAGTTCCAAACTGCAAAACAAAGACTATACCTCTGTTCCTGTATCCTAATTTGGAGCAAATCAAAATTAAATTCATTCAGAGCTATCGTATCTAAAA
AATGGCTCCGACTATAGCAACAACACTATCTTTCTGTGCCCAATCGAAACCTGCCGGCGGTGAAATCTCCGGCGTACCGGAGTCGGAGATGCTTCGAAAG
AGAAACGAAGAGCTGGAGGATGAATTGAAGAAGAGCGTAGAGAGAGAAGAGAAAATGAAAGAAGAGCTGGAGAAGACACGGAGGAGGGTGAAGGTGGCGG
AAGAGGCGGAGGAACGCCTTTGTTTTCAGTTAGGTGAATTGGAGGCGGAAGCTGTAGATGAAGCTCGGGCTTATAGAGCCCGTGTTGTTAATTTAATGGA
ACAACTTTCAGCCGTACAAAAACTTCTTCTATCTGCTTCTAAATGAGTGTAAAATTATATATGCATGCACCTAGTCTAGCTAGTTTTTTTTTTACTTGTA
TATTGGATCAATTTTTCTTCTTCTTAATTCTACCTTTAGACCTTATTTTCGGTGCATTATTTGAATAAAATAATTTTATTCATGATTTTGCGTCGAATCT
GTCGATATTGGTTGAATTAATCTCTTCATATACATATTTGGTGTAACTATATAAAAAGAATTACACTGCTAGATTTCTTTTTTTAAGGAATTTCAATATG
CCATATATACTTGAATTTTTTTTTAAAAAATTAATTAATTAAAATGGAAAATACACTAACTAATTATCATTTAGGGCTGTTTATCCAATTTTTAGAGAGA
AAAAAAAGAAGAAGATATATCACTTTAAAATTTCTAGCCTTGAGTTATTTCGATTCATTAGGGGTCTGATTATTATCTATAATCTCAAAAGAAAAATATG
TCGCTATTATTCTCCAATTCATATTGTAAGAGGAATTTTAGACAGAGAAATAGTCACACGTACTCTAGGAATATAGAAATAGTGATCAACAAATTCAAAC
TCAATTAGTTACCCATTTCGAGACTTATCTTTTTTATTTTCATTAGGTATACAAGAATTTGATTAAAATTAAATTTACATCGAAAAATTCCACCTACTTT
CTAAACGACTCCTTACAAAAAGAACTACATTTGGAGTTGCATCAAATTTAGGCAGATAAATAGGTAGTCACATATACGCAAGGAATATTGAGCATAGTCA
GCAAGAAGCTGGCAGGAAAAAGTTAGGAACTTGTCTGGAATATATGTTACGTGAACTTATAAGATAATACTACGTACATGCCAAGGCAAAATTTTCGCTT
CTAAAAAAAATTATATTTTTATAATCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNCAAAAAATAAGATGCAAATTATTAAATTATGATCAACCTATGGAGTGGATGTCAGCAAAACTCGAAAGATTAA
TTATGCATTAAATTTATATATTATTCTTTGCTATAAAAAATCAAGGTCTAACAATTATATTACAAACACATCTTTATTTATATGATACTTAATAAAATTA
CTCATAACTTATCATTTTTTATAATCACGCGAAGCGCGTATAAGTTCACTAGTATTGTTATAAATGATGACTGTCATAGAGAGCTAACTACAATAAAATA
ACCTTCTGCTAGCTTAATTGGATTATTATAAAGAATATTCCCACTACTTAGTCCTAGAGCTATCAATATGGGTTATTCCATCTCATCCGAGCTAATTCAT
TTAAGTTTTGATATTTTACGGATCAGAATGAGCTAGTTCATTTTTGATGTAAGCCAGAAAATGATCGGTCCAATCCATAAATACGTAGCCTACAGACTTG
TCGGATCGGTTCATTTTTTTAAAAAATTATAGTTTTTTTATAACTATTAAATTAAATTTTGAAAGGAAAAATATATATAATGGCAAACTAATAAATCAAA
TTAAATGTTATAACCACACTTTGATTTAATTGTGCCGCATAACAAACTGTTAGTCAGTTACCTCTCTCTCTCAAACTATCGCTCGCCACTCTCCTCTCTC
GCTCCATATCTCGTTCGCTTCCTATCACTTTTATATAAATACAAGTGTATAAAATATTTTTGTGTTTGTATAAAACGAGAAAAATTGTATATATACAATT
TTTGATGTTTCCCTCTCCCAGATCTCGCTCGCCACTCTCCCAGGTATGACTCGCCACCCTTGCCTATATGGCTAATACAAACAGAAACGAATTGTATAAA
TTGTATTTCTGTTTGTATAAAACAAGAGAAAATCATATATACACTTGCAAATAGATATATTTTCGTCCTATACACTTATAATTATACAAAAAAAATACTC
CCCTGCCCAAAATCTTTTTGATTTCTCTCTTTCTCGTTTTATATAAATTCAAATTGTATATAATTTCTCTCTTTCTCGTTTTATACAATTCGATTCAATT
GTATATTCTCTGTCAAACCTCTTTTGCCTTTCTCGCTTTCTCATTTTATACAAATTCAAATTGTATATAATCGTTTTATACACTTATAATTTTATAATAC
AAATATTTCTCTGCCCAAGTCTCTTTTGTTTTTCTCTGTTTCTCGTTTCATACAAATTCAACTTGTATATAATTTTTCTATTTCTCGTTTTATACAATTC
GGTTCAATTGTATATATCTAACGAATTTTACATATATATATGTTTGCTATGGAGCGCAATTATACAAACTTTGCTATAACATACGAATATAAATTTTGTG
TTTGCTATATGTGAAAGTTTCCCAATTTTAAATTATAATCTAAATAGAAATATTAACCTAATTGTTTTAAGTTTGGACACTCTTTAATTTTAAATTTCAA
TATTATATTATAATTTTTAGTTAATATTTATCGACCCACGGATCGGCCTTTCATATCTATATTTCTCAAGCTCTACAAATCAACAGACTTATTCAGGCCG
GACTAAAAACCTTTTTTTGAATGCGGAGAAGGGTTATATTTATCCTGTACTCTTAGAAAAGGAT