BAC Sequence – LE_HBa0318C22

>C03HBa0318C22.1
TGTTGTGTCCAGCTCCCTCCTTGGGCAACTCATCATTAGTGAAAGTGATGTCATTATACTAAAAGACGCGCTTGGTCATATTCTCCAACTGATTTACTGT
GGTCTCTTTTGGTACATGTGCTTCTTTCAAAACCTTATTCAACACAAGACGATGTTCTTCTGAGTGCAAAAGTAAAGACAACAGTAAAATTTGTGCAGGC
GACTTCTTCAATTGTTCCACGATAGAGTATTTTGGAACCTTAACCTTTTTTAGAAGTTCTACATTTACTGCTTTCTTTAGTGGTACTTGGATATTTTCAG
TCATCTTCCCTTTTCTTAATTCTTCTGGAGAATAATATCTTCCAGAACGTGTAAAACCCCCCGCTTCATCAACTTCTTCAACAATCTCATTTCCTCGATA
AACCTCTGCAGTTTTGTTATAGTTCCACGGGAGAACCTTTGAATCAATTACTGGAAGTTGTTGAACAGGCTTAACGAAAATAGGCTCTTCCCAACTTGGT
CAAGCAACTTTGGTGATGTTGTGTTAATGAAAACCCTTTGGATACATACAACTTTGGCATAGTTGCTCAAACTTCAATCCCCTTTGAAACCCCTGGGACG
CACAAGACTTCGGTGTCAAGATTGACACCTTCCACACTCAGAGATGCAACTGGTTCTAAACTCTTCATTGAATTGTCTTCTTCTTAGATCTTCCTAATTA
ACTTTCCCATTTTCCTGAAGAGTTTGTACTCTTGATCATCACAAACCATACCCACTAAGTTGTTTCAGCTGGAAGTGGGTTATTGGTCACATTGGGAGTG
TTTTGATCATCTGTCACAACAACAGTTCCTTGCTTGATCAACTTCTCTATTGCTCCCTTCAAGGTCCGACAATTATCAGTGTTGTGTCCTGGGGCTCCTG
AATGGTATTCACATCTTTCATTGGCTTGGAAACCTGAAGCATTTGGATTCAGACTATCTGGTGGGATAATCTCAATTATTCCTATCTTTCTTAACTTTTG
AAACAAGATGGAGTACGACTCTCCCAATGGAGTGATTTCTTTTTTAGTTATTGATTTTGTGCATAATTCTACATAAGAGGAGAGTTGTAAGGGACCTGAT
AGGGTGGCTGTTGCGGGCAAAAGTTTCCTGACATGGGGCTAGAAAATGTGGGCGATTGGGATGATACACATATTACCGAGCATTTAAGACCGTGTACGGA
GATGGATATACTGGATATTGAGAGGCATAAGGGTAGTAATGCTGAGGATAACTAAGTTGTCCCTGAACTGATGTGTAAGGACAATTAGACTTTCTCTGAG
CTCCCATTGACCCCGATGCCAGTGAAATAACGTCCTCTTTCCTTTTACGATTTCAAAAACTTGTTGAACCACCTTGAATGGAATGTGTGGTAGATTTGAT
TGTTGTCTAGCTCATGATCCTTCATGTTTTGATACCACTTTCGACCATTTCCCCAATTTTGATTGTTGTGTGAAACGGTCATCCCATTGCGTCAGTGAGG
TGGTGGAAGTAGCCAGGATCTTGAGACTCTATGAAGATATCAACCAATTCTTTCTAATTTAATAGGGGCTTGTCTCTGGCTGCTTGTTCCCTCCATTTGA
TAGAATATTCTTTGAAGCTTTCACTTGGTTTTTTTCTTGTATTTGAGAGTGTATTACGATCTGGAATAATGTCGACATTGTACCGAAATTGTCTAACAAA
ATCTTGAGCCATATCATCCCATATCTGCCAGTGAGAAATCTCTTGGTCTATAAACCATTCTGAGGCAACACCAGTCAAGCTCTCACCAAAATAAACCATG
AGCAATTTTTCTTTACCCCCGCACCCCGAAGTGGATTACAATATCTCTTAAGGTGGGCTATGGGATCACCGTGTCCATCATACTTATCAAGCTTAGGGGT
TTTGAACCCAGGTGGAAGGTGAATATTTCGAAACATACACAAGTCTTTGAATGCGACATTTTTGTGCCCTCCTAACTTTTGCATGTTCTTCATGTGTTGC
TTGATGTTTTTCATTTTTTTCAACATTTCTTCTTGCTCGGATCTTGGAGTGGGCCTCTCAACATCAATTGGGGAGCCAAAATGAACAGAGTTAGGGTCCC
CAAAAGTTATTTCAGGAGTATAGTACTGCTCTAGATGAGTGGTGAACTGTCCTTCTTGAGCTGCTCTTTGAGTCACAGCCGGTTGTGGGAGTGTATAGAT
CGGTGCAGCTGTTGTGACAGTGGGAGTATTCTTGAATGCATGCCTTGAGGATGTGTTGTTGATGGCCCGGCCCCACAATTATCAAATGGACCATAGCCTG
AAGGGAAAAAAGGTTCTGATATTGGGAGCTGAGAAGATGAAGATCAGATACTAGTGATCTCTAGAAAACCAGGAATAGACGTTGGTAGTTCTTGTCATTA
GACCAGGCTTGCCACAATTGTTCCATAATTTGTCTCAGTGTCTGATTTTCTTCAACAGTGACTATCTCTCTTGTTGTTGAATCAATTGGAGTATCCTCTA
GATTCACCATAGTTTCAATATTGGTTGTCATTGACGCTCTTACCTTAGACCGGGTAAATTACGGGTGCTCTGCCAGTTTACCACAAACCAACCACCGAAA
GCTGACTAGAGTTGATGTGAAATGAACAAACTTGTTAGGGGTTAGAAAATTTTATAAATCAATCACATACTTATTAATCACATAGTAACATGGGTTCAGA
AGGCCATTGTTTAATCCCATCTTTGCTTTGCTTATTGTCTTTTTCTTTTTGGAAAAAGAAAAATTTTTGAAAAATAAATTTTAATCGGACCCTTTGGAGG
TTGCCTATGTATCATGTTACTGCACGAATCAGATCATTACGTAGTTCAAAGATTTAGACAACTCAAAAAGATTAATTTGGAATTCATTTGCAAAAACTTC
AAGAAAACAACAAAATTAAACGGTTTAAAAACAACCCGGATCAACATAATATCCTTAAATACCAAATTTTAAACTGAAAACCAAGTCTTTCAACAAACAA
AATGAAACGAGCAAAAAACAACAACTAAAACATCTATTCAATCTTCATCACTTTCTTGGGGCTTTTTTTTCCTCCCAAGGTCTTATACAAATTCAGCAAC
ACCTTCGGCAGATGGGGAACAATGGTCCGTGCTTGCTCAACCACTTCTTGATCATTCATACAACGCTGATTTTTAATAACGTAGGAGGTTTGCTCTGCCA
GTTGATGAACTTGAAGTCTAGCCCTTCCCATGTTTTGATGACAGTCATTTAACAAAGACTGATGATCACCAAGATTATTCCTCAAGAGGGCCTCTCACTC
TTCTTCTGCTTCAAGTTGATGGCAAAGTGTTGCTCTCTCGATGATCTGTTGTCTTTGACCCTCTTCGATATCAACATAATGACTGCTTTTTCTCTTACAT
TCTTCTAACTGATTCATCCAACAAGATCTTTCTTTCTCAAATTTTTCCTTATGCCGCTTAAGTTCTCCCTTTTGATAGTGCACGACCTCTTCGGATGCTA
CTAAGTCTCTTCAATCGAGAGATCTCAAAACTCTTCTCTTTTTTTATCTGTCGTGCCAAGTGTACTCTACTATGAAATTCTTCCTCCAACAGGGATAATC
TTCCCTTTGCATGCTTCAATTCTCCTTCCATATCTTGCAACTCTAACTTGTGATTTTTCCTCTTTGGACTTGTACTTCTTGTCGTGCAATGGTTGCTTTG
GCCTTCTCCAACTTTTTTTTAGATGTCTTATAATATGTTGATCTCTTCTTTTTCTGATGGATCCTTCAGGAGTGTCACCAAATGTCGTTGGATCATGAAA
CCACGATAGGTACCTAGGAGCCACCTTTCCTTTATCTTTCTCCACAACCATTTCACTTAGCTCAGAAATAATACCCCCGTACCAAATCTTCATAATCTCT
TCGCTATTAAAAGCAAAACCTGGTGGAGTGTCATATGTAAACCTACTCATGTCATCATTGGGTAAGATATCTTGAAATCTGGCTAGTTGACGCATAACCC
GAAGTGGGGCATATGGTTGAACACCTCTAAGACCAATCAACACAAGAAATGAGATACCACTGGACATGCAAATGATATTCTTAGCTGGAAACCAGTAATA
ATTCCACACTATTTCATCAGATGTGATCACTGAAAGTTTTTCTTCACACGCTATGATTTCTTTTGGAAAATTAATTTTGGTTTTCCTTTCTTTATGAGAG
GAAACATAGTTGCACCAATCTGGAGTAAACCTAGGAGCACGATCATAGTGATAAAGGTGTTCCAAAAACCATATTTGGAGCAAAATATTACAGCCTTCAA
AGTACATTTTCCTCACTTAAACATTTAGTTAGTGCACGAAGCATATCTACCAGGATCAGAGGAATAATAGTTGGACTTTCCATTGTGGTCAACGCCTTTA
CCACACCAGACAGACGAATGTCAATATTCTTATCCCTTTTGGGGAAAATAATGAGCCCCAAAAATGCGACCATAAAAGCAAAACATCTATTTGCCTTCCA
AGTCTCTTCACCCCCTTGATTACTAAACTGGTTTCGATAGTTCTTGAATCCATCCCTTTGGCCGTATCTCTGGTATAGAAATTCCAATGAGACCCACCAA
TTTTTAAAACTCTCTTTCTCTATTTGATTAATATTGAGCAGTTCCAGGTTTTTTTTGGCATCAACATGTTTCAAAATTATGGGTCTTTTATTGCGTAGAT
CAACACCTCGAACAGTTGAACCCTTCCCCATGAAGTCGGCAATTTCTTCCAATGTTGGTGTCATCTCAAAATCAGAAAAACAAAATACATTATTTTGGGG
ATCCTAGAAAGGAATCAATGCCTCGACCACATCCCTTCTAGGGTCAATCTCCATAAGATGCACTAAATTTCCCAAGTGTTCCTTTACTCTTTTTTTCTCA
CGACTTCCCATGTTTGTCCACCATTGCCATAAATCTTTTGGTATAGTATCTACGATCATGAACTCTGGAATTCTTTCGCTTCTAGGCCTTTTTAAACCTT
GTCCTTTGGTCGATAGTGCCATTCGTACCTTTAAATAGAATCCTATAAAGGTTTTTATGAAAAAATCTAACAGAGTGAAGAAAGAAAAGTAAAAAAAAGT
TTTTTTTTAAAAAAATAATAATAAAACACCAATTTTTACAAACACCGAACCCGAGAAGGGATGCTTACGTATCTCTTTTTAGTGAGAATCAGGTGTGCGT
AGTTCATAAAAGAAAAACTTGTCTTGGGAAGACTATCCCTTTCATTTTGACCTTTTTTAAAAAAATTAAACTCACAAAGCTATTTTGAAGATGGTCAACA
ATGTCAAGGCTTTCTGAACCAAATATTTTTACATAGCATATAAAATGAAAATTTTGGTCTAGCATGGATCCATATCTTAAATTTGGCTTGGTGAAATGTA
CATGATGAAAGAAAAACAAAAGTATATCACAGATAATTTTATCTAGATTTATCATTTATGAAGGTGTCTAGACTGCTTACTCGAGCAGACAACTCGAGTC
GGGGAGGGTCAGTGTATCGGTAGTAGAGCTATTCCTTCTAAACTAGTGGTCCAACAACGCCTAACATGTGTGACAACTTAGAATTAGGAGCGTAACCGCA
CACTGACTCATCCTATATAGAAGTCCAGTGGAGCGTAACCGCACACACACTGCATAACAAAATTAAAGAGATTCAGAGGGTGTGTGAGAGAAATACTTTA
TATACAATATAATATCAAAACAATGAATTGCTGAAGTAACACAATTAGCATCCAAATATAAAATTTATCCAAATAAACAAAATAGCCAAAAAAAAATTAA
TATACAAAGCTCGAATTCTAAAAGAAGTGTCCCCAGTGGAGTCGCCAAGTCTGTCAAACCTCTTTTAGTTTTTAAAATTGTTGAGGATATGACGGGTTTA
AAAATATATATATTTTTGTTAGAGTCGCCACTTGGAATTGAGTTTTTTATGTGTTTCAATTCACCAGATATTTCTTAGTTTAAAATAATATTTTTTTTGT
TTTGGTCTATAAAAAACAAAGATTGGTAAGGAATTCTATTGACCGGAGGGAAGGTATGAGGCACCCGCCGAGTCCCGGGGTTTTATCACGGTCACTTTAG
TGACCTATATTTGGCTAAATAATTTATTTATTTATTTTGAATAAAAGGGGAAAATTTAATTAATTATTTTTTTTTACAAAAAATGATTGGCATAAGAGCG
TAAACGCACGCAAGACTCTTCTTTTTATAAAAGAATACACAAAAAGGATTGTAACCGAACACATGGTGGTATTTGAAGTTTTATTTTATTTTTTGAAGAA
AAAAACACAATAATTAATTACTCAATTTTTTTAAAAAAATAATGATAAAAACGCATAAAAGAAAATGGTGCAACATATAGACCAAGAAATGATTAGTTTT
TATTTATTTATTATGATTAAAAAAAATTAAGCACTTATATCTATTGTTTTACCAAAAGAAAAAGAAACAAACAAGTAAGTTTTTCTACTAGACAATAACA
ACAAAAGAAGAATTTTTTTTTTTATAAAATTATAATTAAACACTCTTTTAAACTAAAGATATACTAGTTTTAATTTCTTTTTTTTGTTATATTGATAAAA
ATTTAAGAAATAACCAGTTTGGTAAAATTTTTTTTATATAAAATGACTACCTTGACTTATTTGATAGAAGATTGCAAAATAGCAAATTTTCTAATTGTAA
GATTATTAAGTCAACTTAGTCAAATGTGTATTTTTACTTTGATAGTCAATTCAAATATTTATTTAAGAGAATTTATTTTTATTTTTTAAAAAAAGAACAT
ATTTATATTTTTTTTGCTGAAATAACCAGATTTACATTTTTCTTTTGTTGCAAAAATATTCAGATTTAAACCCTTTTGCAAATATGATTATTTTTACATT
TTTTTTTATTTTTTTAAGTCAATTTTTCAAAAGAAAGTTACCAAAAACCTAATAAAAATTGCTATTGTTATATTTTATTTAATTTTTTAAACTTTTTTTA
CTTGCTAAAACAAACATTTAAACTAAATCTTATTAATAATATATATGTACATCATAAAAGACATAATCATATGAGAAACACTATAGAATAAATTAATATA
AATATACAAACTAAGTAACATAAGGATAAACATAATTATATGAGAATTATAATAAACTTGGCAAAAAAATCAACAATTTTTCAAAAAAAAAAATATAAAA
AGAACACAAACATTAATTCAAGATTACATTGAAATGTAAAAAGAAATACCTAGAGTTGATGACAAGCAAATAATAGAAGCAAATTCAATTGAATCTCCAA
GACAACCCAAGAGAAATATCTTCTTTTTTTTTTAAGAAGGAGAATTTTTTTAAAGGTTTTTTTCTTGCAATTTTCTTTTTCTCTTTTTTCCTCCACCTCT
TTTTGGGGAAAAAAAAAAGAAGGGGCTTAAATAGGTGTGTAACATTGAACATCTTACTTTTCTTGAAAACATAAGAGCCAATGCATGAATTGGACTATTT
ATTTTCCCAAGGTTTCACCCAAGATGGCCAATGATTTTTTTAAAAGAAAAATCATATTAATTGAATAATTCATTTGCCATTTTAGATGACCTATTTACTT
TATTCATTAATTGAATATAGTTCTATGAGTCATCAGAAAATAATAGGCTCAAATGTCATTTAGATGATCCATTTCTTTTGTTCATTGTTTGAATGATAGT
TAGTGGGTCATTTGAAAATAAAAGGACCGAATGTAATGTAGATGACCCATTTCTTTTATTCATTGTTTGAATAATAGCTGATGGACCATCTGAAAAAATT
AAAAATAGGCTCAAATATTGACCCATTTCATCAAGACCCAAACAAATTGACGTAGTAACACAAAATGTAAACATCTAAAAAATTTTAAAGATCAAACACA
ACAAAATAATGATGAAAAAAAGTAAACCAAATAAAAAATAATAAACATAAAACAAAATAAATAATAATAATACTTCAAGCAACAACATCAACATGATAAA
TTTAATGAACATTAATAACATAAATCTGACATCAAACGACTTATATGGTCAAAGGAAAAAAGATAATGATGAATTTTGATAATGATTGAGAGGGGGATAA
GATTGACATAACTTCCTGGTAATGAAGGTCGCCGGAAAACTTTGCCAAATTTTTTTTGACTTATATCAAATGCTAGCCCTTGAAGATCTCCACACATTTA
TGTAAAGGGTTTGGGATGTGAATGAGCGGAACTTTATAAATTTAAGGAAAAATGTAAAAATTCATATTTGGTTTTCCTTAGATCTACGGAGTTTGGTTAT
TTATATGGATGAAGGTTTGTAGATTTAAGTAGAGGAGGGTGAAAGGAAAAGATGGTAAAATTTTATAGATTTTTCGACCAAAAATGTGGTGGCCACCGGG
AGTTGGTGGCGGCAGCGGTGGCCGGTCGGCCGCATGGTAGTAAGGGGAGGAAGAAAAAAAAAGATGCTATTTTTTTTGAGTTTTGTATTTTTGTTTGGGT
CCAATAATAGCCCTTGGATCAAAATATCATGAATGGTTGAGATTCAATTTTGACCATTTCTATTGACCGGGTCAAAATCAATTGGGTTATTAGAATTGAT
CTAAATCAGCCCAATTAAAAAAATTGGGTCATTTGAGCCAATAAAATAATAAAAACAAATACCCAAAATACAAATAAAATACAATTTCTTACTAAAATAT
TATAGGAGTAAAATAAACACGTTAAAAATTAGGTGTTCACAGTGTAATTACAAAGGATGGAAGGAACGAGTATTTTTCTGGCTCACAACTCTTGTTCTGC
AAAAGTTTGCCAATGAAGAAACTGTAGTGCTAAAATTTCATGATTATTGAAGCATGGAAACACACAAACTTCCTATATAAGGATTATATTTTAAGCGCTT
TAGACGATAACTTATATAATGTTTTCAGTGCATTGACAACTTCAAAAGAATTGTGGAATGCACTCGAGAAGAAATATAAAATAGAAGAAGCATGCTTGAA
GAGGTTTGTGGTCGCAAAATTTTTAGAATATAAAATGACAGATAGTAAAATTGTTGGATCAATTTTGTAAGAGGTTCAATTATCTTTTATGATCTAATTG
TTGAGGACATGACAGTTAATGAAGCTTTACTAGTGGCGGCAATTATTGAGAAGTTACCTTATTTGTGAAAGGACGTCACGAATTATTTAAAGCACCAACA
CAAGGAAATTAAGCTTGAAGATCTTATGATTCAGATCAATATCGAAGAAGATAACAAGAACTTCAACAAGAAGTCTCGTGACAGTTCGACAATAATGAGT
ATTAATATTGTTGAAGAAGCTCTCACCAAAGACAAGAAAATAAAGAATTCCAACAGACAAAAGTTAAACAAGTCAAAAAGAAATTCAAGGGCAACTATTA
CCATTGTGGTAAGGTTGGTCAAAGATATGCTTACTGTCATGCTCGAATAAAGGACAAAGACAAACGCAAAATTCAAGCAAACAACTTGGAGGATATGGAA
GATGTAGATGATCTATGTGCAATGATCTCGGAGTGCAACTTAGTTTGAAATCTCAAGGAATGTTTTCTTGACTTAGGTTCCACTCCACATATTTATCTGC
AAAAACGTTCTTTATGATGTATACTCCTGCTGAGTTTGGTGAACATTTGTTCATGGGGAACACAACAACAAAGGCATCACATGAATTGGGAAAGTAATGT
TAAAAATGACATCTGACAAGGTGTTGACTTTGAACAACGTTACACATGTTCAAACTTTTAGGAAGAATCTTTTTTTCGATGCAATGCTCATTAAGAACGG
GTTAAATTTGTCCTAGTTTGTAACAAAGATTCAATAAGTAAGAATGAGATTTTCTTAGAAAAGGCCTACCTCACTTAGGGACTTCTCAAATGAAAGTAAT
GGTTGTTGACATTATTAATACGAATTCTATTTCTGTTTGCATATTGGAGTCAAATGATTATGGTGTGCCCCATTAGGACATATAATTACAAAGACTTACA
AATATGAACTCCTTTGATATATAACTAACTGTGAAATTTGTGTTGAATGTAAGTTTGTTAAACAGTCTTACAAGTCTGTTGAGAGGATTCAGATCCTTTA
AACTTAATTCTCATATTTATATGCGATATGATATTAATACCGTCTTGTCGTTGATAAAAATATTTTATAACTTTTATTGATGATTTCACCTGATTTTCTT
ATGTATATTTGCGTAGATAAAACAATTGATGCATTTAAGCAATACAAAAATGAAGTGCAGAATCAATTAAATCGATGATAAAAATGATACAGAGAGATTA
GCGATGGAGATTACGAATATCTTTATGTAGACATATGTTTGTAATATGACATTGTTAATCAAACTACAACACCCTATACATAATAATAAAATTGATTCCC
GGAATGGAATTACAGAACTTTAAAGGAAATATGATGAATGCATCATTAATCTATTTTAGTTTACCGCAAAACTCTTGGGGCTATCCATAAAGCTAACAAG
ATACTCTATACGGTACCCGCAAAGTGCAATCGATTCCATATGATTTATGAAAACGAAGGAAACCCAACTTTAAATGATTTAAAGTGTGGGGGTGTTTAGC
CAAGGTATAGGTTGATTTAGCCAAGAGGGTTAAAATAAGACCTCAAATATTTGATTGTGTATTTATTGGATACGTTGTGAACAGTAAGGCTTATCGAGTT
TTAGTTCACCAATCTGATAATCCTGAAAACCATGTTAATACGGCAATTGAGTCAGATAATGTTGAGTACTTTGAACACATTTATCATTATAAAATGTCAT
ACGCCAATTCTAGGTGAGGAAGACAAGTACCATATGAACACATCTTTTACAAGTGATCTATGATAAGAAACTATACTATGAAGATAGATTTACTGATGAG
AAGCTTCATATAAAACACATGTTGACTAGTTGATGTGAAACATGTAATAAGTGAAGCAATGAATACAAATGATAGCTTTACAATGTCTAGAAAGCCTCTA
CTGAAATCCATTATTGTACGAATATGAAAATACGCATAGTAAAGACTCGCAAAGCCGCGAATCAACCTAGAGCTCACCAAAAACAATGTAGTTCATCTCA
TTCTATTAGAGAGATCTACTATTTGAGTACAGGTACATGTAGTATGAAATGGAGCATTCCCAAAAAGGAACGTGAGTACGAAGGAATGTACTAAATATTT
AAGTCATAATATAACAATATGTAAAATAAGATCTCAAGTGAAATCCAATACCAATAGATAGAGACTAGAAACAACCTCTGCTTATACTTGTAGAATCTTG
TACGTTCTTTTTGTTACTTTTCTATGCATTATAATATTTGTAAGACATATGATCCAAATGATCGGCTGATAAGTTTTAGAAGAGGGACGCATGCTAGACA
TTTTAACCCTTGGGATGCTGTCCTCATAATTCCATTGGCCCATGCTAGTCTTTCGACCCTAAGCTGCCACCCTTCTCTACCAATTGGGATATTCACATGA
TAGGATTCGCCCCTAAGCTGCCACCCTTCTATCCCAATTGAGATCGACCCCTGTTAGGAATTTTTCCTCTGGCTCCCACTGATGTACCGTGGTTTCACGG
TATTTTTAGTTCTTTTTCCTTAAGTTTAGTATGTGTCCAAAAGCCTTTTTGTATTGATTTTTATGTAAATTTCTCCTTATTTGCAGGAAACCTCTACTAG
ATGAACACAAAAGTTTTTGAGCAAGAAATGCAGAAGAGACCACCTACGGAGCTTATGAAGGTCCATTGAGTTTGTGACGGTCCATAGGTGGTAGCGTAGT
GAGGAGAGAAGCTGCTGAAGGAATATTAGGAAGTCTGACCTAATGTGGGATTACGGAAGTCCATGACGGTCTGTCCTGCTGGTTCATCGTAATGATCAGA
GAGTAGTCCCAATATCCAAATTCCAAGAAGTTAAAGTATTATGGAACGGAGACCCTCGACAGACCGTCGTTCTTGGAACGCTTCGTCATATATGTTCATT
GAGGGTAATGAAGAAAGCAGCAGAAGAATTTATAAAGTATGGGACAACAGAGGCCATGACGGCCCATCGTGACCACTGCGGTCCATCACGAGGTCCGTCG
ACTCAGACGCGTTTGGATAGATTTTCAGCAATTAGAATTCTTCTTTTATTAGGTTTTTGTTTTTATTATAAATAGTTCAAAAAACCTCATTTCGGGGGGT
TAGACTTTTCGATAATTTTTTGTTCTCTAGTTCAAGTATTAAAGAATTAATTTAAGTAGTTGATACACTTTTTTTGGAATTGATTGTTGATTAATCAAGT
GAATTTCTGGAGTTATTCTTTCTCATTAAAGTAAGTGCATGAATTCTTATATTAAATATATGAATAGTGTGATTATGATAATGGGTAACTAAACTCCATA
ACGAGGGTTGTGGGAACCATGAAGGAATGATGGGGTAAAATATAACTTAAATAGCAATTCTAGAATAATGCCTTGCATGGATATATAATCCTTTCGTTTA
GAAGTCTTTTTAACGGACGGACAACGTTAGAACTCGCCTTAATGCTACATGTTGGACCAAGGAGGTAGATAATAGGAAAAGAATTATCAACATAGATTTA
GTGTACACTATCTAATAGGCTAGCGTCGATTGGTAAGAGGTAATAACTTAGTCAAATATCGAATACAATGCTTAATATGAGGTAAATGGAAGGGTTAGTA
TAGATACACACATAGCCGGACCAAGGTGTGGAATGAAATTTCTAGATGCTGGACCAAGGATTTATAGATACCTAACTTATCACTTTACATGCAAGATATT
AGGAAAGAATTGTTATAGTTAGAATTATCAAGTTACGAACCTGTGGGGAACACTTAAGCCCTATTTACTTTTATTAATTGATTAAGTTTCGAGATTTGAA
TTTGTTAGTTGTTTACTTTAGTTTAGTTAATTATTTTCATTAATTTAGAAATAAAACCCCACTATTTTGTCTTCTGTTTTCTAGGGAAATAAATGACTAA
ATAATAGTAATAATAAAATAAAGTTAAGTCTGAACTATTTTCCTTGTGGGATCGATCCCAACCTCATTAGTTGGGTTCTTTACTTGATACAACCATTTTA
CTTCTTATTTAAGAAGTAAGTTTGAGCGTATCAAATTTTGGTGCCGCTGCCGGGGAAAGTAGCTTTTAGATTAATTTAAACTTGTTACTAAAGTTTAGTC
AATATTTTCTTAATTTTACTTTTCTATTGTTTTTTATTCTTGCAGAACTAACTTCCTTATATGTCAAATACACAGAGAGGAAGAGAACCCTTGTTTCCCT
CTGACCACGAATTAGAGCGTACACTACGCAATATGAATCAAAACTTGGATATTAACGATGATGATCCAAACAAGAACATCCCAACTCTAGTTGATGCTCA
TGGTCAATTATTACCTGATGATCCTGGTGAAAATCAACAAAGGGGACAAAATCCCGCTCCACGTCCTCCAGAATACTACAAAGGTTATGATAATATTGTA
GATTTTGATAGGCCACTTGTCTTTCCCCCTCTACCACAAGGACACACCTTTGTTGTAACTAGTAGTGTGATGCAAATGCTCACTGCTAGAGGTTTGTTTT
CAGGGCTACCTTTTGAGGACCCACATGCCCATAAAACTAAGGTAAGGGCAGTGTGTAAAAGCGTTGTAGGGAAGCCTGATTTGATTTTGGATGTAATAGG
GCTAAGAGTATTTCCTCTCTCACTGACGGGAGAGGCTGCTATTTGGTTCACTGAGCTCCCTTATAACTCAATTTTAACTTAGAACCAACTAAAGGACATT
TTCTTAGCACTTTACTACCCGTTCTCCAAGAAAATAAATCACAAAGACAGAGTGAACAACTTTGTGGCACTACCAGGAGAGTCAATTAGCAGTTCTTCGG
ATAGATTCACTTCATTTTTGAGAAGTTTCCTCAATCACCGCATAGATGATTCACTGAAGGAATACTTAAATCGGGGACATGATGATAATAATAAAGAGGT
ATTGGATACTATAGCAGGTGGTTCTTATGGGGAGTGTCCTTATGCCGAGATTGCCAAAAATTTAGAGAAAATCTCCCGGAATAATAAAGCTTGGAGTACT
AGGAAGTCATATACTAGAAGAAATACCTTCGCAGTGCAATCCAGACACAACGCAGCCACAAATAAGATTCGTGAAGAGATGGCTTAGATGTGAACTGAGC
TTGGGTTGGTAGTAAAACATGTCACTGGGGGTGCAGAAAAGATAAATGTAATGAACTACTTGTCTAAACCACCACCACCAAATGATGAATATTATTATGA
AGAGGATTCATATGCGGTAAATGAGCAGATGGGGGGTTTCCGACCGAATTCCCAAGGCTCAAATCAGGAGAATTGGCGCCAAGGTCAAGGAAACCAAGGT
CGGAACTATGGTAACTATAACCAAAAGGGTAATTATGTTTGAGATGGAAATTACAACCGAGACAACAACTTTAACAGGGGTAACTATGGTAATACAATTG
GGCCCTATGTTCCTCCTCAAAATCGTGAAGTTGATCCTAGGGATGGTGGAGGTAGTATGGCGTAAGTTAAGTATATGTTGCACAAAATAATGAGGAGATT
CGATGCTAGTATGAACAAATTATCTGCGGCTGTGAACAGACGGCAACCGGGCACTTTTCCTAGCAACACTGTCCAAATTTCAAAAAATGATTGACACTAT
ATAGCAATAACTAATCTGGATGGTAAGCAAACCATTGACCCACCTATGGCGTCTAATGAGGAAAAGGTGATAAAAGATAATGATAAAGTGGTAGAGGTTA
GTGGTGAAGTAAAAGATAACACTGGAAAAGATGTTGAAGTGCCTAAAAAGGTAACTCCCATGCCTAGACCACCACCCCATTTCCTCAAAGATTAGTGAAA
AAGACCGAGGATGGTAAATATCGACATTTTATAACAACGTTGAAGAAGCTTTCTATCAATGTCTCTTTGGTAGAAGCTCTAGAATAAATGCCCGGTTATG
CCATGTTTATGAAAGATCTGGTTACAAAGAAAAGATCGGTCACTTTTGAGGAGGATGATAGAATGCAGAATTGTAGTGCAATTGCTACAAAATCTCTAGT
ACAAAAGAAAGAAGATCCGGGTGCGTTCACTAATCCTTATATAATCGGGTTATTACATCTTGCGAAAGCATTATGTGATTTGGGCACAATCATAAATCGC
ATGCCCTTCTCGATTTACATAGATTTGGGTTTGGGTGATCCAAAGCCTACTGCGATGTGGCTACTGATGGACGAATGAACAGTAAAAAGGCATATAGTGA
TACTCCACGATGTGCTAGTAAAAGTGGAGTAGTTCATATTTCCGGCAAATTTTGTTATTCTTGATCGTAAAGTCGATTTTATAGTGCCTATTATTTTTGG
GAGGCCATTCCTTGCTACAGGTAAAGCCTTAGTTGATATGGAAAAGGGGCAGTTGAATTTCGGTTGAACAATGAAGAAGTGACCTTCAACATTTGTAGGT
CCATGAGGCAGTAAAGACTCCATAGAGCCTCGAATCAACGTGGAGCTCACCAATAACCGCTAAATATTATATGCTTCTATTGAGAGATGTACTAGTTGAG
TAACGGTACGTGCACCAAGAAATGGAACATTCCCAATAAAGAACTTCAGTACAAAAGAATGTACTAAATATGTAAGGCATAATACAACCATTTATAAAAT
GAGAGGTCAAGTGAAATCTAATACCAATATATAAAGATTAGAGACCACCTCTCCTTATACTTAAGGAATTGTATATGTTATGTTCTTTTCCTTACTTTTT
TGTGTCTTATATCAATTATAAGACATATGATACAAGCAACCTGCTTTTTAATGGTAGAAGAGGATGACCCATGCTAGGCATTTTAACAGTTGGGAAGTTG
TCCACATAATCACACAAATTTTGATCGACCTATGCTAGGCTTTCATCCTTAAGATGCCACTCTTCAATACGAATTGGGATCGACCCATGCTAGGATTTCA
CTCCTGAGATGCAACCGTTCTGTACCAATTGGGATCGACTCATGTAGATATTTTCCCCTGGTCTGCTACACATAATTATACAGATTGCTTCATTTAGATT
CTTTAATCTTTGAGATTGTTGTTTTGATGTTCATAACTCTTTTGATATTGATACTTTGATGATCATAACTTTTTTGAGATTGTTTTTTTGATGATCATAA
CTTTTTTGAGAATATTATTTTGGTTGTCCTAATCATTGGTGAGATTCAGAATTGTGAAAAATAGTAGAGACATATCGATATGGACTTGGGATACTAACAA
TGACATGTGAAGAAAATGTGAGTTGAACGTGTAATACTTTAGAGCTTATAAAACTCAACAAGCATTTTGACATCTCAAATTGAAGCACATGTCAAGTGAA
GATGTTGAACATTCAGCCAAGAGATTTGAGATCTATTTGATAGCTTAATAGTCACTAAATAATATCAAATATAGGGCATACATGAATGTGTAACCAAGGG
AGAACATGGGCAGATTCAACATAAGGACGAATACATATTCCAAATGGGTACATATAAAATGTACAATAGAGAAAGTAGAGCTCTTGTGAGGTAAAATTAT
AGTCTAACACAGTGAGAGTAATAAACAATAAAATGAACATATAAACATGTGAAAAGATGACATATATTATGTAATAAACAATTGAAGCAAGTTGGGAAGA
TGTGGAAAGATCATATATCCAACATTTAAACATATGTACCATGTGTAATCTATGATCATTTTGTTTTATATAAGGGAAATACGTACCAAGGGCAACTCTG
GATGCTAATACTTGGCCGAGTAAGCACGTAATTTTCGTAATAAACTCATATTATAGTACTCACTTTGATGCTCTAGGGAGTAGGAACTGTAACTATGGAT
CAGTCACTACTATGACAATTAAAAAGCTTACTTTGTAATACAAGTGTTGGATTCATGCAAAGGAAATATGTAATCAAATAGCCTTACATACCTAAATTAC
CAATTCATATAGCTTACAAAGTGTGAACGTGTCCTTTAACATCAAAGTTTTCATCTACAACAACCAATCATTAAGGCGAATATTAGCATCTTACCACCAA
CTCGGGATATTTCAACTCATCAAAATAGTATCCACACAGCCAGCCCATAATCCTTCTAATTGATCGTTTCTTTCAAAATATTTGTGTGTTATAGTTATTT
ACACGAAACAACCTTCCATGAAACGAGCAGTGAGCTTGTCAAACCTTTAATTTAATGGTGCATCACCATAACTTGTAAATCTTCCCCTTAAAGTTTCTAT
AATCATTATCTAAGTAAATCCATGACCTACCATAACCAAGTCACTGCAATAGCAATCTTAAACACTAAAAAATAATCTAAAGACTTGAATGTATGGTTTT
CAATCACCATCCCACGAGTTGCAATAAACAAGTAAGTCAATTATGCTCCATCAATTAGAGGTTGTGGAAGCGTCCTTATCGTTGCTATCTTAATATGTTA
TTGTCCTTCAATTACTCTTTTTGTAATCTTCTTTTAGTCTTTGGTAGAGAGTGGCAGAACCATGCTTACAACACATGTAACTATCTCTAGTTCACTCACT
TTGAACAACTATCCAACATAGTTAAACAATAGAGGAGAGAAGGTGATCTTCTGGATGATTTTGAAGAAACAACATGAACAATAGTTAGAGATCTAGTGGG
AATATTGGGTGGTTGTTTCATCTCGAGAGAGAATTAAATGGACTTAAGAGCTTAAAATTTGTGTAAGAGGAAAATGAGATATTTGTATTAGATTTTTGTC
CTTAATAGGCTCTATTTTTCCACCTTTCTTTTACTTCATTTGCAGTCAACATGTGTACTTAATTTAGGTCACATGTTTCAGTAAGTGATGCACCTACTTT
TCCATTAAAACTATTTCTTGTGGGCATGGAAAGATTGGGTCTTTGCTTCCAATTTTTCCCTTCGTCTTCTATTTAACTTGGGCTAGATTAATACAAGTAG
GTGTAGTGTCATTGTCCCAATAACATGGTGAAAAGAGTCTTAGTAGGTGATGCACCTACTTGGTTGTTTGGTTTGTCAATAAGTTAATGTAAGTAGTGCA
CCCACTTGGTCCTTTGGCTGGTCAATAATTCAAAGTAGGTGATGCACCTACTTGTCACCTACTGATTTAGTTAAGTTAAGCAAGAACCTCAATATTTTAT
TCTATTTCTAGACTATAGTATCTTTAACTTAACTTAAAACTTATATAAACTGTCACTTTAAATTTATACTCAAATACCATTTTATGGTCTCAAGTTTAAA
TACTTCTATTGACATCAACTTAATCGGGTCGCATCAAAATCCCCAGACAATTTACTTTAAACCTACTTTGTTGTCACTAGTCGCACAGGAAACCAAGTAC
ATAACAATACTGCAAGTCAATTTATATGCATTATATAAATAGAACTAATACATGTAGAATATGAGGTATTACAAAAACTGAATGTGATTTGAAGGTGGAA
GACCTAAACGACTACAAGAAGAATCAATAGAAAATACACTACCTAATGAGGATCCAAGGCGTAGTAATCATCAACTGAAATCCACTTCAGTCGGACAAGA
TTTTGTGGAATTCTTCTTTGCAAATAAGCCTCAAGCAATTATAGTAGCAATGTCTTTGTCTACGTTAACTTATTGGAAAAAAGTAGCCCATAGTTAGCTG
AAGTCAATTTCGCATAACCAAACTTGGTATTGGATGTTTTTCCTCCCAGAAATAAACCTTTAGGATCAAAGTGGATAATTAAAAGGAAAATGAAAGCCAA
TGGAACTATTGGCATATATAAGGCTAGACTTGTAGTCAAAGGACACAAATAAAGAGAAGGTCTACATTACTTTAATACATGCTTTCCAGTAACACGGATA
ACATATGTTAGGATGTTAATAACAATAGTGTTAGTGTATAGTCTTAAAACCCACCAAATGGATGTTAAGATAATCTTCTTAAATAGAGAACTAGTAGAAG
AAATTTACATTTAACAACCTAAGAGGTTTGTAGTTCTTGGTAAAAAAGAGAAAGTTTGCAGACCTTTTAAGTCACTTTATGGACTCAAACAATCACCCAA
ACAATGACATGCTAAATTTTACCAAACAATGTTGGCACATGGATTCAATATCAAGGAATGTGATAAATATATTTACATAAAAAGCATTCCAAATCATGAA
GTCATTGTTTGTCTATAGTTGATGACATGCTAATAGTTAATAAAGATATTGTCGAAATAATTTCTTCTAAGCTCATATTGTCTAGCAAGTTTAATATGAA
GGACTAAGGAGTTGCTGATTTCATCTTAGGTATCAGGATTATAAAATTTCCTCAAGAACTAGAATTATTTCAATCTCATTATATTAAAAGGGTGCTAGAC
AAGTTCAAGTACTTGAATTTCAACAATGTCAAAATTTTAATTAATCTAAGATTTACATTTTAAAAGAATGAATGTGAAAGATACTCTTAATTGATATATG
TAAGAATGTTGGGAAGTTTAATATATATTATGAACTACGCATGACATAATGTAATATTTTCTTTTAGTAAGTTGATTGCGTTCAGTAGTAATCCTAATCA
AATTGACTGGATGACAACGAAACATCTGTTGGGGTATCTGAAACAGACACGAAACTATGTTTTACATTATAATAAATATATTGTAATGATTGAATGATAT
AATGATGCAAACTGGGTCATCGTGTCGAATGAAGTGAAATCTACAAGTGATTGTGTGTTTACCATAGTGGATGAGTAGTCTCTTTGAAATCGTCCAAATA
GACATGTATACTTCGTTCCACAACAAAGACTAAATTTATTGCCTTCAATACGGCCGCTTAAGAAGTTGAATGGCTCAAGAAATTTCGTAGAGGACAGTTC
ATTTTTGCCCAAACCCGTGGGACATATTTCCAAAAATTGTTATAGGCAAACAACAATAGGTAGGGCAGGGAGAATAATGTATAAAGGAAGTCTCATCTTA
TACGGCACAGACATAATATTGTAAGTCAACTTCTCTTTAGTGAAAGTATCAATTGACGAAATGAAGTCAAGAGATAATGTGTTAGATTCACTAACGAAAG
GCCTAGTGAGAGAGGCAGTTGAAAGATCATATAAGGGAATGGGTTTAGGTCTTAGTACGAGTCATCATGGCGCTAAATCTACCTTGCGAACTCAAAATAC
CAAGAGCTAGGTTTAAGGAGAAAAACATAGTTGTGGCTGATGGTTTGAAATTGTTAATAAGCTCAATCTATTCTCATGGTGAGGAAAATGTCCAGGATCG
AGGTTAAAACAATAAGGACTATTAATAAATTAATAAAGCTTAAAATCTTTAATAATTTTCTAATTATTGAATATTTTACCAAATAGATTATCTACATGAT
GACATGGTTAGAAATTACCTATGGGAATGTGAAGTGTAATCTGTTTCAAAGATAATTCTCGTCAAAATCCTATTCTTTATACACTTACGAAAAAAATAAG
GCATTCATGACTGAAACAAACACAACTATAAAACCATAAATGTTAAAGGGTCATTTGTGTGAAATATATTTGTTTAGGTACACACAAAATCTCGACAGTT
CAAAGATATCACATCTATCAATTGGTCGGGTATATCCGACATATTCTTACAACGGAAAGTTCAATGAGAAATCTACTTATCCAGATGCAATTGATCTTTG
CTTTTAAACTACACACTCGTATATGCATTCCTTTATGTTATAACCATTCCTTATTAACAAGGGGATTGTGGGGTATAGGAAGAGTTAATGGGAAGTGGAG
GGAGATGAAAACAGAAATTATAAAAGATTCTCTTATGCTTTAAGAAAAGTCATTTCTCCCTCATTGGTGATGGAAAGAAAAATTGAAGTATTTAAATAGA
TAAAAACTTTTACTGGTTGTTAAAAGGGTTGGAAAGAGAGACCCCCATGACATCGTCACCATCGTCAGAAATAGTTACTTTTGGGAAGTATATGGAAATC
TGAAAAATTTAAGTAAGTTAAAAGTATGTTTTGGGTCAACTTCAAAGTATCAAAATTTCTAGCTCCTGATGAGTTAGGTGTAATTCTAGATATCGTTTTA
AAACTCTTGGAAGGATCTTTTCAATGCCACAGAGTTTGCCCGAATCCAGTTCATGTGAGTGAGTTATGTCATTTGGAAGTTGGGCTGTTGGATTAAGGAA
ATGTCCAATCTGAGATTTTAAGGGGATTTTTAGTCTTTTGAGTACCCTATTTTTTTAAATCCATTTTTAGCAGTTTAAGATGAGTCAAATAAGAACTCAG
ACAATTTTAGAAGTTTGTAATTTCATGCTAGGGCTAACGAGAAAGGGGAAGAGAAAAGAAGGAGAAAAAGGGCTAATTCATCAAGATGATCAAGATAGCT
GGGATTTTCGTGAAGAACTTATTCCTATAAGGTATGTGAGACTTCCATGGTGTTGGGATCATTCTCCCATGTGCCAATCATATTATTTCAGTTTGGATTC
GTCGTAAAAGAGTTTTTGAATATTGATGATCTTGATGCCTACTTCTTGAATTCGTATATTATACTTGAATTGCATGAGTTGGGAAGTTTCTGAGTTCGTT
ACGTTATGTTATAGTCAATTTGAGTTAAATTCTTTGGTACATTTGTTGGGTATCTGTATATAAAATTAATTTAAGAACAAGAACTAAGTTTGGGTGAATT
GGGAAAAAAAAGAATTTTGAAGGGCGAAATTTGAAAATAGTTATGCGTCGCGCGTCTAGTTCCAATTTTTGAAAACTCTACTCTATATCGTGGATCTCAC
ACCAGTTGTTATGCCTCGAAGAGACATTTTCAGAACCAAAATTTTACTATGACTCCACATTTTGGACCCACATCCAAATCTTGATTTTTAGTCTTTTATC
ATATTTAGCTACCTAAAATCATTCCTAAAGAACATGAGATCTTTCCAAATATAAATATTAATCCTTGAATCCATATTTCAAGTCAAAGATCACATAAAAT
TTAAAATCAAGAAAAATTAAGATCAAAGTCAAGAGAATTAAAGAGTAAAATAACATAAGGTCATTTTATGTTTTCGTAAATCCTTTACAAATGTTTTAAC
CTTGTGTTAAGACTTCAGTTTTGAGTTCAACACATAGTAAATTTGAAGTATTTTCTTTAAAGAAATATATGGGTACCAAGTATTCCCAATGAAGTGTGAT
AATGTTTTCACATTTTAATAGGAAAAGAAACTAAGATTTCCTAAGAGCCCTCGAACTAGTTTTTAGAAAAAAGAAATAGCTTTCTAAATTAAACAAGTAG
GGAAACTGATATTTCAAAGGTAGCCATTGAGCACTGATATGGGGAAGAGCTAATATATAATAATATTTCACAGGAGGAAGTTTGTTTTAAAGACATAAGA
GCTAATATAATAATATTTTTGGAGTAGTATTGAGCACCGATATGGGGAAGAGTTAAGAAAACTCACAACCCCCATAAACCATGAAACCACCATGGGTAGA
AAAAGATAATACTTTTAAGATGACTTCTTTAGTGCATTTTAACATAGGTTAGTGGATCTACTTAGTAGTTCAGGTTTTATACAAATGGCAAGGTATAGGA
AGGCCCTGGTAGCATGATGCAAAATGTTGTATCATCATTATAGTTCTTCAGGATGGTTGTCGAATAGAGTAACTCCCAAAGAAGTTAAATCTATTTTGTA
TGTATAGTTATTGTATTTTTACATACATCTCAGAGTTATATTGTATTTTTACATACATGCAGAGTGCATGTTTTGAATAGTTTTCTTGATATTGAAATTG
ATTGAAATTGCTTTATGTTGAAATGAGTTCAGTCTTGTAGAGTGGAGTTGCGCCAGGTAAGTTCTTCAGTTTTCCCTTTGAACCCTGTGTTTTTTTAGAA
TTCCAACTCGCATAATCGTACATTCAATGTAGTGGTGTCATTTGTCTTGCATCGTATTATGATGCAGACACAGGTAATGAGGATCCACACCTAGTGCACC
GTTTATCTAATTAACCACTCCAAAGTCAGTTGGTGAGCCTCCTTGAATTCTAGAGGACTCTTCTAATTCTTTCTAGTAGTATATCATTAGGATGTTGTGG
GGTTTTTGCCAACATCCATCTTAGTCATATTAAAGGCTTCATAAACAGTCCAATATTAGTCCTTTGAGTCTTCAGTATTATCTCTTATTGTTAAGACTTG
GATTGTCAGTTTTGACCGAGTTGAATATTTTTATTTTAAAACATCTGGAGTTATTATATTATTTTTATGTTAAGTTAAGTTCATTGGTGTGATAGATATG
ATTATTGTCTTGTGCTGAGTTAAGTAAGTCAGGCCAAGGGTTTGCTTAACGCCAACAATAGTCTTCAAGTGCCATGCACGCCCAGGGTTTGCTTAACGCT
AGCAATAGTCTTCAAGTGCCATGCACGCCTAGGGTGTAGGCTCGGGGTATGGCAAACGTGGTATTAGAGTATAAAGTTCAAGAGTGCTAGGGGTCTATGA
AGCCTTCTATATAGAATCCTATTTATAGGTGTGAAGCGCGTCACATCTATAATTTGGAAGCTGCAAAATTTAGGAACTATCTAACTTCTTTCATACTCTT
TTCGTGCATTAGAGTTTTTCTATAAACTTTTCCCTCTAAGTCGTGCTAGCATAAGTTGTCATATAATCATTCTTCCAGAAAGGCAGCAAGAGGTCATCCA
TGTAGGAGGAATATTGAGGCACAAGGAGTACCCATTGAACTTGAAGTGTAACCCCATAAAGAAGTTACTAAAGAAAAATTAAGAGAGGTAATTTCGATGT
TGAGTCAGTCTATGACTAATCATTTTGGTCAACAAAGAAGATCTCGACAAGAAGGGGCTAACACTTCGAGGATCGTGAGTTATTGAGGATGAATCCCTAG
TTTGTAACACTTCGAAAGTCCAAGACCTTATTTAGAGCCTAACATGTTGGTATAATGCTATTAACACTGATATAAGGCCTAAAATAATGTTTATAAACCA
TTTGGGATGTTTAAGTGTCAAGACGTCAAGAAACGTCCATGACGTCCAGAAGCTAGTATAATTGAACTAGTTGAACGTCCTTAGGTTTCGTGAAGGTTTG
AAAGTGTTGTATAAGGTCTAAAACTTGTAAAATGACTTTAAATATGTAAAACTATGTATATAGAGTAAAAACGTCCAGGTACGACCCCCAAGGGTCGTTC
TAGGGGTCCACAAAGGGACCCCAAACTTGGCTAGATAAGCTACCAAAGCAGCAGCCAAAATGCACATATAGGGAATGTGTCTGCGTCGTGAACTTGGTTG
GCCCTTGGTCAAAATAATGTCTTTGTCGCGCGCATGTTAAGGACACCTCTTTTTCAAAAATTAGTTTTGAAAATGTTGCGGGAGAAGCTCTTCATCGCGG
ACTTGCTCCCCGACGAAAATCTAAAATTTGGCATTCACATTTGACTTTATTAAAGGGTCAATTTAAGTGAAGAGTCTTTTGGTTATTTCCTGGGTGGCCT
ATATATTGGTTTTTAATCATATTTCCTTCACTTTTATGCACTAAAAACAAAACCCAAGATCAAAACCCAAAAGCTCTATCTCTCTCTACTTTCTCTCTAT
ATTCATCATCCATTGAAGAAAAAGGAAGCTTGAAAAAGAAGATAAAATTGCCAAGGTTTTTCACTCTAATCTCATGGATATATTATCAATAAGGTATGAG
TTCTTCACTCTTGGGATTCCTTTCCCCAAGAAGTCCTTTGAAAGATGATTTCCAACAATTCAATTCATAGGGTGTATACTCTATAAGTGAGTTTCTCCCA
AACTTGAGATTTATGACTAATGATGAAAAACTATGACTTTCTATGGTTAATTAAGTATGTGTTTTTTAGGTAATAGATATGTAATTTTGGGTTTTCGTAT
GAAGCATGTTCCTTCTCTAAATAATGTATTCGATTACGTTATATTTATCACTTAATGTTATGTAAATGTTTGTATTTTAAATATAGCTTGAATGAACTCT
TAAATGAGCTCTTTCCCTTAACCCTAACTATGAATTAGTCTTGTACATGAATAGAATAGTTGGGATTAGATATGTTATTGTGAAATTCACTATATTACTT
AATGATTGTTATGAATTGAGTATAAGTTCATGATGAAGATTCTTGGAAGCAATTAGGTAGTCTTATAAAATAATGATTTCTCTATTATGTTGATGTTGTT
CTATGAATTGATGTAGCTATGAAATACAAGTATGTATGATGTTGCTATGCATATATTTTGGACTATGAATATATTAAATATGGGATCATGGTAAGGATAT
GATAAAGCAAGCTGATGATGTTTATCTTTTATGCCTTACAACCTATGATTATGATATGTTAATCTCACACATGAAGGTTGTGATGAGAGGAAATTCTCAT
CTAAACCTAAATATCTTATGATAATGTTTATATGAGGATTTAAATATACTATGGCCTATAACAAGTTTTATGATAAATGTTGACTTAATGTTTATTGAAG
AAGAGACTTTAGCTTAGCACCAATGAACTAGATACTAGAGGTGTCACTTCGCTAGTTGGAAGGTAAGTTCACAATGACTATCATGAGATAGAGGCTTCCA
TGTAATGTGGAACTATATGTCTCTAATATATCTCCTAGTTCTTGAACTATGTTGCCTCCATAGGAATACTAGCCAGTTGATCCACCTAGAATTCTATGTT
CATGTTTTGATTCTACCTTTGCAAGTAGACCACCTTATTTTAATGTGGGGTTTTATGACACCGGATTCCATGTTTAGATTACATGTTCTAATGTCAGTTA
AGGCGATTGTTCCCTCAAGTAAAATGAACGACAAGTAAATGGGCATTAACTAGGGTGACTTGAGGAATCTGCTTAGTATAGTTAGGGATATGGAACTCTA
CCTAGACATTGTACAAGTTGGCTCTAAGAGAAGTCCTAGGAGATTGTTCTTATTTAATATAATAACATGAAATGTATAATGCTCATGATGTATGATGTTA
CTCTTATATGTTGTTGGCTATGTTGATGAAAACGTTATTGGACTATTTTGCTATATGTAATGAGGATCACTAATGATGTAAGTTGTATGAAGAAAAGCAT
TACTTGTGGTCTCTTATCTTGTTTACTTGGTTATGTAGGATTATGAGGCTTCACATGAGCATTGCACTCGTAAGCTTGTGATGAGATTATTGGTAAGCAT
TTTGTATATTATGTTTAAATGATCTAATGAACATTAAATGTTAATATGACTTTATGATGATTTGTCTTTGGTTATGATCATGCTGTATGTTTTTGTGATC
CTTATCTTCCATATGCTCTGTTGTATGTGCATTAAAGGTTTATCAAATGACTTAACATGCCTTCTAGAGAAATGATAGCTTTTTCATGCATGTCCTTAAA
TGTTTATGTGCATATACCCATAATTAGTACATGTGGAGTACTAACCTATTACTTTATATAACTACAAATGTAGAGTCTGTCCTTTGAATATTAAGAAGGT
CGATTGAAGAAGCTTGGAACTCTTTCTCCAAGTATTGGTAGGTCCTCATGTTCGGGAATGCTATATTTTTATTGTTCTAGCTTATGTAAACTTTAGTAGT
TTTAAGATATACTCTTTATTTCCTTTTATCATTTGGATTCTATTGTAGTAAGGCCTATATGGCGTAATGACTTTGAATTGTCTAAGTCTAAGACTTGTAT
CTTTTAGATGGTTTTATGTGAGACAACTTTTGGACTTTCATATGTATGTTTAACATGTTGCTATAAGAAAAGCCTAAGTAAGCTTCTATGCGAGAGGTCT
AAGTATACCTCACTTAGTATATGTACAAGTTTTAAATTTTTCCACATTTTAACTGATGACATGTTATGATGAATAGTAAGGGATTGTTTGAGTCGTCTGA
GAGGAAGACGAGCTAGTCGTATCTGGGGATGCTCTCCAAATGTGATAAACTAGGTATCGGAGCATGAGGTTAAATAACCTAGGGTCGATGTCTCACTAAA
ACACATCTATTAGTGTCTTATTTATAAGTGTGAAGCGCGCCACAATTGTGAATGAGAGGCTAGTGATGATTAGGAAAATTCTCTTTCTTGGTAATCCTAT
GTCGTGCCTTTAGAGTTTTGACACTATGTGTCTCTTAGCATATAATCTCTTTCTTGTGGTTATAGGAGATAAACAAAAGAAGGACAGTCGCGGGAAGAGT
GGTAGAAGAGATTGTGAATGCGGGAGCTACTCCCCAAGGCAATCGAGATCCTCCTCAAGAATAAGTTGTTGCGAATGATTAAGTTCCGGTCAATCCTCGA
GCCATGACTAATAATGAGGTAAGGGAAGCCCTTCTCCAAATGATCCAATCCACCACCACTCAAGCTCAATCCAATGCGGCACAAGCTAATCGGGAGGTTG
TACCTCAAGAGAACCAACACGCTAGTACTATCGCTAGCCGTTAGAGGGATTTTACGAGTATGAATCCTTCCATGTTCATTAGATCAAAAGTTTATGAAGA
CCCCCGTGTCATGACCAAGGAGCACCCTTATAAATAACATGGCATACTTGACCTCTCGGAGGTCTTATACAAGCCAATAGTTATCGTTCATCACATTGTG
ATAGGTAAATTTAGCAGAAAATTTAACACTTTCTTAGCACATCATGTGCTAGAACAACACTTTCATTATGTATCAAGTATCATAATACATACTTAAAGAC
TCTATTCTCTTTTTTTCCAACCTAGACTTAAAATCATTAGAGTACATTAGGGTCACGAACATTACAACATAAGTCATAAGTATACCTATATATAACTTTA
TAGTAAGCTAGAGATTAGGACACCCTTGGACTTAAGGATGCGTTTCCTTGAGCTTGGGAATCACATTTCAAGCTCCTCAATCATAGATACATCCTTTCAA
GTATCCACAACCTACAGTTTGTGTAAAAAGTATAGAAGATGGAGTTAGTACAAGAATGTACTTATTATGGCAACCATACAAAAACATGCATTTAAAATGG
AAATTTTTCTTGAAATCATACTTCATGTCATTTTGAGAAAATATTCATAAAAACTTTATAAAATAAGCGTTATATATTTTACGTACTTTATATAAGCATA
TTCAATGGTCACAACCATGTAAAATCACAAATTGCATTTAAGGCATTTTAGAACCACATTACAGTAAGCTATTTTCTTCTTTACAATGAGCTATCTCATT
TTATAGTGAATTCCTTTCTTATTACTTCTTATTCCCCCAAGTAACCCTCTAGTGATACTTGGTTCAATGCATCACCTTAAGTCTAAAAAAAGCAATACAT
AAAATCTACATAAGTCAACACAGACCACCATGGAAGTATAGTACATCATAAGACACCTTTAAGTCTAAGACCTTGAAGGCATTATAGTAAACTCTATTGA
CTTTCCACATATACTAATGTCACTTCACGTTGAACCTTATGAAACTTTACTCACAATCCCTATCTAAGTCTACTAGTGCAATGTACATGTGAAGCCCTAT
AACCTCACACATACTTAGCAAACCGATCATGAGACTACAAGCCTTAACATCCAATTCATACATCAACTTTGTAAGTGAAGACAAATTTATTCATGTCAAG
CAAGACCTTCATCGTATAGTCATTAAGACCAACATAGTGCATATAAGAACAAGAGCACATCACATAAATCCATTAGGACTCATACCATGCACTTCATCAC
AACAAGTAGACAAATATTACAAAGTCATGGATAAGGAACATATACACAGAGACATGCATTAGAACACATTCCTAGGACTTCCCTCAAGAGCCACTAGTGC
AATGCATAGGTGAAGTCCCATACCCCCACCTACACTAAGCAAATACCCTTAGGTTATCCTAGTTAGGGTCCTTACTTTACTTCCATTATCCATTTTATTT
TAGGGAAACTATATTCTTAACCGACACTAAGACCATGGTGCTACATTGAATTTGATGTTGTACAACCTTATACCAAGGGAAGGTGCTCTTACCTCGACAA
GGTAGAACATTAACACATGCTAGCTTTCAAGTGAATTCACTTGCGAGATCCTATGTGACAAACATAGTTTGGAGCTTGGAGGTACATGTGAAAACCCTCT
TTATGCCAAATGAGGCATTATAGTTATTCACTTTGGAAACCCTCTTTATGCCTATTGAGACATTGTATTTATCCACCTTATGAGAACTATGGTGACCTAC
CTTCCTATAATGGGAAGGGACACCCCTCATCTTCAAGTTAACTCAGTGCTAAGCTAAGTTCCCTTTTTATTAAAAAAGACTTTATTATATTACTTTATAA
AATATCAGGCTTAGGATATTTACTCCTCATAAGCTTAGCTCATAGGTCATAGATGAGAATTCATCAACCTATATCATGTGAGAAACCCTTTCACATGGAC
ATAGCATATGTAAGCACCAATCTATTTTAGGGTACACTTGAGCATACCTTTCATGGCCCCTCCATTGACTAGATTATCATACATGTGTGTGTGTGTAAAC
TTTTAGGTGAGAAAACCTTTCACATAACACATAAATGTCACACATGTTCATATATCAATGCATAAGTCTATAGGTATAACTATAAGTAATCCTTTCATAT
AAATGCACCAAGACACTGTGCACATTTATGCTTTATCATATCATATACTTAACATCATAGCATATAAATCATATTTATAATATGTTCATACAATCCTATG
CATGTACTTAGAAGACCAACCTAGGAACTATCCTATGAAGGTACACATATGCAATGCATAGACAAGGTCCCATACCCTTTCCCAATACTATTACACCTAT
CAAGTAATCCTAGTGAATGATACATCACACAACATCATAGAATGGATAACATAGCATAAGAAACATTTATTCAAGATCTACAACATCTTTATAGTAAGCT
CTAGTCATTATGAACCTATATTAACTTTACTTCACATATAGCATCATAGGACCTCATCATAGGCAGCACATATATATAAAGTTAACTTAACCATTTACAT
GCTCATAACATTAGCCATACAACCTAGATCATAACTAGAATAGTAAACTAGGCAAAAGCTTCACATAGGGTGATCATCACCAACACATATCTATAATACA
ATTGTCTTCAAGGCCATAATCGTATCAGATATATATTAACAATAAATTAAACACCGCCACCATAAAAGAACCATACAACACAATGCCATACAAGGCTTTA
TCAACTATCAATACTTGTAAGAAAAGTAAAAGAAGTAGGAATCTTACCAATTTCTTAACCTTTTGTCATCAATGACCAATACTCATATTTCATCAACTGT
TCATATCTAGGGCAGTATCTCAAGGTATACTAACATAATGCAAATCATATTAATCATAACAAGATTAAGATCATATTAAAACAACTACATCATCAATTTA
TAGAATGTGAAGGTAAGTTGATCTCTTACCAAATTTTTCTTACATGGATAATAAATGATAAACCTCCTTAATTCATAAAAATACAATATAGGGCAGTATC
TATAAGTATTTCTTCATAGATGAAATCATACATTCATACCCTATAGAGTCTAATGTAAAGTGCATACCAATCTATAAGAAGTAGAGATCGAAATCTTTAA
GTATCAATCCGCAATGGGAAAAAAAAACATAATCCCTCATCATAACACATTTAGGCAGTAGCTAAAGTAAAATTAACCATATATGAAGTCATGCATAAGC
TACTATGAGATCATGCTACCAACACCTACCCTACATAATCAATTCATTAGCAAGTAGAGAAACATATATCACTCACCAATTTCCCTTTCTTTCATCATAA
ATTATCCATACTCACAATTCATTAACAATACACATAAATGGTAGTATTTAAATATATCATAACTTAAATGAAATCCTACTACTAATTTACCAAAATTTGA
GATTACAGTGAGCATGTTGAAGAACATAGGCTAGCCTTGGAAACCATCAAACCTTGATCCGCATGGATAACTCATCAACAATTCACCATCAATATAAAAT
ATACACCTTGTATATAAGCAATTTAACATGCTAGAGTCATAACTCAATCAATGAAAGTCATGATCACAATGCACATACATAGGCTAAAACGAGAGTTGAA
AGGGACATGGGTTCATCATGCAATTGGATTGAAATACACGTTACAATCATCATATTAACATCAATTTATCATGATTAAGAGTTTGAAAAAGTTTTGAGAA
AGAACTCATGACTAGATTGAAGAAGGAGAAGTTTGATCATCAACTTGCATTAAAAAACATTGAAGGAACTCCCTAGATGGAAGATTAACTAGAGATGAAA
GATCACCATACATTGATGTAAAAGAAAACCTCTAAAACTTTATAAAGAACCCATCGAAATCCAGGCTTCAAGATGTTCTTGAGCTTCACCTTCAATGGAG
GTTCTAGAGAAAGTTTGGTTTGGGAGGAAAATCTAATTTGTATGAATTGAACTAGAAATGGGGGTTGTCATGTTTTATCACTTAAATACACCCAAAAATA
ACCAAATAAACCATGTATGATCAGTTTAGCATGTGGGGTGAATTTTCCATTAACCCCTTAAATAAAACAGTCATCTGGCAGTTTGACATAGCCTGCATTG
ACGGACCCATCAACGCCCAGTAGTTCTATCGACAGACCGTTCTGATGGACGTCCTTTGGGTCTGAGGCTTGTCAACTTCCTCAATCCTTCAACAGGATAA
GTCTTGAGTGATGAACCCCCATCGAAGGGGTATCATTCAACTGATGAGGCATCGTTTGGCTCAGTCAATTGACACTGCCAAGTCAGTATCTCGACAACCT
TTAGGTCCTTCTTGAAGGCCTCTTACGGGGTACTTGGGAAGTCATACCTGAACATTTCCAACTTAAATGTATAACTTAAAATTTCAAGGAATTTCCACAT
CAATTTCACCCAAAAAAATTACACGCAAAACCTTCAAACATGCTACGCAGACTCAAGACACAAACATGCACGTCTCAAGGGCTAACTTTCAAACGTCTTG
GATGTTCTTGCAAGTTTGTCATATACACTTTATTAAACTCACCATAATGAATATGAATATCATTATTACTCATATAAGGACTTCATAATGCAATAAAACA
TAAGAAATTTCATAAAAACAGATAAGGCCCCTTTGGTGACTAGTCATCGAACGTCTTGGTCGTCCTTGACGTTTGACTTTCTAATGACCTCAAAACACGC
ATGCATACTTTAAAAATCTTAATTAATACTTTAACAAGATTATAGGCACAAGTGAGTCTCTATACACCTAACTCATTTTTGGGGGGTTTTACAATATCCC
CTACTTGGGAACATTCGTCCTCGAATGACACTTAGAACACTTTAGTCACAACAAGGACTTCAATACGTCATATAGTAGATTAAAACATTCATAACATCTA
TATAGAAGTTAATGAACCAAACTTTCAAGGAACACACTTCAAACCATTTAGCACCTAATGCAACATAAGCAAGCAAAACCTTTATTCCCTCATTCTTTAA
TGAATCGGCTCTTATCATGTTCATATGAGGAACATACTTCTCCTAGTCATAACATGGTCTTTGCACTTCAATTCTTTAATATTTTATCTTGAAATCATCC
TTAAAACAGTTTCAACAACACTCAAGAAAAAGTAGGCTCTCATACTTGAATGCACATAGACATGAGTAAGATAGGTTGACAATGGATTCATATTAGTTAG
GCATAATGTCATAGGACCATACTCAACCATACTATGCTTAGTTATGTTTTAGGGATGAATGTCCTTCTCCTCAACTTTTAATCGTGGCATTCTCAAACAT
ACTTCCTAGTGAAGTCGAAATGGTAATTCACACCACACACATCACAACAATAGGAAGCCATTTCACAACATTTCAATTTTTAGCTTATAACTAGCTTTCA
TAAACATGCATCATTTAGGGGAAGTCATACAATTTATAGGCACACAAAAAGACAATAGCTAAACATGCCTTCACTTTTCAAAAGTGATCCTATAATCATG
CTTTCCAAATCATAAAAGTCATATAGTTTTCAAGAGACTCATCATTTTCATTTTTAAGGAGACTCAAATTTTTCATTAATGGCTTAAACAAAACGCATTA
TAAATAATTTCAAACATGATTCTTACCTTATCTCATGAAGTTAAATGCACAACTAGTATATCAAGATGCACAATCAACATGTGAAAACCATGAATTTAAT
CAAAAGTCGTTTCAAGTACTTTAGAATCTTCAAAATAATCTTAAGATAGTGTCAATCAAGACATACCAAACATATAGAGGTCATGAAATTCATACTTTAT
ACAAGGCTCCTATAATGAACAAATTTACTAAGAATTCATTAGTTTCGAGCTCAAATCATTTCTTGCTTGAAGACTTGTAAGATGATAGCCAAAAGTTGTC
CATATTGTGTAGTGAGGGTTAAAGATATAGAATAAGAAACTCTTCATATTGATTCAGTCCCTGTAGTGAGGGAATTTCTGTATTTTTTATGACCTTTCTG
GAGTTCCTCCCGAATGGAAATTGACTATGGCATTGAATTATTATCGGATACAAACCCCATTTTGATTCATCCATATCCGATGACTCCGGTCGAATAGAAA
GAGTTGAAGCTCCAACTCAATGATTTACTAGACAAAGGTTTCTTTCAACTTAATATTTCTCCATGGTGTGCTCCGGTCTTGTTTGTGAAGAAGAATGATG
TGTCCCTTAAAATGTGCATTGATTATCGTCAACTCAATAAGGTCACCATAAAGAACAAGTATCCTCTCCCTCAAATTGATGATCTATTTGATAAACTCCA
AGGTTCTAGCCACTTTTCCAAGATTGACTTAAGGTCGAGATATCACCAACTTAGGGTAAGAGGTGAAGATGCTCCCAAAATAGCTTTCCGAACTAGATAT
GGTCACTATGAATTCCTAGTGATGTCTTTTGGGTAAACAAATGCCTCGATGACATTCATGGACATAATGAATAGAGTTTTCAGAGATTTCTTCAACTCAT
TTGTGATTATGTTAATTAATGTTATTTTGATATACTCCAAGAACTAAAATGAGCATGAGATACATTCGAGGTTGCCCTTGAAAGTCCTCAATGACACCAA
CATTATGCTAAATTTAGCAAGTGTGAGTTTTGGTTAAGGTCAGTTGCTTTTCTTGGCCATGTTATTTCTTGTCATGGTGTAGAGGTCGATACGAAGAAGA
CGGCTGCGGTCAGAAATTTGTCTAGACATTTGACTCCCACAGACATAAGACGTTTCTTGGGTATAGCCAAGTACTATAGAAGATTGGATTCTCGTCCATT
GCTTCTCTTTTGATAGCTTTGACCAAAAAAGGTGAAGTTTGAGTGGTCGGAAGCTTGTGAAAAAAGGTTTTCATGAGTTGAAAGATAAGCTTACCTCTGC
TCCAGTATTGACTTTACCAAAGGATAATGAAGTCTTTTTAGTGTATTATGAAACTTCCCGAGTGGGATTGGGATGTGTCCTCATGCAGCATGACAAAGTG
ATAGCTTATGCCTCTAGGCAACTCAAAGTTCATGAGAAAAATTATGTGACTCATGACCTTGAGTTAGCAGCTATAGTTTTTGACTTGAAAATATGGAGAC
ACTACTTTTATGGTGTGCATGTTGATGTGTTTACTAACCATAAAAGTCTTCAATATGCGTTTACACAAAAGGAGTTGAATCTCCGACGGAGGAGATGGTT
AGAGCTTTTGTAGGATTACGACATGAGTGTCCTTTACCACCTCGGCAAGGCCAACGTGGTTGCAGATGCTTTGAGTCATATGACTATGGGTAGTTTGTCT
TATGTGGAAGAAGAGAAGAAAGAACTTGTGAAAGATGTTCATAGGCTGGCTCGTTTAGGTGGTAGTTAAAAGATTCTCCAATTGGTGGTGTTATGGTCCA
CCATAACTCCGACCCATCATTATTGGTTGAGGTGAAATCTAAGCAACATCTTGATCCTCTATTGATGGAGTTGAAAGAATCAGTACTTGGTAAGCTCAAT
GATTCATTCACCCGGGGGCTGGTGTTATTAGGTACCAAAGGGGATTATGTGTACCGGATGTTGAGGATTTGGGGAATCAAATTCTAGAAGAAGCCCATGG
TTCATGTTATTCTATACATCCGAGTTCCACCAAAATGTATCATGACTTTAGAGAAGTCTATTGGTGGAATGGTTTAAAATGGGACATAGCGGAGTTTGTT
ACTAATTGTCCAAATTGCCAATAAGTCAAAGACAAACATCTAGAACTGGGTAGTTAAACCCAAATCATGGATGTTCCTACTTGGAAGTAGGAAGCCATCA
ATATGGACTTCGTTGTTTGGTTGCCTCCAGCCCGAAGGCAGAATGATTTAATATGGGTAATTATGGATAGGTTGACCAAATCTGGCCACTTTATTCCCAC
CAAGTCCACTTATACAGCTGATGATTATGCAAGAATCTACATTAATGAGATTGTGAGCTTTCAGGGGATTCCATTGTCCATCATTTTGGATAGAGGTTCC
CAATTCACCTTTTGTTTTTGGAAATCTTTTCAAAAGGGTTTAGGTACTCAAGTGAAACTTAGCAGCATTTTCATCCTCAGACAAATGGTCAAGCGGAACG
TGCCATTAAGACCCTTGAATTTATATCACGAGCTTGTGTTATTTATTTAAAGAAAAGTTGGGATGATCACCTACCATTGATCGATTTCTCCTACAATAAT
AGTTATCTTTCAAGCATCTCTATGAACCTTTTGAAGTTCTTTATGGTAGAAGATGTAGGTCTCCAGTTGGATGGTGTGAGGTTGGTAAGTCATCACTCTT
TGTTCCTGAGATCATCTATGAGGCTATAGAGAAAGTTCGAATCATAAGAGATAGATTGAAGAAAACCTATAGTCGGTAAAAGTCTTATGCCAACAACTTG
AGAAGATATCATGAGTTCGAAATCGGTTATCATATCTATTTAAAGATTTCACCTATGAAAGGGGTGATAATATTCGTATGAAGTGAAAGTTAAGTCCTCG
ATATGTTGGTCCTTATGAGGTATTGCAAGGGTTTGGAAAAGTTGCCTATGAGCTGAAACTACCTAATGAACTAGCTTTGGTTCATCCGGTGTTTCATGTT
TCTATGCTCAAGAAATGCATATGCGACCCGATGTCTATTCTGCCTATTGATGGTTTAGGGATAAATGAGAACCTCTCCTATGAAGAGGTTCCGTTTGAGA
TCCTAGATGTCAAATTAAGAAGTTGATAAACAAAGAGGTTGCCTCCATAAAAGTTCTATGGAGGAACTATCTTGTTGAGGGTGCAACATGGGAGGCCGAA
GCCGACATGAAGTCCCGTTACCCTCACCTTTTAAATTCTTGAGGTTAGCCATTCCTCTTTATAAAGAAAATAATTAATAATATGAAATCGACTTGTTTTC
TAAATAGGTGCATATTTTGCTAAAAATTTGTACCAAATTGAGTTTTAAGAAATTGTCTTCATGCTCTACTTTTGCACTTATTTGAAATGTGTAGGCATGT
TGTCTTCTGGAGATTTTGATGTTTTGTTTTTGTCTTGAGAATAATAATTTCATGGTAACTCTTTGGTGTATTTTTTAGCTCATGTTGATGTTGAGAAAGT
AGTTCCTCAATATGTATTATGAAATGGTGAGCCCTTATATGTTGTGCATCATGAATTGAGTTGTTATGTGTAATGCAATAATATGTGATGAATGGAGTTT
CGAAGCAATCCTATGAGCCTTGACTCATGATGATATACATGTTGTTGGTTGTACTTCTAGTATGAGTCTATCCTCCTCCTACAAGAGATTTTAGTGTTAT
TTGGGGATGAATATTCCTACGGGAGGGATAATGTAACACTCTAAAAATCTAAGACCTTATCTAGAGCCTCACATGTTGGTCTAATGTTAGTAACACTATT
ATAAGTCCTAAAATAATTTTTATAAACCATTTAGGAAGTTTTAGAGTCAAGACGTCATCTTACTACACAAACAAATCAATCCATTGACAGAACCTACAAT
CCAAGTATAAATAGTGGGGTTTCCCATGGAAGATACAATGTCAAATAGATTAGTGCTCAGGTCTTTGTTAAGCATGGAAACGAGACAACATAACTTAAAA
TTGCGTGAAGATTCTTGAAAAATAATCTTGTAGTAGGTGTATTCTTTTTCAATAGTTGTTAATTCCAAATGGTTTCTTTAAACATCGCTCTGGAGATTAG
TTCAAGCTATGATTTTGAAACACACGTGAACTTCAACAGAGACTTTGGTCGCACCGTTAAGTAGGGCTGGCAAATGGTGGGTTTGGATAAGATTTAGATG
AATTGAGCAAAAATAGTTTGGATTACAATCCACGCAAATAAAATATGGGTAAATATGGATTTGATCAAATATGTTTTGGGTAAAATTATTCTAACTCATT
TAAAAAAATTACCCCCTCCCCCCGGCCCCCTCCCGCCACCTTCCACCAACGTACCCTTATTTTTTTTGTTTACCAAAAACACCAAAAAAATGTTATTTAA
AAAATAAATTACCCCCTCCCCGTGCACCCCTCCCCCCCTTGCACAAAACGACCCCAAAAAACTTTTGTTTTCCCAAAAAAAATCTATTTTTTAAAAAAGT
TCTCCCCTCCGCCGTGCACCTGTAGCACCCCGAAGATTTCTAAGTTGAGTCCAAACGATTCTTAAATTGCGTATAATTTCATACCAAGGGAATTTTAATT
TTCGTAAGTGTTAACTTAAATTCATTAGTGCAATAATGATTTTTTATATCAATTAAGGTAAATAAAAACTCCTAACAAAAAGTATTGTTGAAACTTTTCT
TACCGATTAAGTTTGACATAAGATTTTACTTTGATCATCTTAAAAAGATCATATCTCTAAGAATATACAGAACTACGTGAGCCTTAACTTATCCAATTAA
AGGTATTTGAATAATCTTTCAAATTACACAAATTTTGCATCAATCCAAGTTTTGAGCAAAAGGTTATGACCATTTTAGTGACTAGTGTAGTGTTGTTCTG
TTTTAACCGCGGAAGAACTCTAAATAAGGTAATAAACCTCTCTTATACCACTATGAAAACCTTAAAACGGATTTCTCAACTCCTACAGAGTCCTAAATAA
TCCTATTTCCATCTTTTAATCCATCATTGTCTTCTCTCTCAAACCCTAATATAAAATCCTATGGAAAAATCAAAGTGGAGAACTCCATACAAGATTCTTT
CCATCTTTTTCATGATTCTTCTTTATGGTAAGTTCTTCTCCGAAATTTTCTTCTTTGTGTCTCAAATTCTTTCATACAATTATGATCACTAATGAAAATC
ATAATTCTTGTCCGTAGAGATTTCAAGAAACTAATTCAAGAATCTTAAGAAAGGTTTTGTTGATTTGTTTCTCACTCAAGCTAGGTCAAGAATCAAATTT
CTAATCTTCCAATATTTGAAAATACTTATCCAAGGTATTGTAGTTTTTCATATATGTGTAGCCTTCACCCATAGAGCCCTTCCCAAATTAGATTTCAAAA
CTTCAAATCCGCAAAAGTTGGGTTTTCCCTCTAAGACATGGATTCCCTTTCAAAAATGATATAAATGACTTGTTTGATTTATATTATGATTATATTGATG
AATTAATAATGTTTTAATGATGAGTTAACCAAGAATCTGTGGATTCTCTTTCCCACCAAATTGGATCTCAAGTATGAGTATTGGTTGATACTAATAGAAT
ATGATAGTGTGATGTATGTTGTAATTGTTCCAATGTAGTGGGTGTGGGTTGATTATGATGAAATTGCATGAATTTATTATGAATATCCATGTCTCCTTGA
TTAATCTAAGATTCTAGGGTAAAATTGATGTAGTCTAATGTTGTGCCATGAAATAGGCATATTGATGGGTTAAATGTGATCTCTTAAGATTGATGAACTT
CTTTACGAATTGCCTTAGAATAGATCACCTAGACATGAATTTATTATGAGAAAATCTTCTAGACATGAACTAATTGATTAGGTCTTATATGATAGATCAT
AATTGTGCGGTGTTGAGATTGAGATTATATGTTCCTATATGACTATAAGTGATTAAGAACGAGGCATGTGGTTAGGATACATTAATAGTTAGGTATATAT
GATGATCATGTGAGGTATGACTTGAGAGAAAGACTTGTAACATGTATATGACTCTTAAGGCTTTAATTGTAAAAGCTAATATAAATAATTTAAGAATGTT
AAGGCACTAAGAAGGAAGTCGTTGCGTATGATTCAGTTGTATATGGCCTTATTGTGAATAGACTTCAAACACATGACCTATAATATGATCACATGAGTTT
ATGAATGACATGATGGATTACTTAATTCATGATTTTACCTATGTTCTATGTAATTAATGATATGTGTTGACTCAATACCACCTTTTAATTCAAGATATGA
GATATATGTATGATTATTATAATATGTGCCTATTTATGATTACTTTTAGAATGAAGTGTCTACTTTGATGATGTTGTTGTTGTGTCATTGGAAGTACAAT
CACTACACATGAATGAATATGGCTATTATGTAACTAAGGTGTTACTTAGGATTCACTTAAAGAGTGAAGATCTTGCGATTATTGGGCAATTGTGGTATTG
TTGAAACATAGTTCTCTCCATACCCTTACACTTTATTATGTATGATATGTTATAACTATGACAATATTTTTGTGTTGTATGAAAGTCCATTTTCATGAGC
ACACTATAAATACGATGTGAAAGGTTTACTCACATGCTGATGTTTCGAAAAGTGAAAGGACATTCTCACTTAAGATATCTATGAGCTATTATGATGGTAT
GTTGGTTTGAGTGCCTAGTGAATTCTCTTACAACCATGAACTTAAGTAAAGATTTAATATGAATTTTAAAGGGAAAATCTTATCACCGAGCGGATAGGAG
TATGAGATGGGTTCCTTCACACTAATAGTTGGATTCTTAATACGTTGTCTCATGAGATGCAAACCTCCACGTTAGTAGTCAAGGTTTCTAGTTGCAATCT
CCCTATCCAAAAAATATTTTCCCACATAGGTATACTGATAGTGGATCCACCTAAAAGCTATTATGTGTGTTCTATCATAGGCATGTTGGAAACCTCTTTT
CGGTGTAGGGGTAGAACAACGGATTCCATGTAGCTCACATGGTCTATGTCGGTTAAAGCTAAATTTACCTATATTATAAGAATATGAATTATGATAAGAA
AATTATTTATGTACTATAGTTCCTCAAGAAGTTCTACTCAGTGTGGATGGAGGTACGGAACTTCATTCATGTATTGCACAAGGGGGATTTGAGAGTGATT
GTGGTATGTTATCTTATTACATGATGATTATAAGTTATAGATATGCTTTATATGAATTATAAACATGAATATGAACATTAACTATACTTATGACTTCTTA
ATGAGCTTTACTTAGTGTAAGTGGGGGTAGGGGACCTCATTTATACATTGCACAAGTTGAACCTGAAAGGGGTTATGATGTGGTTTTCTTATACTATGAA
GATATATGAGTTTATGCATATATGATATGGAGTATTTCTAATCGCGACTTCACTTGTAATAAACTATGAACATGAATGTTTCTTTGTCTTTATGTGTTGA
CTATGCATGAGGTGAAGTATATTATGCATGATCATGGTGTCCTTGAAGTGCTACTTAGTGTAGATAGGATTATGGGGTCCTATCTATGTATTGCACAAGT
AGAGCTCAAGGTTTCTTATGTGATAACTGTATTATGATGTCATGACCTTGGTATTTGACTATGTATTGTGTTTATGATTGGAGACTATGTAGTGTGAAGG
TCGGCACATGTATTATGCTTATATTGGAGACTATGCTTGTAATAATGACGATATCCCTTATGCTATGATGAATTGTATGTGAGTTGTTTCATGAGTTGCA
TTCTCCAACTATATCAAATATGATGTTAGAAAAAGGCATATAGCATGACTTCAAATTAAATGTCCCCTTTTTTGCATGTGTTAAGCATTTTTATGCATGA
CTTCCATACTATGTACTTATTGTGCTAGCCCCATCTTTCTACAGTTCTATATGTGTATGCTTTGGAGATATTGTATTCCTTACACTTGGCTAGGACCATA
GTAGAACAAGAAGAAGAAGATCGGGGAGACCTAATTGAATTTGAGCGATTGACCATATGTCCTTCATTGTAATTCCATTATATTTAGAATTATAAGGGAT
ATGTCCCTAAGATTGTATTAAAGAGTTTTATTCCAAGTATTATAAATGGTTTGAGATATAGTGTTATAGATACATTCTCATTTTATAAAGGAATTCGATT
GCAAAGAAATGTTTTAAATTTCCTCTTTTTTTCCCTATGTTCTTATATCTATGATTATGCTATGGGATTTTATCAGACCCCTTTGAAGTCGAGTACACCT
TATTACGTCTAGGGGTAACCCCTAAGTCATGACATCCCCCATCCCTATAACACACACCTTCCGGCTTCCACCAACGTACTCCTAATTTTTTTTATTTTTT
AAAAACAAAAAAAAGTTTTTTCAATTAACTATGAAAATTTATATTTTATTTTTATTTTTTTAAGCATAATAAAGAATTGTGAGTGGAAGTTAAAACTAAA
TGATACCATATGGTTAAAACCATATACCATTTTTAACCCATTTTGACCATATTTGTAGAGTCTTAAAATATCTTGAAACCCATATTTAACAAATTAAAAT
ATGAGTAATCCAAGCCATTAAATATGGAGAAAATGAACTTATTTCATTAATACGAGTTGAAATTCCACCCCTACCTTTAAGAGGATCTCTACCATGATTT
CACGAGGAAGAACAGAGATTATCATGAAACTTTTATGTGTATTTTTTGTTAGTATAATAATAGAAATAGTCGAGGTAGGGGTAAGGTTTGCGTAGAATTA
TGATGTTGTAAGGTCAAGAAACAAAATTAGAAACTTATAGCGAAAGGGAAACAACTGATGGATCTTATCTTTATGGTATCCTATTAGACATGGTTGAGAT
CCCCAAGATACGTTGTAAAGAGATCAATGTGTTTTGAGGGAAACAGTTTGTGATAACATCTTCTTTCACTTTTTTTTACTAAACGTTTTTCTTGATTTTA
TATCATAAATAATTATTATAATGATATGGAAGTCTTTATACTTGATGACAAATTCTAGGTGAAATGTGATATTTTATAGTATTTTTTTCACTCTCTCTGT
ATCGTTTACAGTTTCGTTCATGAAAAACATCACATAGGAAAGGAAAAATAGCAATCGAACAATGATATTTGTATTTGAATTTATGCGAAGGTCAATCTTT
ATAAAATCTTCAATAAAATATGTAATACTCTAATTTTTCTCTTCATGGATGCTCCTGATTTGACCGAATACTTGTGGCTCAACACTTGGAGCGAAGACTT
CTTTGTATGCGGAAGACTTGCGAATCACCACTAAAGAGAAACTATCTATATGTATGTATTTGTATGTATATATATATACCTCTTTTGGTTAGACGAATAC
ATCTTTATATATGCTTGTGTTAGGGCTTTATGGGTATTTTGGACTGAGCAATTTTGATCCCTGGTTTGAAGAACAAGAGTTGGGCTCATCTTGTCAACTT
AATGGACTTGGTCCGATGTAATTTTGACTTGATTTAAGTCATTTAATTTTAACTTAAATATTAATACGAATATTAATAAAATGTCACTGTCTATAAATGC
CCCTTGCTTCAAGGCTTATTAGGATACTTGATTTGTCAAACTTGTTAAGACAAAACTTGAAGTATTTGTGAAACAAATGTTTTTTCATAGTTGATCTTTC
ATGAACCATTTGAAGCTTCATGAGAAATGACTACGTCGATATGTTGAGGTAGACATTTACCAGAATCTTCATGACAACATTCTCAAATTTGTAAGAGATC
GTTAGACTTATTGCATGATTACTTCTTCATAATCCGGTAATTTCATTTGTGTCGTCATCTACAAAATGATCGCCATTTCGATGATCAAGGATTGTGTCTA
CCAGCTTGACTTGGTGATAAATACATTGTGATTTCGACGCAAATTTGAGGCATTGCTTTTGGGGTTGATTGTCCTGCCTAGGATTTTTTTTTCAACTTTG
CTCAACCACTTGAATAAAACGTAAGGAATTTAAATTCTCATAACGCGAGTCTATTCTCCTTCGAGGCATTTTTTGTACTTCCAGTGTAGTTTCCGAGAAA
GACTTACCTTATTTTTATTTCTATGAGATCTCCATAACTCGACTTATTTGGAAAATTCTCATTGTTTGATATTTCTATGAAAACATGCCATATTTTGGTT
TCTATGGAACTTTTATGATTTGATTCCCATAGAAAATTTCCATAATTTAATTCCTATGAAAATTTAAAATAATTTTCAAAATTTGTAGGAACTAAACTTT
CCCATCATTATAATTTTTCATAATTTATAGGAACACAATTTATATACTTTTTATTTCTATAAAATACACGTGTTCTTACAATGATTGATTGTAAATTTGA
GGCATACAAAACCCAATTTTCGTCCCTTATTTAGCACAGCATGCCTGTGGTAAAAATTTCATAACCTGTTTTAGAAACATTGAAATCATGACCCATTTGA
TGTTTCACAAAATAGACTCAAAGGGATACGACATGTCCGAAATTAAAAGTCGAAACCCTTCCGAATTGGCGGCAATTGATCGAAGTTTGCTATCAGATAT
GTCTTCTTTTTTTATATCTCTATGGAGTCCTACCAAAAAGTCTCTATATTTGTGTAGGAGATTCCGAATGACAAACGACTTGTTTCTATAGAAACTTACA
TAAAATTCTACAACATATTAAAAAATTAAGGTAAAATTTTTCATGGATTGATGATAATTAATTTATTGAAGTTCGTATTCAATTCTTTCATTATTATTTT
GCATATTGTGCAGTCTTACCAAAACGTTTGCATATTAGTTTAGAAGAGCTTGAATTGAGAGTGACTTGATTTGATAGAAAATACTCTTAATTGTACAACC
TCACCAATAATCTAAGTCAAAGTTTTTATGAATTCAAAAAATTGGTATTTTTTAAAGTTTGCAATCCAATTGACTTTGGACATCATCCATGATTTCACTT
CTTTGCATCTTCGTCAAAAAGTCGCATATTGATTTCCTTATTGATTGAGATTTTTTTAATCATCATGCCAATTTAAAGATTCATGCAATTATCACCGTGA
GACACAACTTTCATCATGAAGAGCACTAGAGCATATGCCATAACTTTCACCATGCTGATTTGAAGATTCGTGCAATTAAAACCGTGAGACACATCATTAA
TCATGACAAGTGCGAGAGTATATGCCATAATTTTCACCATTTATATTTGAAGCTCCGTTCAATTGGCACCATGAGACACATCTTTTATCATGATGAGCGC
TAGAGCATATGTCATAATTTGCACCATACGGTTTTGAAGCTTCATGTAATTGGCACCGTGAGACACATTATTCACCATGACAAGCGCGAGAGTATATGCC
ATAATTTTCATCATACCAATTTAAAGTTTCGTGCAATTGTCACCATAAGACACATCACTTTCTTTTTTCTTTTTCTTTTCTTTTCCAGGATTACGAAGGA
TAAAAACAGTCTCAATATCATATCATAATAAAAGAGGGGTAATCCATTATTGTCGAGGAACTACTTAATTCATCTTCGGTTGTAATAGCAATTTTGACGA
CGAATCATACTTGTAGTATTTTTTTGTGATTGTGGCTTTGGTGGAGATGACTCACACTTCGTGCATCTTATTTTGTTACTGCTGCTTTAACAACAAACTA
TACTTGGTGCAGTTTATTTTGCATTTGCGGCCACATATGATACATCTACTTTTGTAGTTTCAACTCTGATGACGAACCACACTTGGTGCCTCTTCTTTTG
CAATTGCGGTTTAGAAACCAACCACTCTTAGTATATCTTCTACAATTGTGGTTTTGATGAAGAATCATACGTGAATCATATTATTTTAGAGTAGTGTCTT
TGATGAAAAATCACTCTTAGTACATATTCTACAATTGCGGATTTGATGAAGAATCATGAGTGGATCATCTTTTTTAAGAGTTGTGGCTTTGATCACACAT
AAATTTTTTTTTGTTTTTGTTTTTTATTGCAGTTGCAGCATCGACAACGAACCGCACCTAGTATCTCTTCTTTTGTAGTTTCAACTTTGATGACAAACCA
GACTTGGTTCTTCTTCTTAATTTGCAAATGTGGCTTTAACGAAGAATCACACATTATTTTTTCCAATAGGAGCACCATGTCGCAATTACTTCCTTGTGAC
TTTCTTGGTGGAACTACTTCCAATGAAGGCATCACGTCATTAGAAGGTGACTTTCTTGGTGGAACTACTTTTGGTCCACATAAAAAAAAATTTACCGTGC
CTAATCCACCTTTATTTCTGAGAAGTGGGGCGCATTGTATAGATGTATTACACAATTTTCCTTAGGTTCTTCAGATAAATTTATAGAATAAAAGTCAAGT
ATCACTTCAACTCTTGAGGAGATTATAAAGGTAAACATTACTGATGTTTCATATATCGAGGATCATGTCGAGAGTTAAGTCGTAGGCCTTACTTTAGATC
ATCAAAGATGACTAAAGAATTACATGAAGTTGGCCTCTCTGATGCCCAATGTCGTCTCCATGGTACAAAGCTGACACATGAAAAGTTGGATGGATCCATG
AAGAAACATTAAGCAACTCTAGCGGATGTGGAGAAAGACTTAAAATTCTTTATATCTAAGAAAAATAAGGTCACTGCTCTCATTAACAAGTACCAAGAGA
AGTTGTCCAAAAGTCAAAAGAATGTCAACATTATGGAGGGTGAGATTTATACCATTGAGGCAAACAATGTGATGTCTAATGATGAAATTGAGAGACTGAC
CAAGCTTAAAGGGGCGATTAAGAAAAGTAACTAGGAAATCATAAGCTTCAAACTCTTTCCATAGCTATATGTTCTTTTTATCTATTTATTTACTTGCTTC
GGATTTTCTCATTCACTCATTATGGTGTAATGGTTCCATTTTTTGATGCAATGAAATAGTGACTTTTATTTCAACATGAAACACCTCGTCTTGAACTTTG
AATTTTGATTGTTTGTTTCCATGAGCCCCTTTTCTTTATTGGAAAAAGGACTGCATAAGCTAGCGTTAATATGAGGATTGCAACAAAATTTTAATTTTTT
TAGCTTTATTTCAGCTTTGCACGCATGTGGAAGAAAATTCATAACATAAAATACGAGCATCGGAATAATGAGTTTATTTTTTTGGGAAAGAAAAGTCAGA
GATCTTCCATCTATATAAAAATCACGTTTATGGGATTTAAGGATTAGCACAAATTTTTGTTTGAAGTTTGATCAAAATCTTCATGCTTGAATCTTCAGCT
TTCTTCAACTTTGCACATAGGAGGAAGAAAACGCATACGTGAAGTAGGAGCGCTGGAATAATGAGTTTCTTTTTTGTTGAAAACAAAACTTCGAAATTTC
TATCTATATAATAATCACGTCCATAGTATTTATGGATTAATACAGATTTGTGTTCAAAGTCAGCTCAAAATATACGATCTTGAATTTTCAGCTTTGCGCA
CGTCAGGAAGAAAATTCGTAACGTGGAGTAGGAGCATTTAAATAATGAGCTTTTTTTTGGAAACATGACTTCGTGACCTTCAATATATATAAAAACTATA
TCCATACAATTTATTGAGTAGTACAGATTTGTCTTTAAAGAAAGCTCAAAATCTATCACGCTCCACTCTTCAACTTTGAGTTACTCTGGGAAAAAATCAA
CAACTCGGCATAGAATCCTCGAAATGATGTGATTCTTATTTTATTGGAAGCATAACTCATAGAAGAAACAATATGTAAAAATCACGGTGAAAACCTTTAA
AGATTTTCACAAATATGTCTTTGAAGTCTTCCAAGTTTCGTTTAGAAATCTGATGGTCTATTTCACAGCTTCGAGCGGTCGTGGTAAAAACCTCATAACA
TGGCGTAGAAACCTTTAAATCACAATACGATTTTTAGGTTGCAAAATAGAACCCAAAAACTAATATATATGTGAAAATAATTGTCGGAACCTTTGAGGAT
TTTTACAAATGCGGCTTTAAACTCAGCTAATATGTATTATTTAACTCTTCTCATTTGGTCATTTGTGACACATTTGAAATTATGTGCTAGCTACATACTT
TTAAAGAGATAGTGTGATGATCATGAAATACCACCAAAATCCCCCCCCCCTTATTTTTACTCATGTGATTGATCTTAGAGTGATTAGTCCAAGCACGTAC
GTACCTTGGTGAAGAGGATCAAGTCATATCGTAGTTCAAGAAAGTGAGCTTTTAATTTTTTTAATTTTTGTGTCCTAACTTTATCCTAGGCTGCCTCTTT
CGAGATTTTCAGCCCAGCGGACATTTTTTTTGGGAGTAATACACATTTATTCTCTTGCAGTCTATGTGTATTGTAACATCCCGAGAGTACACCCTAGAAT
TTGTTGCACTCTCAGAGTGCGACATGGCATCCTTGACCTCTCAGAGGTCTGGTACTAGCCCTTGAACTCATTCATCACATAAAATTTATGAAAAGTAGTG
TGAAATTAAAAATTTTCACACGAAATATCGTAAAAACATGTTTCATATTAAAATTATAGAAAACACTAAGTCTCATCATATGTCAATCTTGGACTCAGGA
ATACTTGGGACACTGCCCATACAATACGAAATATAGAATTACTTAGTCTGTTCCAATACTTGAGATAAAAGAAGTCTAAAGATAGTTATGCCCTCGAGTC
AAGTGTGAACATACTTCAACTTTGCTTGAACGGGTAATAGATTATAAGCTTGCTTCAAAACATCTCTCACCTTATAGCCACAACTTTAGAGATAGATAAA
AAGTATGGAATCAGTACAATGTATGTACTAAGTATGGCTTAATGCATAAAATCATGAAAAATGAACATTTATTAGAAACATCCGCCAAAAATAACATTAA
GAACACAATATAAGTCATATGCAATGTATGTCAAATTATGAAACGTCACAATAGCATTATAGTAATCTTATAGTGAACTTCACTGTAACTTGAAATAAAA
TTCACACCTTACAATATAGCATCAATAAAACCTATGAAACACATAAACATTAAATCCTTCTACCAAAGGTTATTCTATGTCTCACTTGAGTGAGTTATGA
AGCGACCGCCCAAAAATTATGATCCTTCACACACATTTAGACTTCCTAGGATAAGATCATTCACACTTCATAGAATAACATACGTATAATATGATATTCT
CCTCCCAAAGGTTATCAAAATACTTACATAAGTAATTAAAGAAGAGAACTCCCATACACTCTCTCCAAGATTACCTAAATAATCCTTAAGACTACCTATG
TTTAGATCATGTCTACATTATCACTGTACTTCCTATCTAGCGTCATTCTTAAGACTTCCCTAAGTAAGACATGAAGAGACCATTATTTTCCCCCCGTCAC
ACCTTAACTATGAAACCTTTAAAGTACTCTAGGTAAGTACTTATTCATTAACATGTTTTCTTACATGAGTCGTTAACTTCTTTAGTTCACTTAACAGACA
TTCAAGATATAAATACATATAAGTAATGGTCTTGGAGAATACCTAGGGACTCATTTACTAACATCTTAAAAGCCTAATCGTGCAATGTCTAGATACTTTC
CCATACCACCACCTAAACTTCATAGAACTTCTCAAACACAAGTAGGTATCCCGTATGATGAGAATTGACAATAACCGACATAGATCTAACTAGCTATGCA
TGGAATCCGGAGTCATGTACCTGCTCCGATGGAGGTTGTTCTAATTGCCAATGGTAGAACTAGGACACATACAATGTAGGAAAATGATTAAACAATATGA
AGGGTTTCTTTATTCTCTAATGTCATCTTATGTAGAGAAAATTCCCAAACTATATTCACTGGGGCTAGACTTTGTTCTCATAGAGTATTTCAATAAAGGA
GTACATGAAAAGGTTCCATATCTATTTCACAATCCAATCACGGGGGCAATTTCAATTCTTTTTCTTGAAATCCAGATTGAGGAAGTAAGCCTTGTGAAGG
ACGCTGTCACGAGTCAAGTTTTTTCCTTCCTTGTGCTGGCTTCGCGACGCGTGGTTGGCTCCACATCTTCGTTGTTGCAAGCTGATTTAGTAGCTTGCTC
ACCAATGTTTGGGTCCTCCTCAAGGACTCTTCAAGTGGTCCTTGGGGATTTATTACTGGACATTTGGACCTTTATACTATATTTTACCAATTTAAAGTAT
TTTTAGAAGTTTTAGACTTTATTTGACACGCCCAAACCTTCACTAAACATACGGATGTCTACTTGTTCAATTTAGCTTTTTTCCGGACATCAAAGTCTTT
CTTTGTTGTTTTGAATCTAACCTATTCTAATTGAGTTTAATATATTAATATAGGTATGAAAAATCATTTTAACCATTATTTAATAGGTGAATATCTAGTT
TAAGTTATGAAACTGGAGTGTTACACAATCTTTTACCATTATTGGCCAATAATATCCCATTCTTTTTACATGAAAATTCAACTTTGGCCCCGATCGATGT
GATCCACAAACTCCAAAATATGCTTCTTTCATAGAATGATTTGCTTCTTATTCTCCCAAACAATTCAAGAGACATCCCCCTCAAATGATCTTCGATATAG
AGTATCTTTATAGTAAAGAAACCGAGGAGCGCGATGATGGATTTCAGTCTTCTCTTTGGATCTTCTGGAAGTATATTGTAGCACAACTAATCAATAAAGG
CATGTCTCCAGTCAACTATCTCAGCTTGGGAGACAAATACAAGATGTTAAACCTTGCTTTCTTCATCCGAATTTGGTGGTACTATCCATTTTTGGCAGAT
GGTGATTTGGGCTCAGTCAGGGAGAGTTAATGTTGAATCCAAAGCAACTAAGGCATCATCTCTATTATTATCCTTTCTTGGAATATGTTGAAGAATTACA
TCTCTGATCTATCTAATCAATTTTTGCGCACAGTCATAATAGAGGCGCAATTCTGGCTTTTTGACTTCATAGCTACCCTACAATTGATTGATTGCTAATT
CGGAGTCTCCAAAAACGTGTAATTTCATTTGTTTCATAACAACCCCCATTTCAAGCCTGAGTAGTAAGGCTTGATATTCTGCAATACTATTGGAGCAACA
TTGTGTGAAGATGACACAATATTGCAACATTCGTCACTTCTCTTGAGAAGAGAAGTGACGAATATCACTCCATTGCTGGCTCCTTCACGATGTGAGTCCC
CATTAAAATATATCTTCCAATGTTGTTTACCTTGAACAACCATTGCATCTTCATCAGGTAATTTTGTCAGTTATATCCCAATCATTAAGTATTGGGTGGT
ATGCTAAGAAATCTGCCAATGTTTTTGCCTTTCACAGACTTTTGAGGAACATACACAATTTAAAATTGTTGAAACTGGAGATACCATATTACTAGTAAAT
CATTGAGGAGAAGTTTCGACGTCAAAAATTTGATGGGGTTGGCATTAGAAATATGACAAATGAAATGATCTTGAAAGTAGTTTTTTATCTTCTGAATTTA
GACGACTAAGGTTATACATAGATTTTCGATTGGAGAGTACTTTAACTCATTCGTTTTCATCATCCTACTCAAGTATTAAAGGGAATTTTCTTTTTCTTTA
TTATTCGCTTGGCATAGGAGTGCTCCTATTGATTTTTCTTTAGTTGATATCTAAACTATCAATATCTTTCCAGGAACAGGAGTTGCTAAAACTGGTGGTT
TTGTCAAGTAATACTTGATGCTCTCAAAGACATTAATATAAGATTTTTCCTTGTATAAAGGAGCCCTTTTTCATAAGACGGGTGAATGGTTGGAACTTTC
CTGTTAGATCCAAGATGAATCTCCTAGGATATACTATCATCCCTTGCAGACTCTTCAATTCATGGATGTTTCTTGGTTAGACCATCTTCTGAATTGCATG
TATTTTTGCTTGATCTATTTCGATTTGTCGTACAATGAAACCAAGGAATTTTCCAATGGTAACTCCAAACGCATATTTCAAAGGATTCATTCTAAGTTTA
TACACCATCCTCAAATCTTGCAAGTGATCACATTTTTCCTTGATTTCACTACTATATCATCAATGATAACATTCAACATTGTGAAGAATGTTAACAAAGA
TGTTTTGCATAGGTCCTTGATAGATTGATCTTGTTTTCTTTAAATTAAAAGGCATTACTTTGTAGCAATAAATACCCTTAGAAGTGCGGAATGCATTCAA
CTCTTCATTCTTTGGTGATATGCAGATATGATTGTATAGCAGGATAAACCATCCATAAAATACATCACCTCATACCCAGTAGTGACATCAATCATAAGAT
CACGAATAGGAAGTGGAAATTCATCTTTGGGACATGCATTATTAAGATCCCTAAAGTCAAAGCGAACTTGAATTTTCCCATTTTTCTTCCTCACAGGTAC
AATACTTGAAACCCATGTGGGTTACTTAACTTCACTGATAGAGCCAGTCTCAATAAGCTTTCTCACTTCAGTTTTGATCATGAGAACAAATTCAGGCCTT
TGAGCTTGCTTGATGGGACATGCACCGCTTTTCGCAACAAGATGATGGACTGCTACCTTCTGGTCTAAAGCAAACATTTCTTTGGAACTCCAACAATTAC
ATAATAATACTCTTTGAATAAGTCAACGTAGGTCCTTTCATCATCACTCGCCAGTGAAGCATTTACATAAGTAGGTTTTAGATCTTCATCAGTTCCAAGG
TTGATATCTTTCAATGCATCAACTATCACCTTTACTCTTTCTTCAAGTCCAGGTGGCACATCTTTAGCATCTTCATCTTCGTGAGGTTATCCATTGTTGA
AAGCATATGGTAAAACCATGAAACATTCTCCGACTCTCCATCAATTTTAATTGGGAAACATTATGCCTTTCATCTGGTGTAGTGACATGATATAAAAAGT
CATGACATTCTTCATCTTCATAACATTTCATGGTATAGACCACAACAAGTGACTTAGACCTTAGTACTTATCCACATGCGAGTACAATGTTTGTTTCCGC
CTCATTCTATAAGGGATCAGACTTTGAATGTCTTTAGGAGAATTTTGAGGATTGGGTAAACCAGATGCTTGCATACTCTTGATATTTCTCCAAACCTTAT
TTTTACTAGATCCTCACATGATGACTAAGACTTGAAGCACTGTTTATAAACCTAAAATAATGCATTTAAACTAATTAGTAAGTTTTAGAAGTCAAAACAT
TAAGAAACACCCAAGAAATCCGAAGACTAGTGAAATAGAGGTTAGTTTGCCTTGGCATATTTCATGGGGTTTTAGGACTCAGAATTAAACGAAAATTGGT
AACAATGTTTTAAACATATAGAAGAGTGTGTTTAGGGTAAATTCTGGGTAAGATTCCCGAAAAACCACACTAAGGGTCCTTGGAGAGGACCCTAAATTTG
GACTCAAAAGATGTAAGTTGACAGTAGACAATCGACGGACGAAACGACGAGCCATCGATGGGTCCACGACCCATCAATGGGGTCGTAGGTACAGCCTTAT
TAATTTTCCAAAATGTTCCCAAAATCCACTCGTTGAAACAAATGACGCCTTGCCAGTACGGGGCCATTGATGGACCTACGGGTCATAGGTCGAGGTCTTG
TCGTTTGGGGTCTATTTAACTATCTCTTTTTTAAGCCAAATGAATTAATTAGTTAGTTAGTTAGTTAATTAATTAGAGGTTAGGGGGTGTTTAATCAAGT
TAGATGAGGGAGTATATAACACTTAATCTTTATTAAACTAACCCAACACATCATAAATTCCAAACACAATTATCTCTAGCTTCTCTCTACTTTCTCTCTC
CGTAAGCTTCAACCTCCATTGAAGAACACTAGGATCAAAAATGAGGACGAATTTACCAAGGATTTAACCTAAAATTTGTGGCAAAATCATAGCTAAGGTA
TGATTTCTTTCACTCTTCGGATCATTTCCCCAAGAGGCTCCTTAGACTATGGTTTTTCAAACCTTCCAAGACTAGGTTTTTACTTTAGACATGGGTTCTC
TTTCAAAATCAAATTGTTATTCAATTATGATGAATTATAGTATTTTATCATTGTTTAACTTATTGTTGAGGGTCATTTGTTGGTAGTCACTGAAGCTTTT
CCCTTGAACCCTTGTTCTTCCCGAAACACTTTATGTCTTGAAATTCTAAGGCAATTGTGGAGGATGATGAGTATGTGATTATGTAGAATGTCAATTTTTA
TGTACTACTACTTTAATTTACCTTGTTTATTCATTGGTTATGTATCCTTTATTAATTGAAGTATGAAGGCAATGAAAGGGAAAGAAGGTATGAAGATTGA
CTCTTCTTGAATTCAATTATGAAGTATGTGTTACTTGGAGAATGTTTTTATGTATAATGTGTGGTTATAATGTTCATAACAAGTGTTCCTCAACCTTAAT
ATAGAAAATTGGATTAGCCATAATGTATGTGTACATGTTATGATATGATTATTATATGATTCTAATGATAATTAAATAATAAAGTGTTAAGTGAAAGGTT
TACTCACTTGGTTAAGTGGAGTTCAATGTGAAAGCATTGTTCTCACTTGTGATGGCCTATGAACAATTATGTTAAAGTGTTTACATAGGAGTCTAGAAGA
GACTAATGTGAACTTGTATGATTAAAAATATGGTTACTAAATGAAATAAAGACTTAGCACCGAAAGGGCGTGTAAATGAGATGGAGCTCTAATGTCTAGT
AAGTTCGGCCTCCCTTATGGGTTTCTTCATATCTAGAAATTTTGAAGTCCCAATGTATGTGTTGTCTCGTGAGATGGTAACCTCCATGTCTAGTAAGTCA
AGGTTTCTAATAGCAATCTCCTTGACCCTTAACTATGTTCCCACATAGTACTATAGCTTAGTGTATCTACTTTGAACCTATATATGATTGGTTACACCTT
AGGCAAGTGTTAACTCTCTCTTTTAGATGTAGGAGGAGAACACTGAAGTCAATGTATCTCACATGGTCTAATGCCGGTTGTGGTACTTATTTCCCTAACG
TAAAATAAAATGGACAATTTAAGTATGTGATCTCTTATTAGGGTTTTCCTAAAGGTTAATAGATAGGGTGAGGGAGGGTATGGGACTTTTCTCACACATT
ACACATGTTGGAACCTAAAAATGATCTTTGTAGTGTTCTAGCGTAACTAAGTTGATTATATGCTATGTATGTCAAGTCATATATGATCTTTTGAATTAAG
CATGTTATGATGAAATATGAAGTTATGTTGAGTTACTTATATGTTGAGTAGCTTATGTGTTGGGTTGAGTTATGATGTTTCATATATGTGGTTAATAAGG
TTTTATGACACTAAGCATGGTTTTGACTAAATTGTTACTTTTTCTTATGCATTAATGCTTTTATGCATAGGAATCATACGTAGTACATGTGGTTTGTACT
AACTCATATTTCTTCCCTTTTCCCCAATGTTGTAGGTTTCAATCACTGAAAAGCTTCTAGACCACTTTGCAATAAGACTTAGACTTTCCCCAAGTTTTGG
TACGTTCTCTAGTTCGAGGATAGTGCCACATAATCTACCTTTGTAATTTTTGTACTGTGTAAAGACATTCATTTCTTTCCTGTTGTTGGAGACATTGTTG
TAAGCTTTATGTGGCAAATATGCACTTGTATAAAGTCTATGCCCGAATGATGTACTTCGTTTAGATGGTTTAATATGAGATAATGTATTAGACTAAATTC
CTATGTATTGGTTATGTTCTCTAAACGAGAAGCCTAAGTAAGCTTCATATGCGAGGAGTCTGAGTAAACTCCATATATTATATGTGAGAGGCTTATGTAC
ACCTCAATATGTAAAAAGTTTTAATTTTTCCGCATTTCTTACCTATGATATGATATGAGGATTCCTAAGGTCTTGTCCAAGTCCTCTCCGAGGATAATGA
CACCGGTTACGTCTAAGGGGTACTCTCCGGTTGTGACAAACTTGGTATCAGAGAATGAGATCGAAGTAATCTTATGATTGATTTCTCGCTAAACAAGGTC
TATGTAGAGTTTTGTTCATGGGTTTAAAGCGCATAACACTTATGAATGAGAGGCTATGTTGTGATTAAGAAATTCTAATCTTCTTGGTAATCCTACGACT
TGCTTCAAGAGTCTTCTCTTTCTTATGTTTATAGGTGTTACGACCCAAAGCACCCCTTAGGCATAACCGGCGTTAGCGTCCTTTACGAGGACAAAGAGAA
GCCCGTAGTGTTCGTCATAGCACATCATAGGAGACAAACTATAGAAAGATTAAAAACTTTTGCTTATATAGCAAAGAGGTTTAAATAGACCTCTACATAG
GAAGCATACATAGGCTACTCACATATATACATCATATAGGAATTTAGTCTAATACTTTGTCTCACATTTAACCATCTATAAAGTGAATCATATTAGTTTG
ATCATAAACCTTGATCTATTACAATATTCCATAAAGACTACAATGAAAGACTCAACATGAGAATGGAATAATTGTCTCAAAACATACACAAAAATAATAA
GGCTTGATGTCATGCTTATACATCAATGCTTACTTATAGCTTATTAATCATAGCCATAATCATAATCATAATCATAAAAGAACACTACTTAGAATCATCC
CTTAGGATCTCACATGTGCAATGAATAAGAAAATTATCATACCCTCCCTTGCCCTATGTAGTAGCCTTCAAGAAAACCCTAATAAGAGTTCACATACTTA
ACTTATTCATTTGATTTTACATTAGGGAAAGAAGTTCGATAACCGACATGAGACCACGTGAGCTACATGGAATCTGGTGTTCTACTCCCACACCGAAAAC
AGAGTGTTAACACTTGCCTAAGATGTAACCATTCGTACATAGTTATCTAGGTCGATCCACTAAGATAGAGTCCTATGTGTCCACGTAGTTAAGGTTCAAG
GATATTGTTTCTAGGAACCTTGACTACTAACGTGGATGTTTCTATCTCATGAGATAACATATTATTAGGGAATCAAAACTTAGTAACGTGAGAAAACCCA
TGTGGGAGGCCGGACTTACTGACGTTAGACCTCCATCTCATTTACATGCCCTTTCGGTGCTAAGAATTTATTCCTTTTAGAAGTCATGTTATTACATTAT
ACAAGTTCATATTTGTAACATTCCAGAAAATGTACTCGTCTAGTGAAGAGCCTATTAAGTTTTAATAATTGGTATTGGGGGTACATAGGAATCCCAATGC
CCAATATTGAGTAATATTGGAATTATTAGAAAATATTCGCTTAAAAAGGTGTTAGCCAATTATACAAGTATTTAAAATATAATCCAAGATTCTCTCAGAA
ATGTACTTGCAATGAAAACCCTAAGCTAAAAATACACATATTTATTCTCAAAACAACACATGAGGTATTAGGCATCCAAGTTTCAAGCCTAGGCACCATA
GCACATGACTAATTAAAAGGATCATACAGATTAAGCAGTCAAGGACATAGTGATGATCCTTCGACAAGGAGTGAACTCTCCAAATGCAACAATAGGAGTG
CATGGTTGGGAAAGTGGGCAGCAACACATTTGCAAGTATATGTGTAACCGGCCGAGGGGGACCACACGACCAAAGCCAACCAAATTTGGTTAGGTGGTTG
AGGGAAAGAGCGTGAGCGTGTCCCTCCATGTGGGGCCAAACTCCCTGAAAAACTCTAGACTCTAAGAAACTGACCTAACTAACTAACTCCAACCAAAACT
AACTAACTAAGGGACCCGAAAACCTAAGACCTAGTCGAGTGACACCAAACAATGTAACTAACTAAGAGATAACCTATTACCTAACCTAGAATGGTCCAAA
AGTGTTAGTTATGGTCCTAATTACTTAGGGGTACTTTAGTAATTACCCTAGGTCCCTTTATTAATTAAATTAGCAACTTAATTAATTAATGAAAATTCAC
AAGCTAGGCCGAAATCCTTAGCCAATTTAAAGATTTGGCTAAGTTAAATGTTCTCCTATGTGTAGTCGATTTAGGAGGGGCATTTTAGAATTTAACTAAT
TTATTTATTTAATTAAATTATTTAGTCTAAGTTGAATTAGTAAATATCAGTTCCTAAGAATTAGACTCATATTCAAACACTATAAAACTCACGACTAGAA
ACGGTAAGCAAAAACATAAGAAAAACAAAAGTTCTCTTAAGCGATTTCAAGGTATTCTTTAAGGTTTTCGTGCAAGGTGATCTTCGTAGATTCAATTCTA
CATAAGATATATGTTTTCTCTCTTGGTTTCCTTTCCCCAAGAAACTTTTTGAACATTTTATGAATTCAAGATCATCAAAACTAGGGTTGTTCCTAATGAC
GTCGTTCAACATCCATCTCCTTAGTTAACCTTTTTTTCGATTCTAATAGTATGTAGATGTAATCTCTAACATGTTGTTGGTATGTTGTGCTAATTGATTA
TTATGTGTAGGGTTCTTGATTTTTTTATGTCTAATAAGGCCTATAGATTTGATTCATATGATTAGGGTATTAGTTACATGAGTTAAAGAAGTTGTAATGC
CGAATTGTGTTCGAGAAGCTGAAGTTGTTATGAATCATTCATGAAGTTTAGTTCACTATTAAATGTCAACTTGCTTTGAACTATGAAATCATTATAGTAC
ATCCATGAGGTTAATTGACTTAGATAGTGATTATATCAATGTTTGGTTTATGCCAACAAATTGGCTAGCAATATATTGTCCAAAAAGTCGAATAGAATTG
GCTTACAATATTATTTCCAAAATATGATAATTGGCTAATAACTAAGTTATTCCAAATTAAGCATGACCAATGTAACTCAATGAATTCATAACTAAGGGTA
TGTCAATCATTGGGAAAAGTCCCATCATACCCCTTCCAAATAAACAATGAATATAAGTACATTGAACACAGTTTATAACGTTCATAAGGAGTGGTATAAA
GCTACCAATTTTCATTGAACAATATAAGGTGAGTAATGAAGTAATTAAAAGTTTAATAATTATGAAAGTGGCCCGAATGAGGTGTTAAAAAAAGTGAGAC
AAGTCTCACTCACCCCTAAACTATAGTGTTAAAGATATTCACATAAAAGGGTGTTAATAATCGTGACACAAGTCTCATACACCAAGATGATAATGTAAGG
TTAAATTCACATTTCATCAAGTAAAGAAAGGGATGTACGGCTGTCCAAAGAGTTGAATAAACCTCATAACTATAAGCAAGCTTCCATAATGTTTGAGTCA
ACTCTAAAAGTTATAAAGAAAAAGAAGTTGAGAAAAGCACTGATAGACTAGCAATGAGCTTGTTCCAGCACATGTAAGCCTCATGAAATGAGGCTCCACT
AAGGTGGATAAGAGTCTCAAAAAATATCCTAGTCTTGGAACTATGTTGCCATCATAGGAATTAGCTGTGAACAACCTCTTTTCGAAGCCGGTGAACCACC
TTTTTTTGGTGGGGGGCAGACACTGGATTTCATGTTTACCTCACATCATCTAGGTTAACTTTGATCGGTAAGACACCCCTTTTAGGTGTGGGTCAGACAC
TGGATATTATGTTAGCTCGCATGATATTAATGCTAAAGATTTCTTTAAGAAAGTAAGAAAGAAAGAATAAGAAATGTAAGTTCAAAGTGAGCTGCCAAAG
CAACAACTTAAGTATGTCAAATAATCTATGGTGGATATGAATGAATTTTAACAAGTATGAATGAAGTTTTAACAAGTTATTGGCTTGTGCCCAATTAAGA
TATATGCTCAAATATATTCACGTTATGCAAATGATCAAATAATGGGCAAGGCCAAGTAAAAAAAAGGCTTAAAATGACTTCTTATATTATGCCAATAAAG
GAGAGTAAAACATATTAGCATCAATGCCCCATAATCTCCTTAATATGAAAATGATGAAACAAGTGGCCTAGCCAATAAAGATTGGCTTATAAAGATTTTG
TTCTCAATTTAACAAGAATGAAAAGAATAACTTGTAGTAAGGGTAGCCAAATCATTTCCCTGGTCTTTTGGATTACTTGCCCGATTCATTGTAGGTATGA
GACTATAATGAATCATTGTAATTTTAAATAACACATAGTATTACGGAGATCATTGAACTACACAACAAGAAGAAGAAAAAGAATGAAAAATGAACTTAAG
TGTTGGGGGAAAAGCTCTCGGGTTTTTGAGGAGCAAATTTCTAAATTTTCGTTCGAGTAGTTCTAAAATTATGTTCATGATTCTAAGGTCCTATGTTCAT
AAAGAAAATGATTTGTGTGCTTTGAATGCATTAAAATATGTCATATTCATACCATGATTCACAAATAATGAATTAAGAAAGTCTAGTGACTTCACTTTCC
AGAAATGGCATGTTGTTGTAGAAAGAGCTTTCTTTGATCATGCATAGTCCTTACGTTTATATGTTCATATACCCATACTTAGTAAAAGTGTGTACTAACC
CTATACTATTATTATTTTATAGGTGCATGTCATAGAGTAGATTGAGAACTCATTGAAGCTGTGTGGACTAGCGATCTCCAGACTTTGGTAGGTCCTCTTG
AGTTCGAGGATGCTACATCTATCATTCTAGATTATCACTTTAGACATATCTAGTGGATGTTTGACCTAGAGTTTAATTTTAGACGTTTTATTCAAAGCTT
TGTATTAAGGACGTTTGGCAAACTATTACGATATATTGATTCTTTCATTTGAATTGTTTAATCGATTATAGATGGTTGTTAGTTTGATCTCGTTTGAATG
TTATTCTATATAGTAATCATATGAAGTATATGTATACTTCACTATGATTTAAAAGTTTTAAATTTTCCAAAAATTTAACTATATCGGTTGAGTTCGGATT
CCAGAATCCGGATGTGACAACATTAGTCTCTTCTAGACCCTTAAGTAAACCTCTTAAAAGCTCATAGGTGATCACAAGTGAGAACTGTCCTTTCACTTTA
TATACATTATCATAATTATGAGAAACCACATTAAATCATGTAATAATCATATTATAATCATATCATAACATAATTACATAATTCATAACCAATTTACAAA
TCCAGGGTTAGGGATGAGGGATTCTTAAGACCAACATAACAACACAATTAGCTATATAATCACTATCACATAAGTTAATTTCACCTTGCATAGTTTAGAT
CAAAGGAGAATCAAGATCATACCTCATTGCCCTTCATGGGACTTCACCCTTCATCACCCAAGAATTCAAAACCAACATATGAAAATGCGGCGATTCATGA
AGTATTAACATAAATAAAATCAAAGTAAACAAGGGACATATTCATCACCCTCAACAATTCACCTTAACTAATCCAAGAAATTAGGGATTTAGGGGAAAGA
CATGGGTCAAGGGAAAAATCATAGGAATTAGTCAATTTACCATAAATTCATACTTAAACAACATTAATTAATCATAATTCATCACAATTTTGTTTTAGAA
AGAAGACCCATGTGAGGAGGATAACCCTTGTTTAGGGGATTTAGAAATCATCTTTTGAAGGACCTCATGGGGAAAGAAATCCCAAGAGTGAAAGAAACCA
TATCTTATTGATGAGAGCGCACTAAATTTTGTTGACAACCTTGAAGGCTTGATCTTCTTCTTGGAGCTCTATTGGTATGCAATGGGGTTTTGGAGGAAGA
GAGAATTTGGGAGAGAGAGTGATTTTTTATTTCAGCTTGTGGGACTTGATTTTTGTGTTAGAGAGGACCCAAAAATAACCCTAATACATTATATAGTCAC
CCATTAAATTACCCAAAATACCCCTCACTTAAATGGGTTTATTTGTGAAGTCAAAACACCCAAAATACTACTTTTACGATATATGGGATGTAGATGCGTG
TTGCGGGGATAATTCTCCAATTTATTTCCAAATTTTGAGTTGGGGAAGTAGGGTCCCTGTCATCCCCGCTTCGCGAGGCTAACTCCATATCTCTACGTGA
TGGCTGCGCGTTGCGCAACGGCCATCAGAAACCTGCCAGCACACAGCTACCTTGGCAGCTTGCTCGCCCAAGTTCGGCTCCTCCCCGAGGACCCTTCCGA
TGGTCCTTGGGGTGTTGTGACTGAATTTTTTGACCCGTATATACTACAATATACCTATTAAAATCATTTTTTCATGTTTTGGACTCCATATGACCCTCCA
AAATCTTCACCAAACATAGGGGCGTCAACTAGTTAAATTTTGTTAGTTTCCGGATGTTAAGGCTTTTCCTTAATCCTATTGCTCCAATACTTCTCAAACA
AGTTATTTATATTTATTTAGGTCTAAAAACATAATTACACAACATATAAGGATCTAATATAAGTCTTAGAAATTTCCGGGTGTGTCAATAGGCGATGAAT
ACAAGAAGGAACAACGTTCGAAGGGCCGAAGAAGAGAACACAAATGTGGCCGTTCCCTCTCAAGCTCCTCAAAACCCTAAAGTTACTATTGAAGAAGGTG
TTATTTCTAATGTGAAGATAATTGGACATTCATAGTTTGACTCAAGTGATGGCTACTCCTCTTGCTACGGATACTAGGGTGCAAGTGAACCCCAATGATA
GTACCGCCGCATTAAGTATATAGTTTTTCACAAGGATCAATCCTCCTACTTTATTTAGATCCAGGGTGGAAGAAGACCCACAAGGGTTCATAGATGAAGT
AAAGAACAGGATGTCATGGGTGTGACTTCTCAAGAAATTATGAAATTAGCTGATTATCAACTCAAAGATGTAGCACAAGTTTAGTACGAACAATGGAAGG
ATGAGAGATGGGTTAGAGAAGACCGATTTACTTGGGGGGCTTTCAGGATGGCTTTTCTTGATAGGTTCTTGACTTTGGAACTAAGGAAGATAAAGATTAA
AGAATTCATAAATCTTCGCCAAGGGAATATGAGTGTGAAAGAGTATAGCCTTCAGTTCACTCAACTCTACAAGTATGCTCCCACCATAGTGGCGGATTCC
AGGGCCAAGATGAACAATTTTTTTATGTGGGTATCCGACATTGTGATTAAGGTGTATAGTTCAGATATGTCGATTCCTACTATAGACATCTCGTCTTATG
GTTTATGTCGAATAAATTGATGAACAAAAGCATAAGCAAGTTGGTAAGGAGTTGAAGAAATCAAGAGTCGAAGATAGAAATTCTTCCAAGACTAGATTTG
AAGTGCAAGATAAGCCAAGGTTCAAGAGGATGTTTTCCAACCAAGGCCCTTTAAACACTCAAAGGTTCAACAAAGAAAAAAGTTCTACACCTAAGTCTTA
AGAGGGGATAGGTAATGGTACTTATGTGGAGAGTTTCACTTGTGCTAAATGTGGTAGAAATCATGAAGGCAAATGTCAATTTGGCATGGGCAATTTCTAT
AATTGTGGTAAGAGTGGTAACATGAAGAGAAATTTCCCTATGATATAAGCTCAAGGAGGGAAAATACTCAAGCACAAGCTAGTGCACCAAATTTGGAAGC
TCCAAAGTAGAATCCCTTTTATGCTCTTCGCTCTAGGGGTGATCAAGAGAATTCACCCGATGTTTTCACCGGTATGTTGCAAGTGCATTCCAATAAAGTT
TATGCTTTATTAGATACCACTGCCACTTTTTCTTTTGTAAATTCCTTAGTCGCTATGAGGTTTGACGTATTACCCGATGTTCTAAGTAAACCTTTTTTGG
TTATATCCCCGGTGAATGACTCGGTTATTACTAAAAGAGTCTATGAAATTATCCTATAATGTTGACTAATAGAATGACTTGGATTGATTTGGTAGAACTT
TGTGTTATTGATTTCGATGTCATTTTGGGATGAATCGGTTGTATGTTTGTTTTGCTTCTATAGATCATAGAACAAGGATATTTAAGTTCAAATTCCCAAA
TGAACCTATCATAGAATGGAAGGGGGTAAACACAATCCCTAGAGGCCATATCATTTTTTGTCTAAAGGTCCATAAAATTATTTCTAAGGGATGTCTCTTT
CTTGTTGTAAGGGTCAAGGACGTTGAGTCTGAAGCTCCTCCTTTAGAGTCGGTCCCCGTAGTGAGGAATTTTCAGAAGTCTATCCCAATGACTTACCCGA
ATTTCCTCCCGGATGGGAAATAGACTTTGGTACTAATTTATTCCCAAATACAAGACAAATCGCAGTTCCTCCTTACCAGATGTCCTCGGAAAAATTAAAG
GAACTAAAGCTTTGACTTAAGGATTTACTACACAAGGGCTTCGTACAACCTACTATTCCTCCATGGTTCGGTCCGGTGTTGTTTGTGAAAGAGATTGATG
GTTCCCTTGTAATATGCATTTATTACCGCCAACTAAATAAGGTCACTATAAATAATAAGTATCCTCTCCCTAGGATTGACAATTTGTTTGATCAACTCCA
AGGGGCAAGCTACTTTACTAGGATTTCTTTGAGGTCGGTATATCACCAACTTAGGGTAAGGGGTGAACAAATTCCCAAAATAGCTTTTCGAACTAGGTAT
GGTCACTATGAGTTCCTATTCATGTCATTTTGGTTGACAAATGCCTCGGCGCCTTTCGTGGACTTAATGAATAGGGTGTTCCGACAGTACCGTGATTCTT
TGTCATTGTCTTTATTGATGATATCTTGGTGTATTTAAGAGTGATGATTAGCATATGGGATATTTGAGGGTTGTATTGCAAGTCCTCAAGGAACATCAAC
TTTTTTCTATGTATTGTAAGTGTGAATTTTTTTTTGAGATTGGTTGATTTCCCAGGCCATATTATATCATGTGAGGGTTTAGAAGGGTACTATAGAAGGT
TTGTCGAGGGTCTATTGCATCTCCTTTGAAAACATTAACCCAAAACAAGGTTAAGTATGAGTGTCAGAGGCTACTGAAAGAAGCTACCAAGACTGGAAAA
ATAAGTTGACCTCTCCTCTAGTGTTGACCTTACCAGAGGGTTCCAAGGGTTTTGTAGTATATTCTAACGCTTCTCGGGTAGGTTTGGATTATGTCCTCAT
GCAACATGGTAAGGTGATATCTTATGCCTTTAGGAAACTCTAGGTGCACAAAAAGAACTATCCAACTCATGTGTCACGACCGGAATCCAGACCCCAGACG
AGATCGGCATCGTTGACCTCTCAGAGGTCACAGACAAACCTACATACGTAGTTGTTAATTTATCCAGGTTAATTTAAGCAGAAAATTTGAAATTTTGCTT
AATTAAACTTTATATTGTAAAACATTTATCTCGCATAATACTATCTACTTAAAATCATAAGACTTCACAACAACCGTCGAACTCAAGATAATCAAATGAA
AGACATAGTCATAAATATAGAGTTGCCAAAATGGCACCAATGTAACGTCTGAAAGTAAATACGAAAGAAATGCTAGTGGAACATACGCCACTAGCTCATG
CCTACGTCTACTTTAGAATAAATCAGTAAGCATCCTCAAAAGCATGAGGGTCTATCAAATCCAAATAAAAGATCCACGTTCGGGTAACTTCAGCGTCAAC
TCGTAAGCTCTAACGTCCAGCTGCATCTACACCTAAAAGTAGATAATGTATGGAATTAGTACACACTTTTACTAAGTATAGGTATATGAAAGTACACATC
ACGGACATGTATGATTTAGAATAGCTCTCTCCTAACTATATGAATTATGGAAATTAAAGATAATGGACTTGCTAAAATCGGATTAGGGAAGCCATGCCAT
GAGAGTAACAGTATCATATTTCACACATCACCTATCATATTGCATATATCACATAACATATTGCATATAGCTTATATCATATTTTATTTCATTCGCTCAT
ATGCCATGAGACCTTGGAATCAAGGACTTAACATTAGGACTTCCCAAAATGAGTGCTCAACATATAAGACCTCAACTAGGGAGCCTTCTTTAGAAAACAT
AAAGGACTCAACATATGGGACCTCAACTAGGGAGTCTTCTTTAGCAAACACAGAGTCTGCTTCATCATTCATACGTACTTCATTTCATTTCATTCATAGG
CTAGTGTAAACACCAGCTATACCTAGGATGTAGTTTAAGACTCTCATTGGTTTCACTATGCAATGACTAAGAATGACCTAGTGTCTTTACATAAGTCTAG
TTCAGCTCTTGATTATCCTACCCAAACACCTTTGGTATCCTTCATTTCATTGTATGCATTACATGAGACTAGCCTCATTCTTTCTTTGGTAACTTTAACT
TTAAAAAACATATATCATGTGAGATCCATGAAATCCTATGTCTACCCCACACCGAAAAGAGGTAGAATCATCGGCCAAAGTAAAAGCAACACATGCTAGC
GTATATAAGGAATTGAACCCTACTAGATCCCTATGTTGGCTTCATAGATTCAAAGACAAGGAGATATAAGGAGACCCACACCCGTCTGGATGGACAGTCT
CACCTCATGAGAATTACACGAACCTCTGCCTTCCCGAAAGAACGAATCGCAACTCATAGTTAGCCTATCGGTGCTCAGTATAAAGTTTAATTACATTCAC
CTCAAACATCATAGAAGTTGGATTCTAGCATGAGGACATCATAGCTCATTAGATTATTTCTCATCTCATCATTAGTATTAAGTATATATTAACTTTAATA
CTTTTATTTTAGTGTTCATAGAGACTGGTCTCTTCATAAACCTTACACTCTCATAGGTGAGTATGTTTTGGCAACATTTACTTACGCTAATTTGAGATTG
CTCTCATATTTTACATTATCCTCTTATCATGTTGTCACCATATTCATTAGTCTTAGCACACTTTCCCTTCATAATTACTTACCCCTTTTTTACGTGAATG
TTCATTTCATCATATGCCAATGCACTTGGCCTTTTAGTGTGTTCCACACTCTTACTTAACCTTTTGGGGATCACATCATTCATTACATAACATTTTAGGT
TCACTTACTTTTAAACATCTGCTGGACTTATGGATCCAAAAATACAAGCCATGTGGCTTCAATCGTAATTCGGCTAAGTCATTCATACTTACCCAACATT
ATGTGGTACAAGAATTATGCATCTTGTAAGTATGTCAAAGTATCAATTTTGATTCCTTTACGAAGGATGCATTAATTATTTAATCACGTAAGACTTATGT
GTCAATAAGGAATTAGGAAAGGGAACCCTATTTCAAATCCCTTGTATAACACTTAGTTAAATTTTTTTTATGATTTTCGTTGTCATAAACTTCATGGCTA
GGGAACCAGAGATCCATTCCCCACACCTGCACTTTCTTTCTTTCTTTTCTTGATTATTCTCTTAAATATTTCGGCCTAGGGTACCCAAGATCGAATCCCC
ACCCACATTCTTTTCTTTTTCTCTCTTTGCTTGATTTCTTCGTTTAGACTAAGAGGGTGTGGGATCGAACCCCCACAGCCCCATTTTATTTTTCTCCTTA
ATTCTTTTCATTCAGCCGAGAGGTTGTGGGTTCGATTCACACATACCTAATTTAATTATTTCTTTATTTTATTTTTCTACTCTCTCCTTCACCCATCCAA
GAGGTTGTGGATTCGAACCCCACACGCCTCTCTTCATTTTCTTTTATTTATCTCCTAACTTTTCACTTGATATTTAACCCATTTCAAATCCCCCTCACCT
TATTTTATTATTTAATTTTTTTGGTACTTGTATTTGGTGAGGTCTTGGTTTCAATTCCCAGTGACCTTATGCATTTTTTAAAAAATTAAAACAAATTTTT
TTTACACTAAGCTTGGCCGAAAAAAATTTCCAAAATGCTGGAAATTTGTTCACCCTTTTTGCAGTCTATTTTCTCAACTTTTAAATGATAGATTGAGGAA
AATTTTCTTGTAGCATCTAGTGCATCTTTAGGTGAGTTCTCATGGTACTTTCGGAAATTTGATCACCTTTTTGCAGTCCATTTTCTCACCCTCTTTCACT
TTAAACATTAAGACATTTTGAGTAGTTTTTAGGGAGATCTTTAGGTGCATCTTCAAGGTTACTTTCAGTCAAGAATTATCATTTAATTCAGCAACTTTGA
ACTTATATGAACATCACATTTTTAATATATTCGCACAGACATAATTCATAGCATTTTAACATGTCAATATCAAGCTTCAAACTGTGGCTAATTCACAGCA
CACACATGCACAAACAAGTTGACAAACTTCACATTTTCAGAAAACCTCTTTCATTTCTACATCACTCTAAATACACATTCAAATGTGTAATCACAACCAG
CCCTAAAATTATCTACCATAAGTCATACCAACGTATACTTGAATCTTTCAAAGGATCTAATGAAAGGGGCATGCAATGCGGCCAACCTTAGTTTTTTATT
GTGAATAGTCTCAACCTTAGGGGTGTCTTGGGAAAAAGACCAAGAGGGAAGAAAACCCATACCTTAATATCTTTCAACACTTGTTTTAATGCTGCAAATA
TCCCACAAAACCATGCCTCACCACCAAAACATTAAGTACAAACCGTCGAGGAACCGCTTTTTGTTTTCGTTTTTAGAATATCTTTGCTTTTGAGTTTTAG
CATTCAAGTTCTTGATGAACTTTAATTTTTGTTCTGTTCTTTTTCTTTTGTTGAAGACTGATTGTGCAAGTGAGGGTGAGAGTAGATAGAGAGATGTGAG
AATGAGTGAATTAGGATTAGGAGAGTTAGGTGGAGACTTAGTCAAACTAGGACTCCTCATTATTTATTAATTTTATTATAAATCTGATTTTCCTTTACTT
AAATCAGAAAATTAAATATTAATTAATTCAACTAAATTACTAAACACTAATTAGTTCATTTAATTCATTGCTTCCATCAAGGTTCAAACCAGGGTAAAGC
TTAAATTCGCATAAGGGTCAAATTGGGTCAACCCATACCCGAATTTCCCGTTAATCATATTAATTAATTAATTAATTTTTAGGGTTTGGTTGGGTTGGTT
GTTGCATAGGTTCAGAGGTCTGGTCTTACGCGCATCAATCCGTGTTAACCCGGTGTAATCTTAGGCGTTCTAGATATATACGTCATTACTTAAAAGTCAT
TTTAGGGTGGTTACATTATCCCCCCCCCCAGGAACATTCGTCCCCGAATGATACTTCGAATTATCTAGCTCAACGCCAGTCATCTATAAAACATATGCAT
ATCTAAGCTTTTTAATGCTTTTTATTGGTGAATATCGGGTTCATATATTAGAAGGTTGGCGCACATCCTTGAAACCTACTAGAAGCTTTGCACTAATAGA
CTAAAGAACTCTTTCCTAAACTAGTCTCATCAAAGCATACGATATAAATAAACACATAAGTCACATAAATCAGCAACCAACATGATGACTCAAACATATT
AACTTCATACTAGTGCATAAAACTATACACATGAAAAACTAATTTAGGCTACGCACCCGAGACATCACTAGAGGTGTCTTCCCATACACTCCTAGACTTG
AGTGCGAAGAATAGTTGACTCCTTGGAGCCTCTTCACTAGGACCATTCGGCTGAACTTTCTCCTTACCTTTTTCTCCACCTCTCATAAATAGACAAATCT
TCATCATGTGACCTAGTTTTTCATAACTGTAACAAGAACTAGAGACCATCATACACTCTCCTATATGCAGTTTGCTACACTTCCTACAAGGTTGCCTCTC
CTGTGGTGTATTGATATACCGTGGTTTCACAGTACTTTTAATGCTTTTTCCTTATGTTTAGTGTTTCCAAAAGCCTTTTTGTACTAATTTTTATGTAAGT
TTCTCTTTATTTAAAGGAAATCTGTCTAAAAGATGAATGCGGAGGTTTTTGAGCAAGAAATACAGAAAACTACCACCTATGGAGCTTGGGACTGTTCGTC
GTGCCCGTGACGGTCCGTAGGTGGCATCGTAGTGCAGCTGCTAAAGGAAGATGGGGAATTCTGACCAAGTGTGGGGTTACGGAGTGAGTGACGGACTGTT
GTAGCCATGACGGTCCATCCTGCTAGTTTGTCATGAAGATCAGAGAAGTAGTCCAGTACCCAAATTCCAAGAGTTGAAGTGTTTTGGAACGGAGACCCTC
GACGGACTGTTGTGCCTGTGACAATCCGTCATACCTGCCGTCGAGGGTAATAAAGAGAGCAGCAGAAGAAATTGCAGAAGTATGGGACAACGGAGTCCAT
GACGGTCAGTATGACCACGACGATCCATCGCGAGGTCCGTCGATCCAACCGTGTTTTGACAGATTTCCAGTAAATAGAGTCCTTATTTAATTAGTTTTTG
TTTTTATAAATAGTTCGAAAAACCTTGTTTTTGAGGTTAGACTCTTTGTTAGACTCTTGATTTTTTTAGACTCTTTGTAAGACTTTCGAATATTTTTAGA
CTCTTGTAATTGATTGCTGGTGACTTTTGCTGATTAATCAAGTGAACTTTTGGATTTTATTCTTTCTCATTGAAGTAAGAGCATGAATTCTTATATTACA
TATTTGAATATTGTGATTATGACTATGGTTAACTAAACTCCAGCACTAGGGTTGTGGGAACCATAGGCGAATAATGAGGTAAAACCTAACGAAAATAACA
ATTCTAGAATAGTGTCTTGCATGTATTGATAATTCTTTCACTTAGAAGTCTTTTTAACGGATGGCCAACGTTAGAACTCGCCTTAATGCTATTTGCTGAA
CCAAAGAGGTAGATAATAGGGGAAAGAATTATCAACATACATTTAGTGTATACTATCTAATAGGCTAGTATTGATTGGTACGAGGTAATAACTTAGTCAA
ATATCGAATACGATGCTTAATATGAGGTAAAGATAAGGGTTAGTATAGGCGAGTGAAATTTTCTAGATGCTGGACCAAGGATTTAGAAATACATAACTTA
TCACTTTGCATGCAAGATACTAGGAAAGAATTGTTATAGTTAGAATTATCAAGTTATGAACATGAGAGCAACACGTAAACCCTAGTTACTTTAATTAATT
GATTAAACTCCAACATTTGAAGCTGTTAGTTGTCTTCTTTAATTTCACTAGTTATTTTCATTTATTTAGAAATAGAAAACCCCTTTTTTTTATCATTTTT
GCTTTCCAAGGAAGTAATTGACTGCACAATAGTAATAATAGATTGAAGTTAAGTCTAAATTATTTTCCTCGTGAGAACGATCCCAACCTCATTAGTTGGG
TTATTTACTTGACACGACCGCTTTACTTCTTATTTGAGAAGTAAGTTTGAGCGTATCAAATTTTGGCGCCGCTGCTGGAGAAAGTAGATTTTAGATTAAC
TTAAACTTATTGCTATAGTTTAGTCAATATTTTCTTGATTTTAATTTGCTTTATTGTTTTTGATTTTTACAGAACCATCTTACTTGTATGCCAAATACAC
AAAGAGGACAAGAACCCTTGTTTCCCTACGATCACGAATTAGAGCGTAAACTATGCAATATGAATCACAATTTGGGAATTAATGATGATGATCGAAACGA
GAACATCCCAAATCTGGTTGATGTTCATGATTGATACACTCAAACTTACTTCTCAAATGAGAAGTAAAGCGGTCGCGTCAAGTAAATAACCCAACTAGTG
AGGTTGGGATCGTTCCCACGAGGAAAATAGTCTAGACTTAACTTCAACTTGTTATTACTATTGTTCGGTTGATGACTTCCTTAGAAAGTAAAAGCATAAA
AGGGGGGTTTGTATTTCCTAATGAGCAAAAATAACTAACGAACTTGAAAGAGACACTTAACAGCTTTTAATGTTGAGTTTTAACCAAGTAATCAAAGTAA
CTAGGGTTTACGTGTTTCCCACAGGTTCATAACTTGATAATTCTAACTATAACAATTCTTTCCTAGTATCTTGCATGCAAAGTGATAAGTTATGTATTTC
TAAATTCTTGGTCCGGCATCTAGAAAATCTCACTCCGCACCTTGGTCCGGCTACGTGTGTTGCTTTCCTAACCCTTATCCTTACCTCATATTAAGCATCG
TATTTGATATTTGACTAAGTTATTACCTCGTACCAATCAATACTAGCCTATTAGATAGTATACACTAAATCTATGTTAATAATTCTTTTCCTATTATCTA
CCTCCTTGGTCCGGCAAGTAGCATTAAGGCGAGTTCTAACGTTGATCATCCGTTAAAAAGACTTCTAAGAGAAAGAATTATTAATACATGCAAGACACGA
TTCTAGAATTGTTATTTTAGCTAGGGTTTATCTCATTATTTGCCTATGGTTCCCACAATCCTAGTTATGGAGTTTAGTTCCTCATAGCCATAAACACAAT
ATTCAAATATGGTAAACAATAATTCATGTACTTACTTCAATGAGAAAGAATAAAGTCCAAAAATTTGCTTGATTAATCACCAAAAATCACTTGTAAGAAT
CTCTAACAATCAATCACTCAAAACACAAAGTCTAACAATATAATGTTTAATATCACAGAGTCTAACCTCAAAAATGACGTTTTTCGAACTATTTATAAAA
AAATAAAAATCTAATTAAACAAGGATTCTAATTACTGGAAATCTGCAAAAACAAGGCTGGGTCGGCGGACCACGCGACGGACCGTCGTGGTCATGACGGA
CCGTCGTGGACTCCGTCGTCCCATACTTAGTGCAATTCTTCTGCTGCTTTCTTCATTCCCCTCGACGGCAAGTGTGACGGACCGTCATAAGAAAAAAAAG
TCCATCGAGGGTCTCGTTTCAAAATACTTCAACTCTTGGAATCTGGGTACTGGGATCACTTCTCTAATCTTCACGACGAACCTGCAGGATGGACCGTCAT
AGCCATGACGGACTGTCACAAGCTTCGTAATCCCACACTTGGTCAGACTTCCCCATCTTCCTTCAGCAGCTTCTCTACGCTGCCACCTACGGACCGTCAC
AGGCACGACGGACCGTCATAAGCTCCGTAGGTGGTCTCTTCTACATTTTTCGCTCAAAATCTCCCATTCAGCTTTGGACAGATTTCCTGCAAAACAAAGA
GAAACTTATATCAAAATTAGCACAAAAAGGGCTTTCGGACAGACTAAACTTAAGGAAAAAGTATTAATTATACCGTGAAACCACGGTATATCAACACCCT
CAACTTAAATTCATTGTTTGTTCTCAAGCGACGCACTATGACTCACTACACAATCTTTGTACAATAGTATTCATGTTTTTATCCTTTGCAATCATTTGGC
TATCAATCCCGATTAATCTCATCAAATCTATGCATGCTATCACTATTAGGCTTGAATTTTGTGGGATTCGAACATGACACAGACTCACCACGCACTAACA
CCTATCCTCTTCAAATTCTCACCGAGAGGCTAACAATTCCGGTATAGCAACTAGTGTCCTCACTTTAGAACAAAATCTTGATTTTTCACACAATGATTTC
AGTTTGTGTATAAGGATTACATTTCAACACTCGCTCTCAGAACAAAGTCACACTCATTCATACCTATTGCCATAAGCTTGCCCTTATTTTCACTGCCTTA
AGTTCGCTATACAACCCTTAGGATCACGATAGGACTTTTTAGCTTGTAACGTAGGCTCAGAGTCAGGTAGGGTATATTTGGGTATACTTTAGTGACTTTT
TGCCCTCCTTGACATATCGGCTAAACCTTCCACTTTCTATCACTTTATCTCGCCCAGTTTCTCCTATTCTTTCACCTTGCTGTTTTCTTTCTTTCTTCAT
TTGTGTAAGTAACTCTTGTCTTTTCTCGTTTGTAATTCTTGAATATTTCTCTTTTTTTTCAAAGAGTTCTTGAGTCACTTTACTTTTGTTATTTCTCTCT
CTTTGTTCTTTCAACCCCACTTTCCAGAGCATTCCTCAAAACAGTCACCCTCAACTCATGGCTTTGGCATGAGTCAAGGTACACAATACCCAAAGTCGGG
TCAGGGCCATAACGAAGGTTGTTATATATTAGCCACCCTCAACTTATGCTTTTGGCATAAGCTGAGGTGCACATGTCCAAGGAGGGACCAGGGCCAACAT
ATTGTTCCCAGAAAAGATCAGTGGGGTGAAAAAGAAAGGTCTAATTTTAAGCTCAAATTATTTGGATCAAAGAAGGATAACTTTCATTTAGTTTCTTTTA
TTTAGGCTAGAAATGGGCTATATTGAATAAGGGCCTATGATCCTTTCCTAATTGTCTGTTACAACTTACTTTTAGCAGGACTAACCAGGCAAGTTCTAGC
TCAGTATCAGTAGTGGACTATTCAACTTTCCTCACACTCACTTGACATCTCATCACTATACCAGATTATCAGACACCTAGTTCGACTTGAAGATTTAGGG
TAGTGCAATGGTGTAACTCTATTTCATGTTTAGAGCCACACAATTATCAGTTACTACGCCTTTTCATGCAACATTTTCCAGTTTTATCGGGATATCATTT
TAGCCATCATGCTTCAGAGTTAAACTATGTACAAAAGATATAACGTGCCGGTTCAACAGAAAAAGTAATCAGTCTTTTGGGGGAAAAGAACACAGGCAAG
AAAACCCCAAAAGAGGATAGTGAGTTGGGCTACTCAGACTGCACCCTAACACTCACTTTCCATTTACCCCACCCCCAACAAAAAAGCATGCAATTGTCCC
CAATGCATAAAAAAATCTAAAGATTAGAAGGGTAGGTGAAGCAAACCTGTGGCGCATAGCGCCGTCGATCAACATGCTGGTGGGTCTGGTTTCCCAAAAC
CCACATCCTCTGCAATCTAGACACCCTCAGTGGTGTCCTCAACAATCTGGACACCCTCAGTGATGTCCTCAGCAACAACCGCACCCTCACTAGTGCCTCC
TACTGTCTCTACAGTGCGGGAGCTAGACGCCCCAGCCGCTATCTGCGATGCTCTGATCTGGTGTGCCTCCGCCTCAGCAAGTGAGGCTCTCCTCGCGGCC
TCCATCTCTCAGCGCTCCTTCTTCCTTGCTCGCGCCTCATCCTCTGATCGACCCCTCCGCCTCTTGGCACTCTCTCTCGTGTCGATGTCTGCACGAAGAC
TGTCGACTGCAGCCTCGAGAGTCGACACATCTACCGGAGGGGCTGGACGGGCAAAGACTCTCAACTCAAATGCATCGAGGCACTGGTGAACCTCAGTAAT
CTTGCGCTGCATCTTCCTCTCCATACGCGCTTCAGACTCAGTAATAGCCTTCTGCATCCACGGCTGGATATGATGCAGAAGGGTGGCCATTTGTGCCTCC
AATTTTTGGACTCTAGCCAGCGGGGCCGGTAACGGTAGAGGAGCTATACGAGATGAGCTCGCGACTGGGCTACTACCTGGGATAGACTCGACCGGGGTAG
TGTCAGTGGACGCCTGTGTAGCGGAGCAGGCCTGGGCCACCGTGTCCGCAAGATCATCAGCAAGTGGTGGAAGCTCTGGACGGGGCCCTCGACGTGGGGC
CAACTCATTGGCCTCGTCTCTGATAAGGCCGACGTCGATGGTGCCCTGTGGGGTCTTTAATTGATCTATCTGCCATATGGGCACACCTGCAGTCCTGTAA
AGAGCAAAAATCATACACGGGAAAGGGTAGGTAGTAGTGACCTTGAACGCCCTCTCATGCATGACTTCCTGGAGAAGCCATGCGAAGTCGACCTCGAATT
CGGCTATCATCGCTGCTATCAGCACTGCTCGATCCCAAGTGACGATGTTATCAGCAGCTTTGGGGGAAAGGCAGTGACGGACGAGCAGCCACAAGAACTT
CGCGACGAACATGAGGTTGGCCTTCTTGATGGCCCCCTTCGGCTCAGTGACCCAATCTGCACCCTCTCCATCGACTGATAGATGCAGGGCCATCCACCTC
TTGGTGGTCTCTCTCAGTGCCTGCTCGCGCAAGAACTGGCCATTCTTCACGATCTGCCAGCGGTAGTCAAACTCGGCAGTGTGGGGGGTCCGCGTAGCAT
CGGCACTCTCGTCGTATAGGAACCGGTGGATGGTTGGCACGGAAATGCCAACCTGCACGCCCCGGACTCGAACCTGCTCCAGTGGGGCCTGTTTAGCGGG
AGCAGCCCGCCTATCGATCTGAGATCGGAGAGTCGCTACGTAGGATGTGTAGAACTCTCGGACCACCTCCTCGCTATATCATCCCAAAGGACGGGCTGTC
CACTAAGAGATGCCTGGTGAATATGTTGTGGATCTCCGGCAGCAATGGGAGACTCCCTGTAAGTACCCGCCGCTCCAAAGTGAGTGTCCGAGTCATTACC
CCTTTATCAGTAAGGAATTTTGCGTCGGAGTAAACTTGAAACTGGCCTTCGATGCACCACCAGTTTGCTGGACAGAGGCTGGGGTGGGGACCTGGGCTGG
TGCGCCGGATGTGGAGTCTGAACTGTCAGCCTCATCAGACGAGGCCGACGCTACAACAGTGGCAGGTGCGGGAACCTCAGCAGATCCTGAAGCATCCTCG
GACCAGGATACTCCTAAGGAGCCAGACGCTCCTTTCTCATTTGTGGCTGACCCAGAGGGTGTGCCGTTCTGGGAGGCAGTGACTACGCCGGACCCCACCG
TCTTGGGTGTGGCTCTAGGGGCATGTGCAGCACGGGTGGGGGCACATATTTAGGGTCCCGCTCGTCATCAGACCCGATGATCAAGCGTGCAGACGGGGCA
ACAGACTTGGATCGCCCGCGTGTGTAGGCTCGGTCTTGCTTGGGTGCCATAGTAGATAGTACCTGAAAAGGATCACTATTAGTACCAGTAATGTCAAACA
AGACAAGCAAGCCCATACAACATAAAACATTTAAAATTGTATGTTAGTGATAGTGAAACTGTATCACACGACGGGATGACGGCTCGTCATGGATACGACG
GACCGTCATGAGGTCCATCGTGTTGTACTTAGTCAATATATATAGAAAGAACATTGAAAGAGGGGTCTCTGACCATCATGACGGTCAAGCAGGATGGACC
GTCGCTGGGACGACGGTCCGTCGTAAGAGTCCATCGTAGGACACTTAGAAAATGTCGGGAGACCCTTATTAGAGGGGTCTATGACCATCATGACGGTCAA
AAATGACGGACCATCGCTGGGACGACGGTCCGTCGTAAGAGTCCGTCGTAAGACACTTAGAAAATGTTCGGAGACCCTTAGAAGAGGGGTATCTGACCAT
CATGAGGGTCGTGCAGGACGGACCGTCGTGGGTGTGACGGTCCGTCGTAAGTGACCGTCGTAGGACACTTAGAAAATTTTTGGAGACCCTTATCAGAGGG
GTCTCTGACCATCATGACGGTCGTGCAGGACGGACCGTCATGCATATGACGGTCCGTCGTAAGAGTCCGTCGTAGGACACTTAGAAAATTTTGAGAGACC
CTTAGACACAAGGTCTCTGACAACCATGATGGTCGTGCAGGACGGACCGTCGTGAAGACAATGGTCCGTCACAGGCGTCGTTGGGCAGGATGCTAGGGCT
TGTGCAACGGACCCTACGATGGTCCGTCGTGTGTACGACGGGCCATCATCAGGGTCTCGTTCTGAGTAGCAGTGTTATAACTGGGGGTACCCTACGCATC
CCCGATGAACCTACATGGTTGTGTAGTGTTGTAGACCTATATGTGTCTATCCCAACGACCTAAGAAACTACAAGCAAAATCACCTATGCCTAGGGTTATC
AACATGGCACATGCGAACATTTTGAACCGAGGTTTAGACATAAGCATATAAAGGAAATAGTATACGACTAAGAACTAAGCTAATACTAACTACAAAACCA
AAATGCAAGATAAATAAGTATAAATGTAGAGACACATACCTTGGAAATGGAGAAGAAGACAAACGGAGAATGGTTCTTGCAAGGTAGACACCGACAGTAG
CAGCACCGACAAGTAGATGATAATGATAAGGCTTAGGTGGTTTTTGGGAGCAATGATCAGTGAGGGGAAGTGTGGAAGTTGAAAAGAGAGGGGAGATGAG
GGGAATAAGGAAGTAATGGGGTGGAATATGGAGGGGGAGGTATAAACGGTCAGATTTTGAAAAAGGGTCCAGCCGGGTCGGGTCGGGTTTATTTCATTAA
TCGCGTGACGGTTCCCCTACAACGGTCCGTCACACTTGCGAAGACCTGTCGTAGGTTCCGTCGTGTGTGCCCTAATTTAAAAAATGACAGAAATACGTAC
CTGGTGTGACAGATGCATACGACGGTCCGTTGCATTCGCAACGGTCCGTCGTTGTATCCGTCAGTGGCTACTGCGGAGTAGTTTTCTGCAGAATTTCCTG
GTGATGTGCCTGCAAATTTAAAACCCATTTATAGAAACTACCATTATTAAAAAGACGATAAGTATTGGGTTTCCTCCCAACAAGCGCCAGATTTAATGTC
GCGGCACGACTGGGGCCACTTGATTACTCAGACTTCATCAATATGGTATGCCTCGATTACTTCATTCGCTGATTCAGCATGCCCGAGATAGATTTTTATG
TGTTGTCCATTCACCTTGAACCGCACACCCTCCTTAGTTTCCAACTCAACTGCTCCATGAGGGAATAGTTGGGTAACCGTGTAAGGACCAGTCCATTTGG
ACTTGAGTTTGCCTGGAAACAAGCGCAATCTTGAATTGAATAGAAGCACTAAATCCCCGACCATAAACTCTCGTTTTTCAATTTTGTTGTCATGATACTT
CTTCATATTTTCTTTATATAGGGCTGAGCTTTCATAGGCTTTCAAGAGAAATTCATCAAGTTCATTCAACCCATTTAATCGTTGCTTTGCAGCTTCGCTC
CAATCCAATTTTAACTTTTTCATAGCCCACATGGCTTTATGCTCTAACTCAACCGAAAGATGACAAGCTTTCCCATATACAAGTTGGTGTGGAGACATAC
CTATGGGAGTCTTATAAGCTGTCCGGTAGGCCCAAAGACCATCATCAAGCCTCCTTGACCAATCTGTTCTACTAGCATTCACTGTTTTGGACAATATCTG
TTTGATCTCACGATTCGATACCTCAACTTGCCCACTAGTTTGAGGGTGGTAAGGAGTGGCCACATTATGGCGAACACCGTATTTTTCCAATAACCCCTTG
AACAATCTGTTGCAGAAGTGGGAACCCCCATCACTAATAATGGCCCTTGGAGTGCCAAAACGGGAGAATATATTCTTTTTCAAGAATGCAGTGACACTCT
TCCCTTCATTGTTTGCGAGAGCTATGGATTCGACCCATTTAGATACATAATCAACTACTACAAGAATGTAGTTCATCCCATGAGAACTCACGAAAGGGCC
CATAAAGTCAATACCCCACACATCAAATAACTCAATCACAAGAATGGGGTTTAGAGGGAGCTCTTGCTTTCTTAAAATACCACCATCTCGTTGACATTTG
TCACATGATTTAGCAAACCCATGAGCATCTTGATGAAGAGTTGGCCAATAGTAACCACATTGCAATATCTTGTGAGCGGTTCGGATACCACTGTGATGTC
CGCCAACAGGTGAAGAATGGCATGCCTCCAATACACTCAACATTTCACATTCTGGCACACAACGCCGAATAAGCCCGTCGGCACAACTCCTATACAAGTA
TGGTTCATCCGAAAAGAACTTCTTCACATCGTACATGAACTTTTCCTTTGATGAAAGGACAAGTCTGATGGAACAATATCACTAGCCAGATAGTACGCAA
AATCTGCGAACCATGGAATCAAGTCTTATGAAGCAACCAATACATGTTCAACGGGGAAAGTATCATCAATGTCAGTCTTATCCCCTAACTCTCTCATAGC
TTCATCCTCTAGATGGGACAAATGATCAGCAACTTGATTTTCAGTCCCTTTTCTATCCAGCACTTCAAAGTCAAATTCTTGCAGCAGTAACACCCAACGA
ATCAGCCTTGGTTTCGCATCCTTTTTCGCCATCAAATATCTCAATGCTGAATGGTAAGTATGCACTATAACTCTAGTACCTAGCAAATAGGAGCGAAATT
TCTCAAAAGCAAAGACTACTACGAGGAGTTCTTGCTCAGTCACTGTGTAGTTCTTCTGGGCTTCATTTAGGGCTTTACTAGCACAGTAAATTGGGTGAAG
GATTTTGTTTCTTCTCTGTCCCAATAATACACCAAGAGCCACCCCACTAGCATCGCACATTACCTCAAATGGACTGTTCCAATCCAGAGAAATAATGATA
GGTGCAGACACTAACTTCTCTTTTAGCTCACCGAATGCTTTAAGACAGGATTCATCAAAACAAAATTTACATTCTTTCTCCAGTAATTCGCACAATGGGT
GTGCAATCTTTGAAAAGTCTTTGATGAATCTCCAATAAAAACATGCATGCCCAAGAAAGCTTCTCACACCTTTCACAGAGATCGGCGGGGGAATTCTCTC
TATTACCTCAACTTTAGCTCGATCAACCTCTATGCCCTTTTCTGAAATGTGATGACCTAACACAATACCCTCTTTCACCATGAAATGACACTTTTCCAGT
TTAGTACCAAATTGCAGTCTTCACATCTCTTAAGAACCTCAGATAAATTGGTCAAGCATCGCTCAAATGAATCACCAACCACAGAAAAATCATCCATAAA
AACCTCTATAGTATCCTCCACCATGTCAGAAAATATTGACATCATACATCTCTGAAAGTTTGTGGGTGCATTGCACAACCCAAACAGCATTCTTCTGAAC
GCAAAAGTCCCATGTGGACAAGTGAAAGTGGTTTTCTCTTGATCTTCTGGTGCGATAGAAATCTGATTATACCCCGAATACCCATCAAGAAAGCAATACA
ACCCTTTTCCGGCAAGTCTATCCAATATCTGATCCATGAAGGGCATAGGAAAATGGTCTTTTTCAGTCCATGAGTTCAGTTTACGGTAATCCATACACAC
CCTCCATCCAATAACCGGTCTCATTGGAAAAAGTTCATTCTTTTTGTTGGGGACCACAGTCATTCCTTCTTTCTTAGGTACACACTGAACCGGGCATACC
CAACTACTATCGGCGATTGGATAGATTACTCCAGCATCCAACCACTTGACAATTTCCTTCTTCACAACCTCTTGCATAGGAGGATTCAAGCGTCTCTGGT
GCTCAATACTCGGCTTATGATATGGCATGAGTTGGATTTTATGAGAGAAAATACCAGGAGGGATCCCAATAATGTCCGCAATGGTCCACCCAATAGCTCT
TTTGAACTTTTTTAGTACCTTCACCAAACTCTGAACCTGTTGTTCATCTAGGTCTGATGCAATGATTACCGGAAAAGTGTCACCATTTCCTAAGAATTCA
TACCTTAGATGAGGTGGGATAGCTTTTAATTCAACTTTTGGAGCTTCCTCTATAGATGGTTTAGCGGGTGGGGACTCGCGATTCTTCATATCAAGCTCAA
ATTTCTTCGGTTTAAACCGAACATCACCTCAGTCAAGAGCCGCGACTAATGACTCATACTCTTCAATGCAATCGCTATCAAAGTTCATTATCACTGCTGC
TAATGCTTCGACACCTAGATGTTCTTCTATTTGTGTCTCAAAGGTCTCACCCATGTTGTAGGATATAGCAGATGCCGATTGAAGCTCACCACTCTGCCTC
ATGGACCTACAAATATTAAAGGTCACTTCCTCACTGTTCAATCAAAATTTCATCTGCCCCTTTTCCATGTCTACTAAGGCTCTTCCCGTAGCTAGGAATG
GCCTCCTAAGGATAATAGGCACTTCAAAATCAACCTCACAATCAAGAATAACAAAATCGGCTGGAAAGATGAATGACTCCACTTTTACTAGCACATCATG
AAGTATCCCTATGGGCCGTTTTACTGTTCGATCAGCCATCAGTAGCCGCATCGCAGTGGGCTTTGGGTCACCCAAACCCAACTTCTTGTAAATCGAGAGG
GGCATGAGATTTATGCTTGCCCCCAGATCACATAATGCTTTCGCAAAATGTAATAGCCCGATTGTACAAGGAATAGTGAACGCACCCAGATCTTCTTTCT
TTTGGACCAAAGATCTTGTAGCAATAGCACTACAATGCTGTATTCTATCATCATCCTCAAAAGTAACCGATCTTTTCTTTGTGACCAAATCTTTCATAAA
CTTGGCGTAACCGGGCATTTGTTCTAAAGCTTCTACCAAAGGGACATTGATAGAAAGTTTCTTCAACATTGTTATAAAACGCCGATATGTGCCATCCTCG
GTCTTTTTCACTAATCTTTGAGGAAATGGGGGTGGCGGCCTAGGCATGGGAGTTACCTTTTTAGGCACCTCAGCATCTTCTGCACTGTTATCTTCTAAAT
TAGCATCAACATTTACCACTGTATCAGAGTCTTTTGTCACCTCATTCTCATTAGATGGCATAGGTGGGTCAATGGTTTGCTTGCCACCGCGAGTAGTGAT
TGCCATACAATGTCCATCATTTTTTGGATTTTGGACAGTGTTGCTAGGAAGAGTGCCCGGTTGCCGTGTGTTCACAGTTGCAGATAATTGGGCCAATTGT
AACTCAAGTTGCTTAATCGATATTGCATGTGTATCAACTTTTTGCCCAATACCCGCTAGATCATTCCTCAACTCTTTATTTTGCTCATCACTAGCATCGA
ACCTCCTCATCATTTTATGCAACATATCCTCAACTCGCGACATACTACCTCCACCATCCCTAGGAGTAACTTCACGATTTTGAGGAGGAACATAAGGTCC
ATTTCTGTCGTTTCTGTTACCATAGCTACCCCTGTTGAAGTTGTTGTCGCGATTGTAGTTTCCATCTCGGACGTAATGACCCTCACGATTGTAGTTACCA
TAGTTCCGACCTTGGTTCCCTTGACCTTGGCGCAAATTTTCCTGATTAGAGCCTTGGGCACTTGCTCGGAAACCCCCCATATGTTAATTTACTGCATAGG
AATCCTCCTCATAATAACACTCATCGATTGGAGGTGGTGGATTAGCCAAGTAGTTGACTGCATTAACCTTTTCTGCACCCCAGTGACATGTTTTAGTACC
AACCCAAGCTCAGTTCTCATCTGAGCCATTTCTTCACGAATATCATCTGTGGCTGGGTTGTGAGTGGACTGCACTGCGAAGGTGTTTCTCCCTGTATCAG
ACTTCCTAGTACTCCAAGCTTTGTTGTTACGGGAGATTTTCTCTAATTTCTCAGCAATCTCAGCATAAGGGCATTCTCCATAAGATCCACCTGCTATAGT
GTCCAACACCGCTTTATTGTTATTATCCTGTCCCCTATAGAAGTATTCCTTTAGTGACTCATCATCAATACGGTGATTTGGGACACTTCTCAAGAATGAG
GTGAATCTATCCCAAGAACTACTAACTGACTCTCGTGGTAGTGCCACAAAGTTATTCACCCTGTCTTTGTGGTTTAATTTCTTGGAGACCGGATAGTAGC
GTGCTAAGAAGACATCCCGTAGTTGGTTCCAAGTGAAAATGGAGTTGTATGGGAGCTCAGTAAACCACATAGCATCCTCTCCCGTCAATGAGAGAGGAAA
CACTCTGAGACCTATTACATCTAGATCCAAATCAGGCCTCCCCACACAACTTTTACACACTGCCCTTACCTTAGCTATATGGGCATGTGGATCCTCAGAA
GGTAGCCCTGAAAACAAACCTCTGGCAGTGAGCATTTGCATCAGACTACTAGTTACCACAAAAGTGTGGCCTGTGGGTAGAGGACGCAAAACTAGTGGCC
CATCTGAATCTGGTATGTTATCATAGCCTCTGTAGTATGCTTGGGGCCGTGGAGTGGGATTCTGTCCCCTCTGTAGATGTTCACCCGGAGCATCGGGTAA
CATCTGACCATGAACATCAGCCGGAGCTGGGATATTCTGGTTTGGATCCTCATCATTGATTCCCAAATTACGGTTCATGTTTCGCAGTGTACGTTCTAGC
TCGTGATCGTAGGGGAACAATGGTTCTCTTCCTCTCCGTGTACTTGGAATACAAGGAGGATAGTTCTGAAAAGAAATCAAAAACAATAAAACAAAGTAAA
ATCAAGAAAATATCAACTAAACAATAGTAAGAAGTTCAAGTTAATCTAAAAGCTAAATTCCCCGGCAACGGCGCCAAAATTTGATACACTCAAACTTACT
TCTCAAATGAGAAGTAAAGCGGTCGCGTCAAGTAAATAACCCAACTAGTGAGGTTGGGATCGTTCCCACGAGGAAAATAGTCTAGACTTAACTTCAACTT
GTTATTACTATTGTTCTGTTGATGACTTCCTTAGTAAAAGCATAAAAGGGGGGTTTGTATTTCCTAATGAGCAAAAATAACTAACGAACTTGAAAGAGAC
ACTTAACAGCTTTTAATGTTGAGTTTTAATCAAGTAATCAAAGTAACTAGGGTTTACGTGTTCCCCACAGGTTCATAACTTGATAATTCTAACTATAACA
ATTCTTTCCTAGTATCTTGCATGCAAAGTGATAAGTTATGTATTTCTAAATCCTTGGTCCGGCATCTAGAAAATCTCACTCCACACCTTGGTCCGGCTAC
GTGTGTTGCTTTCCTAACCCTTATCCTTACCTCATATTAAGCATCGTATTCGATATTTGACTAAGTTATTACCTCGTACCAATCAATACTAGCCTATTAG
ATAGTATACACTAAATCTATGTTAATAATTCTTTTCCTATTATCTACCTCCTTGGTCCGGCAAGTAGCATTAAGGCGAGTTCTTACATTGATCATCCGTT
AAAAAGACTTCTAAGCGAAAGAATTATTAATACATGCAAGACACGATTCTAGAATTGTTATTTTAGCTAGGGTTTATCTCATTATTTGCCTATGGTTCCC
ACAACCCTAGTTATGGAGTTTAGTTCCTCATAGCCATAAACACAATATTCAAATATGGTAAACAAGAATTCATGTACTTACTTCAATGAGAAAGAATAAA
CTCCGAAAATTTGCTTGATTAATCACCAAAAATCACTTATAAGAATCTCTAACAATAAAACACTCAAAACACAAAGTCTAACAATATAATGTTTAATATC
ACAGAGTCTAACCTCAAAAAAGAGGTTTTTCAAACTATTTATAAAAAAATAAAAACCTAATTAAACAAGGATTCTAATTACTGGAAATCTGCCAAAACAA
GGTTGGGTCGACGAACCACGCGACGGATCGTCGTGGTCATGACGGACCGTCGTGGACTCCGTCGTCCCATACTTGGTGCAATTCTTCTGCTGCATTCTTC
ATTCCCCTCGACGTCAAGTGTGACGGACCGTCATAAGCACAACGGTCCGTCGAGGGTCTCGTTTCAAAATACTTCAACTCTTGGAATATGGGTACTGGGA
TCACTTCTCTAATCTTCATGACGAACCTGCAGGATGGACCGTCATAGCCATGACGAACCGTCACAAGCTTCGTAATCCCACACTTGGTCAGACTTCCCCA
TCTTCCTTCAGCAGCTTCTCTACGCTGCCACCTACGGACCGTCACAGGCACGACGGACTATCATAAGCTCCGTAGGTGGTCTCTTCTGCATTTTTCGCTC
AAAATCTCCGTATTCAGCTTTGGACAGATTTCCTGCAAAACAAAGAGAAACTTATATCAAAATTAGCACAAAAAGGGCTTTCGGACACACTAAACTTAAG
GAAAAAGTATTAATTATACCGTGAAACCATGATATATCAATGATCAGTTGTTACCCGATGCTAGGGGTGAACACCAACAGAGGGGACAAAATCCCGCTCC
ACTGCCCCAAGAATACTACAGAGGCTATGACAATATAGCAGACTTTGATGGGCCACTTATCTTGCCCCTCTACCACCAGGCCACACCTTTGTGGTAACTA
GTAGCCTGATGCAAATGCTCACTGTCAGAAGTTTGTTTTCAGGGCTACCTTCTAAGGATCCACATGCCCATATAGCTAAGGTTAGGGCAGTGTGTATAAG
TTGTGTAGGGAGGCCTGACTTGGACTTGAATGTAATAAGGCTAAGAGTGTTTCCTCTCTCACTAATGAGAGAGGCTGCTATTTGGTTCACTGAGCTCCCT
TACAACTTAATTTTCACTTGGAATCAACTAAGGGACGTTTTCTTAGCACGCTACTACCGGGTCTCCAAGAAGCTAAACCACAAAGACAGAGTGAACAACT
TTGTGGCACTACCAGGAGAGTAAGTTAGTAGTTCTTGGGATAGATTCACCTCATTTTTTAGAAGCGTACCCAATCATGCATAGATGATGAGTCACTGAAG
GAATACTTCTATTGGGGACAGGATAATAATAATAATAAAGCGGTATTGGATACTATAGCGGGTGGTTCTTATGGGGAGTGTCCTTACGCAGAGATTGCTG
AAAAGTTAGAGAAAATCTCCCGGAACAATAAAGCTTGGAGTACTAGGAAGTCAGGTACTGGGAGAAACACCTTCGCAGTGCAATCCACTCACAATCCAGC
CACAGATGAGATCCGTGAAGAGATGGCACAAATGAGAATTAAGCTTGGGTTGGTATTAAAACATATCATTGGGGGTGCAGAAAAGATAAATGCAGTTAAC
TACTTGTCTAAACCACCACCACCTAATGATGAATGTTATTATGTGGAGGATTCCTATGAAGTAATTGAGCTAACGGGGAGTCTCCGACCGAGTGCCCAAG
GCTCAAATCAGGATAATTGGCGCCAAGGTAAAGGGAACCAAGGTTGGATCTATGGTAACTATAATCGTGAGGGTCATTATGTCCGAGATGGAAACTACAA
CCACAACAACAACTTCAATATAAGTAACTACGGTGACAGAAATTATTGGAATGTGCCCTATGTCCCTTCTCAAAATCAGGAATTTACTCCTAGGGATGGT
GGAGATAGTATGGCGCAAGTTGAGGATATGTTAGACAAAATGATGAGGAGGTTCGATGCTAGTGATGAGCACATTAAAGACTTAAGGAGTGATTTAGCGG
GTATTGGGAAAAAAGTCAATACACATGCAATATCGATTAGGTAGATAGAGTTGCAAATAGCCCAATTATCTACGACTGTAAACACACGGCAACCGAGCAC
TCTTCCTAGCAACATTGTCCAAAATCCAAAAAATGATGCACACTATATGGAAATCACTACTCGGGGTGGTAAGCAAACGATTGACCCACCTATTCCATCT
AATGAAGAAAAGGTGAGAAAGGATAATGATAAGGTGGTAGAGGATAGTGGTGAAGCAGAAGATAGCACTGGAAAAGATGCAGAAGTCCCTATAAAGCTAA
TTCCGATGCCTAGACCACCACCACCCTTGCCTTAGAGATTACTGAAAAAGACCGAGGAGGGTAAATAGCGTCGTTTTATAACAATGTTGAAGCAGCTTTC
TATCAATGTCCCTTTGGTAGAAGCTCTAGAACAAATGCCCGTTTATGTCAAGTTTATGAACGATCTGGTTACAAAGAAAAGATCGGTCACTTTCGAGGAT
GATAATAGAATGCAATATTGTAGTGCTATTGCTACAAGATCTCTCGTACAAAAGAAAGAAGATCCGGGTGCGTTCAATATTCCTTGTATAGTCGGGTCAT
TACATTTTGCTAAAGCATTATATGATTTGGGGTCAAGCATAAATCTCATGCCCCTCTCGACTTACAAAAGTTGGGTTTGGGTGACCAAAGCCCACTGCAA
TGCGGCTACTGATGGTTGATCAAACAGTGAAAAGGCCTATAAGGATACTCCATGATGTTCTAGTAAAAGTGGAGTCGTTCATATTTCCGGCAGATTTTGT
TATTCGTGATTGTGAAGTCGATTTTGAAGTGCCTATTATTCTTGGGAGGCCATTCCTTTCTACGGGTAGAGCCTTAGTTGATATAGAAAAGAGTCAGATA
AAATTTTGGTTGAACAATGAAGAAGCAACCTTCAACATTTGTAGGTCCATGAGGCAGAGTGGTGAGCTCCAATCGGTATCTGTTGTATCCTACAAAAAAA
AGATGAAGAAGGATAATGACCTAAAAAGTGAAAAACGAGAGTTTATGGTTGAGGATTTGGTGTTTTTAGACAGTTCTAGGTTGCATTGGCTTCCGGGCAA
GTTCAAGTCCAAACGGACTGGCCCTTACTTGATTACCCAAGCATTACCTCATGGAGCAGTTGAGTAAGAAACCAAGGAGGGAGTGTGGTTTAAGATGAAT
GGAGAATGAATAAAACTCTATTTTGGGCATACTGCATCAGTGAATGAAGTGATAGAGGCATACCATCTTGATGAAGGTTGAGTAATCAAGTGTCATCGGT
CGTGCCGCGACGTTAAATCAGGCGCTTGTTGGGAGGCAACCCAAAACTTATAGTTTTTTTTTCTTTTTCTTTTTAGTAATGGTAGCATTTTCTACTAATG
GGTTTTGAATTTGCAGGCACATCACCAGGAAATTCTGCAAAAAATTACTCTGCAGCAGTCACCGACGGATACATCGATGGCCCTTCACAGTTACTTCATT
GTTTCTCTTAACTCTAAGCTCAGAATCTCTATCATAGCGACTCTTGGATGAACTTGGCTCCCCTTGGTGTGAGAGTCCCTTTTTAAACCTGGGCTTATCC
CTAATTTCAGTACTACTCTTCCTTGAAAAATTCTCCTTAACTTGCCTTAACATGTTCCCTGCCCTATTGTGCTTTTCTTCCTACTTTACTACACTTGCTA
GACATGGACCATAAGTCTGGAAAGGTCCATGTTGTCATGAAGCTTAGCTGCCCTACACTCCTCCTCCGAATTCTCTAAGATCCCTGTAAGGGACCTGCTC
ATCTCGTCCCTGTTGTTCAACACAAGGTAAAGGGCATACATGGACAACTTCACAAATTTCAGGGAATACCCCTGACAGTCATCGATCCCAGCTTACGGTT
GATGAAATCCTCAACCTTAGCCTCTTTCATCTCCCTGGGGAAGAATCTCTCCAAGAAGTTTCTCTTAAACAACTCCCATATGATCGGACCTTCGCCCAAA
GTTAAAGTATCCTGCCACATCTTGCACCAAGACTATGCAACATCCTTGAGTTGGTAGGAAGCCAGCTCAATCTTCTCAGCATCTGTGGCCCCACTGGTCA
CCAAAATCTTATGCACCTCATCACTAAACTCCTCTAGATCCTCTAAAGTATTGGACTCTGTGAAAATTGGAGGATTCATCCTCGTGAAGTCTTGTAGTCT
GTCTGTCATGCTACGTGCTGGTGGGTTCTCTTGTTGAACCTCCTGCCCTTGGCATGGGTCGTCATAGTCTGGGCTTACACAATGATGGCTTGAGCCATCT
GTGCCAAAGAGGTCCCAACCTCTGCATCAGTCAACCCTACTGGGTTAACTGGCATGGCCACTCCTACAGCTGGAGCCTGGTGTGGAACTTGGTTGCCCCC
AGCATCTTTTTCTCCTGTCCTAGACCAGCATTCCTTCTTGTGTTCATTTTCTGAAAAAGATAAGAATTGATGTCAGATACGCTCATAACACCAAAAAATT
AGTCATAAGAGAATGCACGATAAGATCAAAAAAGGGAATTTTCCTACGTATCATTCAGTCTCTAATTCAGGATAGTGGTCACTTCACTACCATGACTTAG
AAACTACTCAATGTGGTTGACGTGAAGTTACTACCCTCAGAATTTAACCTAAAGCAATCATACCACATTTATCATGACCGTAATTTAGACCCCAGATGAG
ACCGGCGTCGTTGACCTGTCAGAGGTCACAGTCAAGCCTACATACGTCGTCGTTACTTCATCTAGGTTAAATTTTAGAGGAAAATTTTGAACTTTTGTTT
ACTTAAACTTTATACTGGAAAACATTGATCTCGCATAATACTATCTACGTAAACTCATAAGCATTCACGACAACCATCTAACTCAAAATAATCAAATGAA
ATATATAGTCATAAATATAGAGTTGCCAAAATGGCACAAATACAACGTCTAAAAGTAAATACGAAATAAACGCTAGTGGAACATACTCCACTAGTGCATG
CCTACGTCTACGCTAGAATAAATAAGTAAGCATCCTCAAAAGTATGAGGGCCTACCAAATCAGGATGAAAGCTCCACGTTCGGGTAACTTCTGCATCGAC
TCGTAAGCTCTAATGTCCAGATGCACCAGTACCTATAAGTAGATTAATGTATGGAATTATTACACACTTTTACTAAGTGTACTTATATGCAAGCACATAC
CATGAACATGCATGACTTAGAATAGCTCTCTCCTAACTATATGAGTTATGGAAAGTCAAGTCAGTAGAATGGCCAAAATCAGATTAGGAAAGTCATACCA
TGAGAGTAACAGTATCATATTTCACACATCACCTAATATATTGCATATAGCATATAACATATTGCATATAGATTATATCATATTTCATTTCATTCTTTCG
TATGCCATGAGACCTTGGAATCATCGACTTAACATTAGGACTTCCTAAAATGAGGGCTCAACATATGGGACCTCAACTAAGGAGCATTCTTTAGTGTAAC
AAGCCTAAGAATAGATATGCTAAGTAATGCTTAATATGTCTAGAATGCCTATGATTAGACCGGGTTCACACGGGTTGATGAGCGTAGAACCAGACCTTTG
AACCTCTGCAACAGTGAAGCCAACTAACTTGGTGAGTTAGTTGAGCTAGAAAAGGTTGGGTCCAACCATGTAGGGCACCCAGATGAGTCTTTACCAAACT
TAAAAAGGGGAAATCTTATGTTTGGAGGGTCTTGGGGTAAAATGATATTTTTATCAGGCTAAGGGTAGTATAGTAATTACCCTAAATATTTAATTAATTA
TTTAATTAATATGGTGGAGGGGCATTTTTGGGAGAAAGGGCGGAAATTGGCTTTTGAGAAAAATCTTTCTCCACAGGGTTCGAACTTATGTGGGAGCAAT
GATTTAGTTTGATTTTATAATTTGGTGGATTAATTTAATAAATTAATAATTAATGGCTGATTTAAGAAAAAGGAAAATGAGATATTTTTTACTATTAATT
ATTATTTATTAAATATTTAACCTTATTTGATTAAGTCTTGCCTAAAGTCCTAGCCCTAAGGAAACACTCTCTCACATCTATCCACTCTAACGTTTATTTC
CATCTCTTAAACATTCTTGTTCACGTTCTCTCTGCTTAACAAAACAAAACCATAAATCAAAATAATAACAAAAGCAAAAGTTCTTCATACTTGAAGAACT
TGCATGCAAATTACAAACGACAAAGAAATCCAAAAACATAAAGCAAAACATTATATTCTCGTCGGGTAAGGTGTGAGATTCGTTGGTGGAAATTTGGTTT
GGGTGGATTTGAAAGAAAGTTGAAATGTTGAACGACGTGAGATTAGGTATGGGTTACTTCCTCTTGGTCCTTTTCCCAAGAGACCATTAAGTCTCTGATG
AATCAACTCCAAAAACTAGGGTTGTTCCCCGTTATATGTTCCCTGTCACTAGCTCCCAATGATCTTAGGTTGGTATATTTTCTAGTACATTAGGCGTGTA
TTGTGATGTTTGTGAAGAATATGCTCATGAAACTGTGTTCAGAATCGTATGACTGATAATTTATGTCTTCTGAAATTATATGAAAAATTATGTGTGCGCA
ATATGTAAGCCGTGACATATACATTCAGTTTGTAGTTCGAAAAATGACATGTTTTATGGTTGTATTTAATGTGCACAAACTTGTACAAATCGTGATGTTC
GTATGAGATATAATGTGGTTGATTTGAGTGAAAGACGCTTAGCTAAATGTAACTATGAAACTATATCTCAAAACATACTAAATGATTCACCAAATGTCTT
AAGAACTAACGTATAATTGTTGATAAAAATGAGCTGAAAAATGTGACCCAATTTCTAGCACCTTGTTAGTTGGTTTCGGCCAACCAAATTTGTACAATAT
GCAATGTAAAATGAATGTAAAATAAGTGAGGTCACTAAGGATTGAAGCCGAGACTTCACCATGTTAAAATCACTAAACAAATGTAAGTAAGAAAATGTGG
TTAAGGGGAATCGAAATCGGGTGCTTTACCCGATTTTCATACTTGAAAATAAAAAAAAAGTGAGAGGAGTGGGTTTAAAACCCACCATCTCTCGGTAGAA
CATGAGAACAAGGAGAAAGTAATAAAAATAATGAGATGGGAGGAGTGGGATTCGAACCCACATCCTCTCAGCCAACACAAAAGGAGTCAAGGAAAAAGAA
AAAATTAAAGAAATGTGCTTGTGGGGGTTTGATCTCGGGTCCCCTATTGCCTAAACGTTTAAGGTGAAGTGAGGGAAAGGAAAAAGGAAGGAAAAACAAT
GTTAATGAGGGGATTCGAAATTGGGTCCCAAAGCCGAGGGTGAAGATTAGGAAAAAGGGAACAATAAATAAAAACATAAGTGTTGTCAAAGGAATTCGAA
ATTGGGTTCCCTTGCCCAATTCCGTAATGACAGATAAGTCGTAGATGAATAAATATTCACAAGAATTCTGCCTACATAGATCGAAATCGAGATCTTGGCA
TACATACAAGGCTCAAAAGTCTTGTATCACATAATCTTAGGAAGAAATGAATTACTTAAACGAACTATGAATCGAGCCTCATGGCTTGTATGTATAGACT
CATAAGTCAAGCATACGTTTAAAAGAACGTGAATCTAAGATGTATGTGATGAAATGACGTAACCCTAAAAAGGTTAAGTAAGAGTGTGAAACACACTAAA
GTGCCAAGTGTATCGGCATATGATGAAATGAACATTCACATTAAAAGGGGTGAGTAATTATGAAAAGAAAATATGGTAAAGCTAATGAATTTTGTGACAA
TATGATAAGAGGCTAACGTGAAAGATGAGAGCAATCTCAAATGAGCCTAAGTAAATGTTACCAAAACGTACTCACCTATGAGAGTGTAAAGTTAACAAAG
AGACGAATCTTTATAAACACTTTAGTGAGAGTATTGAAGTTAATGAATATTTAATACAAATGATGAGATGAGAAATCATCTAATGAGCCATGATGTCCTC
ATGCTAGAAGCCAGCTTCCATGATGTATTAGTTTAATGTAATGGAACGTTATACTGAGCACCGATAGGCTAGCTATGAGTGATGATGCCTTCCTTCGGGA
AGGGCGGAGGTTCATGTAAATCTCATGCGATGAGACTGTCCGGCATGCGCATATGGGTCTCCTTATATCTCCTAGTCTTTGAATCTATATTGTCAATATA
GGAATCAAGCAGGGTTCGACTCCCTATATACGCTAGCATGTTCGGTTCACTTTGGCTGGTGATTCCACCTCTTTTCGGTCTGGGGCAGACACTGGATTTC
ATGATACTCACATGATCTATGTCGGTTAAGGTTAAAGTTACCAAAGAAATAATGTGGTCAACCTCAAATAATATACATAATGAAATGAGCGATACCAAAG
GTGTTAGGATAGGATAATCAAGAGGTGAGATAGACTCAAGTAATGATAATAGGTTATTCTTGATCATTGCAAAGCAAATCCGATAAGAGTCTTAAACTAC
ATACTAGGTATGAATATTTATTGCACTAGTATATGAATGAATGAAAATGAAGTACATATGAATGAATGAAGCAGACTCTGTGTTTGCTAAAGAAGAATCC
CTAGTTGAGGTCCCATATGTTGAGCCCTCATTTTGGGAAGTCCTAATGTCAAGTCCATGATTCCAAATTCTCATGGCATATGAAAGGATGATGTGAACTA
CGTGATATGATATGTGCTATACGTTATGTGTTGTTTGCACAATGATAAGTATGATGATGCATGTAATCTCATGGCATGACATTCCAATCCGAATTTAGAA
AGTCCACTAACTTAACTTTCCATAATTCATTTCGTTAGGAAAGAGCTCTTATTAGTCATGCATATCCTTGGTGTTTGTTGGCATATACAGGTTGACACTA
AAGCTATCCAGACGTGGAGCATTCATCCCAACTTTGTAGGCCCCCATGCTTTTGAGGACGCTTGCCCATTATATTCTAGCTTAGATATAGGTTTGAGTTA
GTGGACTATGTTCCACTAGCAATTCTTTCTCATTTTATTTCAGACATTGTATTGGTTCCATTTTGGAAAGTATACACTTAATGCAGTATTGAACTATTTC
TTTTATTTGATGATATTTATATAGATGGTTTATTGTGAACGTTTATTAATTTAAGTAGAATGTCTTATATGAATGTTAAGTAACAAAAGTTCAAATTTTC
CGCTAAAATTAACATAGATGAAGTAATAATGACGTATGTAGGCTTGTCTGCGACCTCTAAGAGGTCAACGACGCTGGTGTCGTCTAGGGTTTAGACTCTA
TTCATGACATTTAGCAAACATAGAATCAGTTTCATTTATTCATACGTACTTCATTTCATTTCATTCATAAGCTACTGTAGACACCAGCTATACCTAGGAT
GTATTTTAAGACTCTCTTTGGGTTCACTGTGCAATGACTAAGAATGACCTAGTGTCATTACATAAGTCTAGTTCACCTTCTGATTATCCTACCCAAACAC
CTTTGGTATCGTTCATTTCATTGTATGCATGACATGAGGTTGGCCTCATTCTTTTTTTGGGAACTTTAACTTCAACCGTCATAGATCATGTGAGCTCCAT
GAAATCCTATGTCTACCCCACACCGAAAAGAGGTGGAATCACCGGACAAAGTGAAACCAAAACATGCTAGCGTATATAGGGGATTGAACCCTGCTAGATC
CGTATGTTGGCTGCATAGGTTAAAAGACTATGAGATATCAGGAGAACCATACCCGTCTAGACGGATAGTCTCACCTCATGAGAATTACACTAACCTCTCC
CTTCCCAAAAGAAATAATCGCAACTCATAGATAGCCTACCGTTGCTCAGTATAAAGTTTCATTACATTCATCTCATACATCATAGAAGTTGGCTTCTAGC
ATAAGGACATCATAGCTCATTACATGATTTCTCATCTCATCATTAGTATTAAGTATATATTAACTTTAATACTTTCATTAGAGTGTTCATAGAGACTGGT
CTCTTCATAAACCTTACACTCTCATAGGTGAGTACGTTTTGGTATCATTTACTTAGGATCATTTGAGATTGCTCTTATATTTCACATTAGCTTCTTATCA
TGTTGTCACCACATTCATTAGTCTTAGCACACTTGCCCTTCATAATTACTCACCCCTTTTTATGTGAATGTTTATTTCATCATATATCAATGTACTTGGC
CTTTTAGTGTGTTCCACACTCTTACTTAACCCTTTTGAAATCACATCATTCATAACATAACATTTTAGATTCACTTATTTTTAAACGTCTGTTGGAATTA
TGGATCCATACTTACAAGCCATGTCGCTTCATTATTAATTCGTCTAAGTGATTCGTGCTTACCCAAGATTTTGTGCTACTAGAATTATGCATCTTGTAAG
TATGTAAAAGTCTCAATTTTGATTCCTACATGGAGCGTGCATTAATTATTTAATCACGTAAGACATATGTTCTAATACGGAATTTTAAAACGGAACCCTA
TTTCAAATCCCTTGTATAACACTTAGTTAATTTTCTTTATGATTTTCGTTGTCATAAACTTCTTGGCTAGGGAACCCGAGATCTATTCCGCATACCTACA
CTTTATTTCTTTCTTTTCTTGATTCTTCTCTTAAAAATTTCGGCCTTGGTGACCCAAGATCGAATCCCCACGCCCACATTCTTTTCTTTTTCTGTCTTTA
CTTGATTCCTTCATTTAGACTAAGAAGGTGTCGGATCGAACCCCCACAGTCCGATTTTATTTTGCTCCTTAATTTTCTTCATTCAGCCAAGAGGTTGTGG
GTTCGATTCCCACATACTTCATTTTATTATTTCTTTATTTCATTTTTCTCCTCTCTCCTTCACCCATCCAAGAGGTTGTGGGTTCGAACCCCACACACCT
CACTTCATTTTCTTTCATTTTTCTCCTAACTTTTAACTTGAGCTTTAACCCATTCCGAATCCCCTCACCTCATTTTATTATTTAATTTTTAAATTAATTG
TGTATGGTGAGATCTTGGTTTCAATTCCCACTGACCTCATGCATTTAAAAAAAATTAAAACAAATTTTTTTTGTACAGTAAGCTTGGGGGAAAAAATTTT
CCAAAATGCTGGAAATTTGTTCACCCTTTTTGTAGTCCATTTTCTCAACTTTTAAATGATATATTTAGGTGAGTTATCACGGTTAATTTTGGAAGTTTGA
TCACCTTTTTGCATTCCATTTTTTCACCCTCTTTCACGTTAAACATTAAGACATTTCGAGTAGTTTTTAGGGAGATATTTAGGTGCATCTTCAAGGTTAC
TTTAAGTCAAGAATTATAATTTAATTCAGCAACTTTGAGCTTATATAAACATCACGTTTTTAACATATTCTCACACACATAATTCATAACATTTTAACAT
GTCAATATCAAGCTTCAACTGTGGCTAATTCACGGCACATAGATGCACAAACAAATTAACAAACTTCACATTTTTGGAACACCTCTTTAATTTCTACATA
ATTCCGAATACAAATTCAAACACGTAATGAAAACCAGCCCTAAAATCATCTACCAGAAGTCATACCAATGCATACTTGAGTCTTTCAATAATGATAGGGG
CATGCAACGAGGAAAACATTAGTTTTTTGATTGTGAATAGTCTTAACCTTAGGGGTATCTTGGGAAAGGGACCAAGAGGGATGAAAATTCATACCTTAAT
GTCGTTCAACACTTGTTTCAATGTTGCCAATTTCCCACGAAATCAAGCCTCACCACCGAAACTTCTAACACAACCCGTCGAGGAACCCCTCTTTGTTTTC
AGTTTTAGAATGTCTTTGCTTTTGAGTTTTAGCGTTCAAGTTCTTGATTAACTTTATTTTTCATTCTGTTCTTTTTCTTTTGTTGAAGACTGAACCTGCA
AGTGAGGGTAAAGTAGATAGAGAGACGTGAGAATGAGTGGATTAGGATTAGGAGAGTTAGGTGGAGACTTAGCCAAACTAGGACCCCTCATTATATGTTA
ATTTTATTATAAATCTGATTTTCCTTTACTTAAATCAGAAAATTAAATATTAATTAATTCAACTAATTCACTAAACACATTTAGTTCATTTTATTCGTTT
CTTCCATATAGGTTCGAGCCCATGTAAAGCTTAAATTCACACAAGGGTCAAATTCGGTTTACCCATACCCGAATTTCCCCTTAATCATATTAACTAATTA
ATATTTAGGATAAATACAATACTATGCTTAGCTCAAAAAAAACCATTTTACCCCTAGACCTTCAAAACTTAAGATTACCCCTTCAAGTCGGGTTAAGACT
CATCCGGTAAATATTCATATTCTGGTGCCCTACATGGCTGGATCCAACCTTGTCTAGCTCAAATAACTCACCAAGTTGGTTGGCTTGGCTATTGAATAGG
ATCAGAGGTCTCATTCTATGCGCATCAATCCATATGATATCGGTCTTATCTTAGGCATTCTAGATACATTAGGCATTACTTAGAATATTCATTTTAGGGT
TGTTACATCATGATCTTGAATTTGTGATCGTGGTGTTTCCTTGAAAATATGGAGGCATTATATTTATCGGGTACATATGGACGTATTCACCGACCACATC
AGTTATCAATATGTGTTTACTCAAAAAGAGTTGAATCTCTGACAATGAAGATGGTTGGAGTTATTGAAGGATTATGACATGAGTGCTCTTTACCACCCTG
GCAAGGCCGACATGGTTGCGGATGCTCTAAGTCGTGTGACTATGGATAGTGTGTCTCATACAGGAGAAGCTAAGAAAAACCTAGTAAAAGATATTCATAG
GTTGGCTTAGTTGTGTGTTCGGCTAGAAGAATCTCCAAATAGTGGTTTTGTTGTCCATCATAACTGCTAATTGGTTGAGGTGAAGTCTAAGCAACATCGT
GATCCATTATTGATGGAGTTGAAGGAATCGGTTCTTAGTAAGCTTAATGAGTCATTCTTCCAACGGAGGGATGGGGTGCTTAGGTACCAAGGTAGGTTGT
TGATATACCATGATTTCACGTTACATTCAATGCTTCATCCTTAAGTTTAGTGTGTGTCTTAGGCCATTTTGTAGTAATTGGAAGTATTTTTATCCGTGTC
TTGGAGAAAAGTTGTACAAAATGGAAATGAAGAATGTTGTGCAGAAATTAGTGTAGAAGTGACCCATGAAACCATCGATAGCCCGTCGTCCCATCGACGG
ACCGTAGGTGGTGATTGTGGACCGGAGGTTCAAGCATCTCAAAGCAACTCAAGGAATTCAGACCAAGTGCGGGGCTACAAAAGCATTGACAGTTCGTCGA
TCAGTCGATGGACCGTCCTGGAAAATCGTTGATGAGATAAGAGACTACTCCAGTACCGGATGTTGAAGAAAAGATAAGTATGGAACAACTATGGGCATCG
ACGGACCGTAAGTGAATCGACGGACCTTGTTGCTAGTTCATCGATTAGATTAGAGAAGATGCAACGTGCATGATTTGAAAAAATGCTAAGTATGGACCGA
CAGAGGCAGTCGATGGTCCGTCGTTTGACCGACGAACCATCTATGGGGTCGTCTATTGAAGCCATGTTTTGGTCAAAACATTCCTTATTTTGAATCCTTT
TTAATTTAGGACTCTTTTTATTATAAATAGGGTAAATAACCTCATATTTGGGGTTGGATATTTTTACTATTTTCATATTTTTGTTCTTGGAGATTTTCTT
GGATAATTTTATTAAAATTTCTGAATTTGTTATTCAAGACAATTATGTGATTTCAAGTTGAATTGTGGATTTTCTTTCAATTTGTTAAAGTAAGTTCATG
ATTTATTTTTCATCAATTATGAATTGTGATATTGTAAGCATGAGTAACTAAATCCACAACTAAAGTTTTGGGAACCATGGGCAATTAACAAGATAAAACT
AGCTAATTAACAATTCTTAATTAGGTTATTGCATGCATCGATAATTCTTTCTTCTTGAAGTTTTTTTAACGAGTGCACACGTTAGAACTCGCCTTATTAC
TACTTGTCAGACCAAATGGTAGTTAATAGGAAATGAATTATTAATATAGATTTAGTGGATACTATCTAAAAGGCTAGTTTCAATTGGTGTGATGTAATAA
CTAAGCCAAATATCAAATATGATGCGTAATATAAGTAAAGGTAAGGATTAGTAACTTAAACATATGTAGCCTTTCCAGGGTACGGGGTGAAATTATCTAA
ATATCAGACCAAGGATTTAGAGATACACAATTTATCACTTTGAATGCAAAATACTAGAAAAGAATTGTTATAGCTAAGGTTATGGAATTATGAACCTATG
GGGAACACTTACACCCTAGTTTCTCTCACAACTTGATAAACACCAACAATTTACTCTTGTTATTTGCTTGATTTCTAAATATTGCAACGCTTTTGTTTTA
CAAAACCTCCCCTTTAATTATTAGTTTTTGAAATAACTTGACTAAATAGAGGTAAACGTACATTAAAGTTAAGTCTAAATCATTTTCCTAGTGGGATCGA
CCCCAACCTAATCGTTGGGTTCTTTACTTGATACGACCGCTTATACTTCTTTAGGGAAGTGTAATTTGAGCATATCAGTTCTGTGTGCTGGATGTTGATG
ATTTGAGAAATAGAATATTTGAGAAATCTCATGGTTCCCGATATTTTATTCATCCTGGTGCCACAAAAATTTTATCATGATCTTCTAGAGAGATATTTGT
GAAATGGTTTGAAAAGAGACATAGCGGGGTTTGTGTTTAGGTGCCCTAATTTTCAACAAGTAAAAGTCGAGCATCAAAAGTCGGATGGCTTGACTAAAGT
TATAAATATTCCTACTTGGAAGTGGGAAGACATTAATATGGACTTCATAGTGGGTTTGCCTCGGACAGGAAGGAAAAATGACTGAATATGGGTTATTGTG
GATAGGTTGATGAAATCCACTCCCTTTATCCCCGTTAAGTCTACTTTTTCGGCAGAAACATATGCTAGAATGGACATTAACAGGATTGTGAGCCTTCATG
GGATCTCTTTGTCCATCATATCAGATAGAGGTGCACAATTCACTTTCCATTTCGGAGGTCTTTTCAAAAAGGGTTGGGTACTCAATTAAAGCTAAGTACC
TCTTTGCATCCTCAAACAGATGGTCAAGCGGAGAGTACCATTTAAACCTTAAAAGATATGTTAAAAGCTTGTGTGATTAATTTTAAAGGAAATTGGGAAG
ATCACCTAACGCTGATTAAGTTCTCTTATTATAATAGCTAGCATTCTAATATTGACATGGCTCCTTTGAAGCACTCTATGGTAGGAGATGTAGGTCTCCG
GTAGGGTGGTTTGAGGTTAGTGATCCTTCACTTCTTGCTCCCAAAATGGTCTATGAAGCTTTGGAGAAAGTTCATGTGATAATGGATTGATTGAAAGTAG
TGTATAGTCGGAAAAATTCTTATGCAGGCAATAGGAGAAGAGACCTTGAATTGGAAGTGGGTGATAAGGTGTATTTGAAGATTTAACCTATGAAAGGGAT
GATGAGATTCAGTAAGAAGGAGAAGCTTAGTCCCCGCTATGTGGGTCCCAATGAAATATTGTAACAAGTCAGAAAAGTTGCATATGAGTTGAAATTACCT
AGTGAAATAGCTTCGATTCAATTGGTATTTTACGTATCCATGCTTAAGAAGTGTATTGCTGACCCCGAGTCCATTCTCTCTATTGACGGGTTAGGTGTCA
ATGAGAATCTTTCCTATGAAGAGGTTCCAGTGGAAATCCTTGATCGTCAAGTGATGAAGTTAAGGAACAAATAGGTGGCATCCCTCCGTAAACGTTCTAT
GGAGAAACCACGTAGATAAGGGTGCAACTTGGGAAGCCGAGGCTGACATGAAGTTTTGTTATCCTCATTTTTCCCTAATTAAGGTTAGTTGTTCCTATTA
ATAATGAAAATAATTAATAATTTTAAATTTGACTTGTTTTGCAAAAATGCGCATAATTATGGTAAAATGTTTATGCTAAAATGAGTTTTCATGTGAAAAA
AATTGCTTGATTTACGCTCATTTGTGTATTTGGTGTATTATTGCCTTCATGAAATAGTATTGGGCATGTTGATGTGTTTTGAAATAAGTTTTGGCATAAC
TGACTCTAAATGTTTATGTTGAGCTGTGATATGTGGTAATTTGTGTTTTGAGTTGCTAGGTGTAGATGTCATGTTTATGTGTTGAACGGAGTTTTAAAGT
ACTATTTTGAGTAGTAACTCATGTTGATTATATGATGTTGGCTGGGCTGCTAGTATTGAGTCCATTCTCTCCCAATAAAAAGTTGGTGTCATTCAGGGAC
GAATGTTCCTAGGGGGGATAATTAACAGTCCGAAGTTCCATGACCTAACTAGAGACTTACATAATTAACTAAGACTTGAAACACTGTTTATAGTCCTAAA
ATAATGTATTTAAACTAATTAGGAAGTGTTAGAGTCAAAACGTCAAGAAACGTCCAAGACGTGTGGAGACTAGTGAAATAGAGGTTAGTGTGTCTTGGCA
TGTTTAATGGGGCTTTGGGAGTCGGATTAAATGAAAATTTGTAAAAAGGTGCATAACATATAGAAGAGTGTGTTTAGGGTCAAAACAACCGGGTGTGACT
CTCCAAGGACCACCCTAAAGGTCCTTGGTGAGGACCATACATTTGGACTCAAAAGTTGTCATTTGACATAGGCAATCGACGGACCAAACGACGAGCCGTT
GATGGTGTCATAGATCTAGCCTTAGTCAATTTCAAAAATTTTACCAAAAAACACTCTCTGATCCAAACGGCGCCTTGCCATTACGGGGCCGTTAATGGAC
CTAAAAACTGTCGGTCGAGGTCGTCGTTTGGGGTCTGTTTCATAGTTTAATTTTTAAGCTAAATGAATTAATTAGTTAATTAATTAATTAATTAATTAAT
TAGGAGTTAAGGGGAGGTTAATTAAGTTATTTCAGTCAATATATAAGACTTAACCTTTTTTAAACTAACTCAACACTACATAATTCCCCAAACCCAATTC
TCCCTAACTTCTCTCTAGTTTCTCTCTTCCCAAACATCAACCTCCATTGAATAACACTAGGGCTCCGAGTTGAGGACGAATTCACCAAAGATTTCACCTC
AAACTCATGTCAAGATCATCACTAAAGTATGGTCTCTTTCACTCTTGGTATCCTTTCCCAAGAGGCACCTTTAACTATGGTTTTTCAAACCTTCCAAGAC
TAGGTTTTCATTCTAGACATGGGTTCTCCTTTCATTATGAAATTGTATTTCAATTATGATGAATTATACTATTTTATCATTTTTAAATAAGTATTGATGG
TCAATTGTTGGTAATCACTCAACATTGTCCCTTGAACCCTTGTTCTTCCCTAAACACTTTATATCTTGAAATTCTAGGGCAATTGTGGAGGATGATGAGT
ATGTGATTATGTAGAATGTCAATTATTATGTACTAGTCCTTGAATTTACCTTGTTTATTCATTGGTTATTTATTTTTTGTCAATTGAAGTATGAAGTCAA
TAAATAGGCAAGAAGTTATGAAGATTGATTCTTCTTGAATTCAATTATGAATTGTGCGTTACTTGGATTGTAATGCTTTTACGTCTAATGTGTGGTTGTT
ATGTTGATAACAAGTGTTCCTCAACCTTAACCTACACAATTGAATTAGCCATGAATTATGTGTACATGTAATGATATGATTATTATATGATTGAAAGTAG
GTTTCTCATGATTATGATATAAAGTGTAAAGTGAAAGGTGTACTCACATGGGTAAGTGGTGTCCAATGTGAAAGGATTTCACTCACTTGTGATTACCTAT
GAGCTATTATGTAAAAATGTTTACCTATGAGTCTATAAAATACTAATTTTAACTTGTATGATGAAATTATATGGTTATAAAGGGAATAAATACTTAGCAA
CGAAAGGGCATGTTAATGAGATGGAGATCTCACGCCTAGTAAGTTCAGCCTCCCACATGAGTTTCTTCACGTCTAGCAAGTTTGGATTCCCAATATGTAT
GTTGTGTCGATTGAAACCTCCATGTCTATAAAGTCAAGGTTTCTAGTTTCAATATCCTTGACCCTTAACTATGTGCCCACATAGGAATGTAGCTTAGGGG
ATCCACTTAGATAGCTACGTATAATTGGTTACACCTTACGCAAGTGTTAACCCTCTCTTTTCGGTGTGGAAGCCGAACACCGGATTCCATGTAGCTCACA
TGGTCTAGTGTCGATTATGGTACTTATTTTCCTAAATAAAAAGTAAATGAACAAGATAAGCATGTGAGATCTTATTAGGGTTGTCTTAAAGGTTACTACA
TACGATGAGAGAGGGTATGGGACTTCTCTCACACATTGCACATATGGGAACCTAAGGGGTGATCTTAGTAGTGTTCTTGAGTGACTAAGTTGATTATATG
CTATGTATGTCGTCATATATGATCTTTTGAACGAATCATGTTATGACGAAATATAAAGTTATGTTGAGTTACTTGTATGTTGAGTTGCTTATGAGTTGGG
TTGAGTATGACATTCTATATATGTGCTTTGATAAGGTTATATAACACTAAGCATGGTTTTGACTAAATTGTTCCTTTTTCTCATGCTTTGATGATTTTAT
GCATAAGAACCATACTTAGTACATGTGGTTTGTACTAACCCATATTTCTTCCCTTTTCCTCAATATTGTAGGTTTCGGTCATTGAAGAGATTCTAGACCA
CTTTGCAAGAAGACTTGGACTTTCCCCAAGATTCGATACATCCTCTAGTTCGAGGATGTGCCACATAATATACCTTAATAATATTTGTATTTTCTAAAGA
CATCATTTGTTTTACTATTGTTGGAGACATTGTTGTAAGCCCTATATGGAAAATATGTACTTTCATAAGGCCTATGCCCAAATGTTGTACTTCATATAGA
TGGTTTAATGTGACACAGAGTATTAGACTAAATTCATATGTATTGGTTATGTTGCCTAGAAGAGATGCCCAAGTAAGCTTTATATGTGAGGAGTCTAAGT
AAACTCCATATATGATTTGTGAGAGGTCTATGTACACCTCAATATGTAAAGAGTTTTAAATTTTCCATTTTTTTACCTATGATATGGTGTGACGAATGTC
AAGGGCTTATCCAAGTCCTCTAGAGGATGACAATGCCGGTTACGTTTAGGGGGTACTCCCCGGTCAAGACGTCCTCTAAGTTTATCTTCTATGTCGATCG
AAGACAGGAGGCCTTTTGTAAGAATTAGCAGACTCATCTATCAGAGTGGTGTAGTTGTTTCTTACCTTTTATGGATATGCAGATAGGTGGAGGTTGTTCT
AACGAGAGCTTCACCAATTTTGACGATTTGTTAGGATTGAATCTAGCTTTTGGTAGCAGTCAGTAGACATTAGGATAAAAACTTCTTCTATACGCCTCAT
TGGGAGAGATTCATATTGGGTGACTTAGGGGCCACAAATTTTCCGTGAAGTAATGACTTAGAAACCACAAACTTCCCAAGAAATTTTTTGGATAACTTCA
TCATATCAATTTGCCTTACATGAAGGTCAAACCTTCCAGTGTATTTTCTCGCAACTCGAGAGAGTGTCCCTTCTCCTCTTTTGCCTTTGGGACATAGCGA
AGAATGCATGTAACCTTTTTACTTGAAAAGCACCAATCATATTAGGCATCCTTTTTGGATTGCCAAGATTTGGATCTTCCTTGTTTTCAATTTTTGCCAT
ACTAACCGCTACCTTAGCCATCTTGTTAAGGAGTCTGACATCTCCCGATGCAATGTCATCAATTTTTTTGGAATACTTCTTCAAGTAAAACTTTGCATTG
GCAAAGTGACCTTCAGCTTCAGTAAATGGATTATCATTGCAATAATCTTTTTTGCGACAGCATCCTCATAATACTTCAAACATTTGTGGAAAGTAGTTGG
GATTACTTTGTTCTCGTGTACTCACGACGTACAAAGCAAAATGTTATATGAATTTTTGTATCATTTACATGTAACCACGCACTTGATTGGAACTCTTCGA
TGGTATGGAATATTTTGATAGTCCATATGGACCTTTGTCATCCTTGATTGAACCCTTAGATCATCAAACGACTATCAGAAAGATATGTTGTTGATATCCG
AAGTTCTTTCTTTGTGAATTGAAAGGATGTCGATCCCAAACCCTCCATCAATTAGGATTTTATTTTGCTTTTATAATGTGCAAAACCAACCATGAATAAA
ATGGTGATTATGAAATGTGTCATCAAATAGAAGATCATCGTCAGAGAATGTAATTTTGGCCATACATGTGTTTTCGACTCTAGGAGATGGTTATGGAGCA
TCTTTTGATGATGGATGTTTACATCGCTAATTTATTTAAATAGGGAGAAACGTCGCGGTGACTCAAAAGTACTGGATTAATTTAATTTTAAATATTTTAA
ATAATAAAACAAATTTTAAAATGATTCGTCACCTAATTTTAGGAAAAAATAGGAAATCATTTAAGTTATCTACGAAACCATTACATTCTAGGTAAGGTTT
CAGGTTATTTCAAAGGGAAGGTCTTATGCACCCTTTGAAATCTACAATGATGGATCCCGACGGAACTCATTTTTTTCAAATTGAGAAGGAGATAAAAAGA
GTATACAACTAAAACAAATACACAATATACACAAGTAATGAAATAAAACAATCAAATAGAAGACGGCCTAAATTTTCCTATCATCGATAACATGCAATAA
TAGATCAAACATTATTCAAAGAAATTCGAACTTTATTCGAATAGTTTCAATGGGAAGCGACTGCTGGATACCTATAAAGACACTTGATAAAAGTGTTAGT
ATCAAATTTAATTATGAATAAAAATTAATGGCTTAAATAATAACCTCAAAATAAAAATCCATCTTGTAAACATGTAAGGCATTAGAATCGCTGATAATTT
TTAATCGGACACTTTTAACAAGCAAAATATATAAAGATAAACTAAACCGTCTTTTAACATTGAGGAGGCCTCTAAAACCGATGGAAAGATTTTTTCATTG
CCCAATTTAACATATCATATCCAACATTATTTCAACAAAATAGTTTAGGAGGAAAAAAAATTGCACAAACAGAAAGCCACAATAACAAAACAATAATATG
TTAAAAATAGACCGATAGTAAATTGCTAACAACCTTTAGACAATTCAAAATAAATAATAAATTAAAGTAAACATAAAGACAACAACAAGAATGACTGAAA
AATAATTTAAAAAATTAAAATAAAACCAACTATGATAACCACAATAACGAGAAAATACCAACATTATTTTTCATCTGACTTAATTCACTTAAGCGAATAA
ATAACTCAAGATTCCAAATAGACATAAATCTCAACAATAAAATAAATTAACCAAAATAATGTATAAGGCGGAAATAGTCATTAACAAAAAGGATTAATGA
ACAAAAATAAATCAACAAACAGGATTAAATATACAAACCATTTTACTGAAACAAGTATAATAGTAGAAGAACAATTTAAATAAATATCTAATAGCCGTAA
TAAAAGAGAACGAAAAAGATGTTATTAAACATAGGACTCAAACAAAGTTTTATTCAAGCAATAAACCAAAATGATAGTAGTCACACTAGAAGACAAAATA
TCACCAAAAAAAACAACGATGGCTGGAGTGTGAACCCTTCCCCCGGATCTAAAACCCAAAGAACAAATAAAATAAAAAATAGAAAAAAATAAAAATAAAA
GGACACCTATGTTTGTTGGAGGTGTGTTGAAGCTTGGAAAAAGAGATGGTAAAAATGATGTTTGGTCCCATCAGATTCGTTCGCTGGAGATTGGAGTTGT
TCGCCGAAAAAATGGAAAAAACGAAAGGTTTTTTTTTACAGTGTTGTTCTGGGTGTCTTTCACCAAAGCTCGGATCTGAAAGCTTGTGAATACGTGTAAA
AATAGTAAAGAAAATGTGAAAGGGAAAAAGACGGGGGCCTAGCGTTGTTGTAGCTTCGATTCACTGGAAAAAGGGTGCTCTTGGGTGGTGGTTTGGCTGT
GATTACTCGCTGGAGAGAAAGGAGGAAGGTTTTTTTGCTTGGGGTTTTTGACATGTTGTTGGTCGGAAAAAAGAATAGAGTTGGCTGGCAATGAAGGTTG
GTTGCTCCGGCTTTGAGCTGGTCGGAGAAGACAAGAAGAACAGGGGTGGACGCTGGTTGTTTACTGGAGAAAGAAAGTAAAATGGGTGTTTGGTGGCCAT
GGTTGCTTGCCAGAAACGGAAAGGGAGAAGGAAGGTGAAATGGGGGGTCATTGGGTGGTGATTCGCCGGATTCCGACATTCCCATCATAAAAAAAAGATA
CCCTTTATGAATTAAAGAAAAGAGAAAAGATATAAAGTCACTATTGAAATATTCTCGTATTTGCATAATGGCGCCTTAACTTTAAAGTGTCCTATTACTT
CACAAAACTATCTAAATTCATAATAAATATACCATTTTGACTAAATTTAACACCACTCGTGTTGTACAAAATATGGGCGCGTGAAGGACTCTTGGTGCAG
CTTCAAACCAACGTAAAATTGCCACATGCCACTTTCAATTTGACTTATTCTTAAAAAAATATATATAAAAACACATGTATTAATTTTTTAAAACTTTATT
AGAAATAGTTTTCTTAATTTTTCAAATCATTATTCTCATCTTCCCTACCATCATTAGCTTACCCATATTTTTTAGACATTCATAGCTTCCTTCATTTTTC
CTTTGCTCGTTTCCCTTTATAACTAATGTTATTGTGTTCATTCTTATTTTTATTTTTTATTTTTTACAAAAAAAAAATAAGTTTAGTAATTTTTTACCTT
CTACAAATCAAGATAGGAATTTAGAAATAGTGAAACTCTGAGAAATTCGATTTGGGAGTAAGAAGTTGGAGAAGTTAATAATTTAAATGTCAAATTTAAC
TTGGTAATATTTTGAGTATTTAGATTTAATAATTTGACAGAATTGATTTTTATAAATAAATTAATTGGTGATAGTTTGATTAATAATTATATTGTTACCA
CGAAATCCGTCCCGCAATAGTAGATATGTCAACTGTTGCAGTACACGTGAAGGCAATGGTAGAAGACAAAAATTAAGTGGAAGAATAAAGACAAAAATTT
TAAAAAAATAAAGAAAAAGCATCGGACAAATATTCCCCTAGATATGACATGTCGAATAGGATCATGAGATACCTAAACAAACCAATTGACATAGGCATGA
CTTAATAACAATTTAATTAAGAGATATAACACATAGATCTCAAATCATAAGATGACATAAAAGATACCAACATAGTACTTAAGAAATATGTGGAATGCTT
CGTCTGATAAAAGCCTTTCTACAACATAAAAGTGATTGAGACATAATTCATACACCACATACAAATCTAAAACTGAAAATACAATGAAAGTAATAAAAGT
GTCCATGTCTTTGCCCTCGAAGCATGAGGAATCACCCAGTCAATGATCAAGATGAGCAATCCTGATTTGAGCATGTCCATGAAGGAAAAGTGTCATACCC
TATATTATAAAATAATAGAGATGCAACTATGCATTAGTACATTGAATGTACTAAGTATGGAAAATGCATAAAAAACATAGGCATGTCAACGGGGGAACCT
TATATATAATATGCATGACCAGGTAAAACATAGTAAAAGCCTAATCAATGTTACTCATCCTTGTCCTAGAGTCGGTAGCCTAGTTGGAGCATACTTAGCT
AATTAAGTACACTTCAAAGCATATTTTTTCATACGAAGATCAATGAACTGAATTACCGTTGTCTTTCTAATCGCAATGGGGAAAATGATCAAGAAAATAC
CATTTGAATTTCTCCCTATCAAAAGGACCTGGTTGAACCAAACTTGAACAACACCCTTGAATTGATAAGCGACCTATTTTGTCTTCTCGGCCATTGAAAC
TCCCATATTTTCCACTATATTATATATCTCATCAATGAACTCTTGAGGATCCTCAACTTTCGACCCATGAAATTTTGGGGAATTCATTCGAGTGAAGTCA
CTTACCTTTATTGTTGTCGTATCAACAATTGGGTTCACATAAGCAATAACCTCTTTATTTTCTTGGGTCATCATAGCATGAGCCAAAGCATGAAAAGCGA
CTCGAAATTCAGCACGAGTCACTTTTTTCGGCCAAAGGATCGACTGATACTTGAGGAATATCGGGCATTTCATTTCGTGTTATGTTAGCTTTTTGAGGAG
GCATATCCTAAAAAGCATCAGACAAAAGTTAGGAGAAAGTCCTATATAAAGATAAACTTCATGAAACGACTTTAGTGTAGTGAAAGAAGTGAAGTTTCCT
AAACACCTTGTAGCCTTCTATTCATAAATGTGTCGAGCTTCACACTTATGAACAAGACTCTATCACATGCGGCTTGTGATACATTCCCCTATATATGACA
TGTTGAATCGGATCATGAGATACCCTAAACAAACCACTTGATATAAGCATGACTTAATAACAATATAATCAAGAGATATAACACATATAGGTCTCAAATC
ATAAGACGTCATAAAAGATACCAACATAGTACTTAAGAAATATGTGGAATGATTCGTCTGATAAAAGCCTTTCTAAAAGATAAAAGTGATTGAGACGTAA
TTCATACACCACATACAAATCTAAAACTTATTTTCCCTCGAAGCATGAGGAGTCACCCACTCAATGATCAAGATGAGCAATCCTGATTTGAGCATGTCCA
TGAAGGAGAAGTGTCATGCCCTATATTATAAGATAATAGAGGTGCAACTATGCATTAGTACATTGAGTGCTTTAAGTATGAAAAATGCATAAAAACATAG
GCATTTCAATGGGGGAACCTTAAACATAATAAGCATGACCAAGTAAAACATAGTAAAAGCCTAATCAAGGTCAATTCATACTTAAATCATTGGAGAAGCC
TTTTTATAAACCTTTTGAAGAAACATAATTCATTTGTGGGATGTTTACCGTTAACCAACAATAAGGCCATGTGAGCTATACCATGAATACAACATGAATC
TCACGCCGAAAAGAGGAATCTACTTGCCAAGGTAGACTTTATCACATAACTGCTATTGTAGATCCACTAGCTAGGTCATTTAAGAAAATTCTATTGGGAC
TGACACGTAGTTTGAGAAAAAGAAATTGCTTTTAGAGACCCAACCTCTGCTAACTGAAAATTCTCCATCTCAAAGTCCTCTTGGTGATAAATAAATTCCA
ATGGAAAAGACATAATAATATTTGTATCAAAATATTTGTAAAGAAACAATTGAACTACCAATCCAAATCATAATTCATTGTAGAGTAGTTTCTTTCAAAC
TATGATCCCATAAGCTTCTTCAATATAAACACTTGTATCTAAATCATGATTTCATTCATATGTAAGAAAACCTTTCAGAAATCGTACTTATTTAAAAAAC
TAGATTTAGGAACGTGCGTTGCACGTTTATCCCAAGATACTTCATATAAATTTTGTATCGTAAAATTTATCATTGTTTCGATAGAAACTACATATATCTT
TCCAGTAAAAATATTATATCTTTAATTATAAAATTGACTAAAAGTGCATAAAGTAAAAATAACTATCACACAAATTCAATATTCCAATGAAGATATTAAA
ATACAACATGATAGGTTAATGTATACAAAGCAACAGACCATAGTAAATTATCAATAATAATAACACAACAATAGAAAGTAAGTTGTACAATAACAACAAG
CAAGAAACATAAATGTTAAACTAAATAAATAAAAAGAGACGAGAAAAGAGAGCATAGAGATTTTCTCATTTTTTTTCAATTGGTTTAAGTTTATATATTA
TTGTGTGAAGTGTCACTATTTATTATTGGATAGCATTGAGTACAAAGAGTTGTCGTAAATAAATATTAATCCATTTGAGATTATCGATGAGAAATGAGAG
TAATGAACATAATGAATATAATTAGTGAGAGTTGCATACATTTACAAGTTGATGGTAAGTTATGTATACTAATATGATGATTTACTATTTAATATTTAAT
ATTAATATTTAATTTATTAAACAATTTATAAAATTTAAATGTACTATATAAACAAAACTTTAATCTAAGAATAAAATATATAAAAGAATTCAAATATACT
AAGGTTCATAAGCATAAACATTTATTTAATAACATTTGAATTTAGCATAACAGTAAAATTATAATTCAACTTTTCTACTTTGGAGCTTCCACTTATAATA
AATATGATATTCATAGTTCATAAATCATCATTTTTCATAAACATGCATAACTTTCATAATCATAATCCATAGGTTCATAAGCATAATGTATAGTTCATGT
TCATAGGCACGGAGTCCATATGAAATCAATTAAAAACCATGTAATTGAATCAAATCATGCATAATAAGATTTGAAAATAAATATTTGAATCATAATAAAT
AGGACCCACGGAGATTTACATGAAACCCAAAGAGAATTGGGTGAAATTAAATGTGTTATTGAGATTCTTTTGGTACTCAATGGGTGAAAAAAATTTATAG
GTGAATTCCCATATATCTTGATAATGAAAGCCCTAAAAATGCAAAGAGAATGACACCTTGAAGCTTCAAATCTTAGTTCTCCACCTTGAAGCTTAAGAGA
GAATTTTGGAGAAGAAGACTTGAGGGTTTTACGAGATATTGAGTTTAAAGGAGAGAAATTAGGCTTAGTTAATGAGTAAAAACGATTATAGGGTAGTTAT
AGGGCCAAGACAACGTAGTTAAGGGGTTAATTGGGTAGGAAAAGATCAAAGCACCCTTAATTAAAACTGCCAAACATGTCAATGATTTGGACCTACAATC
CGTAGGTCTTTCTAATAACCGTTCTGGTATACCAAAGAACCTGTTACTAGGGCATACAAATCCATTCAACTTCCACGAAACCATTCTACGGATCGTCTTC
CATTCTATGATTCATAGAACTCTTTTGTAGAATAAAACTTTATGTCTAAAATTTCACTAAGTTTGGGTCACTTTTATGAAACCCTCATACAACTCGTAGA
AAGCTCTTCCTGTTCACTTGTAGGTCAAACATCAGAGACTTCACATTTCTTAAAACTCAACCCAATCCAACGAGTGCCTTCATAAGGCACATTCTTACGA
TCCGTAGGACTTCTTACTATCGGTAGATGGCTTCTGTAAGACATCGCCTTAGTGCCAAAAATGCAACTTTTCCTTTCAATTCGACTTCCCAATTTCCGGG
TTGTTACACTTAAGGAAGCATAGTGAGTACATCAATAAATGTCTCTTCCCTATCCAATCCCTCAATATTTAAAACCGGGAACACCTCTATCACTTTCTCA
CTTACGTGAGCAACGTCAGCCTTAAATTGGCGAGCTCAACTACAAACCTTGCCAAATCAAACATTATCAAATATCACAATCAATCATTAACTTGGGATTG
CATATCATCTATCCGGGCATTTAAGTCTTTATACAACCCCAATACCTCTGTGATGGCCGTATCAACAAACAGACCTAGTTATTCAACAAGTAACTTCCTC
TGCTTCTCATATTGATCCTCCATCTTTACCAATCTCATGAAATTTGTTGGTGTAAGAGCATATGGTGAGAACTGTGATTATGATGAAGTAGTCTCAATAA
ACTAAGTAGACTCTACGATGTCTGCTCCCGTTGCCTCTAATGTAGAGGGTGTAAAAGTCGGTATAGTAGTGCTAGTGGACATCAGAGGACACTCTCCAAC
ACTGGCTCCTGCATGTGCACCTATACCAAATACTTGTGGCACTAGTTTATGAACTCACATCTCAAGTCTCAACTCATCCCTCATCTTCTCAATGTGGAAC
CTCTTAGTTACTACCGTTTCCACATCAATTCTGACATGAATAAGCAACTTCTGCTTTACATAGCCTTGTCATTAAGTTGAAGAAAAGTAAAGAACTAGGT
GGCCTAGTCACTCTGTGTCTTATCTCTTTTGCAATAAGTTCTCCAAAGTTTATTGAGAACTCTGATATCCAACTTGCAATGAAAATTACCGTGTCCACTG
CAAGTGGTGTCAGATCTAGTGGGAAACAACTTGTGCCTCACCTAAAACTTGCTACCAAACTTCGTTGGGTATTGCGTAATTGGAGCTTTTCAGAAGTGAA
TCTTAAAGAAGACAATGCAACATCTACTCAACATCACCTGCAAAGGGACATGAAGAAACACGAGAAGTAAGGAGAAGAGCAAAATAAATTCCAAGAAGAC
AAATATGAGATAACAAATGCTTACAGGAAGAGCCAAATTTGAGCTGGAATGAAGTGTTTCTACGGTCCCTTATAGTAACAAACAGACCACCCAAGAAAGA
AATGTGAAAGATCATCTCAAAGGAAGGAAAAAGAGAGGGAGTTGATGGAAGAACACTTACCAAGCGAGAGTGAAGAGATAGACAAAGCCAATAGCTAAAC
AAATAGGTATCAAGATTCAAGGAAAAGCTGCAAGCTCAACCATGGTGGAAATATTTTCAAATGGTGGAGGCGAGGAGAATAATAGAGTACCAAATACGCT
ATTACAAAGCTCGGATATTTGTTTTGTTTAGTAAATCTTTCGTATTCCTTATTTCGGATTGAGTCTAATTTTGGGCCAGATCTCCTTTCTTTTTGTATAG
ACTGGGCTTCCACCATTTGTTTGATTTTTAATGAAATGATCTCCAGACCCAAAAACAATGGAAAAGAGAACTCTCTTTCAGTCAACCGAGTTACAAGTAC
AGAAATGCCTTTCGACAAAAAATTGAGGCAGAGGGCAGGGGGATCTGGGGTGTAAGGCAAGTGTTGTAGTATATTTCACTTGTATATTAGAACTAGAAAA
ATCTAGTATACCGAGTTTGACAGAACATAAAGGCAGAAGCATATCTATATACACAGTCACAAGCCTTTTCTTAGCTGTTTCGAAATCCACAAAATAAAAG
CATCGTACAGCCCATTTTATACAACAAAACAAGTTCACTATGTCCCAAGAGAAGAAAAAAACAAACGGGAGACTGACGTCCAGTTTACTTGTTCCACCAG
TTCTTTGCCACGTTCTTTTTCATTTTCAAATGTCAAGTCACTGATATGAAAACAAATAATTCTTTTCAGCCCCATTTTTGTTGACTCGTCCCAAGGAAAC
TCCCACTGTGTATACTTAAGTAAAATAACATGAGTATTGCATGTATTAGTGTTTACTAGTAAGAGCAAGACCATCAAAAGGCTTGGGTGCTCATAGTCCA
TCAATGCAGTTTGTTGCCAAATGCGACTGGAAACATCTGTATTACTCAGAAAAAGAAGCTTGTATAAGTGCAGATTATAATAAGAAAAACTTTAGCAAAA
GAAAATGATAAGGCTGTAGCATATGTGCATCCATTTGACACTTCCATCACAATCCCAGGATATCATATTGAGTTAACACTTTGTTTATACATGCAACAAA
CAAAAGAAATGTCCATTCTGTCATCTCAAAGATAGAATAAAAGGACAAGACCCAATGCAATAGTGCTGTGTCAAAGTAGCAATAATTCCCAGAGACAACT
AAGCTATGCTGCAGAGGAGATTATCCAATGGTTACTGTCTGAACTTCTAGAATGACATTTTAGCATCATCGGTAAACAGGAAAAATCACACGAAATGGAT
AGTCAATACAACTTACAAGAATGATACCTGATTAGCTGATGCAGTGTCAAGTTCTTTTTCTTTATTTCCAGACAATGTCCCCTAAAAACTGAAGAGCTGG
CACACCTCTGATCTCTACATCAACAAGGGGTGCCTGAACCAACATCAGGCTAGAGAGCTCCGGGTCATTTTGGATCATATCCAGAGCACGACTTTGGTCC
TGTGATACTTCAATCATCAGTTATTGAAGGTTTTAAAAAACCTATTTAAGCTAAATAACACAGGGAAATCAAAGTCTGCACCTAAAATATAAAGACGGAA
GAGAACAGAATTGAAGCAGATGAAGAGCTATTTTATTAATGCTTCAGACTAGATACATAAAAGCCTAGAATTAAAAGTAAAAATAATAACACATGATCTA
GCAGTCACTAAACAACTCCTAAATAATAGGAAAGCAAAACTAACAACTAATTGACTAAGTTTTAGTTAAAACATAGGCAGTAAAATTGCAGTTCAACAGC
AAATTCCTAACACTCCTCCTTGTTTTGGATACTGCAAACTCCAATTTTCTGTCTAAGAAGCTCGAATTTACTGACCGGTGAAGGCTTAGTAAACAGATCT
GCTAGCTGGTTTTCAGACTAGCAGTAGACTAGACTCACTTCTCCCCTTTGCTGCACTTCTCTCAGGAAATAGAACTTGATGTTGAAATGCTTGGTCTTCT
CGTGAAACACCGGACTGTTTGAGATTGCAATAGCTGACTGGTTGTCGACAAGAATGATAGTACTTTCCTTCTGTTCCAAATGTAAATCATACATGATCTT
TCTAAGCCACAAGACTTGGTTTACTGCTCCTGTTGCTGCTATAAATTCAGCTTCTGCAGTTGATTGTGCAACCATTTCCTGTTTCTTAGATGACTAAGAG
AATATTCGTTGAAACAATGGCAAGAGGTACTTCTCATATTTTCTGCGGATCCAGCCCAATCACTATATGAGAATCCAAGTAACTTG