BAC Sequence – LE_HBa0008L19

>C01HBa0008L19.1
TTTGCTTGTAGAAGCTTCTGAAGGACTAATGCTACAAGAGATCTCAATTTTGGTTCTCTGTCTGATGCAACATCCAGAACTGAGAACAGCAAATCCTGGA
CAACATCTGCATATCCAAGTACTTCATATGGAAAATATAATGCTTCCTCATTCTCATATATGTCAACAACTTTTCGACAGAATTCATGTATCCACTGTAG
TGCTACTGTTTTAACTGCCAGAGGAGAAGCGACATGAAGAGCTCTTATGAGAAGGATAGCGTACATTTTCAGATGCTGTAAGACTAGCCCAGGAAGTTCA
ATCCTCCCACTCTCAACCTTTTCGAGTTTCTCAGGTGTTGCTTGCTGCGAAATTGTGGCACTAACTTGTTTGCTTAGAGAGCATTTGCTTAAGAATTCAA
ATGCAGCTAGTCTTTCTAACGTCTTGAGAACTGTGACTTGCAATTCTACATGCCCAAGGACAGGTAACTCAAAAGGGTTGAAATTGCCAATAATGCTTGA
TATTAACTTTCCAGACCTGTTAAGATACAGAGTGTAGATTTCTGCTTGGCCAATCATGCTAGTAGCTCCACTGCCTAAAGAAACACAACTAAGTAAGACC
GCCAAATCAAACTGAACCAATGCAAATAGCTCAGATCTCGAGTAAGATTTAAGAATTTTGACATCATATCCCAGATTCTGCAGGTCTGATTTTTGTCTGA
GCATACACCTCAACAAATCCAGCTCCTCAAGCAGTACAATTACTGATTTTTCAACAACCTCAAAGTTCCCATGTTGAAGCAAAAATATGTAAGTAGCTGC
TGAACTTCCGGGTACTAAGTGGTTGGGATGCAAACGCAGCTGAGATATAGGCGCATCAAATTGTAATATCTTGTGCACAGATGATGGAGAAAGGCCAAGC
TTTTGCAGGGACAACAATTGCAAATTGGTTTTAAGAACTCCATGAACCTGAAAGGAATCAAGCCTCTTCATCCTCATAGACTGGTCTTTACATTCCATAA
CCAAGCTCTGAAACAAGATATCAACTGCAATAGGGTAATATGTTGCAAATCGTGCACTCAAAATTTCAGCAAGCAAAGTCAAGCATCTCCAAGAATCATC
AATCCATTTTGACCACCCAAACTTCTTTCCTATCATAGACATGCATCCTAATAGAATAGGAACCATTTTACAAAGAGGTTCACTGATCTGCTCAAGCATA
TTCATCTCTAGCAAACCTGATGCCGTGGACTGTAACACTGTAGAAAAACAAGACAATAATGCAAGTAATCTTTGGAACTGCTGGGAGCTACCAGGACTTG
CATCCTGAAGCAGCACGTCCATATCACCTAGAAACTTTGAGAGCAATCCCAACGGGAACTGCATATTGTTCACCCAATATTTCTGAAACTGCAGGAAACT
ATCCATAATAACGCGCCTATCAGACTCTGCAAGGTCTGGTACCATCGCCCACCCAAGGAGGAGATCGACAACATCAACAAAATGGGGCTGAAAGCATCTA
AAAAACTTCAAGGATATAAGTGTTAAAACAGCGAGAAGTCTGCGCAGTAAGCTCAAGGAGGTTCTTTCATCCTCAAGAAGCTCTTGGCAAGCCTTGAGAA
TTGGCAATGCAAATCTCTCAACTGCAGAAACATCCCCAATATTAAGAAATTCACGCAAGCCCTCCAATGCAAGATCAGTTGTCCCATCCACTACAGTGCT
AAGCAATGGCAATGCCCAACCAATGAACCGATCAACCAAACTGACAAGAATGACATGGTTCTGCCTTCCATTTGGAGCTATCGAGATTAAACATAGTACA
GAACACAACGCACCATAAGCAGTGGCTGCTGCCTGGCGCACTGAATATGACCTGAGCAGCAGTTTTTACGCCAAACAAAAATCTTCATCAGATGATTTTA
TAATTTATAGTACAAATTATTTAAAAAGTTGATGTGGAAACACATTAGTAGGCTGTCAATTTGATGGTATCTAATCAAAACACCTGTATGGCAGCTTCTT
CACAATTGATTGTGTAATATGATTCCTCACAAGCAACTAACAGAATTGTGCTAATAGCACCAAGTCCCAGGAACCCGATGTAAATCCAAAAAGAAAAAAA
CTACAATACAAAAAATTTCTTCCGAGACTTGTCCGAATATATGGAGGAAGGTGATTATTTTTTTATTTTTTTAATGACAAGGAAAACCCGCAACCGCCAC
CCTTTGGATGCGCATAGGGTAAAATTTCCGCTCCTATGCAATAGCTAGCAAACCCCGTAGGAGAGGTAACCTGCACTAGGCAAACCCGGTGCGACAAGCT
CAACCCATTCGCGAGCAATTGGTTTCGAACTTGAGACCTCTACATGGAAGTCCCGAGTGTAACTCCAGTTATGTGATCTTCAAGCGGTCAAGCCCCAATA
AAGGAGTGGGCTAATTTTATAACCTAAACACTTCTGATTATGGACAGAAATTCCATCATGCTTCTTACTTCCCAGTCATTACCTTCTGAACTTGACGCTC
TATGTATCTGCTAAACTAAGTTAATTCACAGCAGCTACAGGGCTATTCACAAAACTAAATATTCCTTGATGCCTTTTTCAATTCAATAACTTATTTCATC
AAAAAAGAAAAAACTAATATATCTAAAAACTCCTCCTTCAGTGTTGTGTTGCGCACCTATTTGTCCAGACAGAGTAGTGTGGTCTCCCCATCACCTATTT
TAATTTGAATGTTGCTGCTAAATGTTTGCCATAGTTTTACTAAAACCTATGTGTTTTGAAGGAAACACCCCATGAGGACCCGGTATTGTCCTGGTGCACC
AAAAACTGTTTCCACTGTTTTACCTTCACAGCCTTCCTCCAGAAGGCATTCACTTCAGTTCTATATCTTCTTAATCATTTCATAAGTAGGCTTTGCCATG
CATTGTCAGATACCTTAATCCCAATCTCCTTTATCCTTGGGTAAATATAAACCTTCCCATTACGCCAAATGAAACTTGTGATGAGTATTTTTGTCTTCCT
ACACCTATGTCCTAATCTCAAATTAGGGTCAGTTGAGTAAATCCTCATTATTGATTCGGCTTTGTTGAACCAGTTTTATCTGAATACTTAACAATTTATG
TTTTGGGGGAAACTAGAGGTTCTCAAACACCAGAGGTTCTTTACATTTTCTATTAGCACAGAAATCTTTAAATAAACTAAAAAACTATTAGCAAAGTGTA
TTGACACGACAAGCTGAATCTGAATTAATCTGTATTTCATCTATATAGGTATTTTCCATTGTGTACTGGATTTCAAGAGATTGCAAGCTCTTTATGACAA
TTTCCTTCATGCGACTTAGGTTTATTTACCTTAAACATAACAATGATACACCAATTACATCAAGGCAAAATGGATTAAAATGTTCAACTACTTGCTGTAT
CTACCATTTTGTAGTTTGTTAGCATGGTCATGAGTACTTCACATTAAATCTTCAAATAGTGTCAGACCTTGCTAAATATGAAAACACTCATGTAAGATCT
ATGCCCGTAATGCATACTCATTGTTAAACAACTACCATAAAAGTTAAACCAAGAAAATGTATGCTGAGTATCTTAAACAACTTATCCGTGACAAGTCCTT
CCTCCACTACCCTATAGACCATTCAGGTAGCAATAATGATGGCAAAGAGCAAATTAACTTTCTCCGAAACAGTGACTACAAAAAATCCATTACCAAATTG
TAAAGCCTATTCAAGAATAACCAACCCCTCCATCACAAAACTAGCATTTACCAATGAGCCTATTTTATTAGGGGACATTGGTCGAAAACATGGCGTGCAT
ATATAAGAACAAGTGAGAGAAAAAGACATACTTGTCGGAGAGTAGCTGAGAGAAGCCCTGGGCAAGAAAAGAAGCGGAGTGAGTTATGAGGAGAGAGTTT
GGAGGGTACAGAATGGCGCGTTGTAGAGAAGTTATAGCGGCAACACGAGAAGAGTCGTCATCTTCAGTAACAGAAGTTGAAGTGGATTTGGAAGGATCGT
CTTTGGGTAAAGCGACGGTGAGAAGTGCCGCTAATTGCTGCTGCTGGTGATGAAGCCCTTGCATCATCCCTTATTCTGATGATGAATTCTTCATTGTCTT
CTTCGGCACTTCTTGAAATTCCGTTCTCCGGCGACCAACCTTTCAATTTCAACAAACGTCGTAATTGTTAATGTATAAAATAAAATAAAAAAATGAAAAT
GCACCAGCCCGGCCTCTAAAGATTTTTTATTATTCATATTACGCCCCACAACTTTCCTTATATACATTTACAAGTAGAATATTTGGAGAAAATGATCTGT
TATGTTTGGGGTAGATATAAAATGGTTCTTCCTATTTTTTTTTATATTAGATATTTTAACTTAAAGAGGTTAGGTTTATATTATGAAATATCTATTAGGA
AAATAAGTTAAATTTCAACGAGTAGTAAAACTTCATATTTGTTCCAATTAATGTTGATGTGAATAATTAACTGTTAATTAGATACTAAAGATATATGCGT
AAATTTTTTCAAAATATGAGTCAGAAGCATTTAATAGAAATAACTTTTATTATGAGTTCAATTGAATACTTTTATAGTTCAAATATCTAAATAAAATTTA
CTGATAAATTTAAAATTCATTCACATATTTAACCTTCATAATACATGCTAAGATCCTGTAAAGTGTGTGTTGATCATCAGTATAACCCTGACTCGTTAAT
CACTCGATTGTGAAATTCTTGCTCTTGGAATTCAGGTACTTGATCAGAGCTGGGACTTAGCCACAAGACCAACTTGGTTAGTTCCCTGGTAGATTGGTGA
AGTGACCATATCTAGAAACTGTTCCTCTGTTAAATTGTCCAGAAAACAGCTGTTCTTGGTGCACTTCTATAATTACTCAAGTTGCAGACAACCTTCGAAG
CATTATAACTAAACACAGCTACATTTTTCAACTTCAGCATGAACGGAGAAAGTAGATCATAACAACAACATAATCTGTAATCTAAACGCAAACCTTATGT
TCAAGAAAAACACAAGATGCTTCCTAATAATATAGTTTGAAGAAGCGCAACACTTGAAAAAATTGCACAAATTTAGTAAAACAATTACCAGATAAACAGC
TCCATAATAATATGTCAAAGTTCAACATAATTGTTTGCTAGGAATATATCATACAATAATTTATCGCAATTCCAATAGTATTCAGAGGACACACTTTAAA
CAAAACCATAAATTCCTTTCTTTTCCAAAATTGCAAAATTTCAGGCAGTTAATGCCACTTCAAATCACTAGGTATTACAATATGATACCAAATTCATGAA
AGAAAAAAAAGAAGCACTCAGCGTGAACCTCAAGCGACAGCAACTGGCTGTTGTTTCGAGGGCTCGACGGGTTTCTTGGAATCTCCGAGGAAATCTTCGA
GATTATAAATAACGGTGATATAAAGGGAACAACTAGGGCATCGAGCGATCTCTTCCCCAATCTTCAGTTCTTCCTTCGTGATTTGAAACAAGTCACCGCA
CGGACAAGGATAAGTATAAGATTGGAGCTCATCGTTCCACTCCATATCCTCAATCTCCACGTCGTCGTAAGACATCCTTGGTGATTTATTTCTTCCTTTT
CTTGGAGATTAGGGTTTTTGGCTCGGCAATTTGGTCGAGGTTATAAAGTCCGGTCGTCGAAGTTGATTGGGTTTTAAAGAAAAATGAAATTGCACCTCAA
GTCCTTTTAATAACTTTTAAAAAAATGTACAATATGACCCCCAAACATTAGTAAATTACCACTTCAGCATGACCAAGTAAAATGCTCCCACTCTCGTTTA
AAAAAGATTGTCTCTATTTCTTTTTTAGTTTGTTTAAAAAAGAATGTCTATTTATTTTCTTTTTTTGCCAACATTTTAATTTTAACTTTGTAGATCACAC
AAGATTAAAGAATGTTTTGATACATTTGACGTAACTTTAATTTAGAATTACAAAAAAAATCTTTTTTTAAACTCCGTTTCAAATTAAATTAGATGTTTTT
TAAAAAATTATATTATTAGTAGTAAATGTACAATAAGACCCTAAACATTAGTAATTTACCACTTCACCCCACCGTCCGTATACAGCGCCGGCGGCAGCGT
CAGCGACATGAGAAGTGTGGAACTACTCCGTTCGCTTTCACTCCGGCGTTTCTCTACACTTGGTCTATCCAAATCTACTTCTCCTACCATTCCGATTACT
GCCGAAGTTCTGCGAGAATCAGTTACTTCTTCTCAGTGGCATTTTATCAAACATGTTACGGGAGAACTAAACCCCACCTTGATTTCAGCTACTCTTCCAG
AGCTTCGTTCATCTCCTGACCGAGTACTCACTTTCATCGAAAATCTCGGTCCTGATTGCTTAGACATATCCTGTTATTGTCTTGCCATTTCCATACTCTC
TCGTCTCCCCTCGCCTAAACAAGCCACTCACCTTCTCAAGCAAGTGATCAGTTCTCGCTTTGCTTCGCCTAATGAGATTTTTTATGGGCTTGTGAGTGCT
CGGGAGAAGCTGGTGGTGAAGAGTTCAATTGTGTTGGATTTGCTTGTAAGGGCGTATTGTGAATTGAAGAAGGGGGAGGATGCATTAAAGTGCTTTTATT
TGATGAAACAGAAGGGAATTTTGCCAAAGGTAGAGACTTGTAATGATTTGTTGAGTCTTTTTCTTAAATTGAATAGGACCCATTTGGCTTGGATTGTGTA
TGCCGAGATGTTTAGGATGAAAATGAGTTCTACTGTATGTACGTTTAATATAATGATCAATGTTTTGTGTAGAGAAGGAAAGTTGAAGAAGGCAAAAGAG
TTCATTGAACACATGCAGTGTTCAGGGGTTAAGCCGAATTTAATATCTTTTAATACTGTGATTCATGGTTATTGTCTGAGAGGGGATATTGAAGGAGCAA
ATAAGATTTTTGAGGCGATGACAGCAAAAGGAATTGAGCCTGATTCGTATACGTTCAATTCTCTAGTTAGAGGGATGGTGAAAGAGGGGAGGGAAAAGGA
GGTCTCTTCCTTGTTAGAGAAAATGAAACCGTTTGGGTTGATCCCTACAGCTGTGACTTACAACACTCTGATAGATTCATGCTGCAGTAAAGGGGACCTA
GAAAAAGCATTTTTTTACCGAGATGAGATGGTTAAGATAGGCATCGTGCCGAGTGTTGCTACCTATAACTTGTTGATCCATGCATTGTTTCTTGATGGCA
GAATGGTAGAAACTGATGATTTGCTGAAAGATATGTCGGAGAAGAGAGTACTTCCTGATGGTATTACATACAACATATTGATCAACGGCTATTGCAGGGT
GGGAAATGCAAAGAAGGCATTTAAGTTCTATGATGAATTGTTGAGTAGGGGTCTCCAACCAACTATTGTCACTTATACATCTCTAATCAAAGTCTTGGGC
AAAAGGAATAGGATGAAAGAAGCAGATGATTTAGTTGTTGAAATATTGCGGAAAGGGATATTTCCAGATCTGATTATGTTCAATGCATTAATTGATGGCC
ATTGTGCCAATGACAACGTTGAGCGTGCTTTTGATACACTGAACGGGATGAATAAAATGAATGTTCAGCCTGATGAAGTTACCTACAATACTCTGATGCA
AGGGTATTGTAAGAAGGGTAAAGTTGAAGAAGCTTGTATGCTTCTCGAAGAGATGAAGGGAAGAGGAATTAAACCTGATCATATCAGCTATAACACTCTA
ATCAGTGGGTATAGTAGAAGAGGCGACATGCATGATGCATTCAGAATTCGTGATGACATGTTAAGTGCAGGGTTTAACCCCACTCTTCTCACTTACAATG
CTCTCATACAAGGTTTATGCAAAAAGCAGGAAGGTGTACTTGCTGAGGAACTTCTCAAAGAAATGGTTAGTAAAGGCATTACTCCTGATGATAGCACTTA
TCTTGCTTTGATTGAAGGGATTGGTGATGTTGATAGTTTCTTGGGGAGAAAAGACATTTCATAAGGTATCTGTCATGGTGTTTGTTTATACATACAGATA
CAGATAGAGAACTCCGAGGACGGTGTCTATTGTGGTTAATGATGGTTATAAGGGAATTAGGAAAGACATCTGCGCATGCTGATAGTTGTCATTTCCATAA
TGCTGACAACTCCTTGGTGATTCTTTGGATAAAAGGGGACTCGCGTGGCTTGAAGTACCTGCTGAAACTGAAAGATTCACACTGTTATGGTTCATCCTTT
CCAAGTGGCTTGCATCTTCAGATTTTTTCTGATCAGATCGACATGACTGTCTGACTACATAGCCAGTTACGCATTGCTTCATTGCCTCATAGCTTTTGGC
CGGAAAGAGACTGTTTTCCATGTGTATTTTGCAATAATTATATCCATGTTTAGCTTCTTTAACCTGTTGTGCCTCCAATGACAACTGGCTGATCAAAAGA
GAAAGGAACTTATGGGCTTCCCTCAATTTTTGGTTTAGTGAGACACTTCAAGTTCTCTGTAATCCTAATCACTGGAGTTGCATATGTTCTTGATCCTAAA
TCCACACACAACAAACAATAAATGATCTATTGATCCAGATTCCAGCTGCTACCTTAATTACGTCTTTTTCTCGAAAGTGAAGTTTGGATCATTAATAGAA
ACCTGCTGTTAAATAATTGTAGAAATTGGTTCTTTCTTAAGATGTCTCGTTTGACTGAACACAATATTCAAGAAAAAGAAATTTTTTGAATCTTACTTCT
AAAATAAGTAAATAGACATTTTTGTAGCTACAAACTAATCTTTTTTCAAAAAAAAAAGAACTAAAGATAAAATTAAATTATTTTCAAAAAAAAGATTCAA
TTTTTCTGAAACCAGCTTTTAGAAAAAAGGATTTTAAGTTGACACTACAATCCACTCAAAAAATAATTGCTTTCCGGCCAAACTTACGAAAAAGCAAATG
AAGCCCAATAAGCATTTTTAGTGCGCAAATACCTAGATCCCATTTGACCATAAGATTTTCAAAAGAAAATTTTGAAAACAATGTTTGTTTAAGAAATTTG
GCAAGTTCATACAAATATTTCCCTAGTTAGTCAACTTCAAATTTCACAAACTCATTTTTCCAAATTTCAACTAAAATCTACAGCCAAAAGTACAAGTCGC
CATTAACAAAGTTCAAGGTGAACAGAGAATGAAGATAGCAGAATCAATAAAATATTTAGCTTCAAGTTGTTTTTGTCTCGAGATCCAGGAAATACATTAA
ACAACTTCACTTCTGTTTTAGCCCCAACTTTACTCCAATGTTTTTTTCTCTTCTGATACAACAACTCAGATAGATAGTTTCTGACCACTAACTCCAATCC
CCATGGCTAGATTTTCATCAAGAAACAGATGTTCATATCCTTTACTGGTTTGTATCTTGGTGGGGTTCTTGATTTTGCTTCATTTCTCATCTTTGGGTAG
TTATAGAGGTATTCAAAAAGGGCAGATTCAAGAAAGATATGAAGAGTTGGAGGAGATCCAAATTCCTCAATCAAGTGGAAGCCAATCCTCAGAAGCCAAC
ATGCTAATTGATGAATTCCTTGATAAGTCTTCTAAACTCAGGCACATTTTCTTTCCTGACATGACGACTAGCATAGACCCTAGAAAGAATACTAAAGATG
ACACCTTTTACTATTACCCTGGGAGAATTTGGTTAGATACTGATGGGCATCCTATTCAAGCTCATGGAGGTGGGATTCTTTATGATGAAAGATCAAGAAT
GTATTTTTGGTATGGAGAGTACAAGAATGGTCCTACTTATCAAGCTCGCGGGAAGAATGTAGCTCGAGTAGACATCATTGGTGTTGGCTGCTACTCTTCT
AAAGATTTGTGGACTTGGAAGAATGAGGGTATTGTACTAGCTGCGGATGAACATGACGAGGATCATGACCTTCACAAGTCTAAAGTATTGGAGAGGCCTA
AAGTAATCTACAATGAGAAGACAGGTAAATATGTAATGTGGATGCACGTTGATGATTCAAATTATACCAAAGCCTCTGTTGGAATTGCCATAAGCAATTC
CCCTACTGGTCCTTTTCGATATCTATACAGTAAAAGGCCTCATGGTTTTGAAAGCAGGGACATGACTTTGTTCAAAGATGATGATGGTAAGGCATATGTT
ATTTACTCCTCTGTACACAACAGGGAGCTTCATATTGGTCTTCTTGATCAAGATTATGTAGATGTTACTAATGTTATGACAAGGGTTCTCGTGGGGCAGT
ATAGAGAGGCCCCGGCCTTGTTCAAGTACCAAGGAACTTACTACATGATCACATCAGGATGCAGTGGTTGGGCACCAAATGAGGCACTGGCTCATGTGGC
TGAATCAATTATGGGTCCATGGGAGACTATAGGCAACCCATGTATAGGAGCTAACAAAGTTTTTCGAGTCACCACATTCTTTGCTCAGAGCACATATGTG
CTCCCCATTTTTCCTGGTTCATTTATTTTCATGGCAGATCGCTGGAATCCAGATGATTTGGGTGATTCTAGATATATATGGCTTCCTTTAACTGTGGAGG
AAGTAGCAGGCAGTCAACGACCAAGAGTATCTATCTTTTGGCACAAAAGATGGAAGCTCTTTAAAAGTCCAGTATAGAAGAATGAATGCTTATAGTTTTC
TCATCATAGAGCAAGTTGCTAGCTTTTTGTGGATTATTAGAACTAATGTGAAGTGATTACAAGAACATCTATTAGAATAACTTTTACCTAATTGGAACTT
GCATTACACACAATTTTATGCCATGTATATCAAGATGTATGATTGCAGCTTCTTATTTATGCATTTTCAAGCAACCAAAAACTATCTCCAACTCAAGGAG
ACAGAAAAGACTTAATTTTTTTCATCAGTTTTGCGACACACAACCAAATTGTAACCTCCAATCAACTTGCAATTTGGTGAGCTTTTCAAAGTCATTTTTT
CCAATTTTCCTTAATCTTGAAGTAAGACTAGAGTTTCATCCCATGACAGGGAATTCAATTACATTCTTACAATGAATGAGTAAGCTAGATAGATGGTATT
GCTTATATGGTCAGAGCCCTACAGGTGAAAATCTTGCCAGGCAACACATAACATTTAGAAAGAAGTGTATACAATAAGAGGGTTAGAGTTTCTGGAAGAA
CTCATAGTTTATAAGTTTAACATATATATCCAAAACAAATCAATTCTACCTCAGAACAGAGGATTATAGGAATTAGAAAGAGAGTGAATCTTGATGCAGG
AAAAAAGAAAATGTTTTAACAGACCAAAGTTTCATTCAGATTCCTCTACAGCAGTTTCAATTCGGAGGAGGACGAATCCAACAGCAACTCCAACAAGAAC
CAAGCCAGGAATAATGGAAGCAATCCTGAAAATCTCAAGAGCAGCATTGCAGGTAGAGGACAAAGCTCCACCTTTGGCTTGTGATGATGGGGTTTTCAAT
GAGCTAACAATCTTTGCAAAAGATTGTTCAGTGGACATAGGGAGGCCTAATGAGGCAACATGGTTGTTTGCCTTTAGCCCTTCAAATGAATTCAAACCAC
TAATGTACTTCACTTTGGTTACTTTCTGGGAAGAGCTTCTGCCTGTGCCTATAGTGGCTGCTGAACTTACTGTTGCTGCAGAGAATGTTGTCATTGTTGC
CATTGTTTTCTGACCACCAACCTATACAAAATAAATAAATAAATTGAAGTTGTAATAAGTTTATACAAAATCTTTGAAAAGAAAGAACTAAAAAGATTGT
GTTTTTACCTGGTTGTGATGGCTTGTGGAGTGCTTTAAGTTTGCCAAAGTAGAGAGATAATAAAAGGGTGAACATGGGATATTATTTTTTGTGAGGTGAA
TATGAGAGCAATGGATAAGGGGAGTGTTGAGATGGTTGGCTCACAAAGAAAATTGGATGAGGCATCTTATAGCTCATCAACTTGTAACACTGGCCAGGAA
AGTGGGTGGGCCATGGTACTTTTGTCCAAATTTAGCCTAAAGAAGCAGCGTAATGGACTCCTTTCTCCTTTATTTTCTTAATGGAGATATTTCCAAAGTT
GCACAAATGATATGTAAGCATTTAAAACAGAAGAAAATCAAATAATAGATGAACATTCAATTCAAATGTATATAAACCAGACTTTAGTTTTAACACCAAT
TTAACAGACTTTTAATTGTCAGAGCTTTCAATACAAACTAGATAAATCCTAAATATTTGACAACAAACAACACTACTTGTTACAAGTTCACTACTTGGAA
ACTAATACTTCATGGCAAATAAAGGCTTTTTTTGCCTTTTCCTCTCACAATCACAAATGCATCTGTCATCTTTTTCCACAAGATTCCACCTGCATAAACT
GCGCCATCCGCCAGCTAGCCATATTCTACCATCCTTCCAATTTTTGAGTTTCGTCTCAAATTCTCTGTCAGCAGAATCGCGAATTATCATTCTTGAAGGG
AGTTCAAGTTTGTAATCTCTCACCACATCAATTGAAATGTACTGGAATTAGGAAAAACGACTTTGTTAAATGAGAATGCTAGAATATTAAATTATAAAAT
CATTCACTAGAATATTTAGTTATAGGTTTTTCGCTACCAGTTGATCTCTCCTTTTTGCTCGTATTTTCGCTACAAAGTAAGGATTTTTTGGCTGAGTTGC
GCATCCACTTTTGAATATATCTGCACCATATTGGTCGGGGATATCCCTCACCTTGCAAGCAGTGTCTCTTTTGCATCCAACTGAATCAAGAAAGTTAACA
AGTCAGATTCACAAATAAAAATTTCATGCAAACTCAGTGATACACCATCCGTTTCATTTTACATGGTGGTATCTTATTGAACATGAACTTGAGAATGAAA
GACGACTTTTGACACATATCAGAAGTGTTGATGTTTAACTTTATTCTTCCCTGCTGTTCCAAAAACTAACAAACAGTGCCCTTAGGCTCGTTTTGTCAAT
GAACCAAGCAACCAAACCTTTTAAATTCTTTTTAGCACTTGTAATCCTAAACATTTTATGGCATTTATATGACTACAAGATATCATGTATAAATATACAA
AGATGTAGTTTTGTAGTAACATACTAACAAAAAGAAAAATTGAATTGTGTAGAAGATGAAATAGACGAGTAAATATAAAGATCTTTGATTTGTGTCGACC
TTCTGAACGTGACACATTTTTCTTAAATGTACCAGTCCTTTCATCCTCTTCAGTTTCTTCCTCCTCTTCATCATCATTATCTTCGTCTTCGTCTTCCATG
TGTCTGGCCACATCAACAACGTGTTTAAATAAAATTTCAGAACAAGATTGTTATGGATATATTTCCAATACTTGATGACTATAAACAACACGCAAATGAT
ATATAAGCATTTAGATCAAACTTTACCCCCCCTGAGCATTTAAAACAGAAGAAAACCAAATAATGTTTGAACATTTAAATGTAAATTTACCAGACTTTAG
TCTTAACAATAGTTAATAGACTTAATAGACAGAACTTATTAATACAAATTAAACTAGAACTTTTATCATCAAACAACAGTACGTAGTCTTAAAACCTACC
AACTTATAACAGCACTTAAAGCCATAAAAATTTGAAATTCTATGTTAAGTAGCAATAAACAATTTTCTTATACCTCGTGTTGGAGTTGGAAACTGATCCT
TCGTGAAGAACTTGAACTTGCAAGTAGAGGACTTTATTGCCTTTTCCTTTCACAAATTCGCAAATACACTTGACATCTTTCTCCACAAGGTTCCACCTGC
ATAACTTTGCCATCCTTCAGTTAGCCATATTCTACCATCCTTCCAATTCTTGAGTTTTGTCTCAAATTCTCTGCCAGTAGAGTCGCGAATGGTCATGCTC
GATGGGAGATCAAAATTGAAGGCTTTAACCACAACAGTTGGAACGTACTGCAATTAGAATAATTTTTTTGTTAAGTGAGAATGCTATAAGATTGAACTAC
AAAATCATTCTCTAGAATAGTTATAGGCTTTTAATTACTAGTTGGTCTCTCCTTTTTGCCTGTAATTTCGCTATAAAGTAAGGATTTTTTGGCTGCGTTG
TATGTCCACGTTTGAATATATCTGCCCCAAATTGGCCATGGCTGTGCCTCACCTTGCGAGCAGTGGCTCTTTGGTATCCAGCTGAATCAAATAAGTTAAC
TGGTCAGGTTCACAAACAGAGATCGCATGAAAACTCAGAGATACTTCATCCGTTGTATTTCATTGAACATGAACTTTAAAAAAGAAAGAAGATTTTTGGA
ACATATCAAAAATGTTAGGCTCATTTTGTTAACAAACTATATCTTTTAGAAACTTGTAGTCTTAAACATTTCAAGACATGAATATGACTACAAGATCATG
TCCAAGTATACATAAAAGATGTCATTTTTTTACAGTAACATACTAACAAGAAAAGAACTGAATTGCATATAAAATGAAGCAGGGTGTAAATATAACGATC
TTTAATTTGTGTCTACCCCTTTGAACATGACTCATTTTTCTTAACTATGCCAGCCCACTCATTCCATTATTTTCAGAATTTTCATAGTTTCCTTACTTAG
TTATCATATAGCAATGAAGAATGAAGATAAGATGCAAAATTTAATACCAAGAAAAGCATGAAGATGGAAAATTTTCCTAAAAGAAGATTAAAGGAAAAAC
GGAAAAGGCCTAAAATACCCTCGAAGTATTGAAAATGATACACAATTACCCTCCATCCACCTATTGGCCCCCAAATACCCTTCACATCCACCTTTGGGTC
CAAATTTACCCCTTCATTAACAGACCAAAATTAAAAATAATTAAATAATAATTTTTAATGACGTGGCACTCAACCATTGGTTATAATTTAATTATTTAAA
ATAATTTTAAACCCACCCATTACCCACCCATTTTAACTAAACCCACCCATTTTAACTAAACCCACCCATTTTAACTAAACCCACCTATTACTTTTTAAGT
CAATATACTAGTGTTTATACTAATGGCTTTGATCTCAAGCTTCTGCATCTTTTTTTTGGTAGCACATTTTGCCACACCGATTGTGTGTATTCGCAACCCT
ATTAATCAAACACCTGCCCTTTTCGTGTTCGGTGATTCAGTTTTCGATCCTGGAAATAATAATTACATCAACACCACTACTAACTTCCAAGAAAATTATT
TGCCGTATGGAGAATCATTCTTCAAGTATCCTACAGGCAGGAACTCCGATGGACGCCTAATTCCTGATTTTATCGGTATATTTATTAGCGTTTTCCCCAA
TTGTTTGAAAAGTATTAACTGTGGTAGACCTGAACATAATTGTTGGTTGTATTTTGCAGCTGAATATGCTAAATTACCATTTATTCCGCCGTATTTTGAA
ATTGGGAAGAAGCATTTGGTACATGGAGTAAACTTTGCATCAGGTGGTTCGGGTTGTTTGGCTGAAACCGCTCGTGGCTTTGTAAGTCACAATATTTCCT
TTTAAACTTATTCTCTTACTTTTATGTAATTATTGTTTGAATTTGATAGTTAGATCAACTTTTTTATGAAATGTTTGTTTCCATTTGACAAGTTATAGAT
CTTCAAACTCAGTTGAAATATTTCTAAAATGTGGGAAAACTGTTGCAGAAGAAAGTGGGTGAAACAGAGTCGAAACAGATCCTCTCCAATGCTGTATATA
TTTTTAGCACTTTCAATAAGGATATGGTTGCCCCTTTATTTGCAAATTCATCTTTTCCATATTCCGATACAGAATATTTACAGATGATTATGGGCAACTT
AACTTCTGTTTTAAAGGTAATATTGATCTTTTCTATTTCTTTCGATTTAATTTACTCGTTGTAGTTTTTATCAAATGAACAAGTTATGGTAACTATTTGT
ACTCTGTTTACAGGGAATTTACAAGGAAGGAGGGAGAAAGTAATAGTTTTTATCAAATGACCAGTAGTATGTTGACTTAAAAGTAATAGGTGGATTTAGT
TAAAATGATGGGTTTAAAATTATTTTAATTAATTAAATTACAATCAATGGTTGAGTGTCACGTCATTAATAATTATTATGTAATTATTTTTAATTTTGGT
CTGTTAATAAAGGGGTAAATTTGGTGGATGTGAAGGGTATTTGGGAGCCAATAGATGGATGGAGTGTAATTGTGTACCATTTTCAATACTTCAAGGTATT
TTAGGCCCTTTTCCGAAGGAAAAAAATAGAGCAAGAAGTTAATACTGTTTCTTTTTTACAAAATTTGGAAGGTGGGACAAGACCACCATAATAATACTCC
CTTGGTCCGAAATTGTTTGTTGAAAATTAATTTGATTAATTTTTAAAGCTAAATTAGATCATATAAATTTGATATTTTAAATCAAAAAATTAGATATTTT
AAAACTATATAAAAAATACTATAAATTATAATATTTTGTATATTAATATGATCAAAAAATACATCTTAAATTGTTAGTCAAAATTTTTATGATTTAACTC
TAAAAATAAAAACTATGACAAATAATATCGAACGAAGAGAGTAATAATGAAAGCAGCTAAAAATAGCGCCTGCAATACATAAAAGGATTGACAAATGAGC
AAACTATACAGGGCAAACCACAGATTTTTATGGCGTTCAAATGTGATAAACTAAAATGCAAGACATTATGTTTCCTCCTTTTGAATATTAACTCTATATA
TAGTTAAATTGTGTGATTTAATATAAAAATATAAATATCGGAGTACGTATTATTTGCAAACATTATAATCATATTATATTTTTAAATGCAACTTATATAT
ATATGGTTAATGTACATGATTTTATGATACCAGAACAGTTTTGTATTTGTCATTTCGTGCTTGATATCGATAATGACATATAATTAACTTTTAAGTGATA
TTAAAAAGACATAAAATTTCAACATCCTTTTTATCACCAACAATTTTATTGGTTCAATATCAAGTAATTTAGCATTGATTATCAATTAAGGAGTCATGTC
AATGCTAAAATTAATCATCTCAGTAGCGGCTAGATCAAATATGTGTCTATTGCAGACATAAATCCCTTACTACTCACTTCCAAACTTTTAATAAATGTAT
AATCACTGTAAATTAATGTAAAATAATATTTATTGTATATGAAATACAATCGATATAAAATAAAGAACAAATTATAAAAATCACAGATCTTTAAGGTAAA
ATTATAATTTATCTCTTAAAAGTTTATAATTACAGAAATCCCTCAAACGAATACAATAATATAAATGCCGATGCATTAAAAAGAGGGTCGGGTACATTAA
TAGCCAAAAATCAAAACGTTGATATATTAAAAAGAGGGTTGGATACATGCACCGATACATTAAAAAGAGGATCGAATACATTAATGGCCCAAAAAATCAA
AGCGCTGATACATTAAAAAGAGGGTCGAATACATTAATAGCCAAAAATCAAAATATTGATACATTAAAAAGAGGGTCGGATACGTTAATAGCCAAAACTC
AAAATGTTGATATATTAAAAAGAGGACCGGATACATGCATCGATACATTAAAAAGAGGATCGGATACATTAATGGCCCAAAAAATCAAAGCGCTGATACA
TTAAAAAGAGGGTCGAATACATTAATAGCCAAAAATCAAAATGTTGATATATTAAAAAGAGGGTCAGATACATGTGCATGTGCCGATACATTAAAAAGAG
GATCAGATATATTATTGGCCCAAAAAATCAAAGCGCTGATACATTAAAAAGAGGGTCGGATACATGATACATTAAAAAGAGGGTTGGATACACTAATGAC
ATTTTTTACTTAAGAGAAAAATAAGGGATTTTGGAGATTTGTAAAACTTATAGGGGATAATGGTAATAAGTAAACTAAAAGGTGAGATTTTTGTAATTAT
TTTAAAAATGAATATGTAATATAATTTAAAATAAATACAAATTACAATTCTTTGTCACCCTCTCTTGATCTCGCTCACCTTTCTCCCCTATCTCTTGAGA
CCTCGCTTACCTCTCTACTTCTTCTCTCGATCTCACTCGTCTCTCTCCTCTTAATATGTATTCATTTCGATACAAACTAGTTTGTATTTGTATTTTTTAC
CCTCCAAAATTCATGAAATACACTTTCTCCTCTCTCGATCTCATATTTTGCTCGCTGTTCTCATCCTTCATCTCCTAACATTGCTATTATTCATAGTTAA
GCGAGCTATAACTACAGAGCCCTATTTAAGGTCTAAATGTTTGCTATTTTGAAAAAAATCTCTAAATAAAAACGATACTAATTATGTTTATAGCAATTCA
ATAAACATAAGAAGCATATTTTAATACAAGTCCTAACCTCACCTTAACATTTCATCACAATCACTTAATGTAATTGGCAACAAGCTAAACACTAGAACAA
TAAGATCAATAAAAACTTTGTTTGTGAAGCTCTCACTTTTAGTATAGTTTGGTGAGTAAGATTAAATCAAATTTGCTCAATTCTTTTATCAGAATAATAA
CACTGATAAAAACATGAATTTTATGGGGGGAAAAAAAAGCTTTTAGCATTATACAAAAAGTATTGGAAAAAAATATTGACAAAAATGAAGATTATTTTAG
TCAATATTATTGTTATGATAAAAGAATTAATAAAATTTCCATTTAATCTTACTCATCATGCTGAACTAAAATAAGGAGCTCCAAAAGTAAAGTTTCTTCC
TATTCTACTATTTAATTTGTTCGCTAAATTTTATTAAGTGATTATGACAAAATAATTCGGTGAGGTTAAGATTTGTATTAAAGTTCACTTCTCATGTTTA
TTGAATTGTTATAAACATAATTAACATGTTTTTTATTTATGAATTTTAACTAGTTTTATTATTTTTTTCTGTTTATCGTTATAATATATATATATATATA
TACTGGAATTAAAGTGATCAATTTCATTTTCTTAACATTCTTTAATTTTTTTAGAAAGATATCTATTTCTTTAATTTTTCTCAGTTATTTAATTCTTAGT
TAAAGGAAACATATAAGACTATGATAAATAAGAATTGTTTGAAACTTTAATAAGTTGAAATAAATAAAGAAATTTGCCATAATTATTTTGACCTAATTAA
TAAAGTAGTTTTTTTTTTTGTAAGAAAAATATATGGAAAAAGATGTTGTAGAAAGCCGATGAACTACCTATGTGGGCGACCTCTTCTTCTTCTGAATCCA
GTCATGACGACGGAATCCGGCCACGACGACGGTAAAATGATCGAGTCTTACTCCCGTGCGACGGTAAAAAAAGATTGAATCTAAGGATTTTTAGGTTACT
AATTTTTCTTGTTTCTTTAACTGGTCATTCCTTGTTCTTGAGTTGTTGAATTAATGTTTTGCTGATAATCGTACTCCCTTTCTTTTTATGTTAAAGCTCG
GTAAGATGTCCATGATTCTTGAATTCTTGATTGAAGTTTCCGGTTCTTTACTTCTTGAATTGATGTTCCTTAATTCGTTTTCTTCCCATTGTTTTACTTG
CTTGTTCACATGGTTGTGGCCAGATCATTTCAGGTTATGCACATTGTAGTTTTTAGAGAATCCTAGTCAATTTTCTTTGGCATGTATCAGAAGAATCATC
TCATTCTAAAGTGTCTTTCTAGGAGGCACTTAGAATGTGAAACTACTATGTGATGGAAGGGGGCTTGCTTTTCTTTCATCAGCATTGCATTCAGCTTTAC
AAATATCTGCTAGTATGTTTCTGCACTTCTTTTATATCTATTTGTGCCTTCTGGTTGCTTTAAATGTTCTTTCTCTATCAGGATCTCTTGTCAATTGCCA
ATGTGGCTGAGCAACATGAATGTGGGATTTCTTAGGGCCTCTTCAAGGTATATATTTCTTGAAGTTCGTTACGTCTTATACCATCATTTCATATAGATCT
AGGCTGTTTTAACCCTAACTAATACCTGATTTATGTCTATGAAGAACTACTCTTTTGGAAAATCTTCTTCAGTGATTTTTCCAGCCAACATGTTTGTTTT
CTTTATCTATGTGATGAGTCTGGTATTTACATTACCTCTATATACTCGTATACATGGAATGTGGTAAAAGGGTAGTCCTGTTGATGACTGCAATAAATAA
ATCTCCATTTAATGGCCAGAATAACTTGTACCGAGTTTCTTTGCATAGGATGCAGCGTGGGTATCTGATTCCAACTCCAGATAATGCTTAATTCTTGAAG
TGAGTTGGGAAGTCTGCTTTGCTAAATTATAAAGCTTAAGTTTGAACAAAGTATTGTACTATTAAATCACAATCTGAGGCGACACACTTTGTTACTTTTC
TTCACATCATATAATCTGCAGTCATGAACTTTAAGTAGTGTGCTTATTTAATTGTGTTATAATAGAGTTAAATTCTTAATTCACATATTGTTCCGTGTTG
GAGAAGTACCATATGTATTATATTTGAAACCTATAAATAAATAGGCGTGTTGTATTCACTGGATTGTCAAGTTATCAATATGTTTTTTCTTGTCTCATTC
TCTCACATGATATCTGAGTCCACCTTTGTAGGGTTTCCTCGTACTGATAAGTCCACATTCAAATACATGAGTGAACCCCAAAAGTTGTTACACATGTGGA
AGGTTGTTGAGTTATATAAAAGTGGCGTATAAGGTCTTGACAACTTTATTTTTTTCTTAAGGTTTGCTCAAACTTTCACATGGCATCAGAACTCCTAGAT
CTTCATAGACCTCAACAGGGCAGTCTTATGCTGGTTTTCAGTCTAAGTTCCTTTTCTTTTCATAATTGTCATTTTCTTGTCCTTTCTTGGCACCACCACT
TCTTTCATAATTGTCATTTTCATAATTGCCATTTTCTTGTCCTTTCAAGGTTACTGACTAGGAAAATTATTGTCTGTTCTTGGCAGGGATTAAGTAGAAT
AATTGTTTAATTGTTCTCCTTTCTGGTGTATTTATGCATAAGAATCCTTAATGGCACATTCGATCTGTCAGCGTAGTGAATAACTACGTAAGATGATTAT
TTTTTTCCTTAATATACTTTTACGTCTTTCTCTGATTGCTTAAAAATGAACATAATGAGTGAGTAACATGGTATATGGTAGTTACTTAATTTGTTGTAAT
CTGATTGAACTCATCCTTTGTGACAGTTAACGTGGATGATTCTGTGGATGATATTGTGCGTCAATTTCGAGGCGTTTCTGATAGCTTGATGCGTAAAGTT
TTCGGCTATCCTTCATATTCTTCTTATGAACCTACTACCTCTACTTCAGACATAAATTTGTTTTGGAATGTGGAGAAATACATAAACTGGCTTTAACACA
AAGCAACTCTGAGTCAGTTAATAGCTTCTCTTACAATGATAACGGTGAAAAGATGGAAGCCACGGGGATGAGGAAGTAGGACCTAGTTCAGAAGACAATG
GGTGGCATTCGGACAATGAGTTGAATTCAAAAGGATTTACCCCTTAGGTGGTTTAACGTGACGTAGAGCCAATAAGTTCTGCGGTGGACTTGAAGAATGG
TTCTGTGCTCCAGCGTGAATTCTTCAGTTCTGGAGGATTCCCTGGAGACAAGTTTGGTAGTAGCTCCCAGTTAACAAGAGGTCCAGTTAACAAGGTATCT
CTTACTTCTTCCCCTGTTTCTACTTCTTTTGAATGGTATATCTTCATCGGAAATTTATTCTGCTGAATACATGAAGGATGACCAATAGACGTACTACAAG
ACATCTGAACTAAGAAATTGTTTCTTATCAGAGGGCTGCTAGTAAATATATATGAGCTCATCTTTCTTCTGCATATTCGGATATTTTACTTGTATGAAGG
AGTCGATTAACATGCTTTATTAAGGTTCATATTATGTGTCAGTCTGGTCTAATCTCATGTCTGGAATGCTCCCAGTTGGATTACTTATACGGTAGGGCCA
GGGTTTACCCGAGGATAACTTTCGCTTCAGATATGGGGCAATGAAAGGGTGTTAAAGTGATTTCAGTTTTAGCATGAGATATTTACAAGTTAGGTTCTTG
TCAGCCTTCTGAACAAATGATATCTACTGTATTTTATCTTATCTGATATATTTCAGTAGGGATGGCAATGGGGCTGGTTGAGTCTTAACCTGCTAAAATT
CAACCTGCCCCACCCACCCTACATAGCTTTTTTTTCTATCTTCAACCCACTCGCTTCACCATGCCCTATTTTAGTATCTGTCATTTTTTTCTTCGTTTTG
TTACTTTGCTAAAAAGACAAGTTTACAAATTATATATCCGGGCAGGGGAATTCTTGTACGATTGGGTAGAAAGGGGTAGATCATCATTAAGAACATGATT
TTAAGCAAGAAAGTCTTACTTTGGTCGTGTCATTTATTGTATTTGGAATATAATTGATACAAGATTAATACATAATACAATGTAAAAAAAATGCAAAATA
CAATTCTCTCTCCACCCTCTCATTACCTCTCCTCTCTCCTTCCTCTGTAGATTTCGCTCGCCTCTCTCCTCTTAATATGTATTCGTTTTAATACAAAATC
AGTTTGTATTTGTATTTTTTCTCCAAAATTCGTAAAAAGATACACTTTCTCCTTCTCTCCTAGGTTTTGCTCACCTCTCTCATCCCTGCTCCCCTAACAT
TTTGTTATTATTCATAAATAAGCAAAGTATAACTATAAAGTCTTATTTAACGCTTAATATTTGCTATTTTTGAAGGTTTCCTGTTGCTAATTATGTTTAT
AGCAATTCAATAAATATAAGAAGCAGACTTCAATGCAAGTCCTAACCTCACCTAACATTTCACCAATAATCACTTAATGTAGCATAACAATAAGATTAAA
GTAACTTTTGAAGCCAACTTTTAGTATAGTATGATGAGTAAGATCAAATAAAACATTCTCAATTCTTTTATTAGAACAATAATACTAACTAAAACAACCT
TCATTTCTTTTCAACAAACAACAATATTTTTAGTCTTCAAAATTTGTCAATAAACAACAATGCTTATTTTCATCAAATCTGTCAACACATAATAATACTT
AAGCCCTAAAAATTAAAATGCTATGATAAATAGTAATAAACTATTTTATTTATTTATTGTTGCGATGAGAATTTGATCCTTCATAGAGAACTTGAATTTG
CAATTAAAGGACTCTGCCACATTTTTCCCTCACAAATTCACTAATACACCTGTCATCTTTTTCCACAAGATTCCACCAACATAAATTGCGCCATCCGCCT
ACCAGCCATGTTGTTCCATTGCTCCAATTATTGGCTTTTGTCTCAAACTCAATTCCAACAGAGTCGCGAATGATCATTGTTGGAGAGAGTAAGTTTGTAG
TCTCTCACCACATCAATTGGACATACTAATTATGAACAAAGACTTTGTTAAATTAAAATGTTACATAAATTATTCTCTAGATCAATATATAGTTATATAG
CTTTTAGTTACCAGTTGATTTTTCATTTTTGCTCGCATCTTTGCTACAAAGTAAGAATTTTTTGACTGAGTTGTGCGTCCACTTCTGAATATATCTGCAC
CATATTTGTCATGCACATTCCTTACCTTGCAAGTAATAGCTTTTCAACGTCCAGCTGAATGAAGGAAATTAAGATCAAGTTTACAAATAGATATCCCATG
AGAACTCACAAATACTTCATTTGTTTCATTGTACGTGGTGATACTTTATTGAACATGAATTCTATGAAAAAAGAAAACTTTTGGCATTATACCAAAAGTG
TTAGAAAATGGTATTTAAATATATTCTTCTCTAGTATTCAATAAAACCTAGCAAAATATTCCCTTAAGCTCGTTATGGTAATGAAACAAAAAACCAAACC
TATTTTAAATCTTTTAAAACTTATAGACTAAAACATTTCATGTCATTTATAAGATTACAAAATCATATCCAAATATACAAATACGTTATTTTTGCAGCAA
TGTACTAACATTTATAGAATTGATTTACATATAAAATCTAACAGATAATTAGATCTAAATATTTAATTGTATTTACCTTTTGAAGATTACGTGTCTTCTC
CATCTATTTCATTCTCCTTCCTCTCCACCACTTCCTCTTCCGTTTCATCCTCTTTCCCTTTATCCACCTCCTCCTCTGTTTCTTTCTCCTCCCCCTTCTG
TTCATTATTTTCTAACTCTTCCTTTTCCACCTCTTCTTCATCATTATCCTCTTCTTCTACCATATAGTTATCAGTGCTATCATCATCAAATGAGATATTG
TTGTTATCTCTAGTCTTGTTTTTCTCTTTTGGTTCTATACTTTGTCGATGTTCAACATTTACTTCTTCCTTCTTGTTGTCACATTTTAGCTCCATTTTTT
ATACATCCATTTGGTCCAAGTAATTTTATGTCAACTATTTCATTGCCATCATAATCGAATATTATAATGTTTCCAAACTCTAGACTGTTGTCCTCGATAT
ATTTCTCCCATCCATTCAGAAAATACAAATCTTTTTCTATTTTGATTGCTCTTACAGGCCACCACATATTGCTAAACTGATTCCTAAGGAAAACCTTCCT
ATGTTGCTTTCCATTCTTGTAATTTGTATATGCTGTGGGAATTTTCTGTGAAGAAAAAACATATTTTCGAAAAAAAGGGTAAAAACAATATTAATTTCTT
TAAATTAGATTTATCGTATCATAAAAAGCAACAAATATGAGTAGAAAAAGTAATTTAAATAAACTCAAAGTTAGGGCTTTTTGATGTTAGAAATATTAAA
GAAATAGAATACTTGTATGTGCATATCTAAATTTTCTCTCCGTATTCATTGCCCAATCTTCATAAAGTGTTTAATTTACACAAAAAATAATTAAAAATGG
AGTTAGCAAAAATAATAAATCAAATACTTGTATTTGCAAATCTAAATTTCACCAAGACTTTTCATCTTTTCATATCCATTGCGCACATTTTCAAAAGAAA
TAAATTCAAGAAACTAAGTCTCAAAAATCTATTACCACAAGGAGAAAGTGTATTTACCATCCGTTTAGCATTAGTTTGAGGATTGAAAGCCTTGAGAAAA
CCCTTTCCCATGTTCACTTTTGTTGTCAAGCAATTAGAGAATAGAAGAACTTGCCACACAACCTAATTCCTATAAGCGCCTTTATATGTTGAAGTAGTGT
CATTACTCAAGCATATATATATATATATAAATTGATGTCAGACCTAAAAGGTGTATTTATGTCATTTATGTAATGACATAATTATATATGAGTTTTTCAC
ATATTTCACGTGGATATATCAAATAATAAGTCACAAAATTTTACGGTATATTTGTACATTCACCTTTATTTTATTGTTACAAGCGTTAAAAGTCTTTAAG
CTTCAAGCAAAAGATCATATTTTTTGGATCCATGCAAAAGTTCGCACTTTCAACACAATTTCTAACACTTTTATCTTTTTTGGATCCATGCAAATGTTCA
CACTTTCAAACCAACTTTTGACACTGTCACGTTTATCTTTTTGGATCAATGCGAAATTTCACGCTTCCAACACATCTGATACCAACAATTTATCGTTTAC
TGTCACGTTTATCTTTTTTGGTCCATGTAAAAGTTCACACTTCAACATAACTTTTGACACCAACAATTTTAACTTTTTCTGTTACGTTTATCTTTTTTTG
GATCCATGCAAAAGTTCACACTTTCAACTCAAGTTCTGAAACTGTTGGTGTCAGAAGTTTGTGTTGAAATTGTGAACTTTTGCATGGATCCAAAAAAGAT
AAACGTAACAGAAAAAGTTAAAATTGTTGGTGTCAAAAGTTGTGTTGAAGTATGAACTTTTACATAGACCAAAAAAGATAAACGTGACAGAAAACGATAA
AATTGTTGGTATCAGAAGTTGTGTTGGAAGCGTGAACTTTTGCAAGGATCCAAAAAAGATAAACGTGACAGTGTCAAAAATTGTGAATATTCGCATGGAT
CCAAAAAAGATAAACGTGACAGTGTTAAAAATTGTGTTGAAAGTGTGAACTTTTGCATGGATCCAAAAAAGAGCTTAATAAGTCATAATGTCATATGATC
TTTTGCGTGGAGCTTAAAGACTTTTTATGCTTGCAACAATAAAATAAAGGCGAATGTACAAATATACCGTAAAATTTTGTGACTTAGTATTTGATATATC
CACGTGAAATATGTGAAAAACTCATGTATAATCATGTCATTACATAAATGACATAAATACACCTTTTAGGTCTGACATCAATTTATATATATATATATAT
GCTTGAGTAATGACACTACTTTAACATATAAAGGCGCTTATAGGATTTAGGTTGTGTGGCAAGTTCTTCTATTCTCTAATTGCTTGACAACAAAAGTGAA
CATGGGAAAGGTTTTCTCAAGGCTTTCAATCCTCAAACTAGTGCTAAACGGATGGTAAATACACTTTCTCCTTGTGGTAATAGATTTTTAAGACTTAGTT
TCTTGAATTTATTTCTTTTGAAAATGTGCGCAATGGATATGAAAAGATGAAAAGTCTTGGTGAAATTTAGATTTGCAAATACAAGTATTTGATTTATTAT
TTTTGCTAACTCCATTTTTAATTATTTTTTGTGTAAATTAAACACTTTTTGAAGATTGGGCAATGAATAAGGGGAGGAAATTTAGATATGCAAATACAAG
TATTCTATTTTGTTGTTTCTCAAATAGTTATAAATATTTTTAACATCAAAAAGTCCTAACTTTGAGTTTATTTAAATTACTTTTTCTACTCATATTTGTT
GCTTTTTATGATACGATAAATCTAATTTAAAGAAATTAATATTGTTTTACCCTTTTTTTCGAAAATATGTTTTTTCTTCACAGAAAATTCCCACAGCATA
TACAAATTACAGGAATGGAAAGCTACCTAGGAAGGTTTTCCGTAGGAATCAGTTTAGCAATATGTGGTGGCCTGTAAGATTGATCAAAATAGAAAAAGAT
TTGTATTTTCTGAATGGATAAGAGAAACTTATCGAGGACAACAGTCTAAAGTTTGGAAACATTATAATATTCGATTATGATAGAATTGAAATAGTTGACA
TAAAATTACTTGGACCAAATGGATGTATAAAGAATGAAGCTAAAATGTGACAACAAGAAGGAAGAAGTGAATATTGAACATCGACAGAGTATAGAACCAA
AAGAGAAAAATAAGACTAGAGATAACAACAATAGCTCATTTGATGATGATAGCACTGATAACTAACTATATGGTAGAAGAAGAAGATAATGATGAAGAAG
AGGTGGAAGAAGATAATGAACAAGAGGGGGAGGAGAAAGAAACAGAGGTGGATGAAGGGAAAGAGGAGGAAGGAGAATGAAATAGATGGAGAAGACACGT
CAGCTTCAAAAGGTAAATACAGTTAAATATTTAGATCTAATTATCTGTTAGATTTTATATGTAAATCAATTCTTTAAATGTTAGTACATTACTGCAAAAA
TAAAATATTTGGATATGATTTTGTAATCTTATAAATAACATGAAATGTTTAAGTCTTTAAGATTTAAAATAGGTTTGTTTCATTAACAAAACGAGCTTAA
GAGAATATTTTGCTAGGTTTTATTGAATACTAGAGAAGAGTATATTCAAATACCATTTCTTGACACTTTTGGTATAATGTCAGAAGTCTTCTTTTTTCAT
AAAGTTCTTGTTCAATAAAGTATCACCACGTACAATGAAACAGCTTGAATATTTGTGAGTTTTCATGGGATTTTTATTTGTAAACTCTTATCTTAATTTC
CTTTATTCAGCTGGACGTCGAAAAGCTATTACTTGCAAGGTGAGGAATGTGCATGACAAATATGGTGCATATATATTCAGAAGTGGACGCGCAACTCAGC
CCAAAAAATCCTTACTTTGTAGCAAAAATGAGAAATCAACTGGTAACTAAAAACAATTATTATATATTGATCTAGAGAATAATTTTATGTAACTTTCTAA
TTTAACAAAGTCTTTGTTCATAATTACAGTATGTTCCAATTGATGTGGCGAGAGACTACAAACTTAAACTCCATCCAACCATGATCATTCGCGACTCTGT
TGGAAGAGAGTTTGAGACAAAAGTCAATAATTGGAGTAATGGAACAACATGGCTGGTAGGCGGATGGTGCAATTTATGGTGGTGGAATCTTGTGGAAAAA
GATGACAGGTGTATTTGTGAATTTGTGAGGGAAAAATGTGGCAGAGTCCTTTAATTGCAAATTCAAGTTCTCTATGAAAGATCAAATTCTCATTGCAACA
ATAAATAAAAGAAATAGTTTATTACTATTTATCATAGCATTTTAATTTTTATGGCCTTAAGTATTATTATTATGTATTGACAAATTTGATGACTATAAGC
ATTGTTGTTTGTTGACAAATTTTGAAGACTCAAAATATTGTTGTTTGTTGAAATGAAATGAAGGTTGTTTTAGTTAGTATTATTGATCTTATAAAAGAAT
TGAGAATGTTTTATTTGATCTTACTCATCATACTATACTAAAAGTGGGCTTCAAAAGTAAAGTTTTACTTTGATCTTATTGTTCTGCTATTTAGTTTGTT
TACTAAATTACATAAAGAGTCTGTTTGGTATGAAGGAAAACATTTTCTGTGTTTTCCAATGTTCCCATGTTTGATTGGGACAAAAGTTTCGAAAAATGTT
TTTCAAATCAACTCATTTTTTCCTCAAAAATAAGGAAAATGATTTCCTTCAAAAATTAAGAAAAATATTTTTCATAACTCTCCGCCAATTTTAAATTATA
TTTTTTTGGGGAAAAACATCAATTTAAATAAATATTTTCAATTTCAAAATTTTATTTTTTCACCTGATCCTTGACCCTTCCCCCACCGGCCAGCCCCCCC
CCCCCCAAAAAAAAAACCTCCCCAAAAAATTAATTTTGTTTTTTAAAAATATTTTCAACTTCAGATTTTTATTTTTAAACTCCTCCCTCTCTCCCCCCGG
CCAGCCCCCCACAAGTATTTGATATATTATTTTTCTAACTCCGTTTTTTAATTATTTTTTTTGTTAAATTAACACTATTTGAAGATTGGGCTATGAATAA
GGGGAGGAAATTTAGATCTGCAAATACAAGTATTTTGTTTTGTATTTTTTCAAATAGTTACATTCTTAAATATTTCTAACATCAAAAAGTTCAAACTTTG
AGTTTATTTAAATTAATTTTTCTACTCATATTTGTTGCTTTTTATGATTTGATAAATCTGATTTAAAGAAATTAATATTGTTTTTACCTTTCCGAAATTT
TTTTTTCTTCACAGAAAATTCCCACAGCATATACAAATTACAAGAATGGAAAGCTACCTAGGAAGGTTTTCCTTAGGGATCAGTTTAATATTGTGTACTT
TCACCAACATCATTTTATCAGAATTCGTAGGTCAATTTATTCAATCAAGTATTAGTTAATGTAAGTATGAACGTTAGCCAGCTATATAATAGTTGATGAA
TCATCCGTCGATACCATTCTTCTGTTCCTTGACGTGAACCTTTCAAAGTGCACATTAGTGCGCGTAACATTTCAATCTGTCGGATTAAAAAACTTTCTGC
AACTACAAATTTCTAAGCACAAAATAGTCTCCATAGGGAAATTTGACTTTAAATAAGTTCCTTCACATTTGCGTCGTCACATTGTTACCCTTTACCTACC
AGTTCCTAGCCCATACCCCTGAGATTTCTTATCAATGACAGTGTTGTTGCCGGATAATGTATCAAAGTTTGACTTCCTTATGGAAGTATGCTCCTCTATT
CATTTTGTTTTTGGTTCGCTTCTTCACATAGGTTGCGTAAATGATGTGTTCATAACCAACTTTGTTCTGCTGTGAATTAAATTATAAATTATTGACATCT
GCTTTCCCCATGGTGAATGTGATTTCAATGCTGGTTGTTTGTGCAATGTATCAAAGTCTGCCATTGCTTCATCTTCATATTGATTTTAGAGAATCATTCC
ATATTGTCTCATAAACTCTTTGAGCCTGATTTTCTTATGAATGTACTTGTCAAAGGAGGCTTATACTCTCCGACCGTTGAGTTGTAGACCTTCCAGCCAT
AAAACTGCCTGTCATGTAAGCTAGAATTCACTTTTTGCGGATCTCATACAGTGTCTGAATCCAGTCGTTCTTTTGCTGATAAAATCGGCTAACCATCTTC
GACCCTGTTAAACCAAATTTCTCATCGGTTGCCAACTTAAATATACACTTGCTGAATTTTTTCATGAAATTCTCATGCAACTTTTCTAGATCAACGGGTA
TTTTTTCCAGCACATGCCAAACCACAAAACAGTGACTTGAACATGGAAAAACTTCTTCAAGAGCGAATCTGAGTGACTTATCTTGATCAGTGATTATCAC
TTTTGGAGCCTGTTCTAAGCCACGTCTTCATTAACCTCACACATCACTAGGCATATACTAATGTCAGTGTGTATAGCTTAAAGCCGTTATATAATATGAG
AGGAAGATAGATTGATGGAACATACCAAATTATATTAGTCAGAGGTGGTTCCTCCATTAGCTTTGTATTTGGGGAAGGGCACCATACCATTGTCAATAAA
GAAAAGATCACTCACAAGGATTTCATCTCAGGGGGTGACTGGAAAGAAGGGTGGGATATGTAGCGAAGTCCTGGACGATCTCAAACCTGGTGTTGAAAGG
ACAGATATCATGAATACTGCACCTCCAGATTTGTTCAAGTCAATAGAAACTAAAGACATTACATCTTTGAGGGAAAATGATAACCTGGAGAAGGATGAGG
ATGGCTCCCTATTTGAAAGCTCATCAGATTCCTTCATCAACATCATTTTACAAGTACACTCAAACCTTATATCGAAGAACAATCAACTATCCTGTTATTT
TTTATTGCCCTCATGAAACTAGCGTAAGTGCTATGCCAATTATAATACACATATCTTTATTATGTAACACACTAGTATCCCTCAATAATTTTATCAGACT
ATAGTTGGATGCTTATTTAATCAAATTTGTATTATTTTCAGTTTCAACGCTAAATGTCTATAAAACATGTTTTTGAGACATCTTTAAAGATATCTTCCAA
TCTCAGAATTCAGCAAAAGTGGTGATGTAACCATTCAACCTTAACTTTAACATTTGTTTGCCAAAAATATCATCTGTTATCGCATCTTAAAACACTCTAA
AATTGCAATTACAAAATTGTATGCTTAAAAAAGGTTACCTGGCCGACTCCAACTTAAAGTAAGATCATCAGCATGTATAAAATGTGTATAATCAAAGTTC
ATTAATTTATAAATATCAAACAAAACAGAGTATTAATTAAAAAAAATTGCACGCTAAATCTCATAATTAAAAACTTCATTTTTATGTGGTCTGAGGCTGA
ATCATTAAACTATAGAAATTTAATCCATCATATTAGTGAAGTGTTTTCCCAACTTTTGACAGCGGCTATTTAGTTTAGAGGCAAGACAATTTCATGGACA
ATTTACGTAGCACCCAGTTTTTCCCTCCCTCTACCTGTAATTAGATTTATTTTAGAATAAAAAGTTAACAAATAAAAGGTTTTCCCCTTTAAGTTCAATC
TACTCCAAGACACCCATTCACGTTAACCCCTCTCTGCCTTCCTTTTCAAACAAATAATTGATCTTTGTCTAACCATATGGCCTAAGTATACTCAAACGTT
AGAGAGCACCAAAAAATGGAATGATGATGACTGAAAAGGGAACCACATTATAACACTTAAAAAACAGGTCAAATAATGCCGCATTATACAAAACTTCCAA
AATTCAACACATTATATAGTCTAATATCACCCACCTAAGGCCCATGCAAAGAGCAGGTGGATTCCCTAGTATATAATATATAGGAAAAATAACTTAAATA
CACAACTATAATTTTTACATTCTCCAATTTTCCCTACTTTTTTTAAATATTACATAATTTTTTTTTTAATTTTAGTGTAAGTTTTTAAATACATTACATT
CTCTCTCTTATAATACACATTTATCCATTTTAATGTCTATTTTTTCTCCATTAAAACACTCAACCTCTTAATTAAATCAGTTTTTGAATTTTAAATTTTA
TCCATTTAAATACTCAACCTTTTAATCAGCTTTTTGATTTTGAATTTTTAAATTTAATTAATTTTAATTAAAAGACTAAATTTTGAAATTTTGAATTTCA
AAATTAAAAAAAAATGAAATTTAAAAAAGTAAAAATATCAGGAAGCACGACAACTTCCATTAACTTCTACCGTCTTCTTCTTACTCCATCAAGTTTCAGT
TCTTTTTTTCCTTAATCATCTTCATTCATCTTAACCCATTACATTTTTTTCTTTTCTTCTTTTTATTCATAATCCATCATCGTCTATTTCTTCCTAATCT
GTAATAGTTTGAACCCAGCATCTTTTTATTATTAATCCATCATCAATTCGTATATTCTTCCCTTTTTTGTTTTTGTTAATTGTTCTATTACATCATAGTA
ATGGATCTGTTAATTAATAGAAGGATATATGATTCCGACGATAAAAATTGGAAAGAAAATAGGAAAAAGTCTTTGCATGATCCTATCAATCTTCAGAAGG
ATTCAAACAAAGACTCTGGCGAAACATCAAAATCAAAGGTTGTCAAAATACAACAAAAAAGGAAAAAAAAGCAACAAACATTATTGTTAGGCCTACATTG
TCTCGGGTTAGTATTTTGGCAAAACCAAATGATACATATATACCAAACACACACTAAAAATAACTGATACATTGGCTAAACCGTATGTATCATGTACAAT
ATGTTACCCTATAATCCTTAAATTTTACATGATATTTAGGTAAATTGAATAGCATATTCATATGAATTGGTATTATTTTTTAAAAGTAAAATTATTTACA
GTATATTTCAAGAAAAGCATAACAAAAAAAGCATTACACAAGTTAAATTATATAAATTCACATGATACATGATTTATAGTCATTGTAAAGTACACAATAA
CCTCAATAATATTTTTGTATTTTTTATCTAATGGAGATGTATCATTGTGCAAACCAATGATACACACTAAAAAGTACATGATACATTAGATAAACAATGT
GTACCAAAAACACACAATAAAAGTACATGATACACTAGATAAACCATATGTATCATGTACATTATGTTACCTAATAATTCTTAAATTTATATATCTTACT
GTAGCATAAGATTTATAAAATTTTATATATTTAAAACAAACATTGACACAAGTATATTTATCAACACCAATAATAACAAAGTATTTATAATCAAAAGCAC
GACTTCAAATTTAATTACCACATGTTTGTAAGTTTATTTATCTAAACACAAAGTGTTCAATTTGCAGTTGTAATGAAAATTGAAATTCATTAAAATGTTT
ACGTTATAAATTATTCTTGATATCATAGAAACATTACGACTAATTCACTTCTCTTTTGGGTAGAAAGTACAAGTTCTTCTGTTGTGCCCTTCTTGTCCAC
ATTGTCCACAACAGTTTGTGTTCACCGAAATCTTTTCATCTGCATTCTTTCTTCTTCTTTTTCTTGGTCGTCCAGATGATATAATCTTTGATATTTAGGT
AAATTGAATAGCATATTCAAAATAGATGATATAATCTTTGATTTTCAAATTTTGAAATTAATATCCAATTAAGTGTTGATTTAATGCTGATTAATGATCT
GTTACCACAGATTAAACTGTTTTAGTAACAACATTAACTTTACCGTTTTTCTCCCCTATTTTTTCTTAACAGTTTTAAATTACCATGTATCATTTATCAT
GTATCACTACAGTCTAAAGTATCACGGCTCAACAAATTTAAGGTAATTTTTGTAATTAGTAAACTTGTCGGGGCAGAATGTAATTATTGAATTACACTAT
GAGATTCCTTAAATTTATACTAATATATATACAAAATACAATTCTTTGTCACCCTCTCTCGATCTCGCTCGCCTTTCTCCTCTCTCTCTAGACTTCACTT
ACCTCTCTACTTCCTCTCGCGATCTTGCTCGTCTCTCTCCTGTTAATATGTATTCATTTTGATATAAACCAATTTGTTTTTTTCCCTCCAAAATTCATGA
AAATACACTTTCTCCTCTCTCAATCTCATATCTCACTCGCCATTCTCATCCCTCATCTCCTAACATTTTGCTATTGTTCACAGTTAATCAAGCTATAACT
ATATAACCATATTTAAGGCCTAATGTTTGCTATTTAAAAAAATCTATAAATAAAAAACGATACTAATGTTTATAGCAATTCAATAAATATAAGATGCAGA
TTTTAATACAAGTCCTAACCTCACCTTAACATTTCATCACAATCACTTAATGTAATTTAGCGAACAAGCTAAACAACAGAACAATAAGATTCTTCTTGCT
CTTAGCTGCTTTCTCCGCGTCACCTGATATGGCAAGCGGACCTGAAAGACCGAAAAGAACTGTTTAAAAGTCTCTTGCAAGACTTTTTCAAAATAAAGTC
TTTCTATTCTACTATTTAGGGCTCGTTTGGATGAGCTTAATAAAAGCAGCTTTTAAAAAGTACTTTTGAAAGTGCTGAAACTTATTTTTAAAATACGCAG
TTATGCGTTTGGATAAAAGTGCTGAAGTTAAAAAAAAGAGTTGTTGATGTGTTTGACAAATAAGTGCTGATAAACAGCTTTTTAAATCAAAATGTCTGAA
ATACCCTTAAAAGCTGTTAACATAATAAAAGTTAATTAATTTATATTTTACAACCATAAATAATTATATTTTGCTATCATTCACATATTTCTTTCTCATC
ACGAATTATTTATAAGAGGAATATAAACTTATTATAGATTTTAAAGATATATAATTTGAATATATTAAAGAACGATTTAAGATTTTATTTTAGTTTCATC
CATAGGTAGTAATAATTGTCTATCATTCACATATTTCTTTGTTATCACAAATTATTTATAAGAGGAATATAAATTTTTATTTAAGTTATATGTGCAACTT
ATTTTACATTTTAAAAATATATAATTTGAATAGATCACTTGAAAGATTTAAGATTTATTTTATTTTCATTCATTAGTAATAGTAATTGTCTATCATCCAC
ACGTGAAAAGGGAAAAATAGAAGAAATAGATGTTAGGGTTATGTGGGTAATTTAGAGATTGTATAAAAATATTAAGGGCAAAAAGGTAAAAATGTGGTCA
ACTTAAAACAGCTTATAAGCTGGAAAAAAAAATACCTCTACCCCAGCTTTTAACTTTTGGCTTAAAATAAGTTATTTTGAGTATTGTCAAACAGCTAAAT
AAGTCAAAAACCAGCTTTTAAGTCAGTTTGACCAGCTTTTAAGTTGAGCCAAACAGACTCTTAATTTGTCCGCTAAAATTTAGTGATTATGGCGAAATGA
TTCGGTGAGGTTAGGACCTGTAGTAAAGTCCACTTCTCATATTTATTGAATTGCTATAAACATTACTAACATGTTCTTTTATTTATGAATTTTGATATAT
TAATTCGAACATTCTCTTTTGTGGTAAGGATCTCTAATTCCTTAATTTTCTCATATATTTAACTAGTAAAATAACTCGCCTTTCGCGCAAGAATTTATTA
TCTTGGAATTTATAATATAATACTTTTTATGTCGTAATTTTACTATATTTAGAAAAATTACTTTTGAAATGTTCTATGTATAAAAATATTTTTTTTAAAA
AAATACTTAGAAAAGAGTGGCCGCTTAATTTTTTAAAGAAATTAAGAAACTCAATTTAAAAAGATTTTAACAGATAAACCTTTGAAAATTTAGAGAAAAG
AGTAAGAGGTTCTTATTTCTACTTTAAGAATGTATTAGTACTTAAAGTAGCCACAAACACGTGGTTATCCAACGACTTAGGTTAAATATATTTTGACTAT
TTTCTAGAAAATGATTAATTTGAGAAAATAATTATGCAGAAAATAATTTTTAATTTCTAAGAAAAGAGGATATTGATTGAAATATTTGAATTAAATTGTA
GAATTTTACGAAATTAGATTGATTAAAACTTATTTAATTATTTTTTTAAAATAATAATTTGAACCAATTTTAGTTAATTAAAGTATGAAAACTATGAAAA
TTAATTATGAAAAAGAAATTGACTATAGATTTTCAAATAAAATACACGACTTGATAAAATAATTTACTAATATGAAGAATATAGTCATCTTTTTGGGAAT
AATAATTCTAAAGTTAGAGTTAATAAACAAAACAATAAATAATCATAATTAAGAGCGGGGGGGGGGGGGGGAGTTGAATTTGGACTCCCTTTTTGGGCCA
ATTTCATCGAAATTTTTAGGTTTTAACCTAATTCCCATTTTTGTATACACTTGTCGTGTATCGAGTGTATATAACCTATTTTTCTGCTTTCTAAGATCTG
TTTCAGTTTCCAATTTCTCCGGACATCGAGGAGGCTAACTCAAGAGGAATTCAACTCAACGAAATGCAGGGATGGAATCCGAAATGGACTCAGATGGAGT
TTTCACATGCAAATAAAGAGTAATAAGATTAGAATTATTATAATCAATAATTAAATGAGAAACCAATAAACTATAAATTAATACTAAAATCTAAGAAACA
AAATAAAAATGATGTCATTAAATAAATAAGCAAAACTAATTAAGGAAATTTACTATATTTTATGGAAAACAAGTATACAAAACACATTCTTTAATAAAAG
AGTCTATGTGGAGCAAGTTGGATCATTATAGGAAAATAACTATTTCTTGTCAATCAACATGCCAACACATAATGAAAGTAAAGTCACATGTGAATGTCAA
TTCATGATGAAAGTAAAGTCAAGTTAAAGGAAAGAGTGGAGCATGCACTTTGCATAAGAACTCTTTAACAGTCTAGGAAAAATTAAAAAAAAATAATAAT
AAAAAGTTAACCCAATTAGCTCAACTAGATAGTGAAACACATACACACAGAGAAAATCGTATTTGAAATGACAATACATGACCATGGATGTTAAAGCAAA
AATCAAGATGAATACATAGTGTGGGTTCTCGAAAATAGGATAAGAAGAATTTTAAACAATTACTCATACTTAAATGGTAAGAAAATCACATCTTTGCAAT
AAGGGATGTAACCCATTTAAACATTCATACTAAAAATTAACAAAGGAAAAAAAAAAGAACTAGAACTCAAAATGACGAGCAAAGAGCTCAATGTTAAATA
ATCAACATTATAAACCTTGAGATGTTGAAAACAACATGTTTTAATATAAAAGATGGGAAGAACATTTATAAAAGAGGACGCGTTACATTTTTCGGGCAGC
GACTGGGACAAACGAGCTGAGCGAATTCAACTTCGGCCACTAACAGGTGAGCAAAATAACTTGAAAGAAAAATAAAAAATTTGAAGCTCAAACCTTCATG
GGTTTGATTTCACAAAACACTATATGCTCTAACCTTCTAAATCCTATTCCCTCTCTGTCTTTTTTTTTTTCCGTTCCTCTAAATGGTATCAATACCATGT
ATTTATAGCAAAAATAAAGGCTTTAATTCAAAATGATCGTTTTTAGGGGTAGATGAGAGATTGATAGAAATAATAGAGGAGAAAATGAGTAAGAGAAAAA
CATGCCCCAAAAATTCATATTTGATGTGATATCTTCCGATTCAGATTAAACTAGGACAAGATTTTATTTAAGCCAAAGTCAACAAATCTAACCCGAAGTC
TACAATCTTAGAAATTTAGAGAGGGGCTGACAAAAGTAAAATTGCTTAGATGAAGATATTAGGGTTTTTTGCTTGACTTTTACGTCTTTGGGAAGAAAAG
TGAGAGGAGTGTGTCTTTGTTTAGAGGGTTAATTTAGAAAAGGAAAAGAGATAGGAGAGTGTGTTATTGTTTATGCATGCAAATGTGCAAGAAAAAGAAT
GACCATTATATTTAAAATTTTACCCGTTTAGTTTCTATTCTAATCAAATTAAATTTAAATATAGCCAAATTGAGTCAAATAACTAATTCGGCCTAAATTA
AAATAAGATAAATAATCATCAATTAATTATTTGAGCTTCTTAATTCAAACAAAACAAAATAATTATCAACACTTATTCATCACTTAAAATATAGAATTAA
TTATACAAAATAATAAATTTCACCAATTCAAAGAAATAAATGTGTAATTATGTTAAACACTATTTTAGGCTATTTATTAAATATTCTTATAAAATATGTA
AATTGTAAAAACCAATATGTAAAATAATATAGTTAATTATGATAAATACTAACCAGAATTTATTAGAAAAAGATTTTAAAAAATATAAATATTTTAAAAA
AATTTCCAAGACAATTATTTCAAATTGTTTGAAATTTGAAGAAGTTTGATAGTAGACTCGAATTGCATAGGTCAAAATTGGGTGTCAACAGTCCCGTGCG
ACAATAGAAAAGATTGAGTATGAGGATTTTTAGGTTACTACTTGTTCCTGATTCTTGAACTGGTCATTCCTGGTTCTTAAATTAATGTTTTGCTGATAAT
TGTACTTCCTTTTTATGTTAATGTCCATGGTTCTTGAATTCTTGAATTGAAGTTACCGGTTCTTTAATTCTTGAATTGATGTTCCTTCTTTCGTCTTCTT
CCCATTGTTTTTCCTTATTTGTTCACATGGTTGTAGCAAGATCAATTTTAGGTTATATGCATATTATAGTTAAATTTTATTGTTTTTAAATTGACGTTCA
TGGTTTCTTGAATTGTTTTCGATTTAGGTTACTACTTTTTCATATTTATGTTTCTGGTTCTTAAATTGATTTACCTAGTTATTCAATTCTTGAATTCATC
GTTCATGAATTAACTTACCTGGTTATTGAATTCTTGAATTCATGTCCTGCATTTAATGTTAATGTTCAATTGGTAACTTCTTTTTAGTAAAAGTTCGGGG
ATATGTTCCTAGTTCTTGAATTCTCGAATTGAAGTTCCCGGTTCTTTAATTCTTGATTAAAGTCCCGGGTTCTTTAATTCTTGAATTGATGTTCCTTAAT
TCGTTTTCTTCCCATTGTTTTACTTATTTGTACACATGGTTGTGGCCAGATCATTTCAGGTTATGCACATTGTAATTTTTAGAGAATCCTAGTCAATTTT
CTTTGGCATATATCAGAAGAATCATCTCATAAAGTCACTCTAAAGTGTCTTTCGAGAGGCACTTAGAATGTGAAACTACTATGTGATGAAAGGAGGCTTG
CTTTACATAGGTTGGAAGAAATTTCAGGAAAATTACCAAGTAGAATATGTGGACTTTCTCATGTTTAGGTAGAATGACACTACTATTTACAGTAAGAATT
TTCAGCAATATTGACTTGAGAGAAGTATGAAGTTAAAACCATGGAAAAAAATCAACAAGCTTCGATATATGATGAGTGAAGGAAGCGAAGAAAGCAAGCA
AAATAACCTTACAGTTCTAAATTCCCTAGTCAGACATGTGACGGCACAGGTTTATGAGCAAAGATGGTGGATCCATTATATCAGAATTCTGTAGTGCAGA
TTTTAGGAATGCAGTACTTAGCACTATGAGTGCTTCGGACATGGTGATTCATGGTGAGAGACATCATCGTCCAAAGCTTGAAGTGCATGGTTTGTGAGTT
CTCCTTAATCGTTCCCTCATACTCCAAAATATGTCCCAAGAACTCAAGCTGGCAACCATAAGAAAGAAAAACTTGTGCGGTGTTGTATAAACAATTCATG
ATCTATGGTCTCAAATTTTGATTGTTTTACACACAATTACCTGTGACTTATGTCTTCTAAGATTCTTGTTTCTCAATACTGTTTCCTCCTGCCCCAAGTG
TGCACATTTTGAGAAGCTGGGCTCAAAATCTTTTTCTGTATATTCAATTGCAGTTACTGATGCCAATAGCAATTTTTTTCTCATATTCCTCTGGCTCTGT
TTAGCTGATATCCTATTGGGTGCCGTTTAAGCAGATGCAGGAACTTCGAGAGATTGCATAGTCACCTGAAGGATATTCCTATTTACACATTGCATTTGCT
TCCTAAGAGGATATTTTCGTCTCTTACAGAAGATACATTCTTTCATCAGCATTGCATTCAGCTTCATAAATATCTGCAAGTATGTTTCTGCACTGCTTTT
ATATCTATTTGGGATATTTGTGCCTTTTGGTTGCTTTAAATGTTCTTTCTCTATCAGGATCTCTTGTCAATTGCCTATGTGGCTGAGCAACATAAAATGT
GGGTTTTCTTAGGGCCTCTTCCAAGGTATATATATCTTGAAGTTCATTAGGTTTTATACCATCATTTCATTTAGGTCTAGGCTGTTTTAACCCTAACTAA
TACCTGATTTATGTCTATGAAGAACTACTCCTTTGATAAATCTTCTTCAGTGATTTTTCCAGCCAACATGTTTGTGTTCTTTATCTATGTGATGAGTCTG
GTGTTTACATTGGATATTTTTACATCTATATACTCGTATACATGGAATGTGGTAAAAGGGTAGTTCTGTTGATGACTGCAATAATAAATCTCCATTTAAT
GGCCAGAATAACTTGTACCGAGTTTCTTTGCATAGGATGCAGTGTGGGTATCTGATTCCAACTTCAGATAATGCTTAATTCTTGAAGTGAGTTGTGAAGT
CTGCTTTGCTAAATTGTAAAGCTAAAGTTTGAACGAAGTATTGTACTATTATATCACAATCTGAGGCGACACACTTTGTTAGTTTTCTTCACATCATATA
ATCTGCAGTCACGAACTTTAAGTAGTATGTTTATTTAATTGTGTTATAACAGAGTTAATTCTTAATTCACATATTGTTCCGTGTTGGAGAAGTACCATAT
GTATTATATTTGAAACCTATAAATAAATAGGCGTGTTGTATTCACTGGATTGTCAAGTTATCAATATGTTTTTTCTTGTCTCGTTCTCTCACATGATATC
TGAGTCCACCTATGTAGGGTTTCCTCATACTGATAAGTCCACATTCAAATACATGAGTGAACCCCAGAAGTGGTTACACATGTGGAAGGTTGTTGAGTTA
TATAAAAGTGGTGTATAAGGTCTTTGACAACTTTATTTTTCTCTCAAGGTTTGCTCAAACTTTCACATGGTATCTGAACTCCTACGATCTTCATAGATCT
GAACAGGCAGTCTTATGCTGGTTTCATTCTAAGTTCCCCTTCTTTTCATAATTGTCATCTTCTTGTCCTTTCTTGGCACCACCACTTCTTTCATGCAAAA
AAATAACGGCATAATACATATATTAGACCCTAAACTTGGCGTCAAATTTTAACTTTGACGTCCAACTTTCATAATGCACAAACAAGCACTTTAACTATCC
AATTTTTAAATAAATAAACACATGAGTCCTACATGACACAATACACGTAGGACAAAAAATGACATGTAGGATGACATGTGTGTCTATTTGTTCAACTTTA
TATAAGTTTAAGTGTCTACTTGTGCACACCCAAAGTTGAAAGGCATAAATGTGATTCGAATACAAGTTAAAGGGAACATTTATGTATTATAATAAGGTGG
AGGATGGATTATGTTCAAGGCTATTGACTAGGTAAAACTATTGACTGTTCTTGGCAGGGATTTGAGTAGAAAAATTGTTAAATTGTTCTCATTTGTGGTG
TATCAATACATAAGAATCCTTAATGGCACATTCAATCTGTCAGCGTAGTGAATAACTACATAAGATTATTTTTTTCCTTAATATACTTCCACTTCTTTTT
CTGATTGTTTAAAAATGAACATAATGAGTGAGTAACATGGTATATGGTAGTAACTTAATTTGTTATAATCTGATTGAACTCATCCTTTGTGACAGTTAAC
GTGGATGATTCTGTGGATGATATTGTGCGTCAATTTCAAGGTGTTTCTGATGGCTTGATGCGTAAAGTTTTCGGCTCTCCTTCATCTTCTTCTTATGAAC
CTACTACCTCTACTTCAGACATAAATTTGTTTTAGAACGTGGAGGAATACATAAACTGGCTTCAACACAAAGCTACTCTGAGTCAGTTAATAGCTTCTCT
GACAATGATAACGGTGATAAAGATGGAAGCCACAGGGATGAGGAAGTAGGACCTAGTTCAGAAGACAATGGGTGGCATTTGGACAATGAGTTGAATTCAA
AAGGATTTACCCCTTGGTGGTTAAACGTGACGTAGAGCCGATAAGCTCCGCGGTGGACTTGAAGAATGGTTCTGTGCTCCAGCGTGAATCTTTCAGTTCT
GGAGGATTCCCTGGAGACAAGTTTGGTAGTAGTTCCCAGTTAACTAGAGGATCCAGTTGGAGTGCCACCAGAGGTATCTGTTACTTCTTCCCCCTTTTCT
ACTTTTTGTGAATGGTATATCTTCATCGGAAATTTATTCTGCTGAATACATGAAGGAAGACCAATAGACATGCTACAAGACATCTGAACTTAGGAATCGT
TTCTTATCAGAGGGCTGCAAGTGAATGTATATGAGCTCATCTTTTTTCTTCATATTCGGATATTTTACTTGTATCAAGGAGTAGATTAACATGCTTTATT
AAGGTTCATATTAGGTGAGATAAAATCAGTCTGGTAGTCTCATGTCTGGAATGCTCCCCCAGTTGGATTACTTATACTGTAGGGCACTAGGGCCAGGGTT
ACCTGAGGATATGTTTCGCTTCAGTTATGGGGCAATGAAAGGGTGTTAAAGTGATTTCAGTTTTAGCATGTGAGATATCTACAAGTAAGGTTCTTGTCAG
CCTTCTGATCAAATGATATCTACTGTATTTTATCTGATATATTTCAGTAGGGATGGCAACGGGGCTGGTTGAGTCTTAACCTGCTAAAATTTTAACCTGC
CCCACCCACCCTACATAGCCTTCTTTTTCTATCTTCAACCGACTCGCCTTACCATGCCCTATTTTAGTATCTGTCATTTGTTTTCTTATTTTTACAAATG
GAGACTTTATATTGCTTTATCAAAAGTTCAATGCTACTGTAAGTAAAATTATAAATCCAAAAATTTCTGAACACATAGTAAATAGTTCTCCATTACGTTC
ATTAGTATTTACTATTTAGTAATATAGTTTTGCTAACCAGTCTAAACTATATGGCTCTTTTTATGTATTGTACGACATGATTCACTAAAAAATATAAGAG
AACTATAGAAAGAAAAAAACCCAGCTGTAACATAGAAGGAAGTAAAATCCTCCCAGGCACGTTCCGAAAACTCTTTTCTCTCCTACTTTTTAGGGGTGCA
GAACACCTTTTCTGGTGACTCTTCAGCCGGATAAAGATCCTTTATTTGTCTAATTTCTCTAAGCTACCACCTTCGTGGTAACTTCCCGCCTTTCACTCCG
TCAACCAGCCAAAGGGATTACAAATTATATATCCGGGCAGCGGATAAATCATATGACATTGTTGAGAGCTATTCTTCTTCAGAATTCTGGTACGATTGGG
TAGAAAGGGGTAGATCATCATTAAGAACATGATTTTAAGCAAGAAAGTCTTACTTTGATCATGTCATTTAATGCGTTTGGCGTCCAAAGCCAATGGTAAC
AGAATCAATAGATGGAGGATGAAGGATCACCCTTCCAACTACTTTTGCTCTCAGAATTTAATAGGGTAGGGGGGTTCATCAGCATCATAGCAGTCCAAGG
TCAACGGAGGTATGTCATTATTATACCAGAGTCTGTATTTAATGGGGGTTGAGAGATGTTGGCACAGAAAATTGAAGTATTCATTAATAGGAGGGGTCCC
CCAATACTGAAGGAAATTTTACTTCAACCAAAGAGGAGCTCAACCTTTGCAGAATCTATTACAAGAAACCGATGGCAGTCAAAAAATGGGAATCTGGAAG
TTTCAAACAATGAAAACAGATGTATCGAGATTAGTGGTTTTTCTGGTCTTTCGGAGAAGGACATACTCAACAGATGTTTTCTGGAGATTGCTATCCTGTC
CCCGGGGTGTCAAGCAAATGGGGTATAACACAGTTGGTGTCTTCGACATGAACGGGTTTCAATTTCTTTTCGAATTCCCCTCTCGATCTTTAGCAGAGAA
AGTCAAGCTTGGCCAGTGGAGTATGCAGCAAGCTACACTTGACCTTTCATGGTGGACTGAATTCTAGTTTATTTATATTCGAGTGTCAACCATTATCTGG
TCTACTTCTGTAACAAATGCTATGTTTGGTTGGAAAACTTGGAATGACCATGAGTTCACTTGCAAAACACTGAATTGTTTATGGATTTCTCTGTTCATCC
TATATATTTGAATTAAATCTAGCTTTATAGATTTGGTGTTAAAGACAAGGCAAACTGCTATTGTGATGTGGAAAAAGCCTTCTAAAAGAGCAATCTTTGT
CAAGAGGTTTCATTCTACAGTCACTAGTGAACTGGTAATATTCTGCTTCTGTTCATCATTTACAAGCTTATAAGTGAAACCCAGCTCATTTTCGTGCTGT
TTTTTCCTTTTCTATTGACTCTCTTAATTTGTAGAGGACCATATGATTTCTTTGGCATATATCAGAAAATTTACCTGATAAAGCCACTCTGAAGTGTCTT
TCTGGAGGCACTTGGAACGTGAAATTACAATGTGATGGAAGAGGGTTGCTTATACACAATGGTTGGAAGAAACTTCAGAAAAATAACCAACAACAAAATG
GGGAATATCTCGTTTCAAGGTAAGACGGTGCTCTGCAATTCACAATAAGAATTTTCAGCAAGAAAGGACTTGGAAAGACAGGTGAAGTCAACAAACATGG
TAAAAACCAAAAAGCTCCAATATATGGAGGCAGCAAGCGTAAAAGGCCAAAAAAATACCCTCACACTTCAAAATTCCCTAAACAGACTCGTGCTAACAGT
GGAAATGGCGCAGGTATGATGATTTAACTCCTACCCTTCCAATTCTTCTTGCTGTTGTTGAAAGTTAGCATAAAATGCAGTGATAGCGATCAAATTTAAA
CTTTCATCAACTGGAATTTCCTTTGCAGAAGACCTATTTTAACATGTGATGTACTAATGGACTACTATGTTGTATTCCCTTAGAAAAAGAGCTGCACTTG
AGAAAGAAGACGACCATCTCACAGGTCTCACTCCAAATATTCCACAATTTGTGAAATGCTTGAAAGGCTATAATGTGAAAAAGTCCTGGTGCTTCCTGGT
AAGTGTTATCTTGAAGTAAAACTAGTTCATGCTTATTAGTCTCTGTCACCATTAATCTATGAAATGTGAATGTATGTAAACCAAATACTAAAAACTTCTA
ATGCAGTATGTTATTTCCGTGTGTAGCCAGATACATTTGTCAATAAATCTATGTTCATGTTGATGATTTCTAGACTGGTAAACTGTTTTTTTATGTGAAC
GAGACTGTCAAGGTGATTTCTTGAGTGAAAAGAACTGCTAAAATGATTTTTGGTGTGAACTTTGGCTTCATCATTCTATCGGCTATTGATAAGCTTGACA
AAAAACGATAAAATTGTTGGTGCCAAAAGTTTTGCTGAAAGAACCAAAAAAGAGTTTACTAAGTCATACGAACGTTTGAATTGAGCCTAAAGACTTTTAT
GCTTGCAACAAAAAAAGAAAGGAGAATGTGGAAATATACCTAAATTTTGTGATTTATTGTTGATATATACCCTCATTAAAAATGTGGCCGACTCATTTGT
AGCCATTCTATTACATAAATGGCACAAATATACTTTTTTCGTCTTATACCAGTTTATCTATATGTATACACACACGCTTATAGGTAATGAAACTCCTTCA
ACATTAACGACACTTGTAGAGTTTAGGTTGTGTGGTGAATTCTTCAACTCGCGAGGGGTGATCTTTGAAATTATCCCTAAAGAATACGATGAAAAATAAA
TGCAAAATACAATTATTTTATTTGGAGTGCAATTGATACAAGAAAAATGCAAAACCAAATTTATTGTATTTGGAATATAATTGATACAAGATAAATACAT
AATACAATGTAAAATAAATGCAAAATACAATTCTCTCTCCACCCTCTCTTTACCTCTCCTCTCTCCTTCCTCTGTAGATCTTGCTCGCCTCTCTCCTTTT
ATATGTATTCGTTTCGATACAAAATCAATTTGTATTTGTATTTTTTCTCCAAAGTTCGTTAATAGATGCACTTTCTCCTCTCCCTAGATCTCTCTCACCT
CTCTCATCCCTCCTCCCCTAACATTTTGTTATTATTCATAATTAACAAAGTATAACTATAAAATCTTATTTAAGGCTTAATATTTGCTATTTTTGAAAGT
TTCCTTTTGCTAATTATGTTTATAGCAACTCAATAAATATAAGAAGCAGACTTCAATGCAAGTCCTACCCTCACCTAACATTTCACGAATAATCACTTTG
GGTGTGTTTGGTATGGAGTAAAATATTTTCCATGGAAAATGTTTTCCTAGAATATGTTTTCTTGGAAAACAAGTAGATTTTGGACTTATTTTCTCATGTT
TAGTTGGTGAGTAGAAAATATTTTCTGGAAATGATTTTTAGTGTTTGATTTATGAATGAAAAATGTTTTTGAGAGACATCTTTTATTTTTACTCGAGTAA
AAAATAATTTATGACATTGAAAATATTTTTTGAAGCCCACTTTTAGTATAGTATGATGAGTAAGATCAAATAAAACATTCTCAATTATTTTATAAGATCA
ATAATACTAACTAAAACAACCTTCATTTCTTTTCAACAAACAACAATATTTTGAGTCTTCAAAATTTGTCAACAAACAACAATGCTTATAGTCATCAAAT
CTGTCAATACATAATAATACTTAAGGCCATAAAAATTAAAATGCTAGATAAATAGTAATAAACTATTTTTTATTTATTGTTGCGATGAGAATTTGATCCT
TCATAGAGAACTTGAATTTGCAAGTAAAGGACTCTGCCACATTTTCCCCTCACAAATTCACAAATACACCTGTCATCTTTTTCCACAAGATTCCACCTAC
ATAAATTGCGCCATCCGCCTACCAGCCATGTTGTTCCATTGCTCCATTTATTGACTTTTGTCTCAAACTCTCTTCCAACAGAGTCGCGAATGATCATGGT
TGGAGGGAGTTCAAGTTTGTAGTCTCTCACCACATCAATTGGAACATACTGTAATTATGAACAAAGACTTTGTTAAATTAGAATGTTACATAAAATTATT
CTCTAGATCAATATATAATAATAACTTTTAGTTACCAGTTGATTTCTCATTTTTGCTCGCATCTTTGCTACAAAGTAAGGATTTTTTGGCTGAGTTGCGC
GTCCACTTCTAAATATATCTGCACCATATTTGTCATGCACATTCCTCACCTTGCAAGTAATAGCTTTTCGGCGTCCAGCTGAATAAAGGAAATTAAGATA
AAGTTTACAAATAAAAATCCCACGAAAACTCACAAATACTCAAGTTGTTTCATTGTACGTGGTGATACTTTATTGAACATGAACTTTATGAAAAAAGAAG
ACTTCTGACGTTATATTAAAAGTGTTAGGAAATGGTATTTGAATATATTCTTCTCTAGTATTCAATAAAACCTAGCAAAATATTCTCTTAAGCTCGTTTT
GTTAATGAAACAAAAAACCAAATATACAAATATGTTATTTTTGCAGCAATGTACTAACATTTAAAGAATTGATTAACATATAAAATCTAACAGATAATTA
GATCTAAATATTTAACTGTATTTACCTTTTGAAGCTGACGTGTCTTCTCCATCTGTTTCATTCTCTTTCCTCTCCACCACTTCCTCCTCTGTTTCATCCT
CTTCTCCTTCATCCACCTCCTCCTCTGTTTCTTTCTCCTCCCCCTTTTGTTCATTATCTTCTTCCTCTTCATTTTCCACCTCTTCTTCATCATTATCTTC
TTCTTCTACCATATAGTTATCAGTGCTATCATCATCAAATGAGCTATTGTTGTTATCTCTAGTCTTGTTTTTCTCTTTTGGTTCTATACTCTGTTGATGT
TCAACATTCACTTCTTCCTTCTTGTTGTCACATTTAGCTCCATTCTTTATACATCCATTTGGTTCAAGTAATTTTATATCAAATATTTCATTTCCATCAT
AATCGAATATTATAATGTTTCCAAACTCTAGATTGTTGTCCTCGATAAATTTCTCCCATCCATTTAGAAAATACAAATCTTTTTCTATTTTGATCACTCT
TACAGGCCAAGACATATTACTAAATTGATTCCTAAGGAAAACCTTCCTAGGTAGCTTTCCATTCTTGTAATTTGTATATGCTGTGGGAATTTTCTGTGAA
GAAAAAACATATTTTCGAAAAAAGGGTAAAAACAATATTAATTTCTTTAAATTAAATTTATCGTATCATAAAAAGCAACAAATATGAGTAGAAAAAGTAA
TTTAAATAAACTCAAGTTAGGACTTTTTGATGCTAGAAATATTTAAGAATGTAACTATTTGAGAAACTACAAAATAGAATACTTGTATTTGCAGATCTAA
ATTTTCTCCCTTATTCATTGCCCAATCTTCAAAAAGTGTTAATTTATATATAAAAAAAATTAAAAATGGAGTTAGCAAAAATAATAAATCAAATACTTGT
ATTTGCAAATCTAAGTTTCATCAAGGTTTTTCACCTTTTCATGTCCATCGCCCACATTTTCAAAAGAAGAAGAAAAATAATCAAGAAACAAAGTTCGAAA
AATCTATTACCAGAAGGAGAAAGTGTATTTACCATCCGTTTCGCACTAGTTTGAGGATTGAAAGCCTTGAAAAAGCCCTTTTCCATGTTCACTTTTGTTG
TCAAGCAATTAGAGAATAGAAGAACTCGCCACACAACCTAAATCCTATAAGCGCCTTTTGATGTTGAAGAAGTGTCAATACTCAAACATGTGTATATATA
TATAAATTGATGTCATACCTAAAAGGTATATATTCGTAAGTTCACTTTTCTTTTATTGTTGCAAGCATAAAAAGAGAATGGAAGAATACGCCGCACACCT
TAAACCCTATAAGCGGCTTGAATGTTAAAAGAGTGTCAAATACTCATGAGCGTGTATATGTATATAAGAGAAGGGGAGATTATAAGAATCTTAAGATGTT
CTCATGCATAGTGCATTCTAGTTTTTGGTGTTCTATTATTTATAAGTACTCGAAAATATCAATTTCCATATTTTTTTATAGTATCACGTAAAAATTGATG
TATGACGGAAAAGGTATATTTGCACATCCCCTCTTCTTTTTTCGTTGCAAAAGTTCACATGACTTAGGTGAACTCTCTTTTTGGCTCCATTCACACTTTA
AACACAACTTTTACCATCACCAAATTTGTCGTTTCTGTCACGTTTACCAATAGCCTACAGAACGATTACCAATCTTCTTCACACAAGAAACACCTTACCA
ACCATTGATGTGGCTATAACCATGTGAACATATAAAGGAACAAAAACTAGAAAGAAAAAAAACAAATGAAGGAACATGTCTAACATGGGAAGCTAAATGA
ATGTTACTGAACCTACATCACGACAAGATGTAGCGCAAAGTATGCGTCAGCACTTAAAAGATACTAAGTATGAAAATAGAAGAAAGTTGAATAAAACATA
TAACTGAATAAAGCGATAAAGCAATGATATAATCTAAACATGATAATAATAATGAAACATACTGAATATTGAGCTAATTGAATGCAATGACCAAGTACAT
AATACGCAGAGACTGAATACTAACTATACTGATAACCTGGTCAATGCACTAGAACTTCACAGTGGGATCTATTGTTAACCGTTATAAAACCACAAGAAAT
ATCCGTGGAGTCTGATGTATCGCCCCATCGAGAGGACCCAATATACCTTGCCAAAGGTATAAAGGCACGACTGACGTGTTCACTGAATATGTTGCCAACA
TAGGGAACTTATCCTAGGGGGAACGTAGTTCTAGGACTGAGGATGACTGACCCTTAGTCCACTCGGTATTAAGTCTACTCTCAACTGATTGTATAAATAA
CACAGTATGACTGAATAGCTTAAAATACTGACATGTTAACTCTGAAAATGCAACATTAATATACTGATAATGAAATATTCTTAACTTAGGCATGTATATT
AGAATAAACTGATTTAGCAAAGTGTAATTCATGAATTAAATGAATCTACACAACTAGGATTCTGAATTTCATGCAACGAACTAAGCAACAATTCCACGAA
AACTTGATAATCTGATTTGTATTAGTCTAACAACTAAATCTCAACATAAACTTTAAAGTTCTAGAATCCCCAGGTCTAGCATGATATAAAGAATCAAGAA
TGTGACCGAATACTAGGTACCTAATGGGTGAAAGGAACCTAGTAGTGAAATCCACATACCTGGTGACGAAATTCATGGAGAAATCTTCCAATTTCGAGGA
TAAAACTGAAGGAAACTTGATGCGTTCTTGGGGAAGTCTAAGTGGACTTTTTCTCGTTCTTTTCGTTCAACTTGATGAATTTTTGGAGATTGAGTTGACT
AGGGTAAGTTCTAATTAAGTTACTAGGCCAAAACTAATTAAAACTACGTAGTTTAGGAGTCGCATAAAGAATAGACCAGTGTTTTGGACGGCGAGAGGCG
ACAAGGGCCTGCCTCGCCACGCGGCGAGGCGCTAGCCTTTTTGACTCGAGGCGCCAATTAATACCAAAAATAAAAAATATTTAATTGCACATATAATATT
CAAAATTTCAATAGCAATTACATATATTACAAATACTATAATAATTACTATAGAAAGAATTAGGTCGCCATGGGCCGCCTTTTGCATACCGCCTCACCTC
AGTGGGGAATGGCGAGGAGGCCTCGCCTCGCCTCTCGCCAAAGGCGATGAGGCGCTCGCCATTCACAACACTGGAATAGACCAAACGACCCCTGACTTAA
AAGTTGTCGGGGCCAACCGGTGGTCCGTGGACTGACCCGCGGTTCGTTCAGTCAACCGTCGAAGGGCAGTGAAGTTGAATTGGGGTCTGAACCATGACCT
GGACCCATAGGTGCTGGCGTGGGTAGACCCTTAGACAAATTCTCTGGACTTCTCTTGGAAGGTCTTTCCCGCCTACAGTCCGTGAGTCAGTCTACAGTCC
GTGGGTGGTGCCCGTCGAGCACGTGCAACTTGTGAAATCTCCATTCTGGTCTTTCTAAGATACGGGGTGTTTCAGAAAATTGGTGGTGGAGAAGATAGAG
GTGATGCCATTTTTGAGTTGTGTGGAGCTTGGTGGATATTGGGGATTGAAATGGTTGTTGATGCAAAATGGGGATTTGAAATTGTTGTTGATGCGAATTG
GGGAATTGAAATTGTTGTTGAATGCAAATTCGGTGTGTTGGGGAGTATATGTCATGTAGAAGATTAAAGAGATGAGTTTGAGATTTATTTTGGTACGACT
TCATTTGGTTAAGTGGGTCGAGTTTGGGTAAAAACATGAAATTGGATAATTTTTAGTTGATTTGAGACTTAACGTCCAATTGAAGGGTATGAATGATAAG
TATAGTAACAACATGGGTAACAATTACTTTACTTTAATGTAAGGGTAAAGTCAGCTAATAATTAAAGTTGAAGGGTATTTTTGACCCTTTCCCCGCTATA
TAACCATGTGAACAAATAAAGAACAACAACTAGAAATGGGAAGCTAAATGAAATGTTGAATTTCATGATGTAAATCTCTTACTTGCTCCCAAACTTTTAC
TTTCATTTGCACTTGTGAATCAAGCAAAAATGGGATCAGTTCCCTTAAGTGCAGAACATCGATTCAAAAACCAGGTGACACAGTTAAATAACTATGACTC
ATAATAATAAGCCATGTACAAACATCACACAGTGCATGAATTTTCATATGTGGGATCGTTGTTTCACTTATGTACGCAAATTGAAATGTTCAATTACTAA
TTATGAAGAATTATATAGGTCTCTTATGTGCTGCACCCATTGGCTTCTGATTCTTAATTTGGGATCCACTTCAGGGACGGAGCCACCAGTCAAGATACGG
ATTTTGCAACCATTACACTTTTGGGTTCAGATGAAACCGTAGACTATATGGTACATCCACCACTGACTATAAGACAGTTTAAATACATTTATTGGTATTT
GCACCAGATAACTCTAGGTGAATCTGTTCTCTGGAAAAGTTTTCTAGACATTTTGTGCATCCTATTCAATTATATTCAACATTACTACATCTCTTATTGT
AAGCTGTAGGCAAAGTATTGTAAGCTTCATTTCAGCTGTAACATAAAGAAGTTAAACAACTCTAATTACTCAGATACAGAAAAAGGAAAATGAAAACAAG
GTTGTCCATGTTAGGCAGATCAGAGTTCAAATTCCAAAATAATATCAAATTGTAGCAGTTCAAAACTAAAAATTTATCATCTTTGTGCAGCAAGTTTCAA
CAGAGATTCTGAAGTATCATCGAAAACAGAAACCTTCAGCTCATTTGCATTGACAAGCTGACAAACATCCTTCCTTATTCTTATTATAACTCACAAACTG
TTTTCATCCTCCACAAAACGCGCGATATCCATTGTGTTATACAATTCACGTTCCACCTTTTTCCTTCTGAATTACGGAGGACAACTGTTGTCTTATTGTC
TGATTTTGGAAGTTGTTCACAGAAGGATTTTGGAACATACTGCATGACAAGTATTAAGTATTTGGTTTACATACATTTGACACACTTCATAGCTTATTGG
TGACAGAAACTAATAAGCATGAACTTGTTTTACGTCAAGAAAACACTTACTAGGAAACAGGACTTTTACACATTGTAGCCTTTCAAGCATTTCACAAATT
GAGGAATATTTGGAGTAAGATCTGTGAGAAGGTCTCTTCTTTCTCAAGTGCAGCTCTTTTTCTTGGAGTTGCATGTTCTAAGGAAACACTACATAGTAGT
CCATCACATGTTAAGATAGGTCTTCTGCAAATGAAATTTTGGTTGATGAAAGTCTAAATTTGATCACTATTACTGCATTTTATGCCAACTTTCAACAACA
GCTAAAAGAATTGGAAAGGTATGAGTTAAAAATCATCATACCTGTGTCGCTTTCACCGTTAGCAAGAGTCTGTTCAGGGAATTTTGAAGTGTAAGGGTAT
TTTTCTGGCCTTTTACACTGCTGCCTCTATCATATATTGAAGCTTGTTGATTTTTGATCATGTCTGTTGACTTCACTTGTCTTTCCAGTCCGTTGTTGCT
GAAAATTCTTGTTGTGAATTGCAGACTGCCATATCACATTAGCAGTTGCACTTGTGTTTGACACCAAATCTTTAAGGCTAGATCTAATTCACATATATAG
GATGAACAGACAAAAACATAAACAGTTCAGTGTTTTGCAAGTGAAGCCATGATCATTTAAAGTTCTCCAACCAAGCTTAGCAATTGTCACACAAGTTGAC
CCGATAAGGGTTTGACATTCAAATGTAATTAAACTAAACTTCAGAACTTGTAGTCTTATACATTTATATGACTACAAGATCGATCGTGTTGAGATATACA
AGTATGTCATTTTTTTCTTGCTCCTCCACAGCCGATTTTGAACCTTCAACTCATTGTCCTCTTTAGCGATGATCATACAGTCCATGCTTGACTGATTCTA
CCATAGCTTGATGGTTAATGATTTTGCTTGTGTATCTGCAATTTATCAAGTTAGCTCTCAATAAGATGCAGATAAATTTTCAAACTTGCAATATTTTGTT
GGATAAAAAAACTAGCCGGTCTTGCAATTGGTTTTATTTGAAGATACAACCAAATATTATCATCATGTTTGTATCTAAATTTATTTAATTATATTAAAGA
AAAATCATATGAAGCAATATGTAGAAGAAGAAGAAAAAAAGACAAGAATACATGCTTTATAAAAAGAAAAAGAAACAATGTAGTACTTGCCAAGACAGAG
AAAAAAATTATATCGTTCCTCCCCTAATATTTTGCTATCATTCATAATTAAGCAAATTATACCTACAGAGTCCTATTTGAGGCGTAATGTTTGCTATTTT
CGAACTTTTCCTAAAATATGTCAATTATGTTTATAGCAATTCAATAAACATGAGAAGCAGACCGAAATAACTTGTATGTTTACACCAAGTCAATGTAATA
CGTGATTTAATGAGGTAAAACACATGTAAATTAATTATGGTTAAGTACAATGAACTATTAATTTAAACACATAGCATGTATGTATTGACTTGATGTTAAC
AATCAGTGTGGCTAAATTTTACACCATAATTACTTAATATGATTTAGCGAACAAACTAAATAGCAGAGCCGTAAGATCAAATCAAAACTTTACGTTTGAA
GCTTCCACTTTTAGTATGGCATGATGAGTAAGTTCAAATAAAAACTTCATCAATTCTTTTATAAGAACAATAGGACTTACTAAAGCAATCTTAATTATTT
CATCAACGAACAACGATAATTGAAGTCTTGAAAAACAAACAATAATATTTATAGTCTTCAAAATTTGTCAACATGAAATAATACTTAAACATTAAAATGT
TATGGTAAATAGTAATAAACTAATCTCTTTTATTTATTATTGGGATGGGAATTTGATCCTTCTTGGAGAACACGAACTTGTAAGAAGGAGATTTTGCCAC
ATTGTTCTCTCACAAATTCACAGATGAACCTGTCATTTTTCTCCACAAGGTTCCACCGACATATACTGCGCCATCCGCCTACCAACCATATTCGGCCGTC
TTTCCAATATTTGACTTTTGTCTCAAATTCTCTGCCAGCTGAGTCGCGAATGATCATGCTAGGAGGGAGTTCAAGTTTGTAGTCTCTCACCACATCAATT
GGAACATACTATCATCAAGAATAAAGAGTTTGTTAAATTAGAATGTTGCATACAATCATTCTCAAGATCAATATATAATAATAGGCTTTATTACCTGTTG
ATTTCTCCTTTTTGCTATTATCTTTGCTACAAAGTATGGATTTTTTGGCTTAGTTGCGCTTCCACTTCTGAATATATCTATACCATGTCGGTCGATCATA
TTCCTGACCTTGCAAGTAATGGCTTTTCTGCGTCCAGCTAAATCAAGAAAGCTATGATCAGATTCACAAATAGAAATCTCATGAATACTCACAAATACTC
CATTCTTTTCATTTTATGTGCTGATACTTTATTGAACATGAACTTTATGAAAGGAAAAAATACTTTTGACAATAAACCAAAGGTTTTATTATAAAATGAC
ATTTGAATGTATTCTCTCTGATATTCAATAAATACTAACAGAATGGGCCCCTAGGCTAGTTTTATCAATGAACCAAACAACCAAACCTATATTAAAACTT
ATAGTCCTAAACATTTCATAACATCTATAAGATTAAGACTATAAAGTCATGACCAAATATACAAACATAATCATATAAAATGAATAAGCTGAGTAGAACA
AAATATTTAATAATTGTTTGTACCTTTTGAACCTGACCTCCTTTTCTTGAATGTTTGAGTCGTTTCAATCTCTTCTTCATCTTCTTCCTCCTCAGCTTCA
TCCTCCACTTCCTCCATAGTTTCTTTCTCCTCCCTGTCTTCTTCCTCTTCCTTTTCCACCTCTTCTTTAACGTTACTTTCTTCTTCTTCTATCATGTAGT
TATTAGCATTATCATCATCAGATGAACTATCATTATTATCTCCAATCCTGTTTTTTTCTTTTGGCTCTACACTCTTTCGATGTTCAACATACACTTCCTT
TTTCTTTTCACATTTAGCTCCTTCTTTTACACATCCGCTCATTTCAAGTACTTTGAAGTCAAATGTTTCATTTCCATCATAATCAAATATCATAAAGTCT
CCGTACTCTAGAGTGTTGTTATCCTCAATAAATTTCTTCCATCCATTTTCAAAATACAAAGCTCCTTCTATTTTGGTCACTCCCATAGGCCACATATTAT
TAAATCGATCCCTAAAAAAAACATTCCTAGGTAACTTTCCATTCTTGTAGGTTGCATAACTTGAGGGAATTTTCTGTGAAGAAATTTTGTGAAAGAACAT
CAATTTATTTAAATCAGACTGATTATATCATAAAAATAATTAATATCGAAAGAAAAAATATTTTAAAATATTCAACAATGTGGGTATTTGAGAAACTACA
ACATAGAATGTAAGGCATTCTCGTAGTTCTATTGCAAAATTACACTATCAACACAAAGTAATATGATCATTTGGAAATGATAGATACAATTTTATGACAT
CAATTGATTGAATAATTAATCATACACAATGCCAGTATAGATCTAGAAAATTTCAACATATATAAGTACTATGATATAATAATTACTTGCACCACACAAA
AACATTGTCCTCCCCTTATTCATAGCCCAAGCTTCAAACGTATACAAGACAATAGTCACATAGAAAATGAATTAATGAGAGGGAAAGTAAAACTTTAAAC
AACTGTAAAGGGTCATGATTTCTAAGTTTTGCAGATCTAAAATTTCACCAAGGCCTTTAAATTCTCATATCTGTTGCCCACATTTCCAAAAGAAGAAGAA
AAAAAAATGAAGAAACTTACCATTCGTTTTGCACTGGATTCAGGATTGAAAATCCTGAAGAAACCCTTTTCCATTTTCGCTTTTATCGTCAAACTATAAG
AGAATGGAAGAATACGGCGCACAACTTAAACCCTATAAGCGGCTTTAATGTTAAAAGAGTGTCAAATACTCATGAGCGTGTGTGTATATATATAAGAGAA
GGGGAGATTATAAGAATCTTAAGATAGAAGGGGAGATTATAAGAATCTTAAGATGTTCTCATGCATAGTGCATTGTAGTTTTTGGTGTTGTAATATTTTT
TAAGTACTCAAAAATATCAATTTCCATAGTTTGCTATTTTATTTTTATTTTTCATAGTATCATGTAAAAATTGATGTATGACGGAAAAGGTATATTTGCA
CATTCCCTCTTCTTTTTTTGTTCACATGATAAGCTTAGGTGAACTCTCTTTTTGGCTCCATTCAGACTTTCAACACAACTTTTACCATCAACAAATTTGT
CGTTTCTGTCACGTTTACCAATAGCCTACAGAACGGTTACCAATCTTCTTCACACAAGAAACACCTTACCAACCTTTGATGTGGCTATAACCATGTGAAC
ATATAAAGGAACAAAAACTAGAAAGGAAAAAACAAATGAAGGAACATCTCTGATTACTCAAATACAGAAAAAGGAAAATGAAAACACGGTTGTTCATGTG
AAGCAGCTACAGAGTTCAGATTCCAACATAATGACATCAAATCGTAGCAGTTCAAAACTAAGATTTATCATCTTTGTGCAGCAAGTTTCAACAGAGATTC
CGAAGGATCGTTGAAAACAGAAACCTTTAGTTCATTTGCATTGACAAGCTGAAAAACACAGACCTGTCCTTCCTTAAGATTGTTATCACTCACAAACTGT
TTCCATCCCCCACAGAAAGCATGATATCCATTTTGTGTTATACAATTCACTTTCCACCCTTTTCCTTCTGAATTACGGAGGACAGCTGCTCTCTTATTGC
CTGATGTCGAAAGTTGTTCAGAGAACCATCTTGGAACGTACTGCATTAGAAATATTAATTATTTGGTTTACATACATTTTACACATTTAGTATCTTACCA
GTCACATAAACTTGTTTTAGTTCAAGAAAACACTTACCAAGAAACAAGACTTTTTCACATTGTAGCCTTTCAAACATTTCACAAATTGAGGAATATTTGG
AGTGAGAAGGTCCTCTTCTGTCACAAGTGCAGCTCTTTTTCTTCGAGTTTCATGTTCTAAGGAAACACAACATACATCTTCTGCAAGGGAAAAATCTAAA
TTTGATCACTTTTACTCCATTTTATGCTAACTTTCAACAACAAGAAGAAGAATTGGAAATGTATCATTATACCTGTTTCATTTTCACCGTTAGCACAAGT
CTTTTTAGGGAATTTTTCTGGCCTTTTACGCTTGCTGCCTCCATCTATTGAAGCTTGTTGATTTTCTACCATGTTTGTTGATTTCACTTGCCTCTCCAGT
CCATTCTTGCTGAAAATTCTTATTGTGAATTGCAGAGCGCCATCGTACCTAAACACGAGATATTCCCCATTTTCTAATTGATTATTTTTTTGAAATTTCT
TCCAACCCTTTTGTATAAGCAAACCATCTTCATCACACTGTAGTTTCACATTCCAAGTGCCTCCAGAAAGACACTTGAGGGTGGCTTTATCAGGTGATTC
TTCTGATACATGCCTGAGAAAATGGGCTGGGATTCTCTACAAATTAAAACATCAAGTATGTTCAAATTAAAGCAGAACAATGTAAGATTGCTTGTAAAAT
GATGAACAGAAGCAGAGAATTACCAGTTCATTAGTGATTGAGGGACAGAAAACCTTGTAGAAAATTGCTCTTTTGTCTATCTTCAACAACGAGTTTTCCA
TCATATCACAATTCAATTGATTTGAAAAGATGGGAAGATGGAGTGTATTTATGAGCTATTTTCGGGGCCTTTTCCGTTTAGCATACGCGAAAAAGGAAGT
AACATGTTGAAAAATTTACTAGTGCAATAATGTCCTCTTGAAAACATTCAAAATTCAGAGTTTCCTTATTAAGTCACCTGAATAACGAAGATAAGATGCA
AAATTAATTACCGAGATGAGTGTGAAGATGGAGAATTTTCCCAAAAAAAGTTGTACAAGAAGTCGATAGTGCCTTACCTATTTTGAAACAAAATTTGAAA
GGTGGGACAGGACCACATAGGAAAACAGCTAAAATTAGTGTCTGCAGTACATTACAAAATTGAAGAATTTGTGAACTATAAAAAGCAACTATTTTAATGC
AAAACATATGGAGTCATTATACTTTTGAATGTAACAGATCAATTGTATTATAATAGGCCTTTAGCCATTTGCCAATCCATGCTTCATCTTCTTTGCTTAT
CAAGTGTCATGTAAAAGTATTTTATATAATGAACATATAAAAGTTAAACACACTTAAAACTCGATGATAAAAGTCACTAAAAATTAATTGCAAGTGTACA
TATCTACATTGAGCATGGTACGTGTGATAGTCTTCATGTTTTTAATCAACAGTACATACATAGAAAAAATAAATAAAACATAAAACTTCACGAACTCTCA
ATGACAACAACATACCGAGTTTAATCCCACTGAGGGTAAAGTGTACATAAATCAAGTCTCAATGGCAAGAGCAAAATTGGATTCATCGTAAAACTGCATT
TAGTCACTAGTCTGACTAGTTATATTATGAAGTGGTAGTTTCAAATGAATATACAAGACTGCACACCAAAAACGATAACTATACAAATTTCAATGCACAC
TTTGTACAATGAGAAGCAAAAGTAGAGCATTTGCTGCTACCTTGGCATTCCATAAAGAATTTACGGCACCTCAAGATCCTAGATGGGAAAAAAATGAAGA
TGACAAAATCAAGTCACAAAGATTCGCTCTCCTTCCCAGCTTTTCATGAGAATTTTGGATCTACAGGCAGAGTCGAGTCAAAAGAGCTCATTGACGTAGT
CACTGAAAAAAGAGAGGCACCTATACAGGTTGAGTGTGTGCCTTCTCATGGATATCCTTCACAAGATCCCTCAGTTCAGGGAAGATTGATATAAGTACAA
GTTCGAGGACACCATATGTAAGCTGCTTTAAGCAGATAGTAGACTGCACATTACAAGACAATTTTTGTTGTTAATTTAGCAGAAAACATGTAATAGGAAA
CCAATGTTCTCACAGAGAGGTCTTACCTGAAGGAAATAATACAAATCCCTAGCACAACGTCTGTACTGCTTGTGCCCAATTAAGCTGACCAAAGTGGCGG
GAGCACCATCTAAGAATTTAAAGAGGAACCAGTTAATAATATCATCCATGGCCCTCTCAAGGCAGGGTTGCTATAAACCCTACCTGTATCTAAGAATTTA
AAGAGGAACTAAATGTAGAGTGGCAGGGCAACATAAAGCACAGGGTCAAATTGGTTTGGTGAAATTGAACAGATAACCCAACCTAAACGAACATGAACCA
CCCCCAGTGCAAGCATGGAAATTGTGTGTGAATCAATACTGTAAGCGATCTACTCCACAAAAAATAATACCCTCTATACAACTGTTACAGGCCCGGGAAA
CTGGCTAGCTGAAGCAAGAGTAGTACAGTTTGAAAACAGTTTAAAATGAAGCAACAATGAGACATGAATTTTTCTGACTTTTGCACAGTCCAAATCCATA
AATGAACAATAGAAAAATCAAGAAAAACATCTTATTTTAAGGAACTTCCATTTCATAAAATAGGCAAAATCGAGAGCCACACTTACCATAGAGCATCTTT
TTCACATCACTTGCCCTACGAGTAGCCTCAAGCTGCTCCTCAAAAGATCCTGCCTTAGAGACCTTACTTCCTCCAGATTGTTTCGTGCTATGAACAGATC
CTTGATTTGGTTCATTGCTGCTTTCAACAATATTTCTTAATTTTATGAAGAAAATGCCATTGGGCCAGAGAACCTAGGAATGCAATCAGCAACAGAACCA
AAAAGTCACTTCCAAATAATCCTTCTGCATAATTTCCTCATTTTATAATCTTAAAGTAGCACAATGTTGACACACAAGGAAGTCGGGAGACAGCCCACAA
CCAAAGAAATCAAGATGATATTAGTCAAATTCCATACATTATGAGTATGGTATGCTCCCTAATATTAGTTGACTAAATCATATTAAACTTAATTCTCAAA
CAAAGAAAAAAGAAACTACCTTCTATAAACCAACGACGTATATAAAAGTGCATACAAATTAACATTTTATGTTGCAGCACAAATTAACATTCTTTCCCCC
GACACTAATTTCCAAATGCTAATGTCTTCCTATCTATTTCACATATGCCACATCAAGTTCAAAATAAATATAATGTAAAGAAATACTATCTACATAAGTG
CAGTATTGTAGATGGCAGACTTTGAAATCTAATAAGGAATTAGCTGAAGTGTCATGCTAAATGAATCATATTGAAATAATTAAATTTATTACATCAATGA
TCAAAGATTGAATTATGGAATATTGATGAATTGCCACATGCATTAATTTTATGAAGAACTCTCAAGGAGGAATCTAGCGTTGTAAAAAATATTAGAGGCA
TAACATGTCAACTCCTAAAAAAGGAACCTGCACTAAAGTTTGCTAAGAAGGGACTCTACACCATTGTCCTTTTTTGTAATTCCAAACTATTTCTCTCCAC
CAATCAAGAGTTTTTTTTCCCATTTGTCATCTAGTTAATGCAATCTGTAAATACTGTAAGTCCAGAAGCAGAAGCCAAGAAAAAATTGCTTCAAAGGTAA
GCAAGTAAGATGGAAAAGTTACAATAAGAAAACTAAATGCTTACATCTTGAATCCATTTAATTCCCAAAGCAATAATATCATCTCTCCGTAGCCAATGAA
TTTGCCTTAACAGCCAATCATCAATAGCATCCTCCATCATTAACTGCATAATTTCCTTTGATATCCAAAATACCTGTCTTCTGCGCTAACAAAAATGGCT
TTGTTAGATGCTCGCTAATGATGCCATGCCATGGGAATAATATACATACAATATACCATCTGTGCAGGGTTTCGCTAACCTACTGCATAGGTGTGTTACA
CCTCCCATTTTCTAATTTCCGTAGAGATCTTAATATTAGTCTTTTAGGGGCTTTTTTTGCCTCACATAAATCCCCCAATTCACCTAAATGTCCATACTTT
TATTATTTTCCAGATCGATAGTTTCATTCCTTTCTCTTCATTCTTTGGTATTCCTCAAACAACCACAAGAAAGGAGTTTGTCAATAATTTGGTAATTTCT
GAGTTCAGAGTAAAACCATGAACAATGAGCAATAGGATCCACCAAGATAAAGATTTTATTCAATTTAACACTTCTTTTATACATTCATTGAATTCAGGTC
ACTGGAAACTAAAACTTTGAGTCCATCAATCAGAAGGCAAGAACAAACAGAAAGGCAAAAATGCAAATCTATAAATGGAAATTCTTACTCTGGTCGCAGG
GCATAAACACTTTTTTAAAGGCAAATAGTATATTTACCCATAATCTGATCAACAAAATTGAAGCATATTAATTCTTACCTCCATTGATGGCACTGTAAAT
GTTGAAAGAAGACAAGATGCAAAAGGAAAAAAACTTGAAATTTTAAAGAACCATGGCTGCTCTTTCCCTTTTCTCACTAGTGAACAAAGATTGGGTGATG
TAGGGGAGGGAAGAAAAAATTGGGAATTGTGGATTTACGGTGAAAGTACCAAAATAAAGCCCCAACAAGGACCAATCTTTAATGAGGTGGCGAGGACATT
TACATATTGTTACAATTTTGTTGAAAACCATGTCTAATTTGTGAAATCCTGGATCATCTCCTTCTCTCCTTCATGTATTTCCATGCGAAGCATGTGCATA
CTTTAGTAGTTCAGCTTTACAGGATGACAATTTGTAGGTTTGGCATAATTTCAAATCATATATTATATCGACCCTTCTAACTCATTTTTAGGAACCAAAT
TAAGCATGAAGATGTTAAACATGGATGATAAAACTGATCCAATAATGAAAATATGAAAGAGAAGTTAAATGTAGGAAAACAACTCTCAATTTGATACCAG
GAGGGGAGGGGAGGGGAAGTAGAGAAGTACAAAACATGTTGTTGTCACCTTAGCCAGCCTCTTCTATTCAGCTGAAAAATCTTGTCCACCAAATTTAAGA
TAGGTACACTTAAGTTGGGCGGCGTCCACTGAAAGGAAAAAACCCAAATGAGAATGAGTAAGCAAAACAGAAGCACGTGATATTAAGGAGGAAAAAAAGC
AGCCCAGCACAAAATCAAGAACCAGTAGCCGACTGGGGGGAGAAATAATCAGGGTGGCAATGAGGCTGAAATGGGAGGGTTTAAACCGATGTGTGGCGGG
GTGGGATGAACCAGTTTTAAAAAACTTGGTGGGGTGGAGTGGGGCAGGTTGCAGACTTCCAGGCGAAATTTCTGCTTCCGAGCATATTCATTGTAGCGTT
TCTCTAAAAAAAAAAATCCACTTCACTGCTATCTCTAATCTATAACTGTTTCTTTTTCACTTGCTACTTCAAAATCACTTTTGATTTTCTTTTACCATTT
ATTGAAGAATAATTGAGTTGCTACAGATAAAAATACCGATTTATTACGAGCAATATGTTTATTCTAAAGATAGTTTTCTTTCTTTATCTTTAAAATAGAA
TTATTTGATAATTCAAGTTGATAACAGAGATAGTGGATAACATTGTAATTATTTCTTTCTATAGTTTTCTTAGATTTTTTAGTGAAGCATGTCATATATA
ATTAGGTAAAAAGAGTCGTCCAGTTTGAATGCTTAGCAAAAATAAATTAGCATAAAATCAATGAACGTGATGGAGAACTATTTACTATGTCATTCAAGAA
ATTTTTGGATCTGTTATTTTACTTACAGTAGCATTGGACTTTTGCTAAAGCAATATAAAGAGCCCATTTTAAAAAATAAAATTATAAACTTCCCTATTTT
AACACAGTAACGGAAGGAAGAAAAAAATGAAAGAAAAACTAAAATAGGCTAGGGTAAGGCAAGTAGGTTGAAAGTAGAAAAAAATGTTTAGTGGGGTGGG
GCAGGTTGAAATTTTAGCAGGTTAGAAGACTCAACCCGCCCCATTGCCATCCCAACTGAAATATATCAGATGACATACAGTTGATATCATTTGATCAGAA
AGTTAACAAGAACCCAACTTGTAAAGATATCACATGCTGAATCTCAAATAATAGCCTGCATCCAAGCACCCCAGTGAGCTAAACAGGCATCAAGCAATTA
AACAGGCATCAAGCAATTATTACTCTCTAGTTCCTACCAAATTAAATGCTCATAATCATTTTCAGTTGCTTCACAGTTATATGCCTTTCCCAATTTTTTA
TTGGATAAAGTAATAAGGTTTTCATACATGTTTGGGCAAAAACATGCTAGTATATGATAAGTGTACCAACCCTTCCCTGAAAAAGAAACTTTAACCCCCT
TCAATTGCCCCATAACTGACGGGAAAGTTGTCCTCTGGTATGGCCCTTTTGTATAAGTAATCCAATTGAGAGCATTCCAGACATGGGATTAGACCAGACT
GTTTTTATCTCACCTAATATGAACCTTAATAAAGTATGATAATCACTCCTCGATACAAATAGCACAATCCAAATATGCAGAAAAAAGATGAGGTCATGCA
CATCACTTGCATCCCACTGATAAGACATGATTCCTAAGTTCAGATGTCTGTTAGTGCCTCTATTGGTCTTCATTCATGTTTCCAGCAGAATAAATTTCCA
AAGAGGATCAGAACCTCTATATGTTCTCCCACTGGATATCCCGTTCACTAGAAGTAGAAAAGGAAGAAGAAAGGGATACCTCTGGTGGCACTCCAACTAG
ATCCTCTTGTTGACTTGGAACTACTGCCAAACTTGTCTCTGAAAATCCTCCAGAACTGACTGATTTACGTTGTAGCCCAGAACCATTCTTCAAATCAGCC
ACTGAGTTTACCATCTCTTCGTCATGTTTAACCACCCGAGGGGGAAATCCTTTTGAATTCAACTCATTGTCTGAATGCCACCCATTGTCTTCTGAACTAG
GTCCTACTTCCTCATGCCCGTGGCTTCCATCTTTATCACCGTCATCATTGTCAGAGAAACTATTAACTGACTCAGAGTTACTTTGTGTTAAAGCCAGTTT
ATGTATTTCCTCCACGTTCCAAGACAAATTCCTGTCTGAAGTAGAGGTAGTAGGTTCATAAGAAGAAGATGAAGGAGAGCCAACAACTTTACGCATCAAG
CCATCAGAAACGCCTTTAAATTGACGCACAATATCATCCACAGCATCATCCACGTTAACTGTCACAAAGGTTGAGTTCAATCAGACTATAACGAAAAAAG
TAACTATCATATACCAGGTAACTCACTCATTAAGTTCTTTCCTAAGCAATCAGAGAAAGATGTACAAGTATATTAAGAAAAATAGCAATCATCTTTCACA
GTTATTTAGCTGACTGATTGAATGTGACATTAAAGCTTCTTAAGCATTGGTAAACCCCAAAGCATTCATTACTGAACATTTTAACTAGTACTCACTTAAA
TCCCTGCCAAGAACAGCCAATCTTTTTCCTAATTGATAGCCTTGAACAAAATCCATCCGACATTATTTTGTTTTTTTGCATGAAAATTTTGGACTCAAGA
AGAAGTGGTGGTGCCAAAATGGTCAAAGAAAGGACAAGATGAAAACTATGAAAGAAAAGAAACCCCAGCCAAAAAAGGGCATAGACTTGCCTGTTGAGGT
ATCAAGATCGTAGGAGTTCTGATACCATGTGAAAGTTTGAGCATCTAACCAAAACCTTAAGATAAAATTGAAGTTGTCAAAGACCTTATAAACCTAATTG
GATGTTGTTATATACTCGAACTGAGACATTATTATATAACTCGACAACCTTCCACATGTGTAACCAACTCTAGGGATCACTCATGTATTTGAATGTGGAC
TATTGAGTGCAAGAGTGACCTACAAAGGTAGGCTCAGATATCATGTGAGAGAATGAGATAAGAAAACACATTAATAACTTGACAATTCAGTGAATACAAG
ACACCTATATATAGGTGTTGAATATAATACACATAGTACTTGTCCAATACGGAGCAATATGTACCTTAAGAACTTAACTCTATTCTAACACAATTAAATA
AGCAAACTATTTGAAGTTCATGATTGTAGATACTAGATAATATTATGTGAAGAGAAGTAGCACAGTGTTTCGCCTCACATTGTGATTTAACAGTATAATA
CTCTGTTCAAACTTTAGCTTTATAGTTTAGCAAAGCAGACTCCACAACTCACTACAAGAATCAAGCATTATCTGAAGTTGGAAGCAGATACCCACACTAC
ATACTATGTGAAGAAACTTGGTACAAGTTATTCTGGCCTTCAAATGGAAATGTAATATTGCAGTCATCAACAGGACTACCCTTACCACATTCCATGTATC
CGAGTATATAGACGTAAAATATCCAGAGGAAACACCAGAGTCATCACATAAATAGAGAACACAAACATGTTGGTTGGAAGAAGTGGAGTACCTGCCAGCG
TTCTCATCACTGAAGAAGATTTTCCAAAGGAGTAGTTCTTCATAGACATAAAAAAAGTATTAGTTAGGGTTAAAACAAGCCTATAGATCTATATGACATG
ATGGTAAATAACCTAACAAACTTCAAGAAATAAATACCTTGGAAGAGGCACTGAGAAAATCCCACACTTCATGTTGCTCAGCCACATTGGCAATTGTCAA
GAGATCCTGTTAGGGAAGACCTTTTAAAGCAACCAGAAGGCACAAATATTCCAAATAGATATAAAAGTAATGATGTGACATACTTGCAGATATTTGTCGA
GCTGAATGCAACGCTGATGAACGAATGCATCTTCTGTACTAGATGAAAATATCCTCTTAGGAGGCAAATGCAATGTGTAATTAGGAATATCTTTCAGGTG
TCTATGCAATCTCTCAAAGTTCCTGTATCTGCTTAAACGGCACCCAATAGGAAGACATCAGCTAAGCAGAGCCAGCGAAAGTTGAGAAAAGAACTTGTTC
AGTGTTCAAAGGGATTTCTTTAATTGCAATACCAAAAAATTCTGAACACAGTAACATTCAAATGAAGATGTTTTTGGATGATAGGGCACCATTATATAGT
TAAAATATATATATATATATACATGAAAACAATACCTTCTCTTTACAAACCAAGTACAGTTATTGGCATCTGTAACCGCGATTGAATATACAGCAAAAGA
TTTTGAGCCCAGCTTCTCAAAATATGCACCCAAAACCTGGGGCAGGATGAAACACTATTGAGCAACGAGAATCTTTGAAGACAGAAGTCAAAGGTAAAAT
AATCAAAATTTGAGACCATAGCTCATAAGATATGAGCCAGCTTGACTTCTTGGGACACATTTTTGAGTATGAGGGAAAGATTGAGGAGAATTCACATACC
CTGCACTTCAGCTTTGGTAGATGATGTCCCTCACCACGAATCACAATGTCTGAAGCACTCATAGTGCTAGGTACTGCATTCTTAAATTCTGTACTATAGA
ATTCTGATATAATGGATCCTCCATCTTTGCTCATAAACAAATCTTCAGTATTTTGTTGGATGATTAAATCAGATGTACTATTTGATTTTTTAAGCTTACT
CTTAGTCTCATATGCAACAATGGCAGAAGCACTGTCAACATCATAGAGAACTCCTCCCTTGGACGAAGCATCCTTTATCAGATCTTGAGACAAATGCAAA
GGGTGACTTCTCTGATCATGTGGTTCACCTTCCATTATCACGGCCACTTCAGATTTTTGAGTTGGCAACTCTTTCCCCGCATCTTTTCCACTGCTTGCTG
TAATCTTTACTCTAGGAACCGGAACTCCTGTGGAAGAATTCGTTTGGAGTTTTTTCTTATAATTTCTGCCAATAGTCCACATGTTCTCAAGATTTTCAGG
CATCAGAACTTCAGTTCTTCTCTGGGAAGCTGCTTCAAGGACACGAGCCCAGTCAGCGGGCCGTGGATGGCTAGCCTCGTCTTGAATCGAACCAGAAATT
GAACTTCCTGCACTAGCTGTTGATAATTCTCTTCGATGGTCATATTGGCAAATTGAGAGATCAGTCCCTTGACTCTTGGTAGGTGTTTTCTGTTTGTGAT
CAGATTCTGAACAAGTGTCTGACGGAGAACCCTGATTGCGACTATGACTTTCTACTTTAGTCGATTTACCATCGCCAGACTCCTTACACCCCTCATCATT
ATATGCAAGGAAAATATATTCAATCAATTCATTAATATACCTGCAAGAAAATATATCAAGTAAACTAGCAAATGAGTAACAAGTTAATACGGAATGGGTA
GCTACACAAATTGAAATGGAGCAGGCTAGATTGATCAATCAAAAATGTGAATTAACTGTGAAATTCTTACTGCCATTTGTACAGTGATCATAAACAGTGA
AAGAACAGTCTATCCATATCAGCAGTTAAATCTTGGGAAGCTCCAAGAGCACCTTAGATAGTGAGGAAAAAGCAGCACTGACTTACAACCAAAAGGCCAT
AATTACTAATGTAGACCACTAATTTCTCGCCAGCAAATACCCCACACATGAATCTAATAGTCTTAACGCTTTTACGGCAAACCAAAGGTCAAACCACGGG
TCATTAAGAATTCTTTTACTTATTTTCATTAATGAGCAAAGCACAACCAAGATAATAAGTGGCCCCAATTACCCCAACACCAACCACCTCCCGCAAAACA
GGAAGGGGAAATGACTATATTTATATTATTGGTCTCCCTCCCATAGACAAACTCATGCAAGTTCATCATCTTCTACTAAAGACTAATATGCTAAAAACTT
AATGAACTGCAAGAAACTTCAATTTACACAAATTAAGGAAGTGTTCTATGTGTAGAGGGGGGAGATGTACCTAGGATAAGATAATCCTCAATTCACATTA
AAGAGCATCGAACACCAAGGTGATCTCAACTTTTTACTGAACATCTTCAACATGTATGCGGGATTATAAAGGGATAATACTACAAGTAACATTTGTTCCG
GAGATCTGAAAGGAACTCTCATTTGTCTTTCAGACTGATAAGAAAGTCCATCCAGGACAAAGATCTGTGATTCAAATGACTTTGAAGCAATAATTTCCAA
GATAGACAAAGTTACTGGTTAAGTAACCATTAGACCTTTTAAGTTCATCTCCATGAGGATAACATAAAATTGTGCTGTAAAAGTTTTACAAACGGTAACA
TTTCTTCATCAGCTTAAAGACTATGCTGACAGCAATATTAACAAAAAGGCCCCGGTATGCTTTACAAGGCTTCCAAAAATTGCATAATGGATTCAGCATC
CCCGACAAAAAGCTCTTTACACCAAAAAATAAATTGTAAATACAGTTCATTTTAACTACTTAGACTAGAAAATAGTTCGGTAAATTTGAGCATTATCTCA
TTGTTTCAATTCAAATAACTTTTCTGTATTAGCTGAAAACATATACAGTGTGCTGTGTGCCTATCTTCGGTCATCAGACACCAGGTGCAATAACAAAAAT
GGAAAAAGAAAACAAAAACGAAAACAAAGCAAAAATCAAAAATATGATGAGGCAGGAGGGAGGAAAGGTGAGGAGAAGAAAAGTTACTTTCCACAGTAAG
CATACTTCTTCTATAGAAGAAATCATTTTTCCTCCCTCTCCCAGCGCTCTTCCTTAACCTTTTTTTTCCCCAGGTGTTTGGGTGGAGGGGATCAAGATCA
TCTTTCTTGTTTCTTTCCAATCATCTCAGTACTCAAAAGAAACTAACAAATGGAATCACGAACAGGGAAAAAAGAATCATCAAGCACGCTCTTTACCATA
CAGAATCACCAAAGAACAATCTAAGCTTTGGACTAGCTGTCTTAGACTCTTAGTTGTTCAAGTGCAATGTATTGATGACATCCTAAACATAAATACTCAA
ATTTCATAGGTATGCAGACCTTAATATCACAACCAAAAACAACTACGCTGAATCTAATATATTCCACATGAGAAAACAAAAAATATACTCAATATCCCTA
ACTGTGGAGGCAGCACAATGAGTCTTCCGGAGGCAGCACGATGAGTCTGAGTCTTAGTTCTCACTGGTAACATTTACTGAACAGTAAGGCGGTAATCAAC
AGCTTTAGACCCTTACAACCAATTAGCAGCTATACTACAGGGCTCTTTCTTCTCAAAGTAACGCATACACAAACATACAACTTTCTAATTCCATGGTATA
AACCTAGTCAGTGAAAGAACACAGATATAGACGAAGTTATGTATATTGAGAAAACAATTTTTTAATGGTTCACATTTGTAAGAGATTAACTTACACAGGG
CTTGCAAAATTCAGAAGAGGCTGTATCACTAAAGAAGTTAATAGTTCTCTGGCAATACATCGAACTAAGGGGCTTTGCGCTTCTCTGGGTCTTAGCACAA
CAGCTAAGATTCCACCCATGAGCCGTTGAAGTACCTATAAAATAAGCATTAGATAGCATGCAAAGAATGTCAATTGAGAAAGAGTCGATTTTTCCATCAG
AACACTCCACTCACACCTTGTACTCACTCTCAGCTGATATCAAAGCAGGATGGAGTTCTTTAGAGACCAAGAGATGGTGCTTCAACCTTTCATCCCTTTC
TTCCGAAGACAATGTACCCATGACGTCCACGCCAATAGCTGTCTGGTTCCTGCGGAAAAGGTCAAGGTGATCTCCTACCAGGTCCACGACATCCCTAAAA
ATTAAATAACTTGGTTCAATTGCTGGTGACTCAAAACCAATACAGCAGACATAAAGTGAGAAACAACAGATAGAATAACAAAGAAAGATTTGCGTTTAAG
AATAGCAATGGGAGTGGTAATCAAGGAAATGCCCCACTTTGCCCTAGTAGAGTGGCGAGAGGGGGTCATAAGTGGGAAATTGGGAACAAACTGTATGTAT
TCTTTCATGACTAAGTTATTGCCAATTGATAGTATAGTTTAGTACTAGGATTACGAGCAACAGTGAGAATAGTCATTAATTAGCTAAAAGTATTGAGTCT
CAGACCACTTCATATTTCTCTCTGTAAGGGGTCGTTTGGTGTAAAGGTTAACACTAAATAGTCCTGGGACTTAATTATAGTACCACTTAATTTGTTGTTG
GTTGGCAAGTACGGGACAACTTATCCTGGGATTAATAATTAATACCCCTTGGGTGGTATAGTAATCCCGGGATAAAATAGGAAAATGACATGATATCCCT
TTAAACCCTTTTTATACATCACTTTTCACATTCATGAAGGGTATATTTGTAAACACATAACTTGTTCTTGAAATTTATGCCATGCATATTATTTTGAATG
CAATAAACCAAACAACCAATAAAAATGATCTCAACATAACTAATCCCAACATAACTTATCTCATCATAACTATACCATCACAACTTTTATTCAAACCAAA
AGACTCCTAAATTGTTTCACTACAGAGAACTTCTTCCTTTAAATTCAACTATTGCAGGCACTACAACGTCTATTAGATGTGAGAAGAAGTAACCAATAAG
GAAGGGAGGGCATGGCAGGGAAGGGGAATGTGTTTCTTTAACAGATAATGCATATATTGATAGAAAAAAAGAAAATAAAAATCTTGCGGTAAGTTGGTGC
AAGTACATTTACATAGACAGAACCCACCTATGAAAAAACAAAAAGAAAGGTTCCATCCGTAAATTCATATCCCTGTAAGTAAGTTGGGGATATGGGTTTC
CTGCCCCATTGCGTCATCTCTATTTAAGTCAGAGGGATGACTGGGAAATAAAATACCTTGTCAACAGCTCTACGAGGTTAATTCCTTTCACTCTTCCAGA
TATTTCACCAAGGACATCCATGATTATTTCATGTATCAGCTCTGGTGCCTCTTTGTCAGGCGTAATATCAGAGTACCACAAATCTATCACAAAATCATGC
AACACCTTGTCAATGAACTCCTCGGCTGCTGCCTCTACGAGTGGAGAACCGATTTTTCTCTTCCATTTCAGTGTGGGCGGTGAGGTAGAAAGTCGGCTAT
CATTCATAGATAGCTGCTTCTTTTCTAAGTGCGCCAAGTATGTTGGTGGTCGGACATTCCGAACTTTCCAGCGGAACTCCACTTCATTAAACAATATACG
TGATCCAGAAACCAAGAGTAAAGCTATAGGCAGGTTCATCCACATTGATGTACTGGTGTCTGCAATCAAGAGTTGAATCCAAAAACAACCATGATGCAAC
AATAGAAAAGCAAATTGACAGTTGTGACAAACAACTCACCACAAAAATTGCATAAAAACTCAGAAGTATGATAATTTACTCAAAGAAAGCATGTTGTTGA
AGTACGAAGGTTGTAACAAACGTGCAAAACTATCCACAATTTTTTTCCTTTTCCTCTTCCCTTTGTCTCCTGGAAACTTTAAGAAAGCTACTTCATTTGT
TGAAGTACAAAACAAATTTGAAGTAGCTGAAGTGGTCAATGAAACCACCCAAGAGAAGACCACTGACATCATACCAAAACAAAAGGGGCAAACAATTAAT
AATTTTGAGAGTTTTTCTTTTAAATCCAATCTCACCTAATTTTCACAGCTGCGGTTGAAGTTTCTCTGGTAGAGATGAAGGAACAAGACCAACAAAATGA
ATGCATGTTTCAGTATTTTATACTGACATCAAATTATAGTGCAAAGACACCCCAATGTAAAGGTACAACAAACTCAGTAACCAATTATTTTAATTTTTTT
ATTAAGTTAAGGTATTTCACCCACAGAAGGGCATCAAGAAGATGCATAGTTACGACTTACAATAAAAGGGAAGTTGACAAAAGAAATTTAGATAAAAAAA
GGAAGTAACCAATGTTTTAATCTTCATTCCAAAAACAACACTCAAGAAATCTCACCAAAAACCTCAAGAAAATGAGTCTTGCAACATCCATTGATCAAAA
GAATGCCAAAAACATACACAATTATTGTAATGAAACACTGTAAGTAATGCTACAACTTCAAACCTGATGCATGTTTAAGCATTCTAATACTAACATCAAA
TTATACTTCCAAAACTTAGTAACCAATGTTTTAATCTTCATTCCAAAAACAATACTCAAGAAATCTCACCAAAGAACCTCAAGAAATGAGTCTTGCAACA
TCCATTGATCAAAAGAATGGCAAAAAATTATTGTAATCAAAACACTGTAAGTAACCCCACAACTTCAAACCTAATGCATATTTTAAGCATTCTGATACTA
ACATCAAACCATAGTTCCAAAACATAGTAAACCCATGTTTCAATCTTCATTCCAAAAACAATACTCAAGAAACCCCACCAAAAAACCTAAAGAAAATGAG
TCCTTTTACGGCCATTAATCAAAAGAATGCCAAAAACACTGCAATAACTTCATATAAAGAAATTTGAATAGCACTTACGTGTTAAAAAGTAACAAACAGC
AAATATACACAAACCCCACCAAACCGCTCGAACTTTTACTTCTTCGATCAGATCTTGAAGGGTCTCCATTGCCTTCATTGTGACCCCTCAAACCCTAGAA
TTCTTCCAAGAATTTGAAACCCAATCAAATCCCTAATGATAAAAAAACAATAATTTGTTATCTACAGTATCAAAATCATTGATTCATCAAGAATCTTGGT
TACTAGTCAACAAGAATCGATAAATTCTGAACCAAAGAAAATTCTGGATTCCTCTGCTTTTGGCTGCTGCGGTGGAAGAGAGAGAAAAGTAGAATAAAAC
GTGGGAAAAAGAGAGGTGAAATCGTCGTTGCCGGTTGAAAAACACGTTAGAGCCACCTTCGTTTTGGAGCTGGACAAGCTATTGAATATTATGTTGGATT
CTAAATTCCACCATTGTCGGGGAAGGAGAGTTTTGACGATTTTACCCTCTACGACATGCTACACCATAATTTAAACTAAATTATTATTTTTTTACAGGAA
TAGTTAGTGGTACTACTAATTTATAATAGTGAACAGTGATCGACTTTTTTTTGTTTTAATATTATTATTATTATTTTATTTCAATAATTTATAACCATAT
TTACCATCTCAAAAAAGGATTTATGCCGAATATTATTTCGTCTTTAGATTAAGTTATTTATAATCATGATTTTATGACCATGAAGAATATAGTACTCATC
TTCTTATCTTATCTTCCAAAAACAAAAAAGGGAGAGATAATATTGTTGCATATGTGTGGGACCTAGTCCAACTAAGCTGAGAAAAAAAAAAGTGTTTCTC
TAAACATCGAAAAAAATTGAAAGCGTAAGTTTCATACTTAAATTATCACTTTTTAATTTAAATACACACTTCAATTATGTGTGTAATGCACTTTCTTTTA
TATTTGAAAAACATTGATTCACGATATTTTACATAGATAAAATATTTTACCTACATATATAAATTAAATAATAAAATATTAATATTAATTAAAAATTAAA
GATAAAGTTTTACTAATTATTTTTCTTACCCCACTCCACCACCTCCCCACGTACCCCCTCCCCCGACAACCCCCATGTTTTTTTAAAAGAAAAAAGTCAT
TTATAAAATATTTCTAAAAGATTTCATACTTTATTTTTCCCTCGCCTTCCCAAAAAAAAACACTCATTCACTCCCATAAAAATTGATATTATTTTATTTT
AAAAAAATAAAATTCTACTTCATCCTATTTAATCCTTCGCTCCTAATTTTTATTTTTTTACGTTTTTCTCATTTTATGAACGTATTATATTTTTAGAAAA
AAAATTCACTAGTGTACCGAATATAACATAAATAACTAAAAAATTTAAAAAGTCTTGTGACGGCAAGTAAAAATATTTTTGATATGTATATCTAAACACT
AAAAAAATTGAAAACAAAGGGTTAAGTGGGATAGGTAGGATCATTTTTTCAAAGAAAATAAAATAATATATAATAAGTATTTGCGGAGGGGGAGGAGATG
GAGTAAAAAAAATTGAAATACTTCTATAAACGAAATTTAAACAAAATAAAAAACTTTAAAAAATGGTAGGGGGGGTGAGAGGAAGTGATGGCGAGGGGTA
AGAAAAATATTACATTTTATTTTATAAAGAAAATATTATTTTTTATAATAGTTTTTAATTTTTAATTTTAACTAATAATAATAATTTATTTATTTTTTGT
CAACATTAAATGTTTTGTCTATGTGGAGTGTGATGTGATATTTTTTAAAAATAAAAGAGAGAGTGTATCACACATACCATGATGAGAGTGGTATAAAAGA
AATATGTGTGTTTCTCAAACTAAAAAGTGATAGTTTAGGTATGAAACTCAAACTTTTAATAATTTAGGTATGAAACTCAAAGAGAAAAAAGAAGTACAGT
TTAGCTGTGTTTTTAACACTTGTCTCTTCTTCTTTTTCTCCGAAATGACTTATTTTGAATAGTGATACTTCTTTATTATCTCAATTTATATGAACTTATT
TGATTAGTCATGCAATCTAAAAATGAAAATAAAGTTTTTAAAGCTTGTGAGTCAAACAAATTATAAATATTTATGTGGACTTGTTTAGCTAGACTAGTTT
ATTTATTGGAAACTTTCACATATAGCTACTTAAAAATAGTCTAATTACACTCGATAGTTATAGTTTGATAATTACATTTCGTGGTTACATGTTATATGGA
GGAGAGAGGCATGAGAGAGGGAGAAAAAAGTGGGAGAAATGTGAATTGTATATGTATATTGGTTAATTAGATAATTGTATATCATACACATATACGCAAG
AGAGATTAGGAGAGGAAGGTGAATTGTATTTGTATATAGTTGTAGATTATACATATTTATTTATATATATGGCAAGCGAGATTGGGAGAGGGAGTAGAGA
GGCGAGCGAGAGAGTGGGAAAGAGGTGAACTCTGTGTGTGTGTATATATATATATATGTGTGTGTGTGTGTTAAATAATTGTATGTTATACATATGTATT
TGTATATTCTGGCGAATTATACATATACAAACCTGACTAATTATATAAACTCAAAGTTCGCCCACGTAATTAATGTACAACGTTAGTCGCGAATGATAAT
TATAGCAAACTATAGCTACGATGGATAACATTGGCGGATGCACATTCAAGTGCATGGGTGCTTGAGCACCCATTACATTTGGAGACAACACTAATATACT
TTGTATGAATATGTAAATTGAGCACCCATTTTGGTACCAACTTCAAATTACAAATAGTTAAGCATCCATAACTAAGAAATTTTGGATCCGCCACTAATGA
GTAATTAAATAGTATAAGTTTGTTTAACCGCGTAATTTTCTCTTATTCGAGAAAATAAATCGAGTTAAAAATATATATTTTACATAAGCTTTAAAATATA
AGTTTAACTCCTAACAAATAACAGATTTAATTAAGCAGTCAACTTTGATATGTTTTTCAAAATGTACATTTTTAGCTATGTATACACACACACTTGAGTG
TGTTAGAAAAATACTCTATTAAAAATATTTTAATATAGTATGTTATATTTTTTTTAAAAAAATTCAGTTATTAATTTTTGATTGAAAATAGAATTATAAA
GTAAGGAATTAAACTTTTATCCAAATAAAAATTTAAATATTTCATCAATTGAGGTATTAATTTTTATTTTTATTTTTTGTACCAACAAGTACTTTTTCAT
CTTCTTTTTGTTTTTACCTTTTTATCGTTGATTTATGTTCATATGGATAGATAATTTATAGTAAAATAACATAACATATCAATCATATTTATAGACTATA
TTTTCTTATAAATTGAGCATGAAGAGGGTAGGTATACATGAATTTGATAAGGTAGAAAAATCGTTTTTAATAAATTTATCTGTAAAAATGATTTGAATCA
CGTGCAATAATAGCAAGACGTATGATTAAAAAAATAAAGAAAAAAATATCAACAATGCAACAATTAAAGATGATAAAAAATAGATGAAATAACAGTAGTA
ATTGACCTGAAGTATAAGATAACGTTAGTATATGAACAATAATACTTGAAGTATAAGATAACGTTAGTCTCCACAAATTTTCACTTTTTGAACATGCAAG
TTTTGTCTAATTAAAATTTTACATTAAACTACAAAATCTATCAAACAATCGCTCTATATGAATTATTTTTAATTCTCAGCTATATGTTTTATGCAATAAA
ATACGGCGTTAAACCTTTATTTCATACATTTTATTTCAATAAATTATGAGATCAAATTCTTGATCTCTCAATTTTATCTTAAACTAGTAAATTTAGTTGT
ACTTCGTGCGAATATAAATAACTCATTTAATTTGTCAAAAAAAGAACTAAAATAGTATTGATAAAAGTTTTGTGAAGGTTCTCTGTTGTGTTTAATTCAA
ATATATCATATTTGAAGTCTTAATCAAATTTAAATATAATTTAAATTTTTGTAACGGTTATAATTTTAAATCGCTTAAGCTAAGAGTTCACATTCAATGA
TCTCAACCTATAATTTCATTGGATATGTGTATGCCATGCTTTTATAATTTTATACAATTTTTTTAAATCTATCTTTTATTCTTTTTTTTGTTTGTATCTT
TCTCGCAAAATTAAAGAATTTAAATCCAAATAAACTTGTAAATTTTGAAAGCTCAGAACATCAAAATGTCATTATCCTCCTTGTTCGTCAAATCAAAATA
ATTTTTAAATATTTATTATGGTTCAAGAAGATCAATTATAATTTTATAAAATTACTTTTTCCTCCAAATATTGCAGTCTTTTACTATTTTCTTTTTAATG
TTCATATTCTTCAAAAGTTATCCTTTCTTCAGTAATGATGAATCAACTCTCTTTTCATCTTTCAAGTCTTAGATTAATTTTTACTACAATGTAACATACT
TATAAATTTATATAAAAAGAATATATTGAAAGATATAAAAACCTCAATTACACAATAACTGTAAAGTATTTGAAAAAATTAATTATTTGAAATAATCTCT
TAAATGCATATAATAAATTTGAGAAAAACTTTTTAAAAAAACTTTATCAAAATCCCCATAGCAAGAAAGTTGAGTCCTTTTTTATACCTTTTTTTTTACG
AAAAAAGCTTATTATTGTAGCATATGCATACAAATTATATTATTTATTTTGAGATAAGGAAAATATCAAATTTTATTGACTTTTATGCATTCAAAGCACG
AAGATAATTATACTTTATCAATTTCCTTTTATTTTTTCAATTTGTAAATTAAATATGAATTTAGTATGTCATTATTATTTCTATTAAAGTTAGGATATTA
TCCTGACAAATAAAATGTGAGATTACTATATTTGAATTAATATTATAACCATCAATTTTATACTAGTTTGAAAGAGTAAAAGAGAATAGTAACAAAATTA
GCGTATGTTAATGATGATAGTTTGTTCATCAAACTTGAACTTAAATCTCAAATATTGTCATATGTTCATCTTATCTTTCACCATACACAATAAAAACGAT
TCACATAAAATATGAAGGATAAAAAGAAAGGAAAAATCACCAACAATAGTGAAGAAAATAACACATACAAGAAATATAGAAGGAAAAACACTATAAATAA
GAGACATCAACTAAACTAAAATAAAACAATATCACCTTTTTTCTTTTCTTTTTTTGGTATTTTGAATTTGAATTCTCACAAACAACATAGACATATGTTC
ATCCTATCTTTCATATAGTAAACAAAAAAAAGTTAATCACATCTAAACATTATAAAATTAGGCATAACAGAGTGATGTACTTAAGTGTAAATATAATCAA
AAAAGAAAGAAATTCTTACCATTGGCGAGGATGATATACTTTAGTATTTATAGTAATCAATAAATTTGTAACTTAATTAAATAATATGAATTAAAAAAAT
AATATAGTAATAAATAAAATTGTAACGTACATTGGTATTAATTATCTTAATTGTAATATAATAAATAAAAATAACACCTTATACACATTTAGGGCAATAT
ATATCGAATTATAAACATACTTTTTAAAAATAAATCACTTATAGCAGATTATTATCGAGTTATAGCATATCGTTTAAAATAAGTAATTATTTAAATACTA
ATTAATATGTTTAAGTATTTATTTTTATTTTTACAATTACCTTTTTTAAAACAAACTCTTTAAATTTTTAAACAAATTATAAGTATTAATAGTTTACATT
TACATTTTTAAAATAAATAATAAATTAATATTAATAGTATAGTTATCTTTTTGAAATCAAAAACTAAATTTTAGATATTTGATTTTAATCAACTTCCTAC
TTTACCGTTGCCCAATAATAACACACACCCATCACAACCTATACACGATCACTATTCATTTTCCCAACACGCCTCACAGATCACTTTCTTCTCCAAAATC
ACAACTCAAAGATCTACAATTACTTTTCCTCAACACGATTCAACAATATTTTACGTTTTTAAAACTTCATAAAGTATTTTGTGTTAAGTTCGTATATAAT
GTCGAAGAAAATTAGTGGAACACCCTGTAAAAGTCGAAGACTAGTTGAGGAGTCATCATCTGATGATTTTCATGTTCCTTTGTTAATATTTTGACTCAAA
CTCTACCGCACAAATTCACTAAAAAAGAGACGGTAGCTATGTTAAATCTAAGCTTCAAAAAAATCAAAAAAACGAAACAAAGGAAAGAGGGTCTCCAAAG
AAAGGGAAGAAGAGGAAAGGAAAATATATTTGAACATCTTCAGAATTTGATTTTGACTTTGTTGATGAAATAAAAAGTAAAAAATCAAAAAAATCAACAG
ATAATCAAAAAAGGAGTCAGAGATACAAACTACAAAGAAAGCCAAAGAAGTTATTAAGGTCGCTAAAATGATTAATATAAAATTTTGGTTAAAATGTTAT
GTGTTAGGTCATTTTGTTTGACAATTGAAATTTGTATAAGTTATGTATGAATTTTCTATGAATTGATCTTTTAGTTTTGTATGCGAATACTTTATGAGTT
TCATAGTCACATTGTAGAATTTTGACAATTATAATATGTATTACCATTGTATAGTTTATATATGAATTGATGTATTAGTTTTGTATGAGTATTGTTTTGT
GGTTTGAAAGTCACAGATTAGTTTTTTAACAATTGTAATATGTATTAAGGGGCCGTTTGATTACGGTATAAGAAGGCGTATTATTCATGTATAAATCATT
GCATTAGTTTACTATGTTTGGTAAAAATTTTTGATTAGGTTGAAAAGTCAACGTGACTTATACAATGTTTGGTTGCATTTTTATAGTTCTACATAATTAA
TAATAACATAACTTATGAGGAAATCTATGTATAAAGTTATGTAGGGTAGAATGTGGAATAATTATGTGGGTATTAGTTATACATGTAATAAAGTGATAAA
TTACATATTTACCCTGTTAATTTTATTTTATTATTTTTAATTGAAAACTTTATTGTTTTTCAGTATATAGGTTTGTTGTTTTTATTTCTTTTTATATTTA
GACCATTTTTATTTTATTTTTTAAATTGGAAACTATATTGTTTTCTATCAACATGTGTCGTTTTTATTTTTTTTATTTTTATTATTTTTATTTCTTTTTA
TACTTACCGTTTTGATTGATTTATGCAAATATAAATATTTTTTAATATTAGAAATTGATTGTATATTTTAAACGATACATATGCAAATCAAATATTAGCA
TTATATATTATTCAATATATTTCACATTTTATTAGCATGTATTATTATTTTGTAAATAATATATATTAATAATTTACAACAAGTATAATATCTAATAGTT
AATAACTCATGTATTATAATCTTTACGTACCTAAATAATATCTACAAAACTAATATCCACATAGCTAATACCCGCATAACAAAAACCAACATAACTAAAC
TTGCATAACTAAACCTTGCATAATTAATACATGCATAACTAAACCCTGCATAACTAATACCTGCATAACTAAATCCTGCATAACTAAATCCTGCATAACT
AATACCTCTATAACTAAACCCTGCATAATTAATACCTACATAACTAATACCTGCATAGTTAATACCTGCATAACTCTAACCAGTAACCAAACAACCCCTA
ATATTGTATGAATTTTAGTGGATTGATGTATTAGTTTGTATGACTTTGTGTATAAATGTTATAAGAATTGATATATACATTGATGTATTACTGTTACATG
AACTGATTTGGTTGTTCATTTATATGGCAGGGTTTGAATGATGTTTGAATTGATATATAAGTTGATGTAATATTGTTGTATGATTTGTGTATGAAAGTAC
CTTATAATTTCATTTCATTCTTTTCTGTATGAATTGATTTGTTTGTACATTCACATGGCAGTGTATGAATAATGTTTATATAAAATTATATATTCCGTTA
AACGTCTTAATTTAGTATTATCAATTTGATTGTGGCCCGCTAATTTAAAAAAATGAAAGACTTGTTTTTATACAAACATATTCCCGATCTTTTTTCTCCT
AATTTCTATCGATTTCTCCTCAAATCCATTATCTTTTAAAAATTGGTTAGGGCCCACATATTTTAAGAAACGGAAGATTTATTATTTTTATACAAATCCT
TTCCTATTTTTTCTCTTTCAGTTTCTTTTGATTTTTCCTAAAATCTCTCTTCAAATCAATTTTTTTAAAAAAATAAATTATGTATGATTTCCACTAATAT
AGATTTTTGATTATATACTTATTACGCTAGTAGAAAATCATATCTATATACTTCACTTAAAACCTATACAGATATGCATATACAATTGACAAGTCTAATA
CAAATAACATATACATATACTATTAATAGTTAATACAAAATTTTATTTATATATAAATTCCATATATGTAAACTGTGGATATTCAATAATAGATAGTTAT
ATATACATACACATATGCATATTTGTATTTAAATACGTATAATAACATATACATATACAACTGAAAATCACCACGAAAAAATATATACTTATACAACTTA
CAACCAAGTAAGTTTCTTATTTGTATATAGATTTCAAATATATACTTATACAACTGGAATGAATACCAAAGTATACAGATTAATAATCGTTCTATACACT
TATAATTATATAATACAAATATTTCTATGCCCAAGTCTCTTTTGCCATTCTCTCTTTCTCGTTTGTACAAATTCAAATAATATATAATTTCTATCTTTCT
CGTTTTATACAATTCGTTTCAATTGTATATGTATAGCAAATTAATTACACATATATATGTTTCTTATGTAGCGCAATTAAGCAAACTTTGTTATAACATA
CAAATATGAATTTTGTGTTTGTTATATGTGAAAGTTGCCCTTTAAGAAAAGGTGATAAATGGTAATGGTAGTGGACTGAGTTTTTAACGTAACTGTTGGG
CTGCAAACGACGGATTAATTGCTCTTATTTACTGTGATGTTTTAACTCATTTAGACATTCTATACATTTTTTAGGGAGAAAAATCAGAATATTTTTTTTA
AAAAAAAGAGAAAACATATAATTGCAAATGCTGATCATTGGAGGGTGCCACATCAATAATTTTAAATTCAACTTTATATTATTATACATATTATCAACTC
CATATATATTAAAACTCTCTCTTTTAAGGATGACTTGTGTATCAAAAATAACTTCTTCATCAATCTTTCGTAATACGACATTAAACTCATACTTATCTGA
AGTCTAGTTAATCTTTTATTAGCTTATTAATTTTCTTTTTGATACAATTAACAAATACGAAACTTTTTTAGTTTCGTCATACTTATCTTTTTAATCTATT
TTAGTAGAAATGTTTATTTTTCTTTAGTTTTAATTTCTAAATACAAGATAAGTATCTAGAAAAAAAAACCATGTACGAAAAAGACCGGTGATAAGAAATT
TCTTTGTTTTGGATTAACACAAATTAAAAAGTTGGAAAAAACGGAAAAAAGTAGAAAAAGAAACTTGTGGGCTCATTAAAAATATCTTAAAAATTTCCAG
CAATAAAAAAATCCTATAACAGGCCGCCGCATCCTACGTTTCCCCTTATACGACCGCCAATCTGATCAAAATCACACACATAACACAATTCATCAACGGC
CAGGATTCATCTGTTATGAATCCAATCATCACTGGCTAGTAACATTATCTCTCTTTTTGTACAGAAAATATCTCATCACCTTATCCATTCCCAATTCCTT
CTGACTTCTTCTTCTCTATTATAAAATATCCTTAAATTTTCATAATTTGTTATCTGTTTCTTTTTTTACAGAAACGATGATGTTACAATCAATGGCTCTC
AATTCCTTATCTTCTACTTCTCTCGTTGGAGTTAATAATGAGCTTCATTCTTCAAGATTTCAAGTAAATTCGTCGACAATTCGTTGTTGTTCAAGAAGTC
ATGCTTACATACCAAAGCTCGAGCCTTTTAGCAGAACCAAGTTTGATAGAGTTTTTAAAGATCCCCCTTTGATCGAAAAATCTGAAAATGAACTTGCCGG
TATTTCCCAGATCTTCTTTATTTCTTCATCGTTACGTTTCCTTTGTGTCTATTTTCTTGGATTTATCATCAGACACGAATTCAAGATTTGAAGTTCATGG
GTTCTTGATTATTCATGAATCTTTTAACGAGAAAAAAAAATGTCCTTGTGTTAGTAAAAACAGGAACTGTAATTGGGGTTTAATACAATAATTACGTAGC
TAGTGTAAATTTCACAAGTGCGGGCGGTTCAGGGAGGGTTGGAGTATATGCTGAAGATAGTGAGGCTGTTTCCCCTATGTTTAAAAAATTGTTAAAGATG
ATTAATTAATTAAATTTCTGATTTATTCTAGTTTCTGTAGTTGTTAAACGATTTTAATTTATGTACATATTGGTATTCCCACCAAAAATTGGGATGGAGT
AATTATCTACTAATTGAGCTTGCTTTTTTTGTTGTCGAAAGTATTAAGCTTTATCTGCTTTGTTGAATTACTAATGGATTCTGTGTATGGTTATGTGTAG
ATTATTGTTCTGTTCTAGAAGGTGATGATTCTTATAGCTGCTGGCAAGCCTATTTTGAACTCAAAGATCTTGAAGTAAGTTCTTTATCAGCACGTTCTTC
AAATAAAAATTATGTAGCATTCTTATTTGGCCGTGACATGCTACTGTATTATTATGTGTTGTTAGATAATAGGGTTTTCCAGTTTCAGACCTCACTTGCG
AGATTACACTGAATATGTTGTTGTAGATGAATTAATTAACCTTTGGACGTTATTAGTACAGAAAACTTAAAACTCGAGGTTCAATATTTCCTTGGAACTA
TGAGGTAGAAGTTGATGAAAAAGAGCTAACAAAAATGTGTTTTCATTGTGTGTGTATGACAACCACATATAGTAAGCTAACAATTACATCTGAATTGTAT
ACTTAAGTTAGAAATGTCCATATAAACAATAGCACTAGGTGATTTCTTCTTGTCTACCCAAGTCTTGGTTAACATAGTTACTTGACAGCTGCGCCTGAGG
AATTTCAAATTGACCTGGACATCACAGTTATTAAAGAAAAAGTTCATCAAGCCAATTATTTGTTGTATTTTTTGTAAATCCAGTTTAAGTGATCTATTGT
CCAGATATTGTAATGATCTTAAGCTATATTATGCGTAGCACCTTCCTACTGTGTTATTGAAAGGGATTTTGATTTTCTTTCTTTCCAGAAAGAAGCACCT
AAGGAGGAGGTAGAGAGGCTAATACTTCAAGCAGGGGGAGTGAAAACTCTCATTGGCTGCTTACATGGAGTTTCAGACATGCACAAAGCCAAAAAGGAAA
GCAAAGAATCAGCCAAACCTGTCAATCTTGATGCACAACGGGCAGGAGGACTGTGTCCTATACCAGATGGATTGCCAAAGTCGAGAGAAGAGCTCGAGGA
AGAGGAGAAAGCTAGAATGCCAGATTCACCCTATACTAAACTGCTCAGAGCCAAAGGAACACACCCTGTTTGGTACTGATTACACTTGACTACTGGTATG
GAGCTTCATAAAAAGCACGCTCTTTTGGAGCTTCAGATAATCAGGTCAAACAATGGAATTGAATAGTATTTTCTTGGCCAATGTGGTAAAAATTATCTGG
TGATGTAATATTAAGCCTGTGGGGATGTTATCACGTATTTTTGTTAGTGTTAGCATAAAATAGTGTGCTTTGTCGGTAGGTTATAGGAGTTGCCATTTGT
TCTGAATGTAAATATGGTTTGTTTTTGAAAATTATAATAGCAGTGAAGTTTCTAAATACCCTTATGCTCTTTTCTAGATGGTGTTAAACTGATGCCCTTT
TCCTTCAGTTTCCTTGAAGTACATACACAAAATACATCACAATAAAAGAGCTTGGTGCACGAAGCATCTTACATATTCCGTAGAGTTTGGTAAAGTAAAG
TATCTCACTCGGAGGGATATGATGTGTATGCAATTATGTAAGTATCAGTGCTGACTGACTTCCTCCAAATCCCTATTTTTTCTGGTAAATCAGTTGCAAT
TACGGCCATAATTTCTTTGAATAGCATAAGCCTTATCTTTATGTTTACTTTGATTACTGTCCAAACGTGAATACATCCACTTTCCACTGTCACTGGCATC
ATGCCTAACTGTATCACAAAAGCCATTACAAATATTTCCCTTTCTCGATTCCTATTTCATAGGTACAATGTTTGAATCAATAGATTATCTTTTTTCTACC
TGAACTGATATTATTCGATTAGTAGTTTGTGTCATTTTAACTGTGAATTTAAGAATAAACAAGAGTAAGTCACTTGGAACCTTAATAATGGAAAAATCAA
CCAATTATTTACTAGCTTAAAGAAAAACAAAGCATGTTTATGAAATAATGTCCGTCTGTTTTAGACGGTAAATGAACTTGTGCAACTGGTGATTTTCCAT
TCTAATAGGTAAAAGATGGATCAAGAATTAACTCTGTTCACTCAAATTTTTAATTCTAAGAAACTCAACAAACCGCTAAAATTTGTTTCAAGTTTATTTT
GACCCTCCAAATTCTATGGTTCTCAAAATTCATGACAGCTTATCAACCATTTAATTTCCTTCCTTTGCCTACATATATAATGCCCCCCATTTTGCTTTGA
AAAATATATTGCAATAAGCAGCCTTGGGCCTTACCCACAGGTGGACTTACAAACATGGTGGCCTTGGGTTGCTTTCTCTTTTTCCTTGTATCTTTCTGTT
CTTTTTCTCCATCATATTTTGCATTATCTGATATCGAAGCTGCTTCTATTGCCCGTCGCCAACTTTTAAGTAACAATGGCCAGCTTTCAAATACATACGA
GTCTGAAATGACCATTAACATGAAATTTGAAAATGCCAGGTTGAAGAAAGCTTATGTTGCTCTTCAGGCATGGAAGAAGTCTATTTACTCTGATCCAACA
AACTTCACAGCTAATTGGGAGGGTAGCAATGTTTGTGCCTATAACGGTGTCTTTTGTGACAATGCTCTTGATGATCCCAACATCTCTGTTGTTGCTGGGA
TTGATCTTAACCATGCAGACATAGCTGGACATCTCCCTGTGGAGCTTGGCCTCTTGGCTGATGTGAGTCTCATCCACATTAATTCTAACAGATTTTGTGG
AATCATTCCCAAGAGCATTACAAATCTTACCCTTTTGGATGAGATTGATTTCAGCAACAACCGTTTCGTGGGGCCATTCCCTGATGTTGTGCTTGAGTTG
CCTAAGCTCAACTATCTTGATCTTAGGTTCAACGACTTTGAAGGTCAAGTACCTTCCGCCCTATTTGAGAAGAATCTTGATGCAATATTGATCAACAATA
ACCGATTCCATTCCACCATCCCTGAAAGCTTGGGCAATTCCAATGCTTCCGTGGTGGTATTGGCCAATAACAAGTTCTATGGTTGCATCCCGAGCAGTAT
AGGTAAAATGGGCAACTCATTAGATGAGCTTGTATTCACCAACAACGAGCTCTCTGGTTGTTTGCCTGAAGAGATTACTAAGCTCACGAGCCTAACACTG
CTTGATATTAGTGGAAATAAGTTTGTTGGATCGTTGCCTCAGGATTTGAAATCGATGCAGAAAGTTGAAATCTTTGACATTGCGTCGAACAAGTTCATGG
GAAATGTTCCAAAGAACCTTTGCACGTTGCCTAGTTTGAAGAATTTCACATTCTCAAAGAACTACTTTGAGAGCATGGATGAAACATGTAGGCCATCAGA
GTCGAAGCAAGTTAAGATAGATGGTAATGAGAACTGTTTGGGAGGAAGATCAGAGCAGAGGACGGAGAAAGAGTGTTTCCCAGTAGTGAGCAAGCCTGTT
GATTGCAGTAAAGGTCATTGCGGAGTTTCAAGGGAAGGGCAGAGTCCAAAAGATCCACCTAAAACCGTGACTCCTTCAAAACCTTCAACACCAACCACGC
CAAAACCAAATCCATCTCCACCACCACCAAAAACCTTGCCTCCACCACCACCAAAAACCTCGCCTCCACCTCCTGTCCACTCACCACCACCACCACCGGT
AGCATCACCTCCCCCTCCCGTGCACTCACCACCACCACCAGTAGCATCACCTCCACCTCCCGTCCACTCACCACCACCACCACCAGTAGCATCACCTCCA
CCTCCTGTCCACTCACCACCACCACCGGTAGCATCACCTCCCCCTCCCGTCCACTCACCACCACCTCCAGTCCACTCACCACCACCACCAGTAGCATCAC
CTCCACCTCCAGTCCACTCACCACCACCTCCCGTCCACTCACCTCCACCTCCAGTCCACTCACCTCCACCTCCTGTCCACTCACCACCACCTCCCGTTCA
CTCACCACCACCACCGGTAGCATCACCTCCACCTCCAGTCCACTCACCACCACCACCGGTAGCCTCACCTCCCCCACCAGTCCACTCACCTCCACCTCCT
GTCCACTCACCACCACCTCCCGTCCACTCACCACCACCACCAGTGGCCTCACCTCCACCTCCCGTCCACTCACCACCACCACCACCACCAGTAGCATCAC
CTCCACCTCCTGTCCACTCACCACCACCACCAGTGGCCTCACCTCCACCTCCCGTCCACTCACCACCACCACCGGTAGCATCACCTCCACCTCCAGTCCA
CTCACCACCACCACCAGTCCATTCACCACCACCACCAGTCCACTCACCTCCACCACCAGTCGCCTCACCTCCACCTGCTCTGGTATTCTCTCCTCCACCG
CCAGTCCACTCTCCACCACCACCAGCTCCCGTAATGTCTCCACCTCCACCCACTTTTGAGGATGTCGCTCTTCCCCCAACATTGGGCTCGCTATACGCCT
CACCACCACCACCAATTTTCCAAGGTTATTAAGAGGATCGCCATTCTGATTTCAATGGCACAAAAACTACATAAAAAATGTGTACCAATCAATCTGTAAA
CACACATATCAACTGAAAAAACAAACATTTACATTATCAATTGTACACTGAAAAATTGGAAATTTGCTATTAGATGGTGCTGATCATTCTACAGTTTCAA
CATATTTCAGTATTTAAATCCTATCAATTATCTTCATTCAAAATAAGGCTGAAAGTCTGCATCACATTTCATTTGTTGGTTACAAACTTCCGCTAAAAAC
ATTGTAGGACCGCATTATCCTTTCTGTATTGTGTTACTCCCTTGTCGTGTTACAGTTATCGAAAGTTAATTTGACTAATTTTTAAAGATAAATTAGATTA
CTTTAATTTAATATTTTAAATAAAAAAATTAGATATTCTAAAATACATGAAAAGTATTATAAAATATAATTTTTGCATATTAATATGATAAAAAAATAAA
TCTGTTAAAATTTTTATTATTTAACTTTAAAAATAGAAACTATGACAAATAATTTTAAACAGAGAAAATATTTTAAAAATAATCACACCATCTTATACGT
TCAAATTTCGGCTAAAACAATCAATATAAATTACTAATTTTGATGATGTAGTTTTGACTAATAAAATTATCTCATATTTGTTGTTAATACGAATGATTAA
ATATTGTGAATTTTAGTGCAAGAACTGCCGAGAAAATCACGGATATCATTTTTTAAAAAAAATTAATTTTGTCAAAACAAAAAGTACCAGACAGTGGTAA
CCTAATTTTTGTGAGACCAAATACAACGCCGGGTCGGGTCAGCAGTGCGGTGTAATAGTAATACGACGTCGCTTCAGAAGCACGTTTGAACTTTCACAAC
TAGATCGCGAACATTATCAATTTGGTTATTCGGTGAAAATCAATAGCTACATCGACGCTACGATTTTCTCAGATGGTGGACGACACGACGAAGCCTCCGA
CTGAAGCGATTGTTGAAAAGCAAGAAGAAGCTCAGCCACCTCCGGTACCAGAAGTCGCTGGCGGTGGTGGAGGATGGGGAGGATGGGGATTTTCTGCGTT
TTCTTATATCTCGGACATTCAGAAAGCTGCTACCACCGCTGCCGAAGAGATCTCCCGCAATGTACTCGTCTTTCCTAGCATTTCTTAACTTCAATTTTCT
CCTTTTATTTTTGCATTTATAATGTAGATTGTAGCTGTTTTTCTTATCTCGTTGATCTTGCTAATTAGATTTCTTTACTTTGTTTTAATAGTCGTTTTTA
ATGTAAGAAACCTTTTTGATCTTGTTTGCTGTATTTCTTTTGGGTACTAATGAGATGTGATGATTGTTAGGCGCAACTTCACCAGTTATGTGAATGAACT
ATGAGTAATTTCACCTTCATTTTTTTCTTCAAATTTGTGAAAAAACAGTGTCTACTGGCTCTACCATCCGATCTAGAAATTAGACAATTGGACTCCCCTT
TCAGTAATTGCTACATATCACAATTTTTGCAATGTCTCTACTGAAAGATAGATGCCTAAGATTGCTGTATGATATCAGTGATAGTTGAGCATTCGGAGTA
TTTTGTGTTGAGGCTGCAGTTGGATAAATCCTCTAGGGGAGCATGTGTAGTTCTACATCATTGCTACAAATTACTGTGATATGTTTCTGCAATGGTCGTC
AGCAACACTATAGTTGAAATTTGGTCTTTTTGTACTTGGAAAGTGTCATAGTGATGCAGAAACCCAAAGGAAATCTTCTATATTTGGATACTGGTAAGCA
TGTAGCTAATTTGTTGTACTATTTTCTCTGATGCACACCTGTGGCTGGTTTGCCTGTTTATTTAAGCAAAGTGAATTAGTGATATGATCCCTTCAAATTT
CTGTAATGAAAGGGATTTAATTATGTATTGGTGCTTGAGAGTAGTATCGTAACTTGATGTAATCCAAACACCAAGTCCTATCACTAGATTGCATGCCATT
TGAATTTAGTTATTTCTTTTCCTTTCACCTACACGTTAATTGAGCGTTAGAACTTAAAATGAGTTGAGGCCCTCAGATTAATAAACTCTTGGTTGACAAT
TCTTGGTACTTTTTCTTTGTTTTTATGGCAGGATTGCACACTTAAATATACACCTTGAATGTCTCCATGCATTATATTTATATGCCTTTTCACTTTTGCA
GGCCGTTGAAGCTGCTAAATCAGCTGCAAAGAGCCTTGCAGATGTGCAAAATTCTCTGGAAGACACCGAATCCTTGAAAGAGGATGAACGAGAAGTATTG
GTTGAAGAGGAGAGTGAAGATGAGAATGATAAAAAACGTAAGGCTGCTCTTGAAAAATTAGAGAAAGCTAGTGAAGACTCGTTGCTTGGCCAGGCAAGTG
CTACCAAATTAGTTGTGCTGCTTACTTGACTCAATAGGGGATCCAATTTTTATTTTTTAGACGTTCTTCTTGAGCATTGATATCCCTTCCACAATCGACC
CCCATTTTTTGCTAATTTGTACAAAAGTATCTTAAGGTTAGAAGTAGATATGCCATAATTGTTTGGTATGGTCATGTTTTTCACCTTCCAAAATGTGCAG
GGTTTGAGAGTTATTGACCATTCTGTCGAGAATTTCGCTTCAGGAGCTTGGCAAGCATTAGGAAATGCATTCAAAGGAAGTTCTGATTTAGTCCACAAGT
ATGTCTTCTTGTGTATGATTGCGACGTGATAGTTGAATAAAACTAAACTTTACTTGATCAAAAGAAAAAAAACTGATTGCAACACGAATGTTATTTTTCT
TACTCCCGTTCGCTGGAACCTTCACCAAACAGGGGTGTCTGCCCAGCTACTTCATAGCATGTTTTTAGATTTACTTTAAGCAGTTGCTCATCTTGTGTTT
GAAAAGAATTGCTGTATTTAATGGAGCTGATTGTTGTGGGACAAAATGGGAGTTTGTTTTTGTTGACTTTTATAGTTCATTTTGCTTAGTTTTATGATTT
TGACACATGAATTGGTGAATATTTCCTCTGGCAAATTAGGTGAAAAAATGACCTGGCATAAAAGAAATTTTATGTTTGCATATCTCTGGACTAGAGAAGT
AGTCACAAACTACAACTGTCTGGAAACATGAAAATAAGAACCTCCCCATTAACATGAGAACTTTGGGCTCCTGCAATGTTAGTTTTGGAGTCCTCGTAAG
TACGAAAGGACAGTAGGACTGACTGATCTTCTTTTGTAAATTTGGACCAAGTAGAATTTTATGCTGACGAATCTACTGTTACCAATTTCTGTTATCTGCT
TATTCCTTCGTTGAGTAATGCCAAAGTTTCCAAGCAAATGTCATTTTGCCTTTTGTTTTCAGGCTTGAAAATTCGGCTGCAAGTATTGCTGAATCAGTTC
AGCATGGTGGCTTACCTGCCACAACTGGTTCTGTTGCACCATCCATACTAGAGGTTTGCATAAGATTTAATTTCATTATTTTTGGGCAGGTGGAGTGTGT
TTTAGCCGCTATTTTTATTGTGCACAATTTCTTGCAGACTGGGAAAGCTTTTACTGCTAAAGGAATGCATGTGCTTGAGCTACTTGGAAAAGAAACTATG
GATCTTCTGATCTCAGAAACTGGTATTAGAGTTGATTCAGGCTCCAAAGAAGGGGGAGGAGAAACAGATGAAGATCAGTTTTATGAAGAAGTTACATTTG
ATAGATGCTTTTATATTTATGGAGGTCCCGAGCAATTGGAGGTCAGGTCCTACTCATATTGATCTTTGTACTTGGTTGAGTTTGTTCTGGAAATTCAGTG
TCTTATCATGTGAATTACACGCAGGAGTTGGAGGCATTGTCCAACCATTATGCTTTGTTGTTCAACAGAAGAAAAGCGAAGATTCCATCTGATCAAAGGT
CTTCGTATGATGGAAAATTTAAAGAGGTTCAAGAGATTTTTGACTTGAGTTCTGAAGCATATGAAAGTGGTAAAGAGTCGGGAAAAGGAAAGGAAGTTGA
AACTGGCATTGCAGACAGCACAGATGAGGTGAAGAATTTGCATGATTCTAGTGTGGACAAGGCTGCAGAATTGGCAGCAGGGTAAATATTTAACTTTAAT
ATGCTTTACCTTTTAGTTAATTTTCTTCTACTTTAATATGTTCTGGAGAAATATATGGGAACAAAAGAAAATGCGATTGAGATGTTGACAGTTCATGAAT
CCAAGCACTAAAGGGCCTGTTTGGATGGACTTGTAAAAATTAACTGATAAGTCAGAAGTCACAATTACATGGTACCCTACTTTTGACTTATTTTTTAAAA
AAATTTGGCCTAAAAGTGGATGCTTAAAATACTTTATAACCTTTCCAAACACCTCCAAAACTAAAAAACTACTTAAAAGTCAAAAGACCTAAAAGTAAGT
TTATCCAAACGGGCACTAAATTCTTGTGCTTAGTAGAGTGATTATCTTTGAGTTTGTGTCTAGTTGGTAAAAACTGGGATACTGGTGTTAATTTCTGGAT
TTCATTGAATTGCAGATTTACAAATGTTTTGGTTGGACTAGCTCCTAATGACATGGTTCAAAGGACTGCTCGAAGACTGGATACTCTTCATTCAGAGGGT
GTTCATGTATGTAAATTTTTAGTTAGTCTGCAACCTTTTTTTTAATCAAAGAAACTAGCTTCTTCTTCTTGGGAGTAATGAATTAACTTGACTTCTCACT
GATTGTTCTTATGTACATAGAGACTTTCAGAGTTGTGTTGTTTTGCTGCGACTCAACTTGTAATGCTTGGGAAATCAATCATTTCAACTGCAAATAAAGT
TGGGGACCAAGATGCAAATGTGGAAATTCTGAAAATGGAATGGCCGGAGGATTCAATTGAAAGAGCTAAGGTAATCCGATCAAAGGCATGTTCAATGACT
CGATGTGTTGAAACAGTTTCTTCCAGCTTCATTACAGGTAGATCTTTGTCAAACATATACTTCTATGCATTTATGACTTTTATATTGTTTCTTTATTCCC
TTCCTAGTAATTTCATCTGTAGTTCATTGTTTCTGCATCTAATATTGATAGATGACCAACCCATGTATGATCTCTAGTTTGAAAAGATCATCAAACGAAG
ATCAGAAGCACATGGGTAGGAATTCGAGGATTATTTACAAATAAAGTAGTTTTTATGATTTACGGTACTTTTTGTTTTGCATTTGTTACGGTAATTTAGT
TTTTTTAGGTGTTCTCGTAAATATTTTGGAATATAACTATGAGAACTGCGCTGTTTAGTGATTGTTAATTCAACTGATGATGGGGTTTTCTGCTCACGAA
TTCAAAATTACTGGTCTGATAATGTTGAAATGAGGTGATTGAATTTGTAGAAAGGTTTGCCTTCCTTGAGACTGTTTTGTCTACCCGTGGTATGGATAAC
ACGTTAAGGAACAGTTCAGCTGATTTTTCCTATGGAACATGTTTCCTCATGATATATCTTGTTCTTGGTGTAAAAAGGTTGGGTTAAGTGGATGACGTCT
ATCTCTCTTAATTAGCTTCGTTATGCCTTTGCAGGGATATCTGAAGTGTCTGAAGCGTATTTAGCAGCAGTGAAGAGTGTATCTGCTGATTCACATGAGG
TTCCACAGAAATCAATCCAGGAGAAGGCCAATGCATATGCTGAGAATCTTCGTGCTGCTCATAGCACAGCCATGGGCAAAATTCAGGACGGCCTTCAATA
TTTACCCTATGTGGTCATCTCAACCTCAATGCCTGCTGCTTGAAGAATTTCTCAATGCAAAATTTCACACTTAGTCCTTCCTCCTTTTAGCTTTCCTTTT
GCTCTCGCCCCGCCCTCCTCTCTTTCGTGTAAATAACTGTACTTGGTTAGTTTCCATATCCCTTTATCCCTTTGAGACTTGTAAAATCTGGGAGTGCTGA
CTTGTGTGATAGACTGATATCTCTATTAACTCTTAGCTACAGAGAGTATACTTTCCTTTCTGTTTTTATCTAAAGGAAATAAATAAATTTTATTTTATTG
AAGAATTCAAGCCTTAGCCTTTGATACATCAAACATGAACCTTCTTATTTTTGGCTCTCTTTTGTGAGACGCGTGGACCTATTGCTTTAGTAATAAGTAA
TTAGAACAGTCGACTAATAAGTAATTAAAATCAAATTTGCAATGCTAAAGAAACAAATGTCTCAAAGTTAAAAGAAGTTGAAAAAATGTCAAATATCAAC
ATATGTCTATATTCAATGTAGCCATTCATCCGTATCGCTATATATCATGTGACAAATTTCACAACACAATTCTCCTCTCACTTGTAACAAAAAAAAAAGA
AGAAGAAGAAAGTGAAATATCTATCATGGAAAATATGGATGAATCCTTTTTTCAAGAAACAGAGCACAGGCCAAAACAGAGTACAATTGAGGCAGAAGAC
ATACCCATAATTGATCTCTCTCCCATTCTGACCTCTGATTCTTCAGAAATTACAAATCTTGTTGCACAAATTGGTGATGCATGCAAGAAATGGGGTTTCT
TTCAAGTAATCAACCATGGAGTTCCATCTACCTGTCGCCAAAAAATAGAGAGAGCATCAAAGGAATTCTTCTTGCTTCCTACTGAAGAGAAGAGGAAAGT
GAGTAGAGATGAAGATAACCCTATGGGGTTTTATGATACAGAGCATACCAAGAATGTTAGGGATTGGAAAGAAGTTTTTGATTTTGTTGTGGAGAATCCA
ACTCTCTTGCCTGCTTCTCATGAACCCCATGATACGGAGCTCAGGGAACTGAAGAATCAATGGCCTGATTTCCCTAACAATTTCAGGTATTTTGACTGGG
CATGGAATTTATGAATCTAGTGGAAAACTTACTAGGGTTAATTTTATTTTCTCCTCATCAATTTTTGTTCCAAACTTACTGGGTGTGCCCCATTTTCCCC
CTTTTCAGTTTTTGAGACATCATAGATTGTATCGTATCAATAGGTGCTTTTAGAATTGATTCTATGATCTAATGGAGTAGTTTGGAATTTACAGGGAGGC
GTGTGAAGAATATGCTCGAGGCATTGAGAAATTGTCCTACAAGTTGCTAGAATTAATTGCTCTAAGCTTAGGCCTGTCATCCAAAAGGCTGAACAACTAC
TTTAAGGACCAAACAAGTTTTATGCGATTAAATTACTATCCGCTATGCCCAATTCATCATTTGGCTTTGGGAGTTGGGCGGCACAAGGATCCTGGTGCCC
TGACTGTTCTTGCACAAGATGATGTTGGAGGCCTCGAGGTGAAACGCAAGGCAGATGGAGAGTGGATACAAGTGAAACCAACTCCAGATGCTTATATTAT
CAATGTTGGTGACATAATTCAGGTATGACTACTGTAACAATTCTTGATAGAAAAGCAAAATACTTCCAACTGAGCCAAAAACTTTTCACAGGTTTGGAGC
AATGACAGATATGAAAGTGTCGAACATAGGGTGATAGCAAGCTCCAACAAAGAGAGATTCTCCGTTCCATTTTTCTTCAACCCGTCTCACTATGTAATGG
TTGAGCCTCTGGAAGAGCTTACGAATGAAGAAAGTCCAGCAAAATACAAGGCTTACAACTGGGGAAAATTTTTCACTACAAGAAACCTTAGCAATTTCAA
GAAACTTAATGTTGAGAACATTCAAATATATCACTTTAGAAATGGTGACCTGTAATGACAAATGTAGTGTATGGGAAGTATTATTAAGGTGTTATTTTCA
GCTGGAAGGAAATAAAGTGGTGGATTTTTTTCTTGTAAATGATTTGCTTATGTTTCGATAAATTTATCTCTCAGTTTGTCGACTTTCAAACAATACTGGC
AATCTCTTTCATCCTTTAGATTGGCGTTACAAACTTAAGTATGTTTTTACCCAAATCTTCTTCTGTTTTTCTCAGTTCGTCTTCCGCTTCTTCTGTTCCC
TTTAAAATGCTCTGAATTTGATGGCTTCTGACAGAAGATTAAATTTTCAATGAAATAAATTAATGTTGCGTTCATGAAGTAATTTTTGTGTAGTTGGGAA
GTCATGACAACAACTCATTAGCAAGTTCATAACAGTTATCTTCTGCTGTCAACTTTATACCTGAACAAATGACTAATCGCTGCTTCATCAACTTTTCCGT
CCCTTGTGAGTGTCGTAAGTACCTCAAATTTTCTCTAAAGAAGATTGTTGTAACAGCCTGCAGGGTCAGCAGCCTGTTCATCATCAGCACCTTAGAGAGT
TTGGTTCAAGTGCGGACCCAAACTGTATATACAGGCTAGCCAGTCGACAAGATTCAGAGACATCCCCAGACGTGGTCACAGGTACCTTAAATGTTTTCTC
GCATGATCTATACAATTTGATAGACCAGGAGCTATTCTCTCATATATTGATTCACTTGTAACTAAAAAAACATTGAAATACAGTCCAGTAGGAGAGTCTC
TCATATTGTGTAGTGACAATATATCACTGAGATACCTAAATAACTTGATTGAACTGGAGAGTGCAAGTATTCGCAACCTGTTTATCTGTACACACAGGTG
ACTGAGTTGAACAATCAGTCAGAATAATATTCATGTGTTGAAGGGGAAAGAACACACTTGTGCAGCTTTGTTTTCCAGTCATTGTAATATAGTAACGGTA
ATAAGGGAGATTGATTTTGGTATGGCATTTAGAGTGCCAAACAAAACATTCCATCGCGGTAATGAAAAATCTCCAATCGTCCCAACGAGCGTGTGCCCAC
TTTGTTAACATCAATTTGTTCTTTGGAACTAATTGATAACAATGACTTTTTTGTGCATCTCTTCTTGTTCTTCAGTCAGACTTTTAAGTCCATACATCCT
TACCCTTTATATAATGATTCAACTCATATATTACTTGTTTCCTACATACTTACTTGGCAGCTTTTTTGTTTCCAAAAATAAAGCCAGTTTTACTGATTTT
TTTTTATTTTGGAAAATTAAAAAAAAAAACAGTTTTTTTCCCTATGCCAACATAATGGTTTTGTTAGCATTCCTATTACATTTTATTAATATTATAATCA
ATTATTTTTACAACATTTCATTTTTCGTATTTTATTATATCAAAATAAGTGAATTGTAAATATCAGATTCTGTAATTGAAGAAAATGTAATGGGACGATA
AAGTGTTAAAGTAGCCTTATTAAGAAGGCAAACATGCAAATATTAATATGATGAAAATTCAATTTTATATTGAGTTTTGAAGTGCATATCAATGACAAAT
AGTTTAAGTGATTTACCATTCTCATGTAGTGATTACATTTTACTATTTATTCTTAAATATTTTTTCCCTTAAATATTTTATAGGAGTCATTGTTTAGTAT
TTGATAAGACTACATTAATAAATTAAACACTTTGAAAGTCTGAATTATTCTCCTAATTTATTATTTAGCCATTATTATAATTAAAGTAAATGATGCATCA
ACCTGAAAAACATACTAATCTACAAATAAAACTGCTAAGATATTGTTAGAAATTAAAATTAAAAAATTATCTATAATTTTAATTCATCTGAAAATTTTAT
AGTGATAATTCCAATTTTATATTTAACCATATATTTTATAACATTCAATTTGATATAGAGACAAAATAATAATCCAATTGGAGAATTAGAGTAAGCATTA
TGAGGAGCATTAAAATAGAAATTCAACTAATTATCAAATTAAAAATTTATGGAGCAGAAAATTAAATAACATGCCGAGAAAAAAAGTGCTACTAACTTAT
TGTTTAATTAATATTAACAGGAAGAAAAAGAAATTACAACAAATACTTATTATATAATTAATATAATATTTAACTATAGTATATTGACAAACAACAAAAT
AGTAATCCAGATTTAAGGTTTTGATCTTCCCATTTTTTATTATAAGAATTGTTTTAGATTGAAAGGCAAAATGACTGTTCATTCAACTTCTCAACTTTGG
CTATTTAATGTTTAATTAATTAGATATTTATCAATCACAATTTGTTTCTTATATATAAGAAATAAGTATAAGGATTAGAGTGCTGTAAAAAAATAAACAT
ATATTTGTTATTAGAAAAATTATTGAATCACACCTTGTTTTGATGGGTTCGAATGATATTTAGTCATTTTTTATCCATCTTTTCACATATTAATTAATGA
AAATATATGAATTTAATGCATTCTCTATTTCATATACAATATTTTACTACTTACTTCTTGTCCTTTTTTCTTTTGCATTCTTACTTCAAGCTCTTTACAT
CGATATATTAATCAACACAATTTAGCTAGAATAATTTATATGGTAAAAAGTTGTGGACTTATAGAGAAATCGATAACTAACTTACCATCTCCCTCATCAT
TCTTGCAAGTCGTGAAAAGCTTCAAAGTTCAATCACATAGATATAAATTAATCGTAAATTTGTGGAAGGAAGAAAATCAAATAGATTTTTAGAGTGTGAT
GATAAGAAAAAGAAGAAAAAACACATAAAGTCAATCAAAAATCAACATTGAATAGTGATATTGACAATTAAAAAGTATAACAAACATATTATCAAAGTAA
CGATTAATTGCAACAAATAAATTCTTACAAACGAATAGTCTATACAAAAGAGATACAACTACAAACACGTCAAATAACTAAATAGATTGCCTAAGAAAGG
AAGGGGTGAAAAAGTTGGAGAAACTTATAAAGAAAAAAACTTCCCTTCTGATACGTGTAAGACTTCTTATCACCATTTTCAAAAGTTCTATTCCTGAACA
GTAGATCGTCTTTAAAACATTTTTCTACTAGACTAACTAAATTTAGATACACTAACATGTGGTTTCAAACACTTGTGCGTTCGACTCTTAATAAAAAACC
AAGAGAAGTGCTGAAAATATCTTTAAATTTGACGAGATTTAGGGTGTATTTCACTCTTATTACAAAATCGGAGTGTACTAAAGTTCAATTAGTCGAAGAA
GAAAATGGTTTTAACGCGATCATTAGTTCAAAGTTGAAACTAATAATTCACGCCAAATTTAAGAGTGTTTTTATTACTTCTTTTAAAATTTACTTTTCTT
AAGATTAAATTTGTGAAAGACTACAAAATCAAATTAAACAAAATTAAGTTCTTTTCTTTTTTCCAAATAATCTCTTGACCATTTAAACAAAATAAAAAGA
GCTTTTCATATTTCTAATAATAAAGTTAAAATCAAATTTGCAATGCTAAAGAAATAAATGTCTCAAAGTTAAAAACAACTTGAAAAAATGCCAAATATCA
AATATGTCTATATTCAATGTAGCCATTCAGTCTTATCGCTACATACTAGTTCTGAAAACATGCCTTGCACATTTGATCTATGCTATTATTATAATTTATA
TAGACTCAAGATATAAAATTGCTCGACATTGTCTGAACTACTCCTATATTTTTTTTCGTGCATATAAAATAATTTTTTTTAGTGTTTACTTTTTGCCTAT
AACTTAAATATCAACAATTTTTTTGGTGTATGATGAACAACTTGAAAGGCTAGAACTGAGCCCCAAGGCTGAAATTTCTTGGATATAAATATTCTAACAA
TCATTAAAAATAAAAAAATGAATGAAGGACACAACCAATAAGAAAAATGGTGATCAATAAAAAAATATTACAAGAACTATTAGATTATGTGTTTCTTCAA
CAACCATGAAAATAAAAAATTAACGACATCACAAATCAATAAACTAAAATAGTGACCAATAAAAAGATACTCCTTACAGAAGAACTATTAGATGATGAAA
ACAAAGTGTGGCGGATTAATATTATTCAATTTATAAAGGGAGAAATTAAGTACACGAAAGGTTTGTCCATGAATGTATTTAATGGTAGAAGCTAAAAAGT
ATTAACAATCAAAGTCATTAAGAAATGGAAAATGATAAGTTCTAACATCTAATCATGTATTTAGTCTAGTTTAATTGTCATTATTGATTTAATTTTAAAA
ATTAGTAAAAAAAATTAATTTTAAAAATTAGCGAAGGACATTTTCGTAATCTAATTGTGAAAGACTACAAAATCAAATTGAACAAAACTAAGTTCTTTTT
TTTCCAAATAATTTCTTTGACCATTTAAATAGGAAAAAAAATGAGTTTTTCATATTTCTAATAATAAAATTAAAATCAATTTGCAATGCTAAAGAAACAA
ATGTCTCAAAGTTAAAAACAACTTGAAAAAATGCCAAATATCAAAATATGTCTATATTCAATGTAGCCATTCAGTCTTATCGCTATATACTAGTTCTGAA
AACGTGTCTTGCACATTTGATCTATGTTATTGTTATAATTTATATAGACTCAAGATATAAAATTGCTCGACATTGTCTGAAATACTCTTATATTTTTTTG
TGCATATAAAATAAATTTTTTTAGTGTTTACTTTTTGCCTAGAACTTAAATATCAACAATTTTTTTGGTGAATGATGAGCAACTTGGAAGACTAGAACTG
AGCCCCAAGGTTGAAATTTCTTGGGATATAAATACTCTAACAATCATTAAAAATAAAAAAAATGAATGAATGACATAAACCAATAAGAAAAATAGTGATC
AATAAAAAAATATTACAAGAACTATTAGATTATGTGTTTCTCCAACAATCATGAAAATAAAAAATTAACGACAGCACAAATCAATAAAAAAATAGTGACC
AATAAAAAAATACTCCTTACAGAAGAACTATTAGATGATGAAAACAAAGTGTGGTGGATTAATATTATTCAATTTATAAAGGGAGAAATTAAGTACATGA
AAAGTTTGTGCATAAATGTATTTAATAGTAGAAGCTAAAAAGTTTTAACAATCAAAGTCATTAAGAAATGAAAAATGATAAGTTCTAACATCTAATCATG
TGTTTAGTCTAGTTTAATTGTCATTATTGATTTAATTTTAAAAATTAGTAAAAAAAATTTAATTTAAAAAATTAGCGAAGGGCATTTTCGTTATATAATT
GTGAAAGACTACAAAATCAAAATGAACAAAATTAAGTTCTTTTCTTTTTTCCAAATAATTTCTTTGACCATTTAAATAGAAAAAAAATGAGTTTTTCATA
TTTCTAATAATAAAATTAAAATCAAATTTGCAATGCTAAAGAAACAAATGTCTCAAAGTTAAAAACAACTTGAAAAAATTTCAAATATCAAATTATGTCT
ATATTCAATGTAGCCATTCAGTCTTATTGCTATATACTAGTTCTGAAAACATGTTTTGCATATTTGATCAATGTTATTGTTATAATTTATATAGACTCAA
GATATAAGATTGTTCGACATTGTCTGAAATACTCCTATATTTTTTTTGTGCATATAAAATAATTTTTTTAGTGTTTACTTTTTGCCTAGAACTTAAATAT
CAACAATTTTTTTGGTAAATAATGAGCAACTTGGAAGACTAGAACTGAGCCCCAAGGCTGAAATTTCTTGGGATATAAATACTCTAACAATCACTAAAAA
TAAAAAAATGAATGAAGGACACAATGAAGGACACAAACCAATAAGAAAAATAGTGACCAATAAAAAAATATTACAAGAACTATTAGATTATGTGTTTCTC
CAACAACCATGAAAATAAAAAATTAACGACAGCACAAATCAATAAAAAAAAATAGTGACCAATAAAAAGATATTACAAGAACTATTAGATTATGTGTTTC
TCCAACAACCATGAAAATAAAAATGAACGAAAGCACAAATCAATAAAAAAAAATAGTGACCAATAAAAAGATACTCCTTACACAAGAACTATTAGATGAT
GAAAACAAAGTGTGGTGGATTAATATTATTCAATTTATAAATGGAGAAATTAAGTATATGAAAAGTTTGTGCATGAATGTGTTTAATGGTAGAAGCTAAA
AAGTTTTAACAATCAAATTCATTAAGAAATGGAAAATGATAAGTTGTAACATCTAATCATATATTTGGTCTAGTTTAATTATCATTATTGATTTAATTTT
AAAAATTAGTAAAAAATTTTTAATTAAATATCACAGGTTTGGAGCAATGACAGATATGAAAGTGCGGAACATAGGGTGATAGCAAGCTCCAAGAAAGAGA
GATTCTCCATTGCATTTTTCTTCAACCCGTCTCACTATGTAATGGTTGAGCCTCTGGAGGAACTGACAAATGAAGAAAGTCCAGCAAAATACAGGGCTTA
CAACTGGGGAAAATTTCGCACTACAAGAAACCTTAGTAATTTAAAGAAACTTAATGTCGACAACGTTCAAATATATCATTTTAGAAATGGGTGATGTGTA
ATGACAAATCATGTAGTGTATGAGAAGTATTATTAAGGTGTTGTTTTCAGCTGGAGGGAAATAAAGTGGTAGTCTTTTTCTTGTAAATGATTTGCTCATC
TTTCTATAATCTCAAGGCTTTATTTAGAATTACAAGTTTATGATCATCTGTAAATCAAACCAGCTTAAAGATGCATGCAAGAAGTGGGGATGCCAAATCA
ATCTTTTTTACTGCACTCTAAGGACACTCCCCATGATTTATTACTCGGAAGAATCCCAGTTCTGGCATATTGGACGGAAGTCAGTTAACGAAACTTATAT
TTTTTTATTAATCAATTACTCATTTTTGGGATTATCGAAATAAAATAAAATTTTTTAAAAAAGTGTTTAAATTTAATTTAAGGTTGCTATAGTTATTTGT
GAATTTTTGGCGTTAATTTTATATTTTTTCATATTCTTCCAATTTTTTTTATAATCAATTACTCATTTTCGAAATTTATTGAAAAAAATAAAAATTAAAT
AAAATTATTGAAAATTAATCGGATAATTTATTTAAAATGGGGTTGATATATGAGTCAGATTAAATGTTTATGAGTCTGAATATTTTTCCATTTTCATATA
AATGTCATGTGATAAGGTCAAAATGACATGACAATTCTATGTGACATTTAAAGAAATGAAAAATAAGTTGAATATGTCCAACATGGCAACTAACGCCCAT
AAGGGCATATTTGGATCAAAAGTTGGACAGCGAAAGCATGAGTGAACCAAACTTTAAACGGAGGTTATATCTAGACCTTTTCGAATAGTTTAAGGGCATA
TTTGACTCTTTCCCCTTTATTCAATGCCAAGCTCCCTTACCAGCTCTATTCTATATCTTTTTTTCTGCGAGTCATTAAAGTTGTTTACTCTATCCAATTA
AATCGAATCTCTTCCTCTCGTTATTTAAGATATAATTATTGTATATAGTGGAAGAAGTAATTCAATTCCGAAATCTCCTCATCTTCCCTTATTTAAGACT
CATAAATCATACTTTAATCATTTTGATTAGGAAAATCTTTTTAAAATTAAGATTTTATTGAATACATAAAAAAGTTAAAAAAATCTTTTAAAAAAAAAGA
AAAGAAAAACATATATAGATGCTGAGTTTTGGAGGTGTGAAATCACCATTTTCATTTCCCAACTATATAGTTATATATAGATTTTCTAAACTAAATTTCG
AGTAATATTAGAATTACACGATAGGTAATTTTTTTCTAAAAACAAATAAATAGAATGAAGTTGAAGCAAAAAACCGTAAATTAAATTTTAATGAAATGAT
AATAATGAGAAAAGTTTTTGGATATAAATGTTAATGGTGTGCCAAATTTATAGTAATTCCTTAATTGTTTAGTTTATAAAGAGTAAAAATGCACTTGCCA
CTTTTTTTTTATTATTATTATTATTTAATTTTTAATTCATTAGATATAATTATAACAATATGATATGATTTACTTAATATTTAATTAATTACATGTTATA
TATATATATATACATACATACATATATATACATACACTGTTTTCATTAAATTTATTAAAATATTTTAATTTATAAAAAGATAAAATCATAATTCAACTTT
TAACTGAAATATATATATATATATATATATATATATCTTTTAGTTTAAGTCATAAAAATTATTTTAAAAAATAACTTTGAATCTATCTCAAGTATAAAAG
GATAGTTAAATATATTTTGCTTTAGCCACTAATTAGTTTGAGCGGCCACTGAGACTCTGTCGCCTCCGTAAAGACAACAATTTCAAGTGTCGCGTCTGCC
ACTCTAGTTTTGCTGCTGGAGTGGATCTGGCTAAAGACAAGAAGAGAACCACTAATCGGTGGAAATACATGAAGGATGGATGATACACGAAGGAGGTGAA
GGAATGAAGAAGTTACTTTCTATTTGTTTAGTCTAATGTATCATGTTAAATCAAGTCTTCTGCTACTTTCTCTATCCTGTTGTCTATTGTTCTACTGTTC
TTTTGCTAATTCGCCACAGCACCAGATGAATTGGAACTGATCCAGGGTCACCGTGATGTCGAAGCCCAATCATCTTTCACAAGACATAATACATATATTA
AAAGTTGGCTTCAAATTTTAACTTTGACCTCCAAATTTCATAATGCACAAATATACACTTTAACTATTTAACTTAAAATAACTAAACACATCAGTCCTAC
TTGTCAAATACACGTAGGACAAAAAATGACATGTAGGATGATATGTAGGACATGCATGTCTATTTGTTCAACTTAATAAAAATTTAAGTGTCTACTTATG
CACACCCAAAGTCTAATAGCTGTTAATTAAGGTGTAAGGCTGATTATAAAACTTCAGTTAATTCACATATCTGATGCATTTACATGGCGATCCCAGTTCT
TTCATGGAAGTTCTATTAGCGAGCTAGTTGATTTCTTTCATGGAAGTTCTATTAGCGAGCTAGTTAATTTGATATTACACCTATTCTCTTTCAGATATTG
TTTCCTTTCATTGAACTCTATTTTCGATAATCAATTGATGAATGACTTGCTTGATCTTAGGACTTGAAGAAGCAATGATTAATATAAATTGAAGGATCAG
AATAAGGTCCCGATATTATTAACATTCATAATTAAACATGTACATTACTTATTTCAAGTAGTTAGTTAGTTAGTTACTTTCCATTTTATAGTTAGTGGTG
TCATAGTTAGTTATGTAACTAATTAGTTTGTTAGTTTGTTAGATTGTTAAGTTGTTAGTTACTCTTTTCTTTCTCCACTAGATTGACAATCTCACATGTA
TATATACACCTCTTGGGTGATCAATGCAATCAATCAATCATCTTCTACAATACAATCTCAAGAGTATACTTTGATATTCTCCTTATGGAACTTCACAGCC
TCATCAATGGCTGCTCAAGTTCAGCTTGAAGGTTTCGATATGGTATCAGAGCACAGTGAATTGCTCTCTTCTTTTTGGTTTAGTTACGTGTCTTAGCAAT
CGATAGTAGATCCTGAAGTTACTCTGTTGATTACATTTGTTTTCCAGAGATTTTTCATCTCTGTTCATCTTCGTTTGCATCTCTGTTTCTCTTCTTCTTT
TGCTCATCGAACAGCTTAGTTGTGATGGCTGTTGAAGCTGTGGCATCCACATCTGAAGGATCTGTCACATCTGGAAACGATACAAATGGTGTTCTGTATG
TACATCCCTCGGATAATCCAGGGATGATGCTTGTTCCTGTCCAATTTGATGGAACAGGATATAGGTCTTGGAGAAGAGGTGTAATGAGGGCCTTGTCAGT
GAAAAATAAGTTGGGTTTCATTGATGGAAGTTGTGAGAAACCAAACAACAATCCATCTCAATTACGTCAATGGCAAAGATGTGATGATATGGTGACATCT
TGGATACTAAACTCTTTAATCAAAGAAATTTCAGATAGTGTGGAATATGTTACCAATTCTGCTGAGTTATGGAAGGAGTTGGAAGATAAGTATGATCAAA
CCAATGGAGCAAAATTGTATCAAATCCAAAAGGAGATCAATGATCTCACACAAGGAGTTTTGGACATCACTGTCTACTACACAAGAATGAAGAAGTTGTG
GGAAGACTTAAACACTTTGAATGTGAAGAACCATTGTAGTTGTGTGTGTGTATGTGGTGCGAAAGATGGTATGTACAAGGCTGAGCAAGATAGGCGGTTA
ATTCATTTTCTTATGGGATTAAATGAAGTGTACACAGTGATAAGAGGAAACATTCTCATGATGAATCCTCTTCCATCCATGGGGCAGGCTTTCTCATTAC
TAATTGAAGAGGAAAAGCAAAGAGAGCTCAAGCCTGTTGGTAGAACAGATTCTGTTTCCCTGAATGTTAAAGCTGTTGATAACAAAGGCCATGGAGGAAG
ACCTTTTAGAACAAATTTTCAAGGGAATAACTATGTAAATGGCTATGGAAATCATAGTGATACTAACAGTAACTCAGGAGGGAGTTCTTATCCAAACAAC
AGGAATGTCATAGTATGTGACTACTGTAAGAGGACTGGGCACATCAAAGATAAATGCTACAAGCTGCATGGGTATCCCCAAAGCAACAATAATCAAAATA
ATAGATCAGGAAATTACAGTGGTGGTCAGAGTTCTAGACAGCAAGGCTCAAATTACAAAGGAAGAAGAGTGGTAGCAAATGTACATGGTACTACAGGTGA
TGTGGTGTCTGGTAATGGAGAGGAACAATCACAATCTCAAGGTGACAACTCAAGGAATGTTAACTTCACAAGAGAACAATATGGACAGATCATGAATTTA
TTGCAACATTTCCAAAATGGGAATATGGGAGAAGAGACTGGGGCTAATAATACTTCTGGTGTGGCTGCTGGATCAATGAACTTTGCAGGTACTGTGTTTT
GTTCTTCCTCTACTGTTGTTGACAATCCATCTTGCAAATGTTTCGAATCAAGTGCTAATTTGTGGATCATTGACTCAGGAGCTTCAAACCATATAACCTT
TAGTAGAAACTCTCTAAGGAACATTAAAACCTTACCTTTTCCTATACTTGTTTCTCTTCCAAATGGATATAAAGTCAAAGTAACAGAGTTTGGGGAAGTA
CCAGTCACACCTAGCATCATTTTACATCAAGTTTTATATGTGCCTTCTTTTAAGTATAATCTAGTTTCAGTTCAATCCCTAACTGCTACAATGAAGTGCA
TAGTCTTGTTCACTAATGCATTGTGTCTATTGCAGGCCCTTTTAGTGAAGAGGCCTCAGGTTCTTGGTAATTGTAGAGATGGGCTTTACTTCTTGTGCAC
AAAGTGTTTGAAGGCTTCTAATAAAGTCAATACATGTCAGATATGCTGTTGTTTTTCCAATAATAAACCTTTGTCTAGTTCCATTAAGAATGATACATGT
AATTCTTTTTCTGCTAGTCCTTGTTTTCCAGATCAGTTCAAAGTGTTGGTTTCTAATTTTGTTCCTCTTAAGTGTAAACTTTCTCCTAATAATATGAATG
TTCTGGATGATCACAACTCTTGTAGTATTGCAGGAGATAATGTAGATTTGTTATGGCACAATAGACTTGGCCATGTACCGTTTGCTAAGATGAAAAGTAT
TACTGACTTACTAGCTGTTTTCTCTCCCAAACAACCTTTTTCCTGCAACATTTGTCCAATGTCAAGACAACAAAGGCTACCTTTTAACCATAGTAACAGC
CAAACCAAATCCATTTTTGAGCTACTACACATTGACTTATGGGGACCTTATCATGCACCTACATATGACAACTACAGATACTTCATTACATTGGTGGATG
ATTATAGTAGATCAACTTGGACACAACTTTTAAGTACCAAGAGTAATGCATTACAAGTTTTAAAGAATTTTACAGTCATGGTGGAGAATCAGTTTAATAC
CACAGTGAAAAGCATTAGAACAGATAATGGACTAGAGTTTGTTAATAATGAAACACACCAATTTCTTCTGTCCAAAGGGATTATCCACCAAAAAAACTTG
TCCTTACACACATCAACAAAACAGTATAGTGGAAAGAAAACATAAATACTTGTTGGAAACAGCTAGAGCACTTCTATTTCAATCTAAACTGTCTATAAGA
TACTGGGGAGAGTGTGTGTTAACAGCTACACATCTTATTAACAGACTTCCATCAAGTTATTTGAAAAATAAGTGTCCATATGAAGTGTTATACAATAAGA
AACCAAACTATAGTCAGCTTAGATTCTTTGGTTGTCTTTGTTACCCCACTATTCCAAAGGTACTTAGAGACAAGTTTGAACCAAAAACCACACCACACAT
TTTCTTAGGATATATTTTTGGAACCAAAGGTTATAAGGTGATGAGTCTGGCTACAAAGAAGATACATATCTCCAGAGATGTGATTTTCCATGAACATGTT
TTTCCTTTTGCTTTGTCAACTGAAAATCCTTCTTTTCCTTCTGTTTTAAAGTCTTTTTCATCCTCTGATTATGCTGATTTAGATTCATATAAAGGCTGTG
TAAATGATTGTGACAATGTGACTGATACAACTCCTCCTCATATATCTTCTCACATTAGTCAAAATCCCAGTATATCTTCCAGTGCTCCCATTACCTCTTC
AACATCATCCCAACACAATCCTCCCACAATAGTACAGAGAAGATCTCATAGAGAAAACAAAATACCATCACATTTGAAAGATTATGTTATCAATATCCCA
AAACTAAAATCAGTCAATTCCAACACACAAAACACAGAGATCAACAATAATCTATCCCTTACTGCATTGTTTACCAAACACCACCATATATCTCCTGAAG
TCATTGCATCTACTAGTCAGTCACTTGTTGAGAACATTTGTCATGATAGTGAGCCATCATCATATGAGGAAGCATCACTGAATCTTGCATGGCAAAAGGC
CATGATACAAGAGTTTGAAGCACTGTATGATAATGACACTTGGGATCTTGTTACTTTACCACCAAACAAATAAGCAGTTGGATGTAGGTGGGTATACAAA
GTAAAACACAAAGCATATGGGAGCATAGAAAGGTTCAAGGCACGATTGGTTGTGAAGCGGTATACACAACAGGCTGGAATTGATTACACTGAAGCTTATT
CACCTGTAGTCAAGATGACCACAGTGAGAACTTTGATAGCATGTGCAGTAAAGAAGGGTTGGAGTATGTTTCAACTTGATGTAAATAATGCATTCCTTCA
TGGAGATCTTCATGAAGAGGTTTACATGAAATTACCTCCAGGACTTGAAGTACCTAATTCAGAGCTAGTTTGTAAGCTGAAAAAGTCTCTTTATGGCCTC
AAACAAGCAAGTAGGCAGTGGTATTCTAAGCTAACTGAGGCATTATCATCTAGAGGCTACTCACATTCACAATTTGATCATTCTTTGTTTTACAGAAAAG
AAGGTTCTTTGGCTGTATTTGTTGCAGTATATGTAGATGATGTTATTTTAACAGGGACAGACACAACTGAGATTGCACAGCTCAAAGTATATTTAGACAA
CACCTTTAAGATCAAAGATCTTGGAAGACTTCACTATTTTCTGGGCCTGGAGATTCTTGATACAACAGATGGAGTACTAATTTCTCAGAGGAAATTTACT
CTAGACTTACTCAAAGAATATGATTGTTTCAACTATACACCTCTATCATCTCCTTTGGATCCCACTGTGAAGTTGAAAGCCAAGGAAGGAGTTCCTTTAC
CTGATCCCACTTTCTACAGAAAATTGATAGGAAAGTTGAATTTCTTGACTAATACTAGATTGGACATAGCTTTTAGTGTTCAACATTTAAGCCAATTCAT
GCAGGATCCACGAGCTCCACACTTACAAGCAGCTTATCATCTACTTAGATACCTCAAACAAGATACTACTTTAGGAGTTCAGTTATCCAAGAATCCTGAT
TGTACAGTCCAAGCATTTTGTGATTCAGATTGGGCATCATGTTCAGATTCAAGGAAGTCAGTCAGTGGGTACTTGGTGTTGCTTGGTAACAGTCCTATTA
GCTGGAAATCTAAGAAACAAGAGACAGTTTCACTATCTTCAGCAGAAGCAGAGTATAGGTCACTCAGAAAAGTTGTAGGAGAATTAACTTGGCTTCACAG
ATTGATCACTGAGCTAACTGTCTCCATTTCCTCTCCTATTAGTGTCTACTGTGACAGTCAATCTGCAATCCATATTGCTCGCAATCCTGTGTTTCATGAG
AGAACTAAACACATTGAAGTGGATTGTCATTTCGTACGTAATAAGCTTCAGGAGGAGTTGATTTCTTTGCATCATGTGTCTACCTCTAATCAACTTGCTG
ACATTCTTACTAAGGCCCTCACTGGCATCAAGCATTCAGCCATTTTGCGCAAGTTGGCTGCGAAATCATCACCTCCAACTTGAGGAGGGGTATTAACATT
CATAATTAAACATGCACATTACTTATTTCAAGTAGTTAGTTAGTTAGTTACTTTCCATTTTATAGTTAGTGGTGTCATAGTTAGTTATGTAACTAATTAG
TTTGTTAGTTTGTTAGATTGTTAAGTTGTTAGTTACTCTTTTCTTTCTCCACTAGATTGACAATCTCACATGTATATATACACCTCTTGGGTGATCAATG
CAATCAATCAATCATCTTCTACAATACAATCTCAAGAGTATACTTTGATATTCTCCTTATGGAACTTCACAGCCTCATCAATGGCTGCTCAAGTTCAGCT
TGAAGGTTTCGATAGATATCAAGTCAATTGAACTTTTCGAGTATTTATTTCTCTTCTTTTATTTGATGGTGAATGATTAAACTTTGGTTTAGTTGACCGA
AAGATGCAAGAAGAGAAATGACAAATGTAGTCTATGAGAAGTATTGTATTATTATGCTAGTGGGAATAAGGTGGGTAGTTTTTTCTTGTAAATGGTTTGT
TATATTGATAACCTTCAATCATTTTTGAGAAACTACAAATTTCATGAAGTGGGAAAGGTACTAATTACCTACTTTCATAATTTAATCATCTAAAGTTGTT
GCAAGAATATGCAAACAAAACTCCCTCCAATGATTGTAATAAAGAAATGTAGCAGGTAAAGGTATCTTTGGCACGGAGTATGTGCTTGAGCCATCGTGGT
GATTATAAAACTCCAGTAACTTGAATCAATTTTTTGTATGACAATTGTGATCCTCTTAAGCAAATAATTGAGCAATGGTAGAAGTCCATCCAGCAATCAT
CCAAGATGTCGAACACAGGCCAGATCTCACCAAAAGTACTGAAGCAGAGGGCATTCCAGTGATTGATCTCTCAATACTGAATTCTCCAGACACATCGACT
GACGCGGAGTTATCAAGTCTAGTTGGTGAAATAAGAAATGCATGCAAGGAGTGGGGATTCTTCCAAGTGATCAATCATGGGGTGTCCTTAGAGTGCAGGG
AAAAGATAGAATTGGCATCAAGAAAGTTCTTTGCTTTACCTAAAGAGGAAAAGATGAAAGTGAAAAGAAATGAGGTGAACTTCATTGGATATTATGATGC
TGAGCTAACCAAAAAGATCAGGGACTGGAAAGAAGTCTTTGATTTTACTGTTGAGAAGACAGCTATGGTCCCACTTTCTCAAGATCCTAATGACAAGGAC
CTCAGGGACTTTCAGAACCAATGGCCTCAGTACCCTCCAGGATTAAGGTAATTAATACTATTCTACCATCAAAAAAATATCTTAGGGAAGAAAATTTATT
CCTGAATATGAAAAACACCAAAAAGCTGTTTTTACTCCAAAATGATTTTTTAAATGTCAAGGGTATAATTGATCCCAAAGTACAACGGAATATTTCGCGA
TTTACTTATGATTGGATTTTCAGGGAGGTGTGTGCAGAGTATATTCAAGAAATGCAAAAGTTGGCTAACAAGTTAGCAGAACTGATATCACTCAGCTTAA
GCTTGCCAGCAAAAAGGCTGAATGAGTTCTTTGAAGACCAAATTGTTTTTGGAAGGATAAATCATTATCCTCCTTGTCCTGTCCCTCATCTGGCTTTAGG
AGTTGGTAGACACAAAGATGCTGGTTTATTCACCATTTTGTGTCAAGATGATACCGGAGGGCTTGAAATAAAGAGGAAAACTGATGGAGAATGGATAGGA
GTTAAACCTACTCCTGATGCATACATTGTAAATCTTGGTGACGCTACACAGGTACGTCTTATCAAAGAAAATAATGTATTGTTGATTTATATATATATAT
ATTATATAAATGATCGATCACCAGGTGTATAGCAATGATGAATATGAGAGTGTGGAACATCGCGTTGTGCTGAACACTGAAAGGAGTAGATATTCAATTC
CTTTCTTTGTCAATCCATCGCATAGTACTTGGATACAACCCTTGGAGGAGAAGGTCAATGAGAAGAACCCTGCAAAGTATAAGCCCTATAACTGGGGAAT
GCTTTTCACTCATCGCAGAAAACACGATCCCAAGACGCGTGATGAGGAAAACCTTACACTTGATCATTTCATGGCTTGAAACAAATCAATTTTATGTTTA
TGTCTTCTTCAAGTAAATGTGTCATGTAATATAAATAATAACATCTTTATTAGTGTCTATGTCTACTTAATTTCCTATATGTGTAATCCCAGCAAAATGT
GTCAATGTAATCGTTTTCATCCCATCTTATATTATAATGCTTAATGTGATCTTATCTTTGGCTTAACATATCATATCCAAGAATAGTTCTGTGACTGATG
TCCATGAAGAACAGGAAAAACTTACTGTCAGACTGATTTCCTCGCAGTCTTAGATATTCGTATGACTCTAAATTTCATAATTTAATTAAGGATAAAAAGA
GAATATTAATGTTATGTTGTTTTTTAATTATACAAGGATAACATTTTTTTGGGAATGAATTGTAAAAGAAAAGTGTGTCAAATAAATTTATTGTATCTAA
ATGAGCGTTTTTCTTCTTAATCTTGTATTATAATGTCATTTAGGTAGAATTTTCATTTCATAATAATTTTAGAGGAAAATAGAGAAAAAAATATGAATTT
GCTATGGAGCGCACAATTATGCAAACTTTGCTATAGCATACAAATATGAATTTTTTATTTGCTATACGTGCAAATTGCCCTAAATAAAATTATACTAGTT
TCTTGGTAAAAATATCTTGCTACAGTAAATTTCTTCCCTAAATTTATTATTAATATTTGATTTAACCAAAATCCAACCATTAAATTACCATCCATAAAAA
AGGGCAGAATTAGCGTATTCTTTCTTCATGAGTCAAACTTACCATTTGGAACTCTCATAATTTTTTTTCAATAAATTCATAAAGAAAGCAAACAAAAATT
CCACATTCTTAAACATTTGTTGAACACAATGAATTTGAACACATTTGTGTGTTTCTTTTTACTCTTTTCGAATGTTGTGTCTGTTTACTCTCAGGGCAGT
GCTGCTACAGATGCTGCAGTGATGCAAGAATTCAAGAAACAAATAATAAATCCTAATCCACTTAACTGGAACGATCCAGATCCGTGTAAATGGGATAAAG
TTCAATGTAGTAAGGATGGTCGCGTAATTAGGATTCAAGTAGGGGATCAAGGCCTAAAAGGAACTCTCCCATCAAACATTAATACCCTTACTGAATTGCA
AGTTTTTGAAGTTCAAAGAAATACATTCACTGGTCCGCTCCCGAGTTTTTCTGGATTAAACTCATTGCAGACCATTCTTCTTAATGGCAATGGGTTCACT
TCAATTCCTAATGAATTTTTTCAAGGTATGACTAATTTGCAAAGTGTTTACTTGGATTCAAATCCCTTTTCATCATGGACTGTACCAGAAAGCCTGAAAA
GTGCGACTGCTCTTCAAATATTCTCCGCTTATTCTGCTAATATTACTGGTAAAATCCCTGATTTATTTGGTGGAAATACATTCTCTAGTTTAACAACTTT
GCATTTGTCCTTTAATAATTTGGAGGGTCCTCTGCCCTCGAGCTTTTCGGGTTCTTCTATCCAATCGTTGTGGTTAAATAGTATTAGAGGTAAGTTAAAT
GGCTCAATAGATGTGATACAGAACATGACCAGATTAACCCAACTCTGGTTTTCAGGCAATCAGTTTACAGGCCCTTTGCCTGATTTTTCGGGGTTAACTC
AGCTGGAAGATTGTAATTTGAGAGATAATAGCTTCACTGGTCTAGTCCCAGACTCTTTGGTCAATCTTCCTTCATTAAAAGTGGTTAATTTGACAAACAA
CATTTTGCAAGGGCCTACGCCACAATTTCCATCTTCAGTGCGAGTGGATATGTTGGATAATACCAATAGTTTTTGTTTGTCACAACCTGGTCCTTGTGAC
TCGCGGGTTAGTACACTGTTGGATGTGCTTAAGGACGTAAGGTATCCCACGAAGTTTGCTGAGAATTGGAAAGGGAATGATCCGTGTTCGCGTTGGCTTG
GCATAACTTGCGATGGTGAAAACATTACAGTACTCAATTTTCAGAAAAGTGGACTTACTGGGATCATCTCTTCAAACTTGTCGTCTATTACGTCAATACA
GAGGCTGATCCTAGCAGACAATTCTCTTACAGGGACTATCCCAAATGAGCTCACATTGCTGCCAAAATTAACGGAATTGGATGTTTCTAACAATCAACTG
TATGGAAAAATCCCACAATTTAAGAGCAGTGTAGTGGTTAAAACTGAAGGCAACGTCAATATTGGGAAAGATAAGCCACCTACATCTGCACCTTGAACGC
GTTCTGATAAATGTATTAGCAAATGTAATAATCTATAAGAAGATTTGTACTATATATTAAGCTATTTAGATATGATTCTCGTTTCTTCGAGATAATATTT
CTTATAGTCATTCAACTAGTATGATATTTTCTCAGACTTAATTTTGATATCAAAACTCACTATAACTGAAGGGGCATCTCAATGGTTGAACCTCAGTATG
TATTGAAAAAATAATATTCAAAAAGAAAGAATCGAATCAATGAACAAAAAAACAATGGACATAGGAATATTAACAATATCACGTACCAAAACCTATTTAT
TTCTTTTGTGTTTTTTTTCTTTTGGGCAAAAAATTATATAAGTTGATACATTTTAATAAATAATTACAGATTTTAGCTATACTTTTTATTTATTATCATT
TATAGCAATACTATGTATGCAATTTATATGAATTATAATTGTTTTTGAAATATATTATGTTTGTTTGATAAAAATTTGACATATTTAAAACTTGTATTAT
ATGTAAATGATAAATTGTTCTTTCTAATATGTATTAAACTTGTGTTAAAAATGAATTAAAAGTGATTAAATGAAAAAAAAATATTATTGCTATAAATGAT
AAATATTTTTTATTAGTAGTATATTTATGTAAATTTCCCAATTTTAAAATACAAAAAATTCACCTAAATATTAAAGATATTCACATCTAATTATTTCTTT
ATCAATGGTCATATTTAATTTAGTTTATCATTAAATGTTATTATTTTCTTTTCCTTAATATTTCTCATTTCCTTTGTTTTCGTATTTTCATTTCTTCCCT
ATTTCTTTAAATCACCTTTTCCCCCTTTTCAGTTTCTTTTTATTTATTTTTTAATTTATCCAATTCAAGAAACTTGTATTTCTATATAATATATAAAGTC
TTCTTTTTGAAAAAAAATAAAAATATAATTTTGTTCCCTAAATCTCATCACTTATGATATTTATAGCATCTTCTTAAGTCACGTCTTCCTTTCTTATACT
TTTTTACTTTTTATTTACTTATTCACGTCAAGAAATTTATGTCTTTATTTAGTATAAAGGTTTCTTTTATCTTCTTTTTTTTCCTTCTTTAGTTATTTTT
AAAACCATAACTTATATCTATTGAACTTCTATTTTAACAATAAAATTAATTTCATGACTTTTAAATTTACACATTCACAACTTCTAACTATGAAATTATA
AAATTTAAGATACTTTACGATGTTTCTCCATTTTTGTCAATATAAATGCATAATTTTTTGTTTTATTGTTCTTTGTAGTGTTATTCTATCATCAAATCCA
TGTGTTAACTTGACACGATGAACAAGACTCTTGAATGTTGATTAATTTGATAAAAAAAGTGGGCACTTATTTTGTTTTCTTATTTTTCTCTATTTTCTTA
TGATAAAGATTACAAGGAAGATATGTGTGTTTATGTTTTTTTTATGTAACTTCTTTTAGTTTGAATTTGTATAATTTTTTTACTATTGCAAGTTTATATT
TTTGTTTAGATGCAAACAAGTTATTGTAACTTTGTGTGTAATAATATTAACTACTAACCAATGTTCAACAATATTATTGTACGAAAAATTATTTTAAGTT
TTTAAAAAAAGATTCATCTATTTTTTTCATATAAAATCATAATTTTTTATTTCATGAAAGTCCTACTCAAGATTAATCTTTTTATTTCATATTTGAAGTC
GTGTTTTCCAAATTTTGTTACTGTAGTAAAGGTAGACTCAATAAAGAGGACTCTTAGATGTTGATCAGTTAGTCAGAGGAAGTGTTGATAAGAGTTCAAA
AATTTATACGTCATACGTGAATGCACACTTATCGTTTTGATTATGGAATTAGAACGACTTCTCCTTCCTTGTATCAAAAGGAGGGCAAGATCAACTTAAA
CTTAGCATTCGGGCTTTGGTTTTCTGCGCTCTAGGCTAAAAAATTCATCCTTGACTTAGCTAGCGTTTGGTCATAGATTTTTAAATATTTTTGACAAATA
TTATTTGAGTGAAAATTTGATGACTTTTCACCATGTGTTTGGTCATAGGATTTGAAAAATATATTTCACCTTTTTAGAAAAATATGATTTATACCCATAA
GTTTTAAAAACTATCAGAACTAACTATAAGTTTGTATTACAAGTCAACTGGATGTTCGTTACAACAATAACAAATAGTGTCCATGACACTAGAGTAATAT
GGTAATTTGGAGTGAGTGCAACAAACATCATTGCATACATCATGAAGTCTACAAAGCACGTGACTTTGTTACCTTGAGTCAATTTTTCATCATTTTCATC
AACAATCAAATCATTATTTAATATTCAGTAAATATTTCATCACTATTTTGGTGTTCCACGTAAAAAATTATGTAATACAACGCAAACAACTATTATAGAG
GGTGTTTTTGTAAAATATAAAAGTTTGGAATAAAAATTCAATTTTCAAAAGATTCCAAATATTAAGATTTGGTCCAATTATTAGAAAAACTAGTATTTAG
AAATTTGGGATATTTACTAAAAATATTTACTAAATAATGACAAATTGTATAAATAAATATTATTTTGCCAAATTTTTTTCAATATTATTTGAGAAATCTC
ATGGCCAAACAGGCCCTTAGTGAAATGTTGTCTGAGTGAGAATGATTGAACCAACACAAGTCGTAATTAATTACTAAAATAATGTGATTAGTTATTCCAT
GAAAGATGGAATAGCTAATTTTATAATATATATTTGTCTGTCCAATTTTAACCAGAAAAGGACACTGAAATTGCAGTGATTTAATTTTATGTTTAGGTAA
CAGTTGACTTTGATAGTAACTGGTATCCATTCTTCTCATAGAAACAGACTAATCAATCTAATGAGTTAATCAACGAAAAATTGCACAAATATCTCCTTAA
TTTATATTTGAAATTTCAGATACACATTTATATTATATTAAAATTTTATTATTGGACTCACGAAATAGTGTTACGTAAGCAGAAAAAAATAAAAAATTAT
TAATAAAATAAATTTGAGATAATAAAACCTTAGTATAATATAAGTGTGTCTTTAAAATTTCGGATGATTATACATTATCCCTATTTGAAATAATGAATCA
TCAAACGTCCAAATATTTTAATAAATGTAATTGGAAAAAATAACACACATATTCAATATAAAATTCCCAACAAACAATACCTGGCAGCAGGGAATTAAGT
TAGAAGGTCAAACACCTAGAGTATCTATCAAGTTGACGTTATAATGGACCATACAAAATTGAATAGCGGTGCAGTTGGGTTAAGCTTCCACAAAAATAAT
AATAAGAATATAATGACTGAATTATATTTTGATGACCTTTGGTCAATTTAGTATAGGTGTATAATTAATTTATTAATTACATTATTGATGTATGTGATAA
TTGATAGAAGAATTTTCAATTTAGGTGAAAAACTAATTTGAGATAAAGAAGAATTTTAGTTACCCTTTACTTTGTTGTTGTCTGCTACTGTAACGGTTGA
AACAACTTTCACAATAATGAATTTATGAAATTTTAGATGATTGCATATATAGTACCTTAAGTAGAAAAAAAATGTTTCTTACTATTTAATTGATCTATTC
TAAAATATTTTAGGAGATGAAACCTTGTTGAATATAATTGTTAGTAATATATTTAAGTTATATTTTTAATTTCTTCATGGTCGGATGCTTGTCTTTAAGC
AGCTGGCTTTCACGTAGCTGCAGCTGTAGAGGATAGTCTAAAAGCTAACTTTGAAACAAGGTAATAGGAGAAACTAAATAATAATCGAGTGAAGATTTTT
TGTCTTTCTTATGTTAGTTTCGAACTATACGAGTGCTGATTTTATTTTAAAATTTATAATTTAGTAATTTACAATTGGTTGATTTGGTTTTAATTTTTTT
TAATACACCTGGTCATTGGAGATATTTTTTTTATGTCTGAATATTATTTGTGGAATTTCTAAGTATGACACTATATTACCGTACGTATATGATTGATATT
TCTACGTAAATAAACCAAAACAATTTTATCTCGTTATCGTTACTTAATTTGTATTTTCTGTTCCTTTCTTCTTCTTTTTTTTGGCTTGTCATTTTGCTGT
TGTGTTCAAATTTTCTCCCCACACACTGAAATATGAGACCACCAATAATACATCCAACAGAAATAATTAGGAACTATTTTATGCTCTTCCTAGAAAGAAT
ATCTCGAGGTTTAATTTTTATTAAATATTTTTTTGATTGAATTTCTTTATATGTTTATTAAAAATTTTAGTTATTAATTATTATAATTTATATTATTTTT
ACGTAATTTTTAATTATTTATAAATTTTCTTTCAAAAAAAAATTAAATTTTTTTAAATTAAATTCACGATTAAAGTTTCCAAATTCAAATCTAAAAAATT
TGAACTTTCAGCATAAATAAATTAGAACATGTGCTGCTCCGAAGAACGGTGAATTTGTCCGAAGACTTACGTATTCCAGTTTATTAGGGGTGAATATGAT
AAAGACATGATTATGTGATTTAATGACAATTACATAAGTTTGGTTTTCTAACCAGATTTTATTCATTCTTAATCAGATGTATCTAGCGTTTTAACTATTA
TAAATGAAATTTTTCAACGTAAATTTAAATTTAATCAGATCTTAATAAAGTCAAATGAAAAATAAGAAAATACTCTCTCCGATATTATTTGTCATGATTT
CTATTTTTAAAGTCAAACTATAAAAATTTTGACTAACATTTTAAGATATATTTTTTTTATCATATCAATATGCAAAAAAAAAAGTAATTTATAGTACTTT
TTATATAGTTTTAAAATATCTATTTTTTTGTTTTCGAATTAATGTAATCTAATTTACCTTTAAAAATTAGTCAAATTGACTTTCAATAAATGCAACATGA
TAAACAATTTCGAACAGGGAGAATATATAATTGAGACTTAAAGAATTTTTAGTAAAATTTAAAATTTAATCGTACTTTAATATCAAAATCGGACGCATGA
TGAGAAAAGAAAACTAGGTATATGGTTGGCTTCATTAAATACGAAAAACGGCGAGCTTCCTGAATACCAAAAGGAAGCATTGAAAGCTAACTATAGCAGT
ACTGAAGTAATTAAGATGATGCATTCATAATGATTTAACTAATTTTCGGAGCTGCATTCCCAAATTATTATTGTTGTCTTGAAGAAATTTTAGACTAAAA
ACGGTCATCACTGATATCAGTATGTATGAAACTTCGTCGAAAAATTATACAATATATATGTTAAATAACAACCTATAACATAATAACAAAGATATGCGTG
AAGATCTCTAGCATAATGGAAAAGGCCTATATAGGGTATGCATGAAATTATAAAGATATAATATATAAATACGATTCTTAATTTGACGCCAGTTCATAAT
TATGACCGTTAACTTTGGATATGCACAAGTAGATACTTAAATTGTATAAAATTAAATAAATATACACATTCATTCTACATGACACTCTACTAGATAATTT
TATGTCCTACGTGGCATCTTACGTCATGTAAGACACGTGTGTCGATTTGTTCAATTTTATACAATTTAAACACCTATTTGTGCACACTCAAATTTGGAGG
ACATAATTTTTCGCTAAAACTAAGTTAAAGACTATGTTTATGTATTATGTCAATACTATACGAAACTTATACGACACTCAGGTTTAATTATTATTTCAAT
TTGATAATTAATCAGTCTCCTAGATGGGAAGTGTGTAGGATCCCTCTTTTTGCCCAAGTTACCATCATTCTTGTACCTCTGCGGTTAGGTCTTTCACCTA
TTTAAATAGGCAAGACAAAGGTCATTTTACCAAACCTAACATCAAGGCATTTTACGTTGATGATGACAATTTTATTTTTTTTAAAAATATATACCGCAAC
GACATATGCCTTATAAGAGCGATTATTGATCCACTTGTTTTTAGTTAAATTTCATCTAATATTTAATATTCGTATTAAAATTTAATTAAATTTATAAATG
AAAAAATCTCAATTATGCTCTATTCTAACACGACATTGCTGTCATCTCCAAATATTAATAAGATTGATCTCCTTGTAATAATTAAAGTAAATTGGCCAAA
TTATAACTTGTGATGTTGATGATAAATAGTTTAAAAATACTATTAAAACAAAATAAACATAATATTAATTAGAATTATCCTAAAAATGAATCAAGCATGT
CCACATTAAGACCAAAGTGGGGACCCCACGCGCAAGTGACAGCTGTATTCATTTATTTTTTTCTCTCACTTCATTACCCACAAGAGACTTCTCCTTTTTA
TAGAAAGCTTAACAACTCCCATATTTATCATCCCTTTACCTTTTGCACCCCTAATATATCCACTATTTTGCATGTTCTAAAACCACTTTTTAAATAACTT
TTTTTTTAGTGATGCAAAACTACATTTCACCTCAAATAAAATCATTTTAAAATAAATTGATAATAAAGAATTTATTTAAATAAATTTATTTTATAAAATT
ATTCTTATTACTTATATTACGAAAATCTAAGTTTGACTATTGATAATTTATGTTGATATTCAATAATAAAAATAATATACTTGTTGACCTTTCGCTTTTC
TTAATAACTTATTCACTACTCTTCTAAATAATTTTTATTCATCATATATTGAAAATCTAATTTAATTATTGATACTTGGTATACATAATCAATAATAAAT
TTTTTAATTAAAATAAAATTACCTAATTTTTTTTTAGGACAAAATAGAATGGAGGTGATGACAAATTTGTAAAAATAAAATAAATTTAGCAGCACGGGGT
TAAAGTGGAAAAAAGTTATATTTATAGGTATCGAAAATGCAAAAATATATATATATGTGTGTCCTCCCCACTCCTACTCACTTGACTTTTTTATCCACTC
TATAAAGAAAGCAAACAAAAATTCCAAATTCCCAACTTTTTTCCTCCCCTTTCTTCCCACAGTCTCCGCCGTTCAATCTGCACAACTTTTTCATTGTCAC
ACTCTGCGATTCTTCTTTATACCCAACTGGAAGAAAACCCTAACACACTTCTCTTTAAGGAAAAAAAGTTAAAAGTTTTCGAGTCATTCTGTAGAATTTT
CTTGAACAAAATGAAGTTGAAGAAACCCCATCTGGGTTTTGTGTGTTTCTTGATATTATTGTCGTTTGTCGTCTCTGTATACTCTCAGGGCAGTGCAGCA
ACGGATGCTGCAGTGATGCAAGAGTTGAAGAAGGGAATCAGCCCACCGAGTTCACTAAAATGGGACGATCCAAACCCCTGTAAATGGGGTAAAGTTCAGT
GTACTAAAGATGGTCGTGTAACTAGGATTCAAGTAGGGAATCAAGGGCTAAAAGGTTCTCTACCACCGAGCATGAATAACTTGACGGAATTGCAGGTGTT
TGAAGTTCAAAATAATGCACTTACTGGGCCGATTCCGAGTTTTGCTGGGATGAATTCGTTGCAGACCATTCTTCTTGACAACAATGGGTTCACTTCAATT
CCTGTCGACTTTTTTGAGGGTATGACTAATTTACAAACTGTTAACTTGGATACCAATTCCTTTTCGCCATGGTCTGTACCAGAGAGTTTGAAAGATGCTA
CTTCTCTTCAAAGTTTCTCTGCTAACTCTGCTAATATTACTGGTAAAGTCCCTGATTTCTTTGGTGGAGATACCTTTGTTAGTTTAACAGATTTGCATAT
GGCCTTTAATAATTTTGAGGGTCCCCTGCCCTCGAATTTTTCGGGTTCTTCTATCCAAACGTTGTGGTTAAATGGTATCCATGGTAAGTTGAATGGTTCA
ATAGATGTGGTACAGAACATGACCGCATTAACCCAACTCTGGTTTTCAGGCAATCAGTTTACAGGCCCTTTGCCTGATTTTTCGGGCTTGACTCAGTTGA
GAGAGTGCAATTTGAGAGACAATAGCTTCACTGGTCCAGTGCCAGACTCATTGGTTAATCTTCCTTCATTAAAGATGGTTAATTTGACAAACAACTTTTT
TCAAGGGCCTACGCCAAAATTTCCATCTTCAGTGCTAGTGGATATGTTGGATAATACCAATAGTTTTTGTTTGTCACAGCCGGGTCCTTGTAACTCACAA
GTTAATGCGCTGTTGGCTGTGGCTAAGGATGTGGGGTATCCCACGGGGTTTGCGGAGAATTGGAAGGGGAATGATCCTTGTTCGTCTTGGATGGGCATAA
CTTGTGATGGTGGGAATATTACAGTGCTGAATTTTCAGAAAATGGGACTTACAGGGACAATCTCTCCCAACTACTCGTCCATTACGTCGTTACAAAAGTT
GATCCTAGCAAATAATTTTCTTACTGGAACTATTCCGAATGAGCTCGTTTCGCTGCCAAACCTAAAGGAATTTGATATTTCTAACAATCTAATTTATGGG
AAAATCCCACCATTTAAGAGCAATGTATTGGTTAAATATGATGGCAATGTCAATATTGGGAAAGATAATCCACCTCCTTTTGCACCTTCCGGGAGCACTC
CTAGTTCACCCGATGGAGGTGGACAAACTCATGGGAATGGTAATAAAAAATCTTCAACTGGAGTTGTTGTGGGCTCAGTGATAGGTGGTGTTTGTGGTGC
CGTTGCGATTGCTGGATTATTTGTGTTTTGTCTTTACAGGACTAAGCGTATGCGGTCCGGTAGAGTTCAGAGTCCACACACAGTTGTTATTCATCCTCAT
CATTCAGGATCTGACCAAGATGCTGTTAAGATCACAGTTGCTGGTTCAAGTGTCAATGGAGGGACAACTGAAACGCACAGTTGTGGAAGCAGTGCACCTG
GGGACTTGCACATTGTTGAGGCTGGTAACATGGTGATTTCCATCCAAGTTTTGAGGAATGTCACGAACAACTTCAGCGAGGAGAATATATTGGGGAGAGG
TGGATTTGGAACTGTTTACAAGGGGGAGTTGCATGATGGAACTAAAATTGCTGTTAAGAGAATGGAATCTGGTGTTATGAGCGAGAAGGGGTTGGATGAG
TTCACGTCTGAGATTGCGGTGCTTACTAAGGTCCGCCACAGGCATTTGGTGGCACTGCTAGGATATTGCTTGGATGGAAATGAGAGGTTACTTGTATATG
AATATATGCCACAAGGGACAGTCAGCAGGTATCTTTTCAACTGGAAGGAAGAAGGGATAAAGCCCCTCGAATGGACAAGGAGGCTAATCATTGCACTTGA
TGTTGCAAGGGGTGTTGAATATCTTCATGGTTTAGCTCAACAGAGCTTCATTCATAGAGATCTGAAGCCATCTAACATTCTTTTGGGAGATGATATGAGG
GCTAAAGTTGCAGATTTTGGACTTGTTCGCCTTGCTCCTGAGGGAAAAACTTCATTGGTTACTAGGTTGGCTGGAACTTTTGGCTATCTTGCACCAGAGT
ATGCAGGTAAACTTCATCATATGACCTGTTAATTTTAGTTATATTTTTGCATATATTTGATTGCATTAATGGACTTATGTTAGTGTATTTAAGGCCAATA
ATATTAGATTAATAGGCTTAACAGGAGACGGTGGAAGTAGGAACTGCTTCCTCTCTTGTTTTGGTCTGCATCTACAGACCATCAGGGAAGCCTATTTTAG
CCGGATCTTTGATGTTTTGAATGGGTCTCAACTTGAAATCACTCTCTAAAATCCAATACGTAGTTATTTGTTTAGCTGGATTTTGTCCTTTAAATATTGT
TGACACTTTTTTTGGATTTTGTAAGCTCTTTGATTTTAGCTAGGTTCTTGTACTGGAGCTAACTCTCTTGTACACTTTTGCTAATATCATCTCCCTGATA
CAGTGGAAGTAAAACCAACAGAGAGTTGGGAACATTACCTTTATCAAAAATATGAATCAATTCCTATAGAGAGAGAAGTTTCTATGGTGAGAACCTGAAA
ATAAGCAATATGCCTCTAATCAAGGCAAATTCAAATACTTCTTAGAAATGCTTGACAGTCAAAACCTAAATCTACTTCTTCAATAAGATGTAGGAATTCC
TGGTAACCTTTCTCTTATCTCCACAAGTTAGTTATGTTACCGCCATTTAGGTGTTGTGCTCTTGTGTTGAATGATGATTTTTTCCATATTACGGAAAAAC
ACTTGCCTTTCTGATTGTATATTTTCTTCCTTGATGATAAAGCTGTGTTGCTATTGTTCATTTCCTTTAGGCTCAGATCAAGTGCAGTTTATCTCCTTTT
GGCATTGATCGGGTTCTTTCATTTGGTTTCTTGTTTACATTTTATTCTCCCTATCCAACTAAAATTCAATTAAATAGCTCTCATCTTGAATTGCATCATT
AGTATGAAAGAAACTGTTAATACTTGACTATCTTGTTTCATTGGGCAGTTACGGGCCGAGTAACCACAAAGATTGATGTGTTTAGCTTTGGTGTAATCTT
GATGGAGCTAATTACTGGAAGAAGAGCTCTGGATGAATCTCAGCCCGAGGAGAGCATGCATCTGGTCCCATGGTTCCGCAGAATGCATATAAATAAGGAG
ACATTCCGTAAGGCCATTGACCACACAATCGATCTTGATGAAGATACTCTGGCCAGTGTCAGCAAAGTTGCTGAGTTGGCTGGTCACTGCTGTGCTAGGG
AACCCCATCAGAGACCAGACATGGGTCATGCTGTCAACGTGCTTTCCTCCCTGGCTGAGCTCTGGAAGCCAGCAGAAGTGGACGAGGATGAAATATATGG
TATCGATTATGACATGACGCTACCTCAAGCAGTTAAGAAGTGGCAGGCTCTCGAGGGAATGAGTGGCATTGACGGCTCTTCTTCATATATTGGAAGCAGT
GAAAATACACAAACAAGTATACCCACTCGGCCATCTGGATTCGCCGATTCATTTACGTCAGTGGATGGACGATAATTTGATTGTCCAACTATACTGGTGG
TGTATTGCCCTTTAAAGGGTTGGTTTGTTCATTCCTTGTGCTCATCCATCTTTGCCTTCTTTTTCTCCCCGTCTCGGTTTCTTACAGGTTTTGTTAAAAG
ATTTTTAGTGACAATATGAAGTTGCTTTCATCTGATTCTTCTTGAACTTTTACTACCCTGCCTGTGCCTTCTCTCTAGGAGTTATCCAATGTGCAAAAAT
CTCTAATTTCATATTGGATATTTTATGATCTCATTTGAAAGCCTTTTCTCTGGTGTCTAGATTATAAGTCATCAAGAGATTCTAATATGGGAATATCAAC
ACTTGGCCTTGCAAATATAGATTCTCTTGTAACCTTTATGTAATGAAATATGTCATCTTATTAATGGCTGATGATATGGATCCCACGTTTGGCTACAAAA
CAAAAATAAAGGTGGGGCTGCAGATATTTTTGTCATGATTTGCAGAGATTTAAGTCAACCACATCCATTAAAAATGCTGTGAAAAGAGACGTGGAGGAAT
TATTACTTGTTAATTAGTGTCATGTGATGTAAATATTAAACTAATGCAAAGTTCCATTTAAGATTGGGATAATTAATGGATATGATTACCCTTTTGTCCA
GTTGTAATGAAACACTGAATCTCCTGTCAGATCAGCCTTGTCGAGGTAAAAGTTCCACGTGTTGCACCAAAATTGCCAAGTGCAAGACCATAGATGTAGT
TGAGCAGAATAGAGAATTCAAAATTCAAGACTTCTTTTTTAAAAAAATAATTCAGGCGCAGTGTCACAGCAGAAACGGAACTCTTCTAAAAATCAAGTGC
CTCAAATAATAGCCAAATATAATTTAGCTTGCTTAAGCAGAAACCAGCCTTCTCCAACTATAAAGCTGCCATGTAATGTTCCATATTGTGTGCTCATGGA
GAAAAGCAAGTTTTTAACAAGTCTAGTAGTTCTTATACTTCTGTTGCCTTGTGCTAATTCAACATCTAAGAAGCACTTTGTACTAGTGCATACGGAGCCT
GGACCTGGTACAAGATTGTGGCATTGATGACATCTTCAGGGCATAATGTAACAGCTCTGGACTTGGGTGCTTCAGGGATCAACCCCAAACAGGCCCTTGA
AATCCCACATTTTTCTGATTACTTGAGTCCACTAATGGGCTTCACTCCCTGCTGATAAAAAAGTACTTCTTCTAGGTCATAGCTTTGGTGGACTCGGCAT
TTCTAGAGCCATGGAAGATGTTTCTAAGGAGATAGTTCTTTCAAGCAAAAGATATGGATCAGTTAGGCGAGTGTTCATTGTTGCTGCTAAAGATAAATTT
CAAAAGAAGGAATTTCGCCTACAAATGATTGAAAAGAATCCGCCTGATGAAGTGAAAGAGATACAGGGCTCTGACCACAGGACCATCATGTCTAAGCCCC
AACAACTTTACATCACTCTTCTGAGCATTGCCAACAAGTATAACAAATTTACCTAGCTAGTTAAATTTGACATTTAAATAATTTTGTTTGATTGTAATTT
TAGTTTTTGGAATTGACCTCAATAAGCAACCTCTATTTCATGAAATTACTGAATTTTAGTTCAACTCTGTTAAATCTCATCGACTGGAAGAGGAAATAGA
CATTGATGCTGAAGAATTAGAACTATATGAATAAATATTGCAGGAAATGGTCATAGTAGTAGATGGCAAATATATGATAAGTTATTCAGAATGTAAGGAG
TTCATGTGAGCCAAAACATTAAAATTATAGCCATTCTCATGACTCCCTCCCTGGACCCTTTTCTCTTAAAGCTCTTACTTTTCTCAACAATTAAATCATT
TAAATTGAACGGAGACTCGTGATTAGAACAACTGTAGGACAAGGTAAGTCAAGTTCCTTTTTACTTTTTATTTATCACCATTACTGTTTATTATGCACGA
AATCATAAAGTATGAAACCGATTAGTGAACTGATCTACTGGTCCAAGCATGACTACTAATAGTGACCAGACTTGCACCAGCTTCTACTACATTGCTTGCC
CACTTCCTCAAATAATAGCCAACTTTAGGTTGCTTCTACGTGTAAGTGAAGAAACCAAACTCCTCCAACTAAAAAGCTGCCATGTAATGTTTCAAATTAT
GTGCTCATTTTTCAGAAGAAGGAAAAAAATATATGGAGAAAAGCAAGTTTCAAACAAGTCTAGTAGTTCTAATACTTTTGTTGCCTTATGCTAAATCAAC
CTTGTCAGGGCCTAAATCTAAGAAGCACTTTGTACTAGTGCATACTGCAGGCCACGGAGCCTGGACCTGGTACAAGAGTGTGGCATTGATGAGATCTTCT
GGGCATAATGTCACAGCTTTGGACTTGGGCGCTTCAGGGATCAACCCCAAACAGGCTCTTGAAATCCCAAATTTTTCTGATTATTTGAGTCCGCTAATGG
AATTTATGGCTTCACTTCCTGCTGATAAAAAAGTAGTTCTTGTAGGCCATAGCTTTGGTGGACTCGCCATTTCTAAAGCCATGGAAACCTTTCCAGAAAA
GATTTCGGTTGCTGTATTCGTCACTGCTCATATGCCTGGTCCAAATATCAATGTTGCCACAATCTACACTGAGGTAGCAATGTTCCATATTTCCCATAAT
TAGCAATGAGATGATCTGTTATGTTTATGCAGCTAGCTTTTACATGTTTGAAACTAAAAATACTTTGTTACAGTTATTCAAGTCAATATCTCAACCTGAT
AATCGTATTATATACGATAATGGGCCTACAAATCCTCCAACCACCTACATCCTAGGTCCAAAGTACATGGAAACTGATGTTTACCAGCGGAGCCCAACTC
AGGTAAGCAAAGCATAATTCAAATGTAGTATATAGCCAATAAGTTTCGTTATTCTGGTCATGAGAATGGCCCTAAAGTGACTCCTTTCGCCAAAAAGTTA
CTGATCTAGTATTCAGGTACTTAATGGCGACAATAACTTAGAGCTGCATGGTTTAATATATAATCGGGGTTTTTTCCTTGTTGGTGTTAGGATTTGGCGT
TGGCCTCCACACTAGTAAGGCCAATAAACTTCTACAGTCTGGAAGATGTTTCTAAGGAGATAGTTATTACAAGCAAAAGGTATGGATCAGTTTGGCGAGC
GTTCATTGTTGCGGTTGAAGATAAACTTTTGAAGAAGGAATTTCAACATTTGATGATTGAAAAGAATCCACCAGATGAAGTGAAATAGATCCAAGGCTCT
GACACAATGATCATGAGGTCTAAGCCGCAACAACTTTTTACTACTCTTGTGAGCATTGCTAACAAGTATACCTAAGATCGAGCTGTTGATTAAGAAGAGT
AAGTGTGAGAATAAAACTTCAGTCAGTTCACATATATGATGCATTTATATGACTATCTTAATTCTTCCATATAAGTTCTACAGAGCTAGTTAATTTGATA
TTACAGTTGTTATTTCCTTTCATTGTAATTTCGGTATTTGGAATTGACATCAATAAACAACCTTTATGTCCTGTAACTACTCGATTTGGTTCAAGAGCAA
ACAGTAATTAAAATCACATCAATGGGAAGGAGGACGTAATTATCATACCAACTGAGTAATCCAAGTAAATCTTTTAGAAGAGTACAATTTTATTTTGATT
GGGAACAATGAGAAGAACACTAATGGTAAATAAAAGTTTGTTACAGGAAATACCAAATTTTGAAAGTTCATTCCAAATAAACACTAAATTTGCAAACAAA
CGATTAACTTAAAGCATAAAAAACTGTAACTCCATCACTAAATATATTTTTTAACTAAGGGCCAGATTTGGTCATAAAATTTTTACAGTAATGGAAAAAA
TTAGGAATATCCACAATTTGAAAGATTTAAAGAATCTAGAATGGGGAGCATGAACCAGGACGGCCGGACCCCCCTATGAATATAAATAGCCAATGCCTCA
GTCCTCAAATAATAGCCAACGTGGGGTTTGCTTGTGCAAGGAAGTAAGTAAGCAGAAACCAAACTCCTTGAATTATAAAGCTACCTTTGTAATATTCCAT
ATTATGTGCTCATACTTTTAAAAGAAAGGAAAAAAAGATATGGAACATGCAAATGCTATTGTCTTAGAGCCTAAAGCTAAGAAGCATTTTGTGCTTGTTC
ATTCAGCATGTCATGGAGCCTGGTGCTGGTACAAGATTGTGTCATTGATGACATCTTCAGGGCATAATGTCACAGCTCTTGACTTGGGTGCTTCAGGGAT
CAACCCCAAACAGGCACTCGAAATCCCACATTTTTCTGATTACTTGAGTCCGCTAATGGAGTTCATGACTTCACTTCCTGCTGATGAAAAAGTAGTTGTT
GTAGGCCATAGCCTTGGTGGACTCGCCATTTCTAAAGCCATGGAAACATTCCCAGAAAAGATTTCAGTTGCTGTATTTCTCAGTGGTCTAATGCCTGGTC
CAAGTATCAACGCATCCAATGTCTACACTGAGGTACTCATTTTTCATATTCCCAACTTTAAATCTGTTCATTTTTATTTAAAATCTTTCATATTTGAAAC
TAAATATACTTTATTATAGGCACTCAATGCAATAATACCTCAACTTGATAATCGCGTTACATATGACAATGGACCTACGAATCCTCCAACCACTCTTATT
CTAGGTCCCAAGTTCTTGGCTGCTAGTGTTTACCATCTGAGCTCAATTAAGGTAAGCAAATTATAATACTGTCATTGAAATTGACTTCTGTCATTATCAG
AATGGCCCAAATTAATGTGACTTCTTTTGTCTAGAATAGTTTATCCAAAATTACCAATCTATTCGATTAATATTAGGCTTAAGTAATTGATAACCTCTTA
AAGTTGTTCATATAATTCACTTGAACATCTTAACTAGGAGTTGTACCTATTTGAACACCTAAATTGTTTAAAACATGTATCTATTAAACACAAAACGTTG
ATATAAAAAAAATTGTGTTTTTCACTTACCTGAAGCACAACACGTGAAAGATTCAAAACAATTGTTTTTTTTCTTTCATTTTTTTTATTGACACTTGCAC
TATAATTAACTTAAAAACATTTTTTCTTCATTCATTTACACTTTTTTCAAAAAAGAAAAAAGCTCCACACCCGTACCACTCATCTTCTTCAGAGTTTAGT
TTGCAAAACTTTGTTCATTTAGCTCTAACATTGTTTTTCTTTATTTTTTATATAAAAAAAGTATTATTTCTTCCTGAAGATAAATGAAAATCAACTATGA
AGAAATCATACAATTCAGAAATCATACAATTCAGATTTGAAAGAAAAATTTTCTTTTCTATGATTTATTTCGAATCTCATAAAAATAATGAAACAAATAT
GAAGAAAAATAAAAAAGATGAATAATTTTTACGTATATAGATTGATATTTGTTTATCACAATTTTCGAACAAGTATTTTTACTGAAATACAAATATAAAC
TCATTAAATTTATCAAAAATAATATTTGAAAATTTGAATGAATTAATTTTTAAGCTATTAGTTTTTTTTTTTGTCATCGATGTAGATTTTCTTTCTTCTT
CACTCTTAGTATGAAAATATATATCTTTTTAGAAAAGTTAATCTTCAAGTTATTTGAAAAGAAATTAGGTTTTGTGATTTGACAAAAAAAATTATTTTGG
GAAGAAGATGAAGTTTGAAGGGGGTTGGGAAGGGGTAGGTAACAGTACAATAGATTGACATTTTTTTAAAAAAATAAATATATAAAATGTGTTTGAAATT
ATTTTAAACATATTTGGGAAAAATGTCTAATATACCCCTCAACTTTGTCATTTAGAGCTTATACATCCCTCGTTATAAAAGTGGCTCATATATGCCCTTA
CCGTTATACAAACGGCTCACATATACCCCTGCCGTTATAAAATGACTCACATATACCCTTCATTTAACGGAAGTTAAAAAATTAATTTTAAATTTATATT
TATTACTTCTAATTTTTTTTTAAAATTATTTAGGGATATATATGATTCTTCTATCAAAGTTCAACGTATATTTTAATATTTTTCATACATAAATTATTTT
TTGACTTCTTTTATTATAATTATTTGAGTTTCTTATTCTTATTTTGTTTTTTCTTTCATTCCTTAGTTTAAAGTAAAAAAATTAAACTATTTTTTTTACT
GTATATTGTAATTTAATTTCGTATTCGAAGAAAAAATTTGGTTATCTACAACAAGTTTTACAAGAATATTAGTGAAACATAAATAAATTTGATTATCAAA
ATAATAATTATAAATTAGTCATTGAAACAAAAAAAAGTCAAAAAAATTTGTTTGACGATGATTATATTTTTTAGAAAAAAATAATAAAAATTTAGAGTAA
AATTATTTTTTTTCATTTCCGTTAGAGGAAAAGGGTATATGTGAGCCATTTGTTTACAAATAGGGGTATATATGAACCACTTTCATAACAAGGGGTATAT
CAGCTCTAAATGAGAAAGTTAAGGGGTATATCAGACTCTTCTCCCAACATATTTTTATAATTTTGGAGACCATTGTCACATGTTATTTTTCTATTAGCCG
TTTTTGCCATGTCAGCCAAGTGTATCACACATTGTTGAAATCAAAAAATGCCTAATAGGAATAATTTTTGAATAGGTTAAAGTGTTCAATTGGTACTAAT
CTCAGTTAAGGTGTCTAAGTAAAATATGCAGACAACTTTCAGAGACCATCAATGACTTAAGTCATTAACATAACTTAAATCACAAGATCAACTTGCAATT
ATTGGAACTGATCTAAATCGGGGTTTTCCCTTAAATCTTGGCGTTAGGATTTGGCGTTGGCCACTACACTAGTAAGGCCATTTTATTTATACCGCGTGGA
AGATGTTACTAAGGAGATAGTTCTTTCAAGGGAAAGGTATGGATCAGTTAGACGAGTGTTCATTGTAACTGCTGAAAATAAAAGTCTGAAAAAAGACTTC
CAACAGTTGTTGATTGAAAAGAATCCACCTGATGAAGTGGAAGAGATCGATGGCTCTGACCACATGCCCATGATGTCTAAGCCCCAACAACTTTTTACCA
TTCTTCTGGGCATTGCCAACAAGTATACCTAATTAGAGCTGTTGATGATGAAGAATAAGGGGTCATTTGTAAGGCTGAGAACAGAGCTTCAGTCAATTAA
CATATATGTGATGCATTTTATATATGGCCATCTTAGTTTTTTCATGGGAATTCTAAAACCTTGCTAGTTAATTTGATATTTCAATCATTTTCTTTTGATT
GTTAATTTCTTTCATTGTAATTTCAGTGTTTGGCTCCATCAATAAACAGCCTCTATTTCCTGAAATTACTGAATTTTAGTTTCAATTTGAATAAATCTCA
TAAATGGGAAGAGGATACACAGATGTTGATACTGAAGAATCAGAACAATATGAATGAAAAATATGATGTAGATGGACAAGAATTTATTGAGGCCATTTGG
TAAGAAAAAGAAGTATGTAGTACTAGTGGACTTTGGAGCAACACACAACATTATAGATGAAAGAGAAAAAAATTAGAGCAAAAGTATTATTTAGTACTGC
ACAATCTATCCTTGTGCTTGAGGTTTGACATCTCTATTCAATGGCAAGTATCATGTACTAATTTTACGATACTAATTTATTTGGTGAACCACGTCGTAAT
GATATTAATACTGTTTTAATAGTCATTGACACCTTCATTATGATCTAGAGAACAGAGGGCCACATGCTTCAGAGTATTGCATGATCTTAAGAAGTCAATT
TTAAAGCTTGGCAATTGCATATTGAGGCAAATTTGATCTTGGAGGCAGCTTTAGGTCTTCCCAATCTTCATCATCTACCTTGGAGAAGTAACGATCAACA
TCATCATCTCTAATTAGCTCCAGTTTGGAGGGCTCCCACTGAAAATATGAGCACAAGAATGAAAGAAGCTCTTGATATGTAAATTCAGGATTATCCATGA
TCAAATGAACAGAACGCACCTTAGGATTTCTATCCCTGTCGATCAATATGGCTCTGTGACCCTGCAGTAAAAGTGTCAGTCTTGTAATGCAGTAAAATGG
GTGGCTGAAAGATGGCATGTTCTACCTCAAAAAGATCCTTGCTAAATTCTCCCCTGAACACATGACAAGCCATCCGATACTCACGGACAAGGCAACTACC
AACACTTTGAAGCCTCCCTTCTCTTATCTGGAACAGAAAAAGGAAACAAATGACCAATCTGCAGATACACTAGAACTCTCCAAAAATGTTGTGGCCAAAT
CAAGGCAATAGGACCGTGCAGAAAGAGATTCAAGATGTGGTTGTGAGCAAGACTTCATCATATTTTTATTTGAAGAACTTGTGTCACCAGCAATACTAGT
ATAGTATCAAATTTTAAAAATTCAAAATACATAATCTTAATCCGACAGTGAAATCCAAATTATCTTTCTGAGGTAACGGTTACAAAAAAAAATGAGCCCC
AAGGGTCACCATTTTAGATAAGTTAGCCAAGTCAGCTTGGTCTAAGAAAGGAACTTTTCGGTCATAATTTAAAGGTTTTTAGTTCCTCAGGGACAGCGAC
AAAGCCAACAGAGGTGAATATGAAAAGGTTTAGCCAGGAAAAGAGTGGACATATATTGTGGCTTACCAATGCCGTTATTATGGTACCATCTCATAAGATT
GCAAAATCTGTATGGATATATGATAATATGAATAAGAAATATGATTTTGGTATTCATCTATCAACTCTTTCCATTAGGCACAAAAATTCAACAGCAGGAC
ACATAAATACTTACAGTTCCTAGGATTATGCTGAAAATAATACCTACTATCCTTAATGGATGAATGATAGCATAAAAGAACCACATTAAAACAATACACA
TCACGGTTAATTATATGTATTAACCTCCCTATATCAAACCAAGCTAAGTATCTTTTTCCGTATTTCATCCTACATGACCAATTTCTGATCAACCTGAAGA
AAGAATGGTACAGAAGTTTAGGTGACAAAGTAATGGTATCACAAGGTATTGATTGACTTACTGATCTCAAGGAAATTTTAAGGCTTGTAGGGGATGCTTT
CTTCAGCGATTGAATAGTTGAAGAGATCCATTCATCTTTCTTGTCCAAAGCCTCACTTTCCTATAAAAAAATTCATGCATAGTTCTTACACAGTATTTTA
GTAACTAATATTATTAGAACTTTACAAAGTAATTTCACCACAGCAAAAAAGAGGATCAAACGACCATCCATCTCCCAAACTTACAAGAGTAGATATGATT
TCTTCAATTGTCCTTCGAGAGAAACAGTGATTAATAATCTTCATCCTACATGCATAAAATTGCAGAAAGTAAAACTGGTGCACAGTTGAGAAAGAGGTAA
TGAAAATCCAAAGACTAAAGATTTATTCTAATTGAACAATATTTTTCCTAGAGACATGGGAACTTTGGAATGCTATCCCTCGTCTTA