BAC Sequence – LE_HBa0291L11

>C01HBa0291L11.1
TAGGAAGGAATGGATTACGTATATTCTCGAAAGAATGGATTACGTATATTCTCGAAAGAATGAATTACGTATATTCTATATTTACTTGCGTTACCAATTG
TCATTTCTTGGTCATTGTCATTGAGATTCATATCAATTCGGATTAATATTTAGGTATAGATATTATCTCTTTTTTTTTCTCCAAATAAAAGAATAATTTG
CTATATCATCTCTATTAATTACAAGTCATTTAAATATTAGAAAATAAACAGTATTTAATAACAAAAAAGAGTAATTGTACATCAAGTTAACAAGAGTAAC
AAAGTCACCTTCAAACTTTAAACTAAGTTCATTGTTAGAAATAAAAATCAAAATTATTGAAAACATAAAATTTTACTACAAACAACACATATATTAAACT
AAAATTAATGAAACAAAAATGTGTATGATTTTATGAGCATAGGTTTATATAAACCTTAGTCCTTAACATACTTTGTTGCCAACAGTTTGGTAGAGAGACC
TTAGCTGTGTGTTCCATTTATCAATGGCAGTGTACTTCTTCATCCCTTTTGATCTGTGCGCGTAAACGCGTCATGTAAAACAAGTTAGTAGCTAAAATCA
GACAGCGTTGGGAAAATAAGCAATGACACGTTGAGGGGTTATGAACTGACCTGTCGCGACACTCTAGCAGTCCGTTCACTTGATCAATGTGGCCATCAAT
CCGGTTATCCAAGATTAGTGAGACCAACAAGTCCTCAACATCTTTTTCTGGCACATTCAGCTCCTGTACGTCGAGTAATATGAGAAACTAACTAGTAGGT
GTGTTGGCTTTAGGAGGTTCGTTAACAAAATTTTGTGATAAAGACCGAGTGGCAGCTACATTCACCCTCCGGGAGATCAAGTAGTGATGAATATGTATGT
ATTTTCCAAGTATGATCACGTTGTCTTATACAATATTTGCGCCATAAAAACAAAGCCAGCTGATAGGGACAACGGTCATCACAAAAAAATTAAGAAAGGG
AAAAAGGAAGAAAAGAAGACTGAGTTATCACCTTGGATATGAAGGGAATTCGGATTCTTGTGTAAGGCTTGATGAGCTTCAGTAAAACCTGGGTTCTGAC
CTTCCTTAAAAGATCCTCAATGTAATTCCGAATGAAAGGGTCATCCATTATTGTCCGTCTATTACTCTGTTAAAATTTCGAGAAATGCACATTCAAAGTG
ATCAAAGAAGAGACCCAACTACAGACGGTAGGATCAACAGGCAAAATATTGAAGTTTACAGAATGACTGTACCTTAATAATTTTCTCGAACTCTAAGATC
TCATTTCGTTGATATGCTGCGATAAGGTTTGTCATGGCCAAGATCTCAGGGTCATTTTTGTAACTGAAAAGTATAAACAGTCATGCACAGACACAATGCA
GCTGTAGTCAAGTCATATAAGAATGACAAATTGTTGACGTTGAATCTTGCAAACAAAAACCTCTTAGTGAACTTACGGTTTAGCTTCTTGGCCATCAAAA
GGGTTAACTTCAGACTCCATCAGCATATTTGCCAGGACCAAGTACCTGTTAAAAGTTAAAGAAACCGAAAATAGTGCAACATTAGAAACCCAGAGGTTTG
CAAGGGTAAAGATAGCATTGGAATTCACATATTGCAATCTTCTGGTAGAAGGTGAATGCTTGAAACGATCACCTAGTACCAAATTACAGAAATTGATATG
GAATGACTTAAACCTTCATTTACATGCAAGTAACAAAACTCAAAAGTTTCCAACACATGCAAAGCATGCATCCATTCAGCGAAAATGTAGTGAGAACACA
TCTTATGATACACCAAGAAACGGATTTTTGAAGTGTAAGAGATGGTACAAACCACCAAAAAGGGTGCAGAAATATGCTGTTAGTGACCAAAAACACACCA
CCACATTGATTATTTCACACACCACATAACAAGTGGAGCATACACGGTCTGAACAAGGAAACGGCATCTCGTTGAGGAGCCTTCAGTATAAAATAACGCT
CCAAAAACCTCAAAGTCTACCAAGAAACCTTTTTGAAAAGATCTAATAGGGAAAGTAATTTCATTCTGTTTCACACCAGATTTAACAGCACCTCCTCTCC
ACAAAATAAACTTCACAGTAAAGTCTTTGGCAACTTTAACACTTGGACTGGCCTACATGAGATAGCAAAATCTGCCACCTTCATCTTCATGAGCTCCAAT
TTATGAAGCCAATAATGCTAGTAAGCATTTCTTAATTTCATCATAGTTCTATTCTGTCCTTATTCAACCATGAAAGGCACACTAAAGAAAATACCAGAAA
TTGGTCCTTGAGAGAACAGTAGGGCAATTTTTTCCAAGTAGTGGACAGATGCATCCTGACATAAACTCAAGTGTAGTGTGTGTTTACATATTTGCATTGA
ATTCATTAACGTACTTCCTTAAATTCTACTTCTGAAGTACTATATTAAAGTATTGTATATGTTTGCATTGAATTCATTAATGAACTTCCTTAATTCTATA
CTAAAGTACTATATAGAAGTGTTGCGTGTTTACATGTTTGCTCTGAGTTCATAACGAACTTCCTTAAAATCTACTTCTAATGTACTATCTAATATCTGTC
TTTATATATATGATTTTGAGATTGATTGAGGCATCATTAACTAGTTATGATCCTCAATCTCACACCCTAATGAACGCATAGTTCAATTTCGTGCAGAGAT
GTACTGCAAATCTACAACACCCTGTTTAGATCACATACACATCCTCTGAACGAACTGCAACATATTTCACAAAAGCAACATCAAGAGGTACACGAGGTAC
ACTGCCACTTCAGGACAAGAAACTTCAAGCTTGAGGAGCGAAATGATGGAAACATTTGACACTCTTTTGGTTGGCTTGATCATAAGAACGGTAGCTATAA
AAAAAAGTGAAAGGTGAAAACTGTTTCTTTCACTTGATTAGAAAATAAAAAGGTAAAAGTCGAGAAATATGCAACCCTCCCAAATTTGAAGGGGAAGGAG
GAAGCAAATTTTCCTCATTGTGTAAAGAAGAGAACAATGGAAGAGAAAATACATGTAGGCAGTTGCACAAGCTGAGATCAATGCTTAATCTTGTTAACAC
TTCCATTCGTCCAATATTTGCAAGGAGTAAATATACTATTCTTGGGAAATTAGTATGTCAGTAGAAATGTGGAGAACTTCTAAAAGGTTAAAAAAACAAA
TTTTTGGTGTTCGAAATAGATGGGTCTAATTGGAGCAAAACAGATAGTGACGATTCATATGGCCAACCCCAACTAGCTTGGATTGAGTCTTAGTAGTTAC
TTGTTGTCTCAAGTTAAACAAACTACCAGAGGTCAATGTTAAAACATCACATAGTGAAAGTAAGATAAGTGACTTCCCCTTCGCTAATGCACTCCTCTTC
CCTTTGTTGCACCAAACATAGCGCAAGAAATGTGAGAAAATGGTTCAACAACAATTATAAAAGTTTATAAAACATTCAGTTTACAAGGCCATAAACTCCA
GGTTAGGGCTCTAGCACATTATCAAGTTATTTGTTAGTGATTAGGTAACGAACTACAGTCTGGGAAGCTTGAACTAAAGATGGCAAATGGGACGGGGCGG
GAAGGAGGCGGCTATAAACCTGCAAAGACTATGGCCTGCTCCGCATGAACCCGCCCTGCATAATTTACCTAATTTTCTTAAAGTAAAAGAAACGTACCAG
TTACCAATCTATACTGCTAACTTTGAATAATATATATATATATACGTATAAAAAGAAAGGAAAGATTTTATACATATTAATATATGAGAGTCGTTAAAGT
TTGTTGACCTAGAGAGGAGTGAAACTAATAATTACGTATGACTTAATGATATGGCACGCGTTAAAGCAATTGACTCCTCTAAGGAAACAAATAACTTACT
TTGTACAAGACTCTGTTTCACTTTCCACCCACCAACACCCCACCCATGTTTCCCAGAATAATTTTGATATAATGGATTTTCCTATTCCAATTACGTATAG
AAATTCTTCACACATTTACCCTTTAGTTTAAGTTTCAAAAAAAAAACCAACCCACGTACCCGCCCCGCTTACTCAAAAGCTCTAACCCACAGTGTCCCGC
AAACACTATAACCCGACCCCTTGCGATCCCTATCTTGAATACATAGTTCCTGGTCAGTCAAAAACTGCCTGTATCCTTCGCAAGAAAAAAGTGGAAATAC
CAAAGGAAACAAATAAATGCACACACACACAATGCATATGAAGCACACACATCATAAACTGCACACATACTTGAGGCACTGAATACGCCTATGATTCCCA
GCTTCATCATAGTTCTTGAAAGCTTCAAAGAAGTCTGTAGCTGCCTCTGCCCACTTTCTCTCTGCCATATGCATTTTGCCTCCGCATTCACGAATGATTC
CCATTATTCTTGGATGAGGAATTGCCGACTTGACTGAAAGTGCTTTGTTGTACAGTTCCTGAATTAGACTCATATGTTTCATGAATTAGGAATTGAGAAA
AAGTGAAAAACAACTCATCACTTCACACTATGTTGCCTAGAACCTCCGAAAAGAAAACGACAGTTGTGTATCAGATCCTGGAGGATCTCATATGAGTGTG
GCAGCATTTTGGAGGATCCGAGCAACATAGACATAAATGAAATGTCAAGCAAGTTCTAAACCAAGTATACCGTTGAGATGTAATACCATGGAATACATGT
TTTCAAGATATCAATGCAAGAATAAATATCAGAAAGTTCAAGAATTCCGATCAATGTACAAATATATACTCTGCATGTAATAAAAATAAATTATTTAAGT
CTCTCTCTGCAAGTATAGAGAGATAGAGACAGAGAAAGAAAGAGAAAGAGAGATGCAAAAAGTGACAATATATATATACATACATATATATATATATATA
TACAAGGTGAGTGGTTTGCAATGTTATTTTGCCAAGTGGAAAAGCCAAATAGCAATCTTTGGACAACAGTAGAAGTGGTTAATATTTGTTTTCTTTTGGT
GCAATACTTACTGGATAGAAGGTTTAGGTTTCACTTCAACCTATAAATTCTTGCTTTTGAACTTGAATTGAAAGATAAAAATCTAAAAGATTAGGTCTTC
CCTAGAGCATGCCAAAGTCTAGGGAAACAACCTCTTACTATTGGAAGAATTTAATAGATTCTCACTATTTTCAGGTAAAGAAAGGAAAAATCAAAGCAAA
TTATGTGTTACAAAGACTAGAATCTTCCAAAGAGTCTCAATCACTATTCACTACCTTTGGAGTTTGGAATGTACTATTATCTTTTGTGTGATTCTTTTGT
TTCCAAAAGACATGAGCTTCTAGAAATAACATGCTTTAGGAATAAAAGAGACAACAAAAACAAGAAGAAACTTAGACAGAGAAGTAACTGAAATTAGTAT
CTGACACCTAACTCTGCTCAAAAGAGTGTATCAAATGGGAAGAAAAGGTAATAATATACCTTCAGTTTTTTGTTGTTTTTTGTCTCTGTATACATTTGAA
TCTCAATTGCATATACCTCCAACAATTGTGTCCCTTTCTTCTCATCATCAGTGCCATCTTCTTTTTTACAAGATTTGTGGAGCTCTTTCAGAATCTAACA
AAGTTATCAAGTTATGTTCATGAAAATCATAGAAAAATGATAGCCACAGATGCTTCTAATCTGAGCAAGCAAGATACCTTGCTCATTCGTCCATATTCCC
CCATGTCAAACCAAATCTTGCAAAGCTTTAGATTTGTCTTGAACCACAACCTCTGTAAAAGAAAGAGGGGATCGTGAGACCTTAACGAAATGACAGATGA
ACTTAGAGAGAAGCTTACAAACAGACTCCCTGTATGCCAAAAATTTTTGTTCATCCTAACCTCATTCTTTGCCTCTTCGAGGGCTTTCAATGTTGTCTGG
TAGAACTCTTGCAAAAGGCTGAAGTTCTGACTAGCTGATCCAGAAACAAAATCCATGATACCATTTATACACTTCTCACTATAGTTCCGTGTCACTGCTG
ATTTTATGTAGGTAAGCATTTCTCTATAAGAATCCATCATTTCCTTGAACTTCCCTAGCTTATAGTAAAGCTTAACAGTTTGCTTTAAAGCTTTAAATCC
CCTGGAGATAATGATATAGTTGATAAAAGCAACACAATAGCAAATTGTAGCTCTAAAATTCTTAAAAAGCTTTAGGAAACTCATTAGTTGAAAGCATAAA
GCTGTGACCTGAATAAGAGGCTTACGTCATTTTAACATTACAAACTTACACTATAACTTAAATTTTTGGATAAGGGACATAATAAGAAATATAAAATTCC
AATTCAGAGAAGAGGATAGAAAACCACATGCCAGAAGATGAAAAATCCGGTTAAAAATAAACGAAAGAGCTTGATCTTCATTAGTGATTTGAAATTTGTT
CAATCATATAAGCCCAAGAAATGAGAGAAAGAGAGGTTTATGTATAAATACACGTCACGAATTTGGTTTTACTAGCTGATGAGAAGGAAGCTTGTTATCT
TAGTGAAGAAAGATAGAGGGCAAGCCCATTATCCGACGAGCTTTTAAACCTTGAAAATCTAATTGATTCTGACCTCTTTTTATTAACCAAGGTAAGTGAT
TTTGACTTTCAGGACATATTAAACAAAAGCTACACAAGCAGTAAGCTTTTATAAAAGCACAGTTGAAGACTGCAAATTAAAACTTTCAAGTTTCAACTCC
TTACCACTCTGCCTTCTCAGGCTCCATATGTACTACTTCAGCAAAACCCTCAAGTGCTCCTTTGGGATCAGTTTCGACCATACCTATGCATGACATCATT
GTAGAATATTACTCCCTTCGATTATATATATGTTCATAAAGAGAGATAGCTATAGTGAAATGCAAATCGATTAATACAAATAGAGAGAACATCTCTAGGG
AACAATACAAAAAATTACAAAAAGATGCACAACTTGAACAAAGGAAACAAAAACCAGAACCTAACCTCATAATGCAGAATGATATAGTGAAAATCACCGA
GAGAACTCAGCTCCCTTTTGACCATAGATTTTAAAGATTAAACTCGAAACTTGAAATCTTGAGTTTTTATGCATTTTACTTGGGGAAAAAATTGAATCTT
TAAGTAAAAGTGAAATTTCTCCCACAAATGATCAGTTTCGAAACTTGAATTCTTGTTTTATCGTTTTTGATAACCGTTGTGTCCAAGCCAGATTGCGCGC
AACTCCACTAATTTCACGTGATACCTGTCACCTCTCACCAGCAGCAACAGGTACCAATAACTCCATTCACCAAGGCTAAAACAGATAGGAAAAAATCACC
TAGTGTTTGTCTCTAATGAATTTGAACCATTAACCCTTCAGGGTGGACCAGTGGTTTGAACTTGAGACTTTCCATGTTGGAGGTCTCAAGTTCGATACCA
CTTGCCAGCAAAAAAGCAAGGGGTTTACATTCTGGGTCGAGCTCATCGCACCAGGCTGAGTTACCTCTCCTATATGGTTTGCGAGTCATTGCATAGAAGC
GGGAGTCTTACCCTGTGCGCACCCAAAAGGTAGCGGCCTCACGTTTCCCTTGTCATAAAAAAATGAATTTGAACAATTAAGTCACAACCTTGGGTGCATA
ACTTCAACATACAAAATCTATGGCAAAACATATCATTTGAACAAAAATAATCAAAATTTGATCCCAAATGTTTAGCTAAACCTAGCTCAAATAAAATTAC
CCTACTTACAAACATTCAAAAATTCTCAAAATTAAAAGTCATAAAAAAACCTTTAGAATTGTAGTACTGATTCTCTATATCAACATCTTGTTCTTCCTGC
TCCTCGTCCGAATACTCGAATCCATAATCCTCCATATCCGCATCTGCAACATACAAAATATTCACAAAAATCGAACCAAATACACACAACGAAACCAAAA
ATTAACCAAAAAAATTATCGAATTTGATGAGAAATCGTAAAAGTACTTACCAGAACCCATAGCTGATTTTCAGATGAAAGAGACGATTGAAAAAAAATAG
AAATTTGAAGTTTCGAACTAAAAGGGTTTATTATTAGAAGAAAAAAAATTGAAATATTTTTATTAACGAGATAAAGAGTTCAGATAATCAATTAATTTAG
AGACGAAAACTCACATAATTAATTGATGGAAAGTAGTTATTTTATTTTATTTTTTAATTTATGAAATTTTTTTAAGATTTAGGTAAATGTCTAAAAATGG
AGAATATATTAGACATATTTCAAAAATTATCTTGGTGATATATTAATATGTATTTTGTAATATATTAATGTATAATTAGATTTTTTTTATAGTGTGAATT
ATACTTTTGGTGAAGCTATATTTATTAGTGAGGGAATAATGAATTCTTGGTGATTTATTTTTCTAATTAATTGTCTTTTTGAAATATTTTTTGTTACATG
TTTATTTGAGATTGTTTAAGTTTTTAATTTCCTTTATTAAATATGTTAATGATTGAATATATAACTGAAATTTAACGAAGGTGCATATTACGAAATAAAT
AGCAAGTAAATTGAAATAAAAAATATAATTTTTGAGTAAAATTACAAATAACAAAAAAAGAGTTAATGTTAGAAGACAAACATCAAAGAATAATGTAATA
AAAAAGCTAATTTTTTTAAAAAATAAGTAAATAATTAAAAATACTTTCTTATTATCCATTTAAAAAGAAAAAAAAACATTTATACTATACTGTGGATTAT
GATTGCATCGATAAAATAATTTTATTTTTAATATAATTTGAATTTTGGAAAAAGGGTCTGATATACCCTTCAACTTTGTCATTTGGAGCTGATATACCCC
TACTTATAAAAGTGGATCATATATGCCCTTACCGTTATACAAGCGGCTCACATATACCCCTGCCGTTATAAAATGGCTCACATATACCCTTCATTTAACG
GAAGTTAAAAAATTAGTTTTAAATTTATATTTATTACTTCTAATTTTTTAAAAAAATTATTTAGGGGTATATATGATTCTTCTATCAAAGTACAAGGTAT
ATTTTAATTTTTTTCATACATAAATTATTTTTTGACTTCTTTTATTATAATTATTTGAATTTCTTATTCTTATCTTGTTTTTTCTTCCATTCCTTAATTT
AAAGAATAAAAAATTAAACTATTTTTTTGTGTGTTTTGTAATTTAATTTCGTATTCAAAGAAAATTTTTGGTCATCTACAATAAGTTTTACAAGAATATT
AGTGAAACATAAATAAATTTGATTATCAAAATATAATTATAAATTAGTCATTGAAACAAAAAAAAATATTTGATGAGGATTAAATTTACTCATATGGGAT
TATATAATATTACAAACCACAAAGGAAGTCGGCATCATAAAGACGACACTTACATTAACTACAACTATTTAATGAAACTTAATATAAATTGAATTTCTCG
TAGACAGTAAAATTTCATTGTCGACAAAAAGATAACCATATAATATTATAAACCACAAAGAAAGTCAGCATCATAAAGACAACACGTAAAATTTCATTAT
CGACAAAAAGATAACCATATAATATTACAAACCACAAAGGAAGTCAACATAATAAAGACAACACTTACATTGACTACAACTATTAAAGAAACCTAATATA
ATTTGAATATCTCGTGGACAGTAAAATTTCATTGTTGACAGAAAGATAACCATATAATATTACAAACCACAAAGGAAGTCAGCATCATAAAAACAACACT
TGCATTAGCTACAACTATTAAATTAACTACACAATAAAATTTCATTGTCGACAGAAAGATAACACTTACATTAACTACAATTATTAATGAAACTTAGTAT
AATTTGAATTTCTCGTAGACAGTCTCAATAGAAAGATAACTATAATATTACAAACCACGAAGGAAGTCTGTATCATAAATACAACATTTGCATTAACTAC
TATCACTATTTATTCTTATCTTTCACGAACATTTTCCTAGTCAAACCACAATTAAGTGCTTCATTAGGCACATTCTTAACAAGATGAACACCTTCAGCAA
AGACAACTCCCATACCTAAATGCAAATGAGGTTCAATATGACAATGAAAAGCCCAAACCCCAGGATTATTTGCCACAAATCTTATTGCTGTCCATCCATA
AGGAAATATCACAACACTATTCCTCAATGGTGGATTCTTCAAATTAAACTTGTCAACATCTTTTTTATGATCAAATTTTCCATCTCCATATCCTAACACC
CAAAAATTATGTCCATGTAAATGCCAAGGGTGAATTTCACTTACATTTTCACCCAAGGCATTTGCATTTTGTAGGATTATGTCAATAGTAGTGTTGAATT
TCAACATGTAAACCCTATTTCCATATGTTGAATTAGGGTTTGGTGGTGGCTTCATGATGTTGTAGTTTTTTGAGAAAGTGTTTGGTGGAGACTTAGTGTC
AAATGCATTGTTTATGCCATGTTTGATTGAGCCTAAATAGGGTGTAGTTGGAAAAACTAAGGAAATGTTGTTGATTGACCATCTTGTGTAACCTTCAATC
CTGTTGTTACAAAATATAAGTTATTAATTAAATAGAATGAGTAATAATTAATATTACATCTCTACTAATTTAACATTTAAGATCATTTTTATATCCAAAT
CTTATTATGATCATTTGTCAACAAAAATATTTTCATGTATTTTATGCACCAAGCCCAAGTAAGGGTATATATAAACAGCAAATATAATTGAAGTTATATA
CATTGATAACGTAAATTATATCTATTTGCATTAATTATTAGAATGTTTATATTATCAATGTAATTTAATAGGTTATAAGTAGCCGTTAACCAACCTTATT
TTCTACCTAGGTTGCTATAATCCTACTTTTTATGAATGATTACCTGTAATTATCTTTTGAATTTAACTTATATACATGAGTAATAATCGGAAAAAAGTAT
CCTAGTAATAAATTTTAACATATTATAGCATGTACTATGTATATCTTTTTTATTATAACTTTTTTAAAGAATAGTTAAACATAAATATCATCATTATATA
TAAGTTAAACTCAATAATAAAGCTTCATAGTTTGAGCACCCATTAGATCCCATAGATAATTTTAATACTTTCATTATATTTTTCAAATTTTATGCATGTT
CAGTCAAATATCGTCAAAGAAAGTACCTGGTTTGCGTATTGAGAAGCAAAATACGACGATTTTGTCGAGTAGGAGGCCTAGGAGACAACCCCATCAAGCC
AAAAATCTTGTTAGAGAAGGTTTTGCTATAGTTATAATCATTCCAAAGAGGTGGCAAAGGTGGTGGTGAATTTGGAATTTTTGAAGCAAAATTAGGAATG
TAGTTCAATATAGTAAGGCCTTGTGGTGTTTTTGGTTCTCTTCCTCTTACACTTATTGAAATCCAATAGTTGTTTGATGGATTTTGATCAGTTTTGAAGA
GAATTGAATAGCTTTCACCTGAATAAATATCCATATTTTCCACAAGAAATGGTTGAATATAGTTTCCATCTGCTTCAACTACCATCATTTTGTGACCCTA
TATAGGACATAAAATATCATAAAACTTATATACATCGACAGTGTAATTGATTATCATATAACATATTAAGTTTATATTTTGTCAACTCAATTATTACATC
CTCTTACCTCCCCCCACCCCTCACCCTTTCCACTTTCGGACTCTAAAATGAATATCAGATCACTTATAGAAAAAATGCAAAATATCAAGTATATATTTTC
TTCGTTTCATTTTATATGTCATCTTTCGGATTTCAAGAGTCAAAACAATTCTCTCTTTGACCATACGTTTTTCATAGGTCTTTTAAACATTTTGAACTAT
CAATTGTTATGGCTCATAGTACTTTTTACGTAGTTTACAAATATACAAATTTCATTTCAAAAAAATTGAAGATTCCATGCACAAATTTCCGATCAAACTT
AAACTGTTTTACTCTCAAAACATAAAATAAAAACTCCAATCTGATGTAATTTTAAGTGTTTGTTATTTCAGGACTCGTTTGATCATGAATTTACTTTTTA
CCCTTTCTAACTTTTATTTGGTGGGTACAAAGGTCCCTATTTCCAAACTACTCAACTTTCTTAAAGCTATGTAGTTTTCAACTTTGCACCAATTATGTTA
ATCTATCAAATTCTCTTTTTAAAAGAGGTTTGAGAGGATATAAAGAAGATTTGTGTGATTCTTGAGTAAGTATCAAATCTAATAATAGATTTGATATATA
ATATAGGGAAAATATCCAAGTACCCCCTCAACTTATGCTCGAAATCCCATAGACACACTTATACTATACTAAAGTCCTATTACCTCCCTGAACTTATTTT
ATATGTAATTTTCTACCCCTTTTTAGTCTACGTGGCACTAGTTCAAAAAAAAAGTCAATCATCGTTGAGCCCACAAGATAGTGCCACGTAAGCTAAAAAG
GGGTAAAAAATTATTAATAAAATAAGTTCAGGGGGGTAATAGGTTCTTAGTATAGTATAAGTGTGTCTCTGAAATTTCGGGCATAGGTTGAGGGGGTACT
TGGGTATTATCCCAATAATATATAAATATGACTTTTAATTTGGGTTCAGCTGGTAACTTTGATTTTCAATTTTGGGTGTAGTAAACACTTAAAATTGTAT
AAAATTAAAGAAATAGATACATTCATCCTATATGACACCCTACAAGGGAATTTTGTGTCCTACGTAGCATCTTACATGTATTATGTCACGTAGGACACAT
GTGTTTACTTGTTTAATTTTATACAAGTTTAATTGTATATTTGTGCATTCTCAAAATTAGAGAGCATAGATGTCAGCTAAAGTCAAATTAAGTGTCACGT
TTATGTATTATACCTTTAAATTTTGATATTGACTTGTAATTTTATTCAGTTTCAAATAAAAATGAATGAATTTTTTTAATGATCTGACCACATATTTAAA
ACCTTCATGGGAGTGGAGTTGACTCGCTCTTCCTACTTTTAAAGATAGATGAAAAAAAAATTTACATGTTCTAGTTTGAATTGCATGTAAATTGATTCTG
ACATCATCTTTATAAAAATAAAAGATAAAAAATATAATTGACTCGTCGATCAAATGACTTTAAAGTTGTAAATAAAGAATAATAACTTTGTAAAAAGCGA
AAAAAAAGAATAATAATTTTGACGTGACACGAAAGATAAATAAAAGTTATATTAATTTTAAAGAATATAATTGACTCGTCGATCAAATGACTTTAAAGTT
GTAAATAAAGAATAATAACTTTGTAAAAAGTGAAAAAAAAAAGAATAATTATTTTGACGTAACACGGAAAATAAATAAAAGTTATATTAATTTTGTGGCT
TTACCTCAATGGCCAAGTTGAGTGATGCCAATGCTGTGGTGCTGGCAACCCTAAGTCTATAAGTCTTGTTTGGATGAACTTTGAAAATTTGGGGTGCGTA
TTGTTCATCCCCTCTTAACTTGCACTGAGGAATGGGTAATTTGCTAAATTGCGCCGCAATAGAACAATTGAATTGACCTCTTCCATTCATCAATAAAGTC
TAATTTAATTTATCAATAACAAAAATAAAAAAATTAAATAAGAAAAGTGGTTGCAATAATTCTTTTAAATATAATGGATATTGTTAATTAATTACTATGT
TTGATTTTCAGAAATTGTATTTTTCTTTTGTGTAAAAAAAAGTGCTCTTTTGATCATATATTTAATGGAAAAAGGATAAATATATTCCTGCACTATCGTA
AATGGTATGCAAATACCCTTTTTCATATTTTTAGAATATTGGCGTTCCTGCTGTCTAAAAACTAGAGCGTAAATGTCTTTCACTCTAACGGAAGATTAAA
TAGGGACATGTGACACAATCTTATCTGTCGATTCAATATTTAATAAATGTCGAGTCGATGGATAAGATTATGACACATTTATATCTGTTAGTATAAAGGA
TATATATATATATATATAATTTTTTGACGGCATGGACACCAATGTTCCAAAAATATGACGAAGGGTACCTACATACTATTTACGATAGTTTGAAGATATA
TTTATCATTTTCTCATATATTGAATTAGTTAGATGATTCAAACTAGTGATATTGTGTGAAGAAAACATAATAGAAAATCTACCTACTATATTATTAAAAA
AAAATATCTTTTATCCCTTTATTACGGGGAGAGAATAATTAGAGAAATCGAACTCATACCAACAAAAAGTGAAAATTTAGTTAATCAATAAACAAAGCTA
CTAAGATTCTTCGCAATATATGATACTTTATTAGCAAAGTACAAGGATAAATCTTGATTTTCTTTTATTTTTATATTTGTAATTTTCATACCTAATTAGT
TCTATAATTCATGGTTATAATTGATATATCGAAACCATATTATAAGAAAAAAAAGTGGACTTCTATTAGTTCTGTCAATAATTTACGGTATGAGTTGTGA
TGAGATAGTTGAGATCCCTTCATCTTTAATTATAGGTTTCAGGTTTGAAATTTGAGTATGAAAGAAAATTTATAATTCAATACGCGAATTCTGATTAGTC
AGACTCCAATGCAGATAGATATGTACCTGTGGTTCACCAATCCAACGAAAAGGCTTAGAAGAAAGATCAATTTGTTGGTCATGATAACTTTTATGCCACC
AATCACTAAGTAACAAATTCAACTCTTCATCGTAATGGAATGGTTCTTTTTCATCTTTTGGTACTTCAACTATGAGTGAACCATATAGTCCTGCTGATCT
TTGCATTCCATAGTGTCCATGATAGAAATATGTCCCTGCCTAATCTACTTCAATTGATTAGTCAACACACACACACACACATATATATATATAATTGATG
AGTCAACACACACACACATATATATATATATTTTAAAAAAGTAATTTTTTAGTTGGATAGATATTGAGTTCATATTGCAAAAGTAGATAAACAAAAGACT
GATGTACAAAGTATCGTGTGTTCACGTATGTTTAGGAAAGGGCTTGATTCAAAGCATATGATGTATTCCCTTTGTTTGAAAAAGATTGACCTAGTTTGAC
TTGGAACGGAGTTTAACAAAAGAAAATAGTTTTTTTAATCTTGTGGTTCTAATTTAAAGTTATGTCAAATGTACCAAAATACTCTTTAATCTTGTGGTCT
TAAATATGTCATGTGGAAAGTTAAAGTTCAAGTGTTGCCAAAAAAGGAAACGGGTCATTCTTTTTTAAACAGACTAAAAAGGAAATAGGGTCATTTTATT
TAAAACGGAGGGAGTAAATAGTTTATTCTAATGTAAGCTCAACTTTAACAGTTACATGGAGACTACTTAATCGTTGCTATAAGGTTTCATGCACGGTGCT
GAGAAAGGTTGACCTCAAGAGCAGGGGCGGACCTAGAGTCAACCGATGGGGTTCGGGTCAAAAAAAGTTCGTTGTATATTTAAGGTAGTTTTAAAAAAAA
TTGTTTATATATTTGAACCTCCTGAATATAAGATTAAAGATTGGCTTAGTGGTTGAAGGGTTCAAATCTTAAGCACTACTCTCTCTTTTTTTCAACCCCC
TTAATGGAAATTCTGAATCCGCCATTGTTCAAAAGGCGTAATATAGATAGTCTACCTAATTATGCAAGCAAATATTAATGATTACTTTTACGACTCGAAC
TAGATCAAAATATAAAATAGGAACAACTTTATCGTTGATCCAATGTAGTCCTCCAATAGTGTTCATGGTAGAAATATGTCCCTGCCTATAGTATTAAAAT
AAACTTAACACATTTATTTTTTGAAAAATGTAATTTTTAGTTGGATAGATATTGTGTTCATATTACAAAAATAGATAAAGTAACGATTGATATACAAAGC
ATCACGTGTTTACGCATATTTAGGAAAGGATTCCTTTCAAAGTATATGATCTAAATATTTTATTCTAATGTAAATATTAGTGATTGTTTTTATTATTTAA
ACTTTGACTTGTAAATTACACGAAGTTTATTTTATCGTTATTATAAGGTTTCATGCAAGGTGCAAAGAAAGGTCCACTTTAAAGGGTGAGACGTAGACAA
TCTACCTAATACAAGCAAATATTAATGGTTACTTCCACGACTCGAACTAAATCAGATGGAGACAACTTTATCATTGTTTCAAGGGAAAATGCACAAATAT
TCCCCAACCTAAGCTCGAAATTTCAGAGATACATTTATACTATACTAAAGTCTTATTATCCCCTTGAACTTGTTCTATAAATAATTTTCTATCCCTTTTC
GACCTACGTGACATTAGCTTGAAAAAAATATATCAAAATGGGCTGGGCCCATAAGATAGTGTCATGTAGGCCGAAAAGAGGTTGAAATAATTCATAAAAT
AAATTCAGGGGTAATAAGATTTTAGTATAGTGTAAGTGTTTCTGAGATTTTAGACATATGTTGAGGGTACTCGTGCATTTTCCCCTTTTTCAATATTCAT
GCTTCACTTATTTAACATATCATTAAAATTTCTACAATAAATGTTTCTTATTCTAAAATTAAAATGTCAAATATTTTAGAATAATAAATTCATTATTTTC
TAAAGAGTGAAATAATTACCTTGTCAACTTTAAATTTGTATAGGAATGTTTCTCCAGGATTAATGGGACATTGGGAGATCAATGCAGTTCCATCAGCCCA
TGGTGTTCCAATCTATAATTACAAAAAATTCACCAAAAAAACAAAAAAAAATGTTATATATAAGAAATAATTATCAACATTATTTTTAAAAAAATTCACT
TTTTCCCATTGAACATAAATTTCCTTATCGAAAAATATTCAGTGACTATTTTCACAAATATTTGGATTAAATCAGTGAAAAGGGGAAAAGAAAAAGAGTA
GTGTTTCACATTGAAAAAGTTAGAAAGTTTTCTAATATAATTTCAATGTGAATTTATTTCTCGATGGGTATTTTAAAGTACGTTATTTAGTGAGAATAGA
ATTTCTCGATAGGTACTTTCAAATAAGTTTATTTAGTGAGAATAGAATGAAAAATCATATTTTATAAGATGAATTTTTCATTAATTTGAGATGAAAAAAG
CATGATACTTTTAATTAGCTATATATATTAATATATATTAATATTGAAGAAATTTGTTATAACCTTCTTTCATCACATAAATTAGGTCACCTAAAAATTA
ATTACAAATAACTTTTTATAAGAATGATGAATTGATGAGCTGCAAAAATATATATAGAGTACTAACTGACTTACACTAGTAGTGTAAAAATCTTCTTTTA
ACACTATGTTAGGTATAAATTAACAGGAAAACAAGTTACTTAAAAATAAGAAAAATATTTTTTCTGATAAATATAGAAAGTAAAAAAAATTTGTGAGTAA
CAATATTTAAAATATTTTATATAATATTTTCTTTCAAATATTTCTAAAAAAAGGGACTTTTTCAGAGGTAAATATTGAAAAACATTTTTCTTCGTACTAA
ACATACTTTGATATTTATGTCAAAATTATTTTGTATATAATATATACATCAAATCGAAACACGATCTCACTGAAATCTCAGCATCACCACTTATACTATC
AACAACAACAAATTCAGTAAAACTTTACATAGTATTTTCCTTGATCATTCCTGCTCCCTACTTCGCACCCCAATTCAAGACCCCTCTCATCCCATATAGT
ATTTTGTTATATTACATAAAATTACTTTATATATAACATTTTCTTGCTTATCTATCAAATAGTTTTATTTTATTTTTTTTTAAAAAAAAGAGACTTTTTT
TCAGGGGTAAGTGTTGAAAAACATTTTCCTTCATAATATATATCAAAATTACTTTACATATAACACATACATAAAATCGAAACACTCTTATTGAAATCTC
TTACTTCACCACTTACACTACCAACAATAACAAATTCAGTAAAATTTTACGTAATGTATACGCAGACGTTATCCTACCTGTGAGATTCCATGCCAATGAA
TGACTAGTCCTTCAGTATGAAGATTATTGGTAAGGTGAACAAAAATGGTGTCACCAACAATTGCTCTAATTGTTGGACCAGGAAATTGTCCATTGATAGA
TATCACAACACCATCCACACCATCTGGACACCAATGCATGTACTCAACCTCCCATTTATAATCCCTATTTTTGGCTGAAATTGATGACAACAATAAAAAC
AAGTACAAGATGCCTAATAATGAAGACATATTTATATTATTATTATTATCAAACTAATTAACATAGGGAGTATAGACAACCAATAAGTTGGTCTTAAATT
TATAACATTTTTTTGTGTATAGGTATTTGGCCCAAGACAATATAATGAGTTGAGGCTCTATCGAAAACAACTGATGCTAGCCTCTCTATATATAAGGGTG
GAGCCACTTTAGTCGAAAGGTGGTCTAGTGCACACCTTTTGCGAGAAAATTATATGCGTGTGCGTGAAGGTTAAATGTTACTCTCTCCGTTTCAAAAAGA
ATGTTTCTATTTTCTTTTTAGTTTGTTTAAAAAAGAATGATCCATTTCCTTTTTTGGCAACACTTTAACTTTAACTTTCCACGTGACATGTTTAAAACCA
CAAGATTAAAGGGCATTTTTGGTACATTTGACATAACTTTAATTTAAAACCACAAGATTAAAAAGTCGTTTCTTTTCTTAAACTCCGTTCTAAGTCAAAC
TAGGTCATCCTTTTTTAAACGAAGGGAGTAGTTATTATGAGTGTATAGGGATAAGGTACTAGTACCCCCTAGGCTATTACCGAAATTCCAGAGACATACC
TTGACTAAACTAAGGTCTGGTCTTATTACCCCTTAATCTTATTATTTTTGTAATTTTACACCTTTTTTTACGTGACATACTCAGTGACTCCACGCAACTA
AGGCGCGTGGGAGATATTTGGATGCCACGTAAATCAAAAGGTGCACAAAATTACAAAAAAAAAAGAAGATATAAGGAGTAATAAGACCTTACTTTATTTA
TGGCGTGTCTCTAAAATTTCGATCAGTCTAGGTGGGGTACTTGTACATTTTCCCTAAGTGTACGTTCAATTTGTACACTCTTCACCAATTTTTTAGCTCT
GGCAATGTTTATATACCTTCATAAAGCGAAAATACGATTTGTGTACATATCTTTTTTTTATTATTCAGAATCTATTTGTGAAATTACACTGAATATATTG
TTATTATTCTTGTTATTGTTCATGAGGTGTTAATTGGCCGAAGAACCGAGGATACTCTTATTGGACCCGACCTAGCTCTATACCTCTTCTAATTATTTGT
ATTAAAATCCGACTTAATTTAAATTCATGCATTGTAAGTCTTACTTTTAGAGAAGACGTTTTCAAATAAGACTTTTTTCTATTCTTAAAAAACTTTTAGA
CCTGAATTTCATTTTACGAAAAATGAAGGAATCCGAACCGCCCCATCCATACACCACAATCACATTACATGATTTTAACTCTCTTTTTTAATAATTTTTA
AATGAATTTGGCCTTAGATTATATAGCTTATATATAACACTATAAAAAGAATAAATTCGTTATAGTACATTTGTATATATGAAGGAATTTAATCCATTAA
TTTGGTATAAAGAACAAAATTCATGACTTTTTTGTTACTTTCCCTTCAAGAGAATTATCGTTACGAAATTAAATGTCTTTCGAAAAAAAAAGTATCACGA
AATTAATTGGACCAATAAAAATAAATATTTATAATATAAAGCTATTCAAAAATATATATTTAATAGGAAGAAAGTCATATATACCAAACGGATCCTAAAA
TTTTAATAGAATTCACAAACCCTAACAAATAGCTCTAATTAATTATTAGTACTTTTCTAATTACCATCTATGATTGACTAATTATAATATCAGTATTAAG
TATGATGATATTTTTTTTTAATCTAGTGATAAAATGAGAAGAAATATGCATGTACATTCCTCGACACGAGGTTCGTCAATGCCTTTAAAAATGAGACATA
TATCTTAGACCTCAAAAATCGAAGGACCTACTTTTTTTTTAGTAATAACAAAATTATCTTAAGCTTTTTTTTTAACAAAAAAAATAACAAATGTTTTAAT
TTATTTCGACACATTAAAGAAAGTTTCTTTTTTATGGATCAATTTTAAATTTAACTTCCACATAATATGTTTAAGATCACAAAATTATATATCGAGAGAG
TTTAAGATCATAAAAAAAGTAAAAAAATTATCAAAAAAAAATAACTTGAATCTCAAATATATAAAAAAGTAATTAAAATTTAGACATTCAACTTATTTTT
GACTTAAATTACTAATTAACTTGAACCGTCACGATATGCTTATTTAAAGTTTGTCATAAGGTAGATACATGAAGCAGTAAACAGTGGCATGGTAAGGGAT
GAAATATAATATTTATTCATTTTTAGAGTCGTTATTTCTGTAAATTTATTTGCTAGGTTGAAATTTTGAGTCTGATTTATATGTAAACGTTGCCTTAAAT
CTCAACCATATGCTCATATGCTCCAAAATATGTTCTCTATAACTTTCAATAACCAAGTCCTCAAGGTACTCAAGATGACCAAGTCCCTATTGTGGGTGGA
ATAGTTAATGAAATATGAGCCTTGAGGAATACTTAATGAAATTCTCCATGTAGATATGCCCCAATAATGTCCCTTTTTAGCATAATTTCATGATATGTGT
GCATATTGTATCATACTTAGTACAAGTAATGTACTAACGTATTTTCTTCCTTTTTCCCTAACATTTTAGGTTCCGGTCGTTGAAGGGCTTTGAGATGACT
TTGAAAAAGACTTGAAATTCTCAACCTCACTTTCTGAGGACAATGTCACTATCAAACTTATGATGTTGTTCTAGTTTTAAGGCTCCTATGTTCTTTCCTT
TTTCATTTGAATACTAAACAATGTATGACCTATATGTGGTCTTATTATATTGATGTATGGGCTAGGCCCAAATTGTTACACTCTTGCTAGATGGTTATGA
GATGAGACATGCTTTTGAGACTATATTATATTTTATATATCTATATGCAATAAAAGTAGAAGACTAAGTAATCTTCCTATACGAAAGGTCTATGTATACT
CGATATAAATATTATGTGTATGTAGAAATCTATGTAAGCCTCAATGTAGAAATAATGAAAAGTTTTTAATAATTTTGCATTTTTAACCTATGAATGTAAT
GATGTAAGCTAAGAGGCTAGTCTTAGTCCTCAAAGAGGCCGCCGCCGCCGGTTACGTATAGGGGTTGCTCCCGAAATGTGACAGTAGGATTGTTGTAACC
CTTCTCCAACTCATTAAGGGGTCCTCCTGTTATCTAAATCAATTAATATCATGTATATTTTCTACACCGATGACTTATCAATCACAGAAATATATCACGT
TTTGATATCTACTCTACTTTTACAATCAACATACGAAACACGACAACTCAACATAAAATAAATATTCCTAGGGGAAAAATTAAACAGGCAAGATTTTTCT
CTTCAGATAGCTTTGGTGAGCATACTTGATTTTCGGAGGATTTAAAATTTATTTCATGTTATTGTTCATTTTTTTGTGGGTTTTGTCCCCACGTCTGTCA
TAGTATTAAAGGCTTCATAGGTTGTTATAGTTGAGGAATTTCTTAGTACTTTCTTTCCTTTAATGATTGTGTTATGATGTATTATTATTATTTGAATTTA
GTAGTTTCAGACATTTCAATTGATTATACATTGAGATAAATGTATGTGCTAAATCTATTATCGTTTGAGTCTTTCACTAAATAGTCAGTCAAATCAAGAA
TTTATTTCGGGATCGAAAATGATTTTTGAGTGTCGCCAAAGTCTAGGGTATAGGCTTAGGAAGTGACAATTGATTCCATAGAGATATTAGTTTCTCCAGA
AAAGTATCGAAATTACACCGTTATTATAAAAAAAATCGGAATGTATTCTTCATCTATCCATTTATTTTAGAAAAAATACCCCTCTGTTTACATTTTTGTC
TTAGGCATATCACAAGATTTTTCTCTGTTTACTGAGTATGTTGTTGCATGGACCAATTCGGATAGTGGTAAAGTCTGCATACACTCAACCTCCTTAGACC
TCGGATGGTGATAAAGTCTACATACACTCAACCTCCTTAGACTTCATTTAGTGAAATTTCATTGAGTATGTTTTTGTATAAACCAATTCGGGTAAGGATT
GAAGATCCCAAACCTCATTTAGTGAATACACTCTATCTTCTCTAGACCTCATTTACCGAAATTTCACTAGGTATGTTGTTGTATGAACCAATTCGAATAG
TGGTAAAGTCCACATACACGCAACCTTATTAGACCTCGAATAGTGGTAAAGTCTGATACACTCAACCTCCTCAGACTTCATTTAATGAAATTTCACTGGA
TATGTTATTGTATAAACCTGGTAAGGATTGAAGATCCCGAACCAACGATAATAACATACTCAGTAACAAGTGAAATCAGAAAAGAACAAGATGTACGCAG
ACGTTACCAACTATCTTTCATGACTAAAAAACATCACAAAGGTATAGTGATTAAAGGTCATAAATTTGTAATCACTACCTCATAATTGCAAAGATTAACC
AACTTCAAATCTCATGGAGTTAGGGGCAATAATATTAAGATTGACAATTGAAATGTTAAATTTTTTGGGTAAATAACATTGAAGCCAATCTCATCAATAT
TTCACTAAACAATAATCTAAAAGTACAAAACAAAAAAAAGTTCTTTTCCTAACCAACAATCTCTGCATCAGTTGGAAGGTCATATATCCCTACTGTAACT
CTTCTTAAAGCCTCACTCTACTTTCTTGCTCTCTTCCGCGGCGACTTCTTCAGTGCTCTGTGTTTTCGACTCATCGAACTCCAACAACTGTTCAACCATA
AGATCAAGAATGCAATACAAAGGTTTAGAAAAGCCCCATCTAGTGTTGCTCTTATAAGAAGGAGAAAATAAAACAAGATTAGAGATAAGTCTTTGCTTAA
ACGCGTATATATGAGAGAAGGCCACATTGTGGCATGGTAGTAGTCAATGAAATGAGATGAAAACCGTAAGGAAACAGAGTTCGAATCCTAGAGGAGGCAC
TGCCTGGAAAACTTATTCGGTACATGAGCCGATGGGAGACAGCAGGTACATGACAGAATTGAGGTGTGCCCAAGGTTTCGTGGACACTACCATTATCAAA
AAAACGTTAAAAATTGAGAGGAGGAAACTACACAATTATGACAATCCCTACTACTTATCAAATCCTACGCTATGTCACTGAGAGAAATTGACCGATAAGA
CATGCTTGGGGCCTAAAACGACGTACTATTATACTTTATGACCGAATTCACCAAGTTCTGAATACACAGCAATTTAGAGTAAAACAGTAAACAGACACTC
AAGGCCCATATAAAGTAAGACGGAAACAAATGGAGCGAGGAAGTTATAGATTAGATTATAAAAAGAAAAGTTTACCGGCTTCATATCCCCATTCCAAATG
CAGTGCACAGCCACAAATCCAATTACAGCTGGAACAATATACAACAACGCGGGCTGGAACAAAAGGAGTACGCAGAGTGCAAGGTTAGAGAATATCGAGA
AGGTTGAAAAACAAGGGCACTGTAGTCCTACTACAGAATAAAAGAAACAAGCGTTTCTGGGACACCAACCTGTGCAGCTTGAAACCAGTTCATCACAATA
ATGGTTGAAATCACACCAACAGCGTATCCCGAAAATGCACTTATAAAGTATTGAGGCCCCTTTCCTCTGGAGACATCAAAGCGGAGTGCCAAAGCCACAA
AAATGCCTGAACAACAGGATAATTACTAGTTTATGACAAAAACTAAATAATGGGAGGTTTGCAAATTCATATATTGGCTTTTGTAGAAAGGTCATTTAAA
AGCAACAGGTCTTTATGGTAAAAGAAAGATGTTATACCAGGAATTACAATATCTCCGAGACCCAACATTGAAAAGGGACGTTTCAAATCCGCTGTGGGGA
ACAAAAGCTGCAAAAGGAAACAAAAAGCAAATTCTAATTACGAAGAGTAAAAACGACGAAAAAGGTCAGTATTCACATATTGGAAGAAAAGCTAGATGAA
AAGAAAAAAACTATACGCACCTTGATAGGAGCATCAAAAGACTTAGCAACACTAACCATCACTGGGGTAAAAAAGACCCAAAAGATGTCATACACAAAAA
GTCCAGCCTGCAGTTAAGAACATAGTATTCATTCAGCAAAAAGACAGTGATTTGATGCATAGAGAAAATGCCAGAACCAACGTCACATAAAGCTAAGGAA
ACTCTATTTATTTCTCGATCCACTATGTATCATACACGGGAAAAAGGATGTGTTTATGTAATGCACACTTAGGAGATGGCTCATTAAAAGTTCCACTTCA
ACTATTTAGTCGTGCAGTATAGCCCAATAGGAATAAACAGAATGACACCTCTGTCCCAAAATAAGTGTCACCTTAGGAATTCATGACAAAAAATTGTTAT
GTTTTTTCAACTACACCCTCATACACCATCTTGTTTAAGTGTCAAATTCTCAAGCAACATTTATAGAATAAGGGTAGTCTAGTAAACAACACATAGTATT
TAATTTCTTAATGGACGAGATTTTTGCTAAAGTGACACTTATTTTGGGACGGGGAAAGTACATATTAAAGTAAAACTTCTCTCCTTACCAATAGTATGGC
ACCAGTCTTAAATGATCCAAGGGAAAGCATTTCAATCCCCTGCACGTTCAAACGGAAAAATAAAGTCCATTATTCAATACTTCAGTTATACAAGGAAAGT
AGGGGCATGCCACCTTAACTTTTTATCTATCTATAAACAGCAAACATCAAAGAAGTCCAAATGGTAGCTATAAGCTATATAGACCTATGGGCTATGAGCT
TCTTCAAAGAATATCAAGGACGCTTTTGGAAAATAAAGGACTCATAGGCAGGTGAACTGTAGTAATAAATGTAAGTTGAACCACCAATCTATATGACATA
TCTAGAAGTAACGATCAAAAGGAGTGGGCTAAGTTAATTGGACTTCGATGATTCACAGACATCAAACGGAGAGAGAGAGAGAGAGAGTGCACATTCATGT
CACGGACTTGACACTAGAGAAATGATTGATGCTAGCATGTTTTTTTGTCTTTGCAGGGATTTGAACCTGCGACCTCATAGGTCTCACCCACTTCATTGAC
CACTAGGCCACACCCTTGGGTGCTAACTCTAAGAAAATCTTATGCATAAAATGAAGCCAGATCAACCAAAATCACTATTTCAACTTCAAATAATCAAAAC
AAGATCTACAGTTCATTAGACAGAGAGAGAGACACACAATGGTAACATAACTAGCTGCAACAGTGTGACAAGCTTTTTTTCTTTGAGAAAGAACGACGTG
ACAAACTTTGTTAACAGAAACAAACATTCAATTCAGTGTCCAACCAGCAGAAGAGAAAAGATGATGCAAGAAGGTTGTTTCAGGATCTTAAAGCAAACAG
ATAATGTAACTACGCTAGTTGTACAGACAAACCTGAATAGAAAATGCAAGGCCCAATACATTGTTAGCTAGCCAATGCTTCTGTTTAGCATACCATACAC
AGAACATGGTTCCAGGAATTGCAGCAACAATCTGGGACCTTGTGAACTCAAACTCCAAAGCTGAGAAAGAAACAAATAAACATCATCTCTAGAGAAAAGA
GAATGCAGAAAACTAACATATTCCAGTCAAAGATGTGAAGGTGTACCACCTAGTGTGGTATGTAGGGAAATGCCATTAATTAATGATTTTACAAGGGTGG
GGGGAAGAAGAAAATCCATAGTGAGTAAAGCAAGATTTAGATTCTTTCGGGGAGAAAAAGCCGGTCGCCAACTAGTATTTTTCAATAGGAAAAAGAAGTG
GTCCATTATTTTTGTCTATGCATCTGATTGATGCTATCAATGAAATCATATTACTTCATTTAAAAAGAAAAAAAAAGAGCCGGTCCATACAGCGGAAATA
TGGGAAGTGCCATATTACGAGATCTTCATTCCACTTTTCCGGCAAGAATCGTTTGATAGCAGGTAACAGTGTTGCACTGCAAAGGCCCAAAGAAAGAGAT
GATATTAAAACATATAATGAAACTACTTTTTAGAAAATTGCATAAAAAATATACTAAGCATAGTAGAATGATCCATACGGAAAGAACATACGCAAAAGCA
GCAATGCCAAGTACAAAAAAGTAGCACGTCAATACAGCATTAACCAGGTCTTTTGAGAGGAACTTAAAAAGCAAGAACAATGACAAGAGCATTGCACTTC
CAACCAAGGGGAATCTCATTGCATGTTCCTTAGACATTGTCTCCTACAAAGTAGAACAGAATAAGTTTAAGAAACATCAAAACAGATAACATATAAAAGC
AAGACTGCAACTTAAGAGTCGGGGAATATACCGTAGGTGGAGTAGGCTTAACAGAACGGTAGCAACCCACAAAAACAGTGAGACAAGCCGTTAGCACGAC
ATTCAAATTTGGGTCCACATTCACAACCAGTGGGGCCAAACTCAAACCTGAAATTCACAACCAAAAACACAAGAGTTCTCAAGGTAATTCAGAAACATGA
AGTCAAGAAAGAGATTTGGAATAACCAGCAGCCTTTTCTCTCTCCACAGACCACACAACCAGAAACTTTTTCTAATCATAAAGATGATGCATTGGGGAAA
GGAGAGAAAAGATGAAAAGAGACAACAGCAATAGAGCTCCCTGAGGTGTGTTGACTGAACTGTCCTAACAGGAGGCCATTTGATTGATTGAAACATCCAA
CACTAAGGAAAAATCTTAAAGCCCCTTCAATACAAATTCATCAATGTACACCCACAAAGTCGGACCTATTAAAATACAGGAAACTAGGTAATGAGCAGAC
ACCCAACAGACAACAGAACACGAGGAAACTTTTGAACAGCCATCACAACACTATATCAGCATGTACTCTATAGTCTAAAATGACTTGATGACAGTACCTA
GCTAACAAGGAAAGTCGATTGCAGAGAACACCAACAACAAGAATCCACCAAAAATTGTGATATTTGAAGGGAAATGGCCAACTATGGGAGGGTGCTACAC
AGCAGCATATCAATCAATCAATCAACTAGGCCTTATACCCAAACTAGTTGGCATCAGCAAGGGCCAAACACCAGTTAACCTAGCAATATACATTTTGCTG
AACATGCATTGAAGTTCAAGAGTAAGAAGGATGGTCCCATAGGCCCCTTGAAAATAAGCCAATGCCTACTTCAGAAGCATAAATACATAAAATGATGCCT
GTGGGCCCAAATCATCAGACCATTTGATCGAACATTGTATTAAAATCATCAAACCTAAGGAAGACAGTAATGTGAAGCCAATGAGAATTTCCCGAGGTTT
GACCTCTTACAATAAGCAAAAAAATATTATGGCAGCTATAGAGTAGGATATTTGGTCTTAACTTTGACAAGCATAAGGGATAAAACTTAAGCATAGGAAT
AAAGGAACTGTTCTGTTTTACAACACATCTGAAGTGAGGAAAGTATAATAGCAACAACAAACACAAAAGAGAATCATACATATACAGTTGTAGCATCTAT
TTACTCCGCAAATCTAAATGACACATATCCAAACACTCATAAATCCATTCTTCATAATCAAAGAAGAAACTTAAGAATTATGAGTTCTAAAGATTTATCA
AAATAATTTCAATTGACACCGTTGCTCATCTCATATCCTGCAGATGGATTCCTTCACTTCCAAATTCCAAGTTATCACAAAACAAATCAAACTCACTATA
CTATACATTACTAAAAGAAACATTCATGAATTGAATTGCACAAGATAAACTCATTTTACTATGTAATCCAGCTACCATTAAGAAACGCGCATGAATCAAA
TCGAACCTGCTAAAGCAACATTTGCTAATCGTTCACTATTCATCATCCTCACAGACTACTAACTCAGAAAACACTTAGTTTTCTTCCCACAGCAACAGAG
ATAAGCTGCAACAAGCCCCAAAAAAAGTATCAGTAACAATAATCAACATTAACATCTTTTCAGATCCTAAAACATTAATCTTACAAAAATAAATAAAGGT
TCAATCTTTAACAATATTTCTCACCAAATTTATCAAGATTTCGTCTTTCTACACATTTCAACAAAAACCCAATTCTAGGATATCAATAAACTTGCCTCTT
AACATACAAACAAATCAATTGGGATTAAAAAAAAGACCCCCAAATCTCTTAACTACATTAATTAACCTCTAACACACATGAAAACCCAATAAACTGAAAA
TTTCAAAAAATCCAAATTCTCAACAAAAACCCAATCCTATAAAAAGCATAAAAGATTGTTTTTTTAGGAAAAACAAAGAACCCCAAATCAAAATATTAAG
TCAAAACACATATATCACAAGGTTTTTGATTAATTTTTACCTTACAAAACAGAAGTAAAATTGCTGATCTCCGAGTAGACAGATCAAGATGAGATTTTTC
AACAAGATAGAATTTTTTGTAACGTTTTTGGATTTTTTATTTTTTTTCTTATTATTTATATATATATATTTGGGAAAAAAATAATAAATCAAAATAAGGG
TTTTAAGATTTGGGTCAAAATATAGTCATTGGGAGAAGCACGTTGAGATTGGTTGTTTCAACCAATAGGATATCGCCACGTCAACATATTGAGAAATTAT
GACACGTGGAACTCTCTCAAATTTTTTTGGAAATTTTCATTTATTAGATACTTAAATTATGCTCGAAACTTTTTACGCGTATTCTATTCTTTACCTAAAT
GTTTAAATAAAATTTACGATAAACTAATAAAATTATTTGCACGCAAAATTTCAATATCACGGAATTTATAAAATAATACTTAAAACTTATTTATCATTAA
AACTAATATATTATATTATCTTACATAGTAATGAACATTAATAATTTTATAAAATATTTTTTTCTTTCACGAAGTGTTACTATTTGATATTTTTGGGCAA
TCAAATGAATATCAATCTGAGATAGTAATTTTTTTAATAAATAAATAATCATTGATGAAGGAATAAATAAATTTTAAAAAAATGATAAAGTAAATAAATA
TTCTAATTTTAATGTGTAAAAAATTTAGTCATACCTTTTGTTTTTACATATACCATTTTAAAGTTCATAATTAAATATATCATAAAAAATTATTGAAATA
AAATTTTTTTAATACATGTATGATGGGTGTATTTTGCCTTCTTTAAAGTTTAATGCATGTATAATGGAACAAAAATAGAGCAAATAATAATAGGATCAAT
AAACCAAAAACACACTTGAACAATAAGGTTTATTCATGGTTTTTTTCTTTTTGTTATTAAGTTATCAATATTAAGTTATCAATATGATAGTAAAAAATGG
AAAATTGACTACAATATGATAGTTAATAAATGTTAGGGAAAAGGATCTGATATACCTCTTAACTTTGTCATTTAGAGTTGATATACCCTTTGTTATGAAA
GTGACTCATATATATCCCTAATTGTAAACAAATGGCTCACATATACCCTTTTCCTCCAACGGAAATGAAAAAAAAATTATTTTAATCTAAATTTTTATTT
TTTTTCTAAAAAATATAATCATATATGAGTAAATTTAATCCTCGTCAAACATATTTTTTTTGACTTTTTTTGTTTCAATGACTAATTTATAATTATTATT
TTGATAATCAAATTTATTTATGTTTCACTAATATTCTTGTAAAACTTATTGTAGATGACCAAATTTTTTCTTCTAATACGAAATTAAATTACAATACACA
CAAAAAAAATAGTTTAATTTTTTTTCTTTAAACTAAGGAATGTAAGAAAAAATAAAATAAGAATAAGAAACTCAAACAATTATAATAAAAGAAGTCAAAA
ATTAATTTATGTATGAAAAAAATTTAAAATATACCTTGAACTTTGATATAAGAATCATATATACCCCTAAATAACTTTTTTTTTTAAAATTAGAAGTAAT
AAATATAAATTTAAAACTAATTTTTTAACTTCCGTTAAATAAAGGGTATATGTGAGCCATTTTGTAACGGCAGGGGTATATGTGAGCCGTTTGTATAACG
GTAAGGGCATATATGAGCCACTTTTATAACGAGGGGTATATCAACTCCAAATGACAAAGTTAAGGGGTATATCAGACCATTTTCCCTAAATGTTAATATG
TTTCTACTACTTATATATAAGTGGCAATAAGCACACAACTGAAAGTCAACATGTCTGCTTCAGCTGTGTGCTTATTTATATAGCTGGCCTATCAGATTAG
GCTTCGTGTTTTAACCCCAAGGTCTGGGGTTCAAACCTTGTCAACATCATTTTTTATATTTCTATTTTAATTTCAGCTTTGTCAGTATCAAAATAACACA
ATTTTGAGTATGAAAAGTGAACTTCTGAAACATATTATCACACAATCTATTGATCTTTAAAATGCAGAGCATAGGCAATATCAGATGGGGTGATAATGGT
TATGTCAGTGCAGGAAGGCAAAAAGCATATTTTTCTAACAACTATTTTGGCCAAAGTTTGGTATCGTAACAACTATTTTGGTCAAAGTTGAAGTATTTTT
CTAAACTTTTGCCCTAATTTTTTTTCTACTAGAGTAGACCCATTTTTATAAAAATCAAGTCTTATTTAAAGTCACAAATCAATCGCATTGTAACAACACA
ACTCTTCGTTCATGACATTATCTTCTTTCTTTTGCAAGTAATTCACAATAGGATCACAATAAGACAATTCACAAAACATCATTTTTAATAACAATAAATA
TAATGATGTTTTTTTAATTAATCCTCATTTTGTTCATTAGGATAAATTAAGTAGAACAAAAACTCCATCACTCCACTCACATTATTCCTCAACATACACA
ATGAAGGAAAATATACAAATTATACTAGAATTACAAGGTTTAGGAGATCAATTGTTTTAATCTATTCAACTAATCAATTCAGGACTTGTATTTTTCTTCT
TCCGAGCGACGTCCAAAGCCACATAATCTATTTCAATCAACTATTTACAATAAAATTTCGAAATTAACAATATTCAATTTATATATTTTGAAAACAAAAC
AACGGGTTGATTAATCAACTCAAAATTCAATTCCGAAAATGATGTTTGAATCCAAAATCTTTTACTTGAAGATGTTACCTAAGTCATATGCAATTTGTTG
GTGACAACTGTTTCGAAAAAAGAAATTACATTCAGTTCACAATCTCAATTCTAGTTTAAAACTCAAGTTCTTGAGAAACCTTGTCATTAGCCAATCAAAA
TCTCAAGTTTTGATGTTAAAAATTCAGATATAATCAAAGGAAAATAAAGTTTTAAGAGTCATAAAACTTACCCAAATAATTTAGTACAAGAAATCTCAAA
ATCGCCTCCAAGGATTTTAGCAAGGTCAAAAATGAAAAATGGAGTTTAAACCCCAAAATTTACAGCTCAAACCCTTCTCTAATGAATAAAAAACAATCAC
TTTTTCGAAAAAACGAACCCCAAAAATAATTTCGACCTTCACTTTTGCAAAGGTCGCCATTGTGAATAGGTCCTTCGCGATCGTGAAGGTCAAAGAAAAT
TAAACCTTCGCAAAAGCGAATCAGACCTCATTATCGCAAGCCTCACCAAAGTGAGCCCTGTCTAGCGATTGCAAGATGCACTAGAATTCAGACCTAAGTA
AAATCAGTCCAACTCAAAAACATTGAAATGAGCCTCAAGATTCGTTCAAACCCCCTAACATACAAATTATGTATGAAATTTTAACTATATTCGACATTTC
AGATTCAATGGAACCATCAAATTTGATGTCTTCTTGACCCGAAACTCGTGAAAATAACAAAAATTGAATATAACGCCTAAAAAATACCAAATCAAGCTCG
AAACCTCTAAAAATTCAAGTAAATTCACACGTAGACCTAAAATTTATCTCCCGAATCCGATAGAACCCTCGAAATTTCGATTTAAACATTCGAACTTTGA
CTATTGACCAAATTCAACCCAAATTGCCATCAACCTCCTCCTATATAGGATCATATCCTCGATATTTAAAACAAAAACACTAAACCATTTTTTCTCATCG
ATTTTAATAAAGCCATCTATCTATACATATATAACTACTCAAAATATTTCAAAATATCATTCTTTTTCCCTCTCTTATAAGCCGGCAAAGGGTGGGGGTT
GACGAAAGGCGGCGGGTGGGTGGAACCCTAGATAAACATTGGTGTATACAACACTTATCCTTCTTTTTCCCTCCATTTTAGGCCATGTCTACCGTTGTCG
AGCTTGAGATTGAGGGGTCAGAACTCTTGAACAACTTTCAGGATTTGTCTATTGGAGAACAGGTAATTGTGGGGTTTTCTTCAAAAATCAAGATCTATCT
ACCCTGTTGCGAATGTGTGCATGTAATTCATTTTCTTTGCTTTATAACTGGTAGAATTGATGTTATGTGATCAATTGGTGATGGGTTCGAGCCGTGGAAA
CAGTGATATATCTTGAATGTTGTTTAAGAGTTTCAATTAATTGAATTTGATTGTGTGTTTGCAGTAGTTTTTTTTATTGTTTAGTGGTTTATAGAGGTTT
AATTGATTTGGGTGTTAGTTGGATTTGATTTTAGAGACAAATTCAAGATTTTTAGGTTTGTGGATTTTGAGCCCTAGTTTTTCTTTTGCTGCTTAATGGG
TTCAAGATACTTTATTTGTACATATTATTAACTCAGTTTCTTTGCTTTTTATAACTGGTAAAGTCGTTGTTATGTGATTAAGACGTGACAGGTTCGAGCC
TTGGAAATGGTGTTGAATTGATATATCTTGAATGTTGTTCAAGAGTTTCGATTAGTTGTTTTCCGTTAAAAGTGTTATGTGTTTGCAGTAGTTTTTTCTT
GTTTATTGTTTTATAGAGGTTTAGTTGATTGGGTGTTTGTTGGATTTGATTTTAGAGACGAATTCAACATTTTAGGTTTGTGGATTTTGAACCCTATTTT
TTTTCTGCTTAATAGGTTCAAGATACTTTATTTGTACGTATTATTAACTCAGTTTCTTGGCTTAACTTGTAAAGTTGCCTCTCCAGTTAAGGCTGTAGGG
TAATTTTTCTTCCTGTTCCTATTCTGGTACATGATTATGGCCCGTGTAGCGTTGCTTTTCATCATTTGACGAATAGAATATCATCTTTCCGTTGTACAGG
CTTACTGCTGTGTTATTTGATTAGACGATACAGGTTAAGCTGATTGTTGTGGATTTTTGTTTCAGACTGAAGTGGAGAGCAATTCTGAGGAAAGGTACCA
AGTCGATTGTGAGAACAATTATCATGGTGACTGTGCCATATGTTTGAATAAGATAGTGCTCCAAGAAACTGCTCTTGTAAAAGGTTGCGAGCATGCTTAC
TGGTATGTACATAGAACCAATCTCCAATTATTTACTGCAATTTTGATCATCACGCCCATGATGGAATTATATCCAATTTACTGTTTTGGATAATTTCGAT
CACTTAAAGTTGGTTCCGAGCTAATTATCCTACGTCTTGTTAGTTATCTCCTGCAATATGATCTGCATGCCTCTGATAGGATTTATCCAGTTTACTACTT
AGGTGAACAAATCACTTACATTTGGTTCTGAACTATCAAGAAATATAGCTTGTTTTTTTTTTTTGGTTATAGGTTATCAATGTGACTGTAAATAAATGGC
AAATGAACTATAAAGAAAAGAAACTCACATGCCAATGATACCGAATCCCTCAGAAGCACCTCTTCATCAGCAGGGTGAAGAAGGAATAAACTTTGTTGGC
ATTATTCTGTTTTATTGATGCAGGGCAATTTTTGCTTTTCTATGTTGGGTGAACACAAGAAGGAAAGAAAGGAAATTCACTATGTCTGGCGAGTCTATGC
TCAATTACTCAGCCGGAAGATTTTTTGTTTTATTAGTTGTATTAATTAATAGCTTATTTATTGCTCTTGGGGGATTCGGTTTAGTTATCAATTATGATTG
ACTTTTGCGCATCAATTGCATTAATCTGTGCTGGTTTGTTTTTTCCCAGCTTGACTGAACCTTACTTTGGTGCAGTGTGACATGCATCCTTCGGTGGGCA
ACCTACAAAAATGAACCAACATGCCCTCAGTGTAAACATCCATTTGAATTTCTCCACATCCATCGCTCCCTTGATGGAAGGTAACTGATTATTTTGATTC
AACTTTCTTTTAGTAAATGTGATTCAAGATGATGCTAATAATGTGGCATATGTGGTATTTAATGTACATCCTTAGTTGCACTTTTACTAGTAAATATAAA
ACCATGTGCATAATTCTCCGAGGAGGAATTTAAGTATTTGTGACTTCTTTTCTTGATCTGTCACTTCACTAACATAATGATCTAATTAATTATCCGGTTG
ATTTTTGTAAGAGGTTGTGGAGCTGTATTTATTGCCTTGGTAACTAGACCAGTAAAGGTAGGCTGTGGTTAATGTTGTGTCTTATTTTTTTGTCAATTGT
GGTGCAACCTGGAAAGGGTAGTAGTATACAGAATTTGATCTAGAGAGATCCTCAGCGCTACTTGATTTTATTGCAAATTCCATGTTCTGTATATGCCATA
AGCTGACTTCTAAAGATTCTGACCGTTGTTGGTATTACTAAGTTCCTAGAGATGCATCCAATTGACCTCTGAATATCTAATTTGAGGTATGTGTATTGTC
AAGAATAGGGTTTGTTTGTGATAAAGCATGTTATCGGGTTGTATTGAGGACCAAAATCTTGTCTGGCATTGTCTTTTCCTTGTTTTTTTTCCTGTAGTTT
TGCTCTTGAAAACATCCCCATAGTTGTGGTTGGTTATTTTTATCCTAAGAAATGATAACATTGTTTCAACAGTATCCAGGACTACATGTTTGAGGAGAGT
GTTTGCCTTCTACTGAGAGCATCATGGTTTGAACCCTTTGTGGAGGAAATCGATGATTACATGGATTATGAGGATGATGAAGAGCTAGAAGACTTCCATG
TTACTAGTTCACCAAGTCTCCGCATAAGCAACAGGAGATGGGGCAATAATGGTTACGTCAGGGCAGGAAGGCAAGAAGCAAGTCCTGCTCATCCACCAAG
CTCCCATGACTCGAGCGCCGGATCATCACGCCAGACTACGAAGAATGAGACTGCTGTTTCTAAAGTAACTGTTGGTCGGCGTGCAAAGAGGACACTCAAG
CGTGAAGCTGCTGATAAGGCAGCTGCAAAAAAGCACCAGTCGCATTTACTGAGGCTGGGTCGTACATGAGTTTACTCCATGTCTAACCTTGAAGATCATG
ACATAGTGAATCACCTCTGTACAATATCTCTAGGTCCTTCCATTTGTAGAGTAGTGCCCACCGTTTAGATGATGAGTTTGCTAGATGGCATGAACCATTT
TAATGCCTGTTGATATCTCTTATTTCCACCATTATATGTACATTGTTAGGTGATTATTTTCATTTAAATCTTCCATTGTTGGAATGAAGTATAACATGAC
TGGAGGATTTAGCATTACTGGTGTTCGTTTTGCTATATTGAGTTTGTTCTGCATAGCTTTTAGACTATTAATTGTGTTTTTTTTGTACTTCTGAAATGTT
TTTGTCAATTCGATTGAATGTATGAACGCGTTTCAGCTCAACTTGAATGGCAAGTTCTAGAAATCGAAGTTGTAACTGCTAATGTTCTTGTGAGCAAAAA
AAGGTGATAAAAAGTCTTCGGAATGACTCGGTTGGTTTGGTTTGGAGGGTGGTTATCCATAGGCCCATTTTACATCTGCACAAATAAAAATAATAAATGT
ATCAGTTGACTGGTTCAATGCCAATAATTTAGTTCTTTTAAAAGCACATAGACAATTCTTTGTTCATCAGATCAAAATTTCAACTAATTTACTAAATCCA
TGGCATCTTCTTCTTCTTCTTCTTTTGTGAGTAATTCACAACACTCTCCTCGATGGAAGTACGATGTGTTTTTAAGTTTTAGAGGTGAAGATACTCGTAA
AACCTTTACAAGTCACTTGTACCAAGCTTTGAAAAACAAGGGAATATTGACCTTTCAAGATGATAAAAGGCTAGAGGATGGCGATTCTATCTCAAAAGAA
CTCTCGAAAGCTATCAAAGAGTCTCAAGTTGCCCTCGTAGTTTTCTCGAAGAATTATGCTACATCAAGATGGTGCTTGAATGAACTAGTGAAGATCATGG
AATGCTACAAAGATGAAGATGGAAAAACAGTCATACCGGTCTTCTATGATGTGGATCCATCACATGTTAGATACCAAAGTGAGAGTTTTGCAGAAGCTTT
TGCCAAACATGAATTGCAGTTTAAGGATGATGTTGAAGGAATGCAGAAGGTGAAAAGATGGAGAACTGCTCTATGTGAGGCAGCAGATCTGAAAGGACAT
GACATCCGCCAACGGTGAGTATAATTACATAAACGTGTTCTTTAACTTGACCTCAACTGACTTTAGGTGTGTATAAGTAGGTAGACACACAGATCCTACG
AGTCATACACAAATTAGTTTGAGTGTATCATCTTTATGCTCGCTTATATATAGTACTTGAATTTCTTATTCTTATCTACAATTAATCTTCTTGTTTATGT
AGGGTTGAATCAGAGAATATTCAACGAATAATTAACCAAGTTTTGTCCAAATTATGCAAGACTTCAGTATCATATTTGCAAGATGTTGTGGGAATAAACA
TTCATTTAGAGGAAGTGAAATCCCTACTAAAGCTTGAAGTCAATGATGTTCGTATAGTGGGGATCTGGGGCATGGGGGGAATTGGTAAGACGACAATAGC
AAGGGCAATTTTTGACACACTCTCGTATCAGTTTGAAGCTGCTTGTTTCATTGAGGATGTTAAAGAAAACAGATTTGGAATGCATTCTTTGCAAAATATC
CTTCTCTCAGAGTTGTTAAGGGAAAAAGATAGTTACGTGAATAATAAGGAGGACGGAAAGCACATGATAGCTCGTAGACTTCCTTTTAAGAAGGTTTTAG
TTGTGCTTGATGACATAGATCATAGAGACCATTTGGATTACCTAGCAGGGAATCCTAGTTGGTTTGGTGATGGAAGTCGAATTATTACAACAACTAGAGA
TAAGCATTTGATTGGGAAGAATGATGTAGTATATGAAGTGTCTACACTTGTTGATCGTCATGCTATTAAATTGTTCAACCAATATGCTTTCAAAGAAGAA
GTTCCCGATGAATGTTTTGAGAAGCTCTCATTGGAGGTTATACGTCATGCTAAAGGCCTTCCGCTAGCCCTGAAAGTGTGGGGCTCTTTCTTACATAAGA
GGGACATAACTGAATGGAGAAGTGCTATAGAGGAAATGAAAAATGAGTCCAATTCGGAAATCGTTGAGAAGCTCAGAATTAGCTATGATAGATTGGAGAA
CATACAACAAGAGATATTTCTGGATATAGCATGTTTCTTTCGAGGGAAAGTAAAAGATCACATCATGCAAATTCTCGAGAGCTGTTATTCTGGAGCAAAT
ATTGGATTGCGTGTCCTAATTGACAAATCTCTCGTGTTCATCTCTGATAATAATACGATTCAAATGCATGACTTGATACAAGAGATGGGTAAATATGTGG
TGAAAATGCAAAAACATTCAGGAGAAGCTAGCAGACTATGGGACGTTGAAGATTTTGAAGAAGTGATGGTCAACGATACAGTAAGTAAAATAAACAATGC
AATATTACTATATCCGTTTATCTTATGTTATTAAGCCACAAATTAGTCTAGTGTGGCCATTTGTATCCAGGAAGACCTGAATAGTATTCTGAGCTAAGTT
GCTCGGACTCTCCAAAATTGTTGCCACACCCTTGTCGGATCCTCAGAAAATGCACTACTTTTGAAGGATCCGACAGTCACCTGATGACATTTTTGAAGAG
TCCGAGCAAACATAGATGAGCAATCCTACTTTTCATATTAGCAAAGAAAAGTAGGCCTTAGAAGTATTAGGGATAGGTGATTAGACAAGATGTGATGCAA
CTTCAAATTAACGAGAACATAACCTTAGATTGGAGGGACACAGACTAAGGTACGTAGGAGATTAGTTGGACAGTCGAATGTTGTCTTCCTGATTCTTCTA
TACTATTAGTCGTAGTATAACTCTTGTAGTTTCTTGTCCTTTAGGATTGGTTATTATCTGTCATTTTATTTTGTTATGACAACTGTTTAGGATCACTAGG
ATGATTTGTCAGGTTGTCTATAGTATTTTTCCATGACTATCTTCATTTCTGCTATTTCGTTCTATATAATGCTTTGTGCTGACGGTCTATGAGAAACAGC
CTCTCTACGTAGTGGTAAGGTCTGCATACACTCTACCCTTCATAGACCCCGCTGAGTATGTTGTTGTTCTAGCTCATCAAGAACTTCAAGTGCAATAATA
AACGATACAAAACATGGCACTAATGATCCTTTTATCAGGGGACTAAAGCAATGGAAGCAATCTGGCTACAATATATTCAAAACCTATGCTTTAGCGAAAA
AGCCATGAAGAATATGAAAAGGCTTCGGATATTATATATTGGTGGTTTTCAGATACATGTTGATTCCATTGAGTACCTTCCCAACAGCTTGCGTTGGCTT
GCCTTTTATCACTATCCTTGGGAGTCGTTGCCAGAAAATTTTGAACCCAAAAGACTTGTTCATCTTAATCTCCGGTTCAGTTTGGCGTTGCATCATTTAT
GGACTGGAATAAAGGTACACTAGCTAAATTGCATTTTCATTTCTCTCTAATAGATCGACATCTTAACATTTTCGTGAGTTTTAAGATATGAAAAGAATAC
TTTCTGTGTTCTAAACAGCATTTGCCGTCTCTAAGGACGCTAGATCTTAGCTACTCTACAAACCTGATGAGAACACCAGATTTCACGGGGATGCCAAATC
TGGAGTATTTGAATCTATCGTATTGTAGTAATCTAGAAGAGGTTCACCATTCCCTCGGATGTTCAAGAAAACTCAGTTTGTTATATTTGTGTTTTTGTAC
ACTCCTTAAGAGGTTTTCATGTGTTAGCGGGGAATCTCTTGAATATCTGTATCTGCATGATTGCTATAGCTTAGATACATTTCCAGAAATCCTCGGAGGA
GTGAAGCCGGAGTTGAAGATTAAGATGGAACGATCTGGAATAAGGGAAATACCGTCATGTATTCAGTACCTAACTCATATTACCAAGCTGAACTTAAAAG
ACATGAAAAAACTTGTATCTCTTCCTAGCAGCATTTGCATGTTGAAAAGCTTGGTGGAGCTAGATGTGTCGTACTGCTCGAAACTTGAAAGCTTGCCTGA
AGAGATAGGTGATTTGTTAAAGTTGGAGAAGCTTGATGCCACATGCACTTTAGTTTCACGACCTCCATCTTCTATCGTCTGCTTGAACAAGGTTAAGTTC
TTGAGTTTTGCAAAACGAAATTCAGAAGTAGGCCTTGAAGGTGGAGTGTTCTTTGTGTTCCCTCGAGTGAATGAAGGGTTAAGCTCATTGGAAGATTTGG
ATCTTGGTTACTGCAATCTAATAGATGGAGGACTTCCGGAAGACATTGGATCCTTATCCTCGTTGAAAAAATTGCATCTTGATGGAAATAACTTTGAGCA
TTTGCCTCGAAGCATAGCTCAACTTGGTGCTCTTCGATTCTTGTACTTATCAGATTGTCCGAACCTTAAAGAGTTCCCTCAGGTGAATGATGGATTACGC
TCACTGGAAGATTTGGACCTCAGTTACTGCAATCTGGTAGATGGAGGACTTCCGGAAGACATTGGATCCTTATCCTCTTTGAGCAAATTACATCTTGATG
GAAACAACTTTGAGCATTTGCCTCGAAGCATAGCTCAACTTAGTGGTCTTCGATTCTTGGACGTATCATATTGCACGAGGCTTAAAGAGTTACCAGACTT
CATGTTGATGCCTGATTTGTATTTTTTGCATCTGATAGATTGTATGAGTCTTGAAGAGGTTCATCATTCCCTGGGATTTTTCGAGAAGCTCACTCACGTA
TGCTTGTATAACTGTAAACGCCTTAAGAGGTTTCCAGGTATGTGCATCGATTCCCTTAAATGTATCCGGACTTGGGGTTGCTCTAGTTTAGAAAGTTATC
CTAAGATCATCGGTACCATCAAAGTGGAATCAGAGATTCACATGTTAGACAGTGTAATGTGTGATCTGAATTCGAATAGTTCATTTCCACATTCCTTGTC
TCAGAGGATCGTTTCGTTGCAGCATGACATCTCTGCTTCAGATTTCTTATCACTAATTAGAGTGTTTACGGTTCATTATCCCGAGAAGAAGATCCCAAGT
TGGTTCCACCATCAAGGAATGGATACAAGTGTTGTATCCATCAGTTTGCCAGAAAATTGGTATGCACCAGATAACTTCTTGGGATTTGCTGTATGTTACT
CTAGTGAACTAATTGACATCACAGCTCACTTGATTCCGTTATGTGATGATGGGATGTCGTGGATGACCTTGGAACTGAACTTATCCCGCGATTCAAAATG
TTATACAGAATTCTCTGATTATTCGGAATGTGAGACAGAATCATCTGACTATTCAGAATGTGCCACTGAACTTACTCTTCATTTTTTCTTGGTACCTTTT
TCAAGCTTATGGAATACATCTAAGGCAAATGGTAAAACACCGAATGACTATAGGCTCATTACGTTATCATTTTCTGGAGAAATGAAGAAGCTTGGATGTC
GTTTGTTGTATAAAGATGAGCCTGCGCTTGTTGAGACCTTGTTACAGATGAGGGAAAATAACGATGAACCAACAGAACGTTACATTGGGATCAGGAGCAG
TAGATATAACAATAGTGAACATCATGACTCCGTCACCAATGAAGCCAGTTGCTCCTCTTCTATGAAACAAAGGTCACGTTCTAATATTCGTGGGAGTGTA
GCCCGTCTCTTCAGAAACATTGCAACTCTTTCTTGCAAATCGAGGAATTCAGCTTAAATATAGGTAAATATACACATGCAACTTGTATCATGTATTCTGC
TAACTAGTATTCGATCTGCTTTTTTATGTGGAATGATGTATGACAGATATAACGATATCACTTGAGTATCGTTGATAGATGACCAGCGACACTGCCTATG
AAGCTCACGTTTTAACATTTCCTCTGTCTGAGATACAGATTCGCGAAAGAACTTAGGTGTGCTATAATTCCTTCTTCTTACATTTCATTTTCGATATATT
ATCAGATTTAAACATTTACTAACAAGTATCTGCCTCGAAAAACAAATTGCAGATGAATGGAGCCCTCTGAAACTCTTAGTCGCGTCACATCACAAAGAAA
ATGGATCAAACATAGACTATTTCCAGAACAGCAATGACCGAGCTCAAATAATTTCGATTATAATGCACCTTTGAACCATATAATTACATCATAATATGGC
TTCAGTAATACCATATTTGTACATTATTTCATTTGATTACATATATGTTAAGGTTGCAAATTAGTAGATGATGATCTTGTAGTGAGTGAAGGCCTCATTT
GTACAATTTGTTCTTCATCAACACCAATTTTCTTGGCAGCTAATCCAGCTTCAAAGAAGCGTTTAACCGCGTCTTCCATATAAGCTTTCCCTTCTCTTAC
AGTCATTCCTTTGCCTATCTTTTCTGGATAACTTGTTAGTAGATGATCTCCTTTTAGAACCGCGGCGAGTTGAACTAGTTCTTCCTGGAATTCACTTATG
TTTTTATCTTCATTTGCTTCTCCCTTTCTTATCTTTGTTGGAGTTGGAAGTTTTTCTGTGGAGAGTGTACGCAAAGTTAGGTTGAACAAAGAACATAGAC
AATCAATAGTACTTCCCTCTGTTCCAATCAGTGGCGGAACCAGGAATTTGACAAAGGGTGTGCGAAACTAAGGGAAAAAGGATAAATATATCCCCGACTT
ATCATAAATGCTATGCAAATACACTTTAGGGATATTGGTGCCCCTGTCGTCTAAAAAATAGAGCATATATACCCTTTATACTAACAGGCATACACGTATC
ATAATCTTATCCACCGACCCGATATTAGATCGATGGATAAGATTGCGTCACGTGTCCCTATTTAGTCTGAGTGAAGGGCATATACACTCTAGTTTTTGGA
CGGCAGGGGCACCAACATCCCGAAAGTTTGACGGAAGGTATCTGCATACTATTTACGATAGTTCAGGGTGTCCTTTTTTCCCAAAATCTAAATGTATACT
CGTAATAGCTAATATTTAACCTTGGTAGACTATATAATTTTCCGAGGAAGAGTGTGACTAACCAGGACAATCAGTTCTAGGCTCCTTTCTTATCTGTAGA
ATGTGTTCAAAAGTGCCAGCCCATGCATCTCTTTTAGTAAGAAATGGTGATGGCAAATCAAAGATCTTCTTCACTGTTGCTGGAATTGATGAATGTTCAT
ATTCCGACGTCGGAAACGGAGAGCCATTAGGACCATGAACAACTGCAAAAAAGTAAAACAGTTTATCGTATTTTCAAATTTGAGTTAAATTTTTTGTGTA
GCATCTCGCATTAGCAGAGTTCAGACAAGGATGGTGCCCTAAGAAAAAAGTTACTTGTGTTGGTTTTTAGTTATGTGTGTGACATAAGTCAAAGAAATTA
TTAATGTTTAGTTTTAAAATTTTAATTATGTGTGACATAAGTCAAAGAGATTATTAATGTCTCTATATTTCTTTTCTAACAAACTAATGAAAATTACAAA
ATAACTAATTGATTGATATATGTATACATATATATACACCAACTGTTACAACTATAAAGTAGTCATATTTCTCTTTAACTAACAATTATATATGTTTTCT
ATGTAATTTGATGATATTTCATATATATATATATATTCTTTAACAATGTTTTTCACTAGCTATAATAAATGTTGAAATAAATGATACTGTTATTAAAAGA
TATTATTTTTGATGGAAAAAAAAAAAGATAAAGTGGAGACAACCAACAATATTGTCCTCTTTCTAGTGTGAAAATGACTACTTTTTGCACACATCTTTTT
CCCAAATAATTCACTTATTTGTGTCTTCACATGTGAACATCACAAGAGGTAGGATGTAGGGACACATTGATTAACTTTGGATTTATTAAAAGTATATTTC
ACACACCATTAATAGAAGTTTTTTATTTTTATTTTTTTGGGGTCCAAAACCATTAATAAAAGTTTGTGAAGTGTGTGACATGTTGACACATAAGATAAGC
ATTCATTTGTTGACAAAATGCTCCTAAATTTCATTATACTGAAAATAATTATCTCATACGATCACTTTGCAAAATAAAGAAAATATTAATTAATTTTTTT
TATAGTACCCTTTCAATTAAATTTTTTTAAAAAATATTCATATTTATTTATAAAATTTTGAAAAATAATTAATTAAATTCTAGTACTGAAAATAATAATA
TTTATATAGAATTGAAGTGATTGTACCTGTGCCCTTTTCGATCCAAGGAGAGATCATAATAGTAGGAACTCGAACTCCCAACCTATCGAACTCAAAGTTA
AATGGTTCGGGTCCTATAATTCCATCCGGGCTAGGGACCCCGGTGACAGGTGTAGGGACGTGGTCGAAGAACCCACCGTGCTCATCGTAGGTAATGATGA
AAAGGGTTTGGTTCCACTGTGGGCTTGCCCTTAGGGTTTCATATACCTCCTTTACGAACATTTGTCCCTGATAAACGTCGTGTGATGGATGATCATCGTT
AGCGGGTATTAACTTTGAGTCCATGTATCGCTGCTCCACCACAACATATCCTGGTAATAGGGCCGCCACATTTTAGCTCATTTAATAGTTGATATTATTA
TTCTTACCAATATTTAGAAATGCATTTTCAAGGTGAGAATATTATTCATATTATGCAGAAAGACTGAAACTCTATATCCTTTAATGGAAAAATTACATGG
TTAAGCAAACTTATACTACTTCTTACTCATCATAGTTATAGTTTGATATAATTACCACTCGCGACTAACATTATATATTAACTATGTGGGGTGACTTTGA
GTTTGTATAATTAGTTACGTTTGTATATGTATAATTCGTTAAAATATACAAATAATATAATATACTATTATCTAATCGATATACATATATAATTCACCTC
TCTCCCACTCTCTGCCCTCTCTCTCGCTCGCCTCTCTCCTCCCTCTCTCAATCTCTCTTGTCATATATGCAAATACATATGTATAATTTACGATTATCTA
ACCAATATACATATACAATTCATCTTTCTCCTACTCTCTGTCCTCTCTCTTCACTTCTCTCCTCTCTCTCCTAGTCTCACTCGCCTCTCTTCTCCCTATA
ACATGTAGCTACGAATTGTAATTATCAAACTAAAGCTGTGAAAAGTAATTAGACTATTTTTGAGTGACTATATGTGAAAGTTATCTATTTTAATCAATAT
TTTTAAACATATCTCGAAAAGAAAAAAAACGAAAATCATCACATAAATTAAAATACGAACTTCTAGCATTCATACCTGGTAGTTTTCCTGATTTAGCATC
ACTTTTGAATGTGAGATCATAAGGATGAAATTTTCCGATGTACTTAAGCTTTCTCAAATTCAGGTAAAACAGAGTCGCGGGAATATTCTGATAATAGATT
CCAAAATTTACTCCGGCGTCGTCGAGATTCTCGAAAATCGTTCTCTGTGGGTAACCTTTAGCTAACAGCTCCGCGATGTTAGAGGTGGCGCCGTGAGATG
TGCCGGAGTGAACGTAGAGTCGATTCGGCTGAGTCGACGCTGGCACCGACGCAAACCACCGGTCGAACACCGCAAATTCCGATACTAGAGTTTTATATAC
TGACACCTGAAACAACAACACCACTTAATAATTTTGACGTAATTCATTATCATGTGATCAGAAGATAACGAGTTTAATTCGTGCCTTTCATAAAAAAAAA
AGGCACATGCATTATAGAAGTTTTTCAAATATATAAACTTTTTAAAAAGATTTTATGTCCAAAATAACGATTTCATTTTTAAAATTTGAACTATACTATA
AAATTAAAACGAAAAAAGTATTTAGTTAGTCATAGAAAACAATACAAAACAATTGTGTGATACATATTTGGTAAACAAATACAAAATATTTATTAACCCA
AAAATTATACCGTTTATATATGATTAAAATAATATATATAACACAATAAATTTGGAATCTATTTTACCTAATTCAGACTGCGTCATTCACTAAAACAATA
CAATATAATATAATCATAAAAAAAGAAAGGAGTCATTTTAATTATTTGAGGATATAGAATAATTATTCGTAATTATACTTCCCTATAAATACTTCAAAAA
TTTAACAATTTATTCTATAATTTCGAATTTCGAACTTTTTAAACTTTAAAATAATTTCGAAATTAACCAATTTTTTTAAAAAAATTGTAGTAAGAGTAGT
AGTGAACTATGCTACTCAAAAACTCTTCAAAAATATTACTGCATCGTATCGTATCGAATTCTCCGAAAATGCAGTCCGGTAAGTATATATTTTCGAAGAA
TTCGAGCAACGGATACTTACCATTTGAGGCTGAAAACCATTCATGACTTGTTCAGGCATATTAGTATCCATTGAAAGAGCTTGTTGAACAAATCCATTCA
TCGGAGCTAATTTTTTCGAACTTTGATTTGATCCGAAAATCTGTTCACGTATAGCTTGAAATGAATGTCCTGGATCAGGATCAACGTAATGTGATTGATC
TCCGAAGAAAATTCGACGGGAATTCGGATCCGATGTCGAAATCGGATTCGATTCCGACCCATCGACGCCATTGATTTCTGGATTCATCTTCTTCATCCAA
CCTAACATATGGTCGAACGATCTGTTCTCCATTACCAAAACCACCACTGTTTTTATCGGACTGCTGCTGCTGCTACCAGCAGCAGTGCAGTTACGGTGGT
GGTTTGATAGTAAAATTACGAGAATGAGTAGTCCGACGGCGACGGTGTTCGTCGCCGGCGATTTGGATTTGGGTGACATTTTGTGAGTGTGAATTTGGGG
AATTTTGGAGTGTAAACAAAATATCTCACTATAAATAGTGTGGTATATGGATATAATATAGATGTAATATTTTTATAATTATTGGTGGGTCGTTAATTCA
TCAGTTTAGAAAAAAAAGAGGATAAAATTTGATTTTTGCTTTGAGTCGTTAGTTTAAAACGATCGATAAAGTTATTTACTCGATTTTTCCTTGGTTTGTT
TGCTATGGATGGATCAAGATATGGTGTTGTTTGTCTATCGGGTTAAAGGCGTTGCTGGTGGATATGATAGCGATGTTCTGACTTTGAACGGTATTTAAAA
TTCAAAAAAAATGAAGGAAATTTTGATCAAGGAGGTAATTTTTTTTATTTACTCCATTATAATTATTTGAAACACGTAGCGTATAGAATTGTGTTTTGAA
TGTAAGTCAATTTGAAAATGTTTAGTTTACATATATAAGAGGATGATTGTTGAAGGTCATATAAAGAGATTACTAAAAAAAAAAAATTCATCTGGTGTGA
GACTTTTCAATATTTGACCTTACGTCTAGAGCTGAATAATTGATACGTGGGAAATTCAATACGAGCACCAAACATTAGCTAATAGAAACACTAATGAGCT
ATGTTCTAATATCATGTAAAGAAACGAAATAATTAAGTTAGTTTATGAGGTCGCAGGGACTATTCAAAATTATATAAAAGGACCACTTATATTTTATTAT
CTGACGTGAGTCTCCTCAACACGTAGATTGACTAAACTTGACAATATATATATATATATTAGGTCAATGTAGAGGAAATTAAAAGGGAGTGGTATGACCT
AGTGATAATAATTAGGGAGATTCAAGTTTTTTCAGCAAAGGATGGGCATATGCATTTAAAAATGTGGCAATTCTAAAAATTATCTTCCTATGTCAAATTC
AACAACAAAAAAACTATATTTTATACCAGAATTAATCGATAAGGTGCAGAAGATGAGATTACTGTTCTTTTAATTAGAAGTCTTCATATCAAATTACAAA
TATGAAAAGCTTTTCTGATAAAAAACATTTCTCTGAAATGAATCTTACGCGACATGAATCTGAATTAGTCGGGCTCCCAGTTAAAATTAGCATGTCTATT
GTTATTGGGGAAAAGCTCACATGAATCTTTACATAGTGCACATGATGTCAATTCATTTTTTTGGGGTAATATAATGTTATTGTGACATCAAAGAGCATAT
GGAGGTTGCCATTGCTTGCATCTTACCAAAGAATGGAGAAATGGCATTTTTGCAAGTTTTATATTTAGAATAATATACTCTTTTGATGTGTTTGATCAAA
TTTTTGAAAGGTTAAACATATTTTATTTTTTTAAAAAAAATGAGTATTTTAAAAAAGAATTAGGTGTTTTGATCAAATTTTTTCATAGCAAATAAATGTT
TTAAGGGAGTAGTAGAAGTTATTTTTCATAAATTAAAAAAAACCCAAAGTATTATATTTTAGAAAAATACATATAGATTATTTGACCAAATTTTTTAGAG
GTGAAAAGTAAGGGTGTGAATTGATCAGTTCGATTTGATTTTATGTATTATCGATTTGGTTTATCAGTTTTTAATTATGCTAAATCAATAAGATTTTCTT
TATCGATTTGTCGGTTTTGATATTTAGCAGATTGATTTTCGATCTAATTAATAAAAAATACTTATAAAACAAATATATGGCTTCTCCAATAGTTTTATGT
GAAAAAACAATAATGTAGCTTTACAACTTCTCATTATATAAAAAAATGATATTAATTAAAATGAAAAGAAATATACAAGTGCAACACAAAAAGAAATTAA
GAGGAATATGATTCTTACTTTTAAGTATCGACAATTTGTATGATGTGACTTTGTGAACTTAAAGTCACTTCAACGCTAAAAAGATAAAGACAATAACTAG
TAAATAATAATGTGAGATTAATATTTAATACTTATGTACAAGTAAAGTAGTAAACTATTATAGTATTAATGAGTTATCAATTTATAACATAACATTTAAG
CAATCAAAATCAAATCGATAATCCAACTATTTTTAAAAATAAAGTCATTAAAATAATTAATCCAATAATATAATAATAATAATAACAATAATAAATTAAC
AATACTTTTTTCAATTTAATCTATCGATCTTTTTTAACCGCCTATGTGTATTTTTTTTCTTTTAAATAAATCTATAATAGAGACAAGATTTATTACACAA
TCAAGAAGGGACAAAAACCACACATTTTTTTTTGTAATAATTCAAAAACTTATTAATCAAAATGCTTAAGAAAATATAAAGAAATTGTAGTCAAAGAAAT
AATATTTTCTCTCTTGGTATTTCATGTAGGATAGATTAGAATTATTTGGAATAAAAGAACTTCATTAAAATTTAAATACACATTTAAATTGTTAAAATAT
TGTATTAATTAAGATTTAAACTATTAAATAATTAAGATTATACTTGAATATATAAATTTTATTTTAATTAAAAAATTATAAATAATTAATACTTAAAATC
AACAAAATATTTTTTAAAGATTATACTGTGGATTCGTGGAAGTGATACCAGTGATGATTGTAAAAGCCAATTATAAATAATATTTACTACGTGGAATGTG
AGTAATAACTAGCGGTTATAATAGATGATAATGATAGTTAATGATGCCGGTGAATAACACTCTCTTTGTCCGAAATTGTTTGTTATCGAAAGTCAATTTA
ACTAATTTTCAAATGTAAATTAGATCACATTAATTCGATATTTTAAACAAAAAATTAAATATTCTAAAACTATATGAAAAGTACTATAAATAACAATTTT
TTATATATTAATATGATGAAAAATATATCTTAAAATATTAGTCAAATTTTTTATAATTTGACTCTAAAAATAAAAATTATGACAAATAATATCAGACAGA
GGGATTAATAATGGTTATGATGGTGGTGATTGATAATTATTTTTGTAATGATGATTAACTTATGACTAATTATGATCAGTATTGATGATTATAAATTCAA
TAAAACTATATCATACCTACTATGTTTTTGGTTGTTTGAAAAAAGAGTTTAAAAAATACTTCAAATTTTAATCGAAATTATTGTTACGATATCAAGCTTT
ATAGAAGACATCCCTGAACTATTAAATAGCGTATTTTAAAGATACATATGTCTCCACGTGAACATCAAACATATTACATAACTACAAAAAATAACACTAT
CGTAACAGCAATTTCGATCAAAGTTTGAATATATTCCAGACTTTTATCCTAATTTTTTAATCTAGTATATGATTTGCCCACAAGTCTAATTTTTTCAAAA
AAAAAAACACTGGATCCAAACATTGTAAACTATAAAATAGCAAATAATTTACACTTGATCCAAAGTTTACTGATAATAATATACAAACAGTGGAATAACT
GCACAACTAGTTATACCATAATGGAGTTCTACAGTTCCATTCATTTCCAATATCATATATACATCTATCTTATCTTAAGACATTATGGAAATAGACTTGC
CAGAAATGTCTTGTTCTGCACCATAACGAAAGCGCGGGAATTGTTCACATACCTACTTCTGTAACCATACGAAACGATCTTTCAAGCATTTTGCAGGTTC
CATGATACCGCCGAGCCATCCAAATCCAAAACACAGTTGCTTAGATTGTAAGGTAATGAGTTGTTGTCTGTAAGGTATCAATATGTTCCTAAGGCCTGCA
TTGAGAACAACTCGAGTTGCCAAATCAGTCATCGATAGTTGAGAACAACGTAGATACAGAATGGTTTTATGAAGCGGTTTATTGTACCTGATGTGCACAT
AGTCTTGTAAAGTAGAGCTACATGAGGATCTCCTCGCGTACTCATGTTTGGCTTCTCCAAGCACTCGAGGAATGCAAGGTCTGCTTTGAGAAGTTCAGCC
TGATCATGAGAATCGTAGCCCATGTCGTGACAATAGCAGCAAAAATCCAACCAATCAATCGGTCTTCTGTCCCAAATTGGTGACCCTCCATCTTTTCCAC
TTGACCAGTTTGGTCCACAGTAATGACCATATCGAGGGAAAAGTTGAGAAAGAAAAGCTCGTGGACCTGTATGCCATGGAACTTTAGAAACATATGGTCT
GAAGCGTATGGCTGACTTTCGAGCTAGAGAGTCTACACCTTCACGAGACGGACGTCGTTTCAGTTTCTTGTTGACAGTTGTTGGCATTTGAATATTACCC
TCGGCTACTTTAGCCCAAGGAAGAAATGAAAACACAGTCCATTTCCAAAACTGAGCATTTTGTTTAGGTGTTTGCATTAGGGTGCTAGTAGATGCAACTG
TTGATGCCATATCATTTGCAGAATGGGGTTTGAACCACGGGAAATTACCGAAAAATGAAAAATCCATTGCTAGATGATGGAAGCCACAGCCGATTACGCA
ACTTCAGCCACCAGAACTTGTACAAGAGGACCTATATCCACACATGATTGCATCAAATGCAGCGATAATTTTTAGTTACAATTTTCAAAAAGAAAGTGGG
GTTTGGGAGGATAGAATGTATGCAAACCTTGCCCCTACCTTGTGGAGATATCGAGGCTGTTTCCAAGAGACCCCCCCCCCCGGGCTCAAGTAACACGTAA
CAAAACAGTATAAGAGGTTCAAAAGACAAAAAAAAATGAACCTGGTTGCTAATTACCAGCTATAATAACAAACTAGAAGACAATATATAGTCAACGAGTT
GATAAAAAGGGGAGGTTGTTCCTGTTCATATGGAAAAGAGACCATGTTTTCGTCTTTCTTCCTTTTATCTCTTTGGTTGGAGAGTGAAGATTGTAACTAT
TTTAGTAACATATCATTTGTCTCCTTCTAGCAGACTAGTATAGAGAAGATTTTGCCATTGCGTTGACCAATGAGCATTAGATAACTAGTACAGTCCATTT
CATCGTAGACAATTTATCTATATTGTGTGCATTAAAATCACACTATCATAGCATTAGCAGTTTTGCACACAGCACATATACAGAGTAAAAATATACCTTC
CTGCGGAACAGAATACAACCGTTTAAATGTCAGTTTCTTCGGAAGAAGAGAGTGCACAAAATTAGGAGGTCAGAAACCGAGTTCAAATGACACCTAATTC
ATTGGCAATCAGTAACCAGTCAAAAAAAACAAGACCTGTAGGGGGGAGGAGGGGCACAGGCATAACGTGAGTAACCACCAGCGGATTTCAGCTCCGGAGA
GATGGAGATTTTGCCTAAGTCATCTTTTCTAGGTAAGGTATAGAGAAATGTTAGCCTATGAAAGTTATTAACACGTGGGAGTGCGGATCTCACAAATATT
CAAATCGCACATTCATGTAGAAAGGGATATAGGGGGTGTTTGGATAAGCTTTTTTAAGTGACTTTAAAAAAGTCAAAAGCCAAAAGTAGGTAGCTACCTA
CTTTTGACATTTGACTTTTTTTTTTTTACTTTTTAAGCCTAAAGTAAAGTGCTTTTAAGCACTTCGTGTCTTTGTCAAACACCTCTAAAAATTAAGAAGT
GCTTAAAAGCCAAAAACACCTAAAAATAAGTCAATCCAAACACCCTCATAATCTTAGTAAGAAATGGGGCATTGTAGGGTAAGATCCCCACTACTTGGTC
CCTGGTGATTTCTAAAGCTCGTCTCCCAGAGATTTTTCTGTTATGAAGAACAGTAAAATAGGGACACCAACTAGATGATTCTGTCTGCCAGGAAAGTAGG
AAGATAAAAGATAATCTGGTCATCCTATAGAATAAATAACAAGATGTGTGGCAAAGAATATGAGATTAAAGCCAATAAGTTTAAGCTGGAACTTAGCAAC
AAAGTTACGCTGCCATCAGACTTTGGGAGGCCTTTACATGATCAAATAACTACTAGTTGGAGATATGCAAAAAGAAAAATAAATGTAGTCCTCATTCTAG
GACACTGAGAAACTTCAAAGACTCATTTTTTTTATTTTTTCAATAACCGAGAAATCCGTCTATGACACGCCCTTTGGACCAATCACAGCGACTCGTCTTT
TATTTCACACATTATTACACCATTTTCCATGTGGATGAGGAAAGATTAACTCAATAGCTATTCAGACGAATAGAGTCCCTCAAGAAATCCAATTCTTACA
TAGGCTTCTCTTCAACATTTCTCGCTATGTACATCTAGTGAGAAAATAATGTATTCGTAATGACTAATGAGAAGACTCAACATCTTGCTTTCACACTGTA
CATCTAGTGAGAAAACAATCCATCGTAATGAGAAGACCAAATTACTTTTTTTTTCTCAACTACTTGCTTTTGCACTGTGAAGCTTATGCTACAAAGTAAG
CAAATGATGTTCCCTCTGACTGGATGCATCTGATTATAGATAACGCAGTAGAATCTTCACCATCTCCATCTGGTTGATACATTTTTAGTGACATAAAGAA
ATATAAGAGTTATTGCTGTGAGACTTGATGCCTTCTCCTAGGTTAGGACTTCAACCTTCTTAAGAACTTACTTCTTGCTAGCGCTCTACGGAATTGATTC
AATAACATGATCAAACCGCACGAGTTGTGTGGTACATGCATGTCACGAGTTTACGACTTTGAATCTCCCCCGTTCATTAGTGTGTATTTTAAGTGGACAA
TGATTAAGTGGAAGATCAATTATCCACCGAGTTTCAAATCTAGGTGCAACGATTTTCTTGGTTATTCAAGAAAAAAAACATACTTCCTCACAAGTCAAAT
GACTAGACGATCAACTAGGCTTAAATCCCAAATTGCTTGGGATAGGAATATGAATACTCCATTTCTGTTCTACTTACAGGTAAAAGAGAATCCTCCATAT
CCATTCCACTTTGCTGCTTAAGTGGTTACATCTGATGTATTCACCTTTTACAGGATCATCACAATTAGGTTATTTATTATACTAGTACCGCAACCCTTAT
CTTTTATCCAGGCTTCTAACTGGCTATACTTTGAGAAATTTACACAAGTAGTACCACTACTTTTGGATTATCCGACATGCACGCGTCAACATTTTTGAAG
AGTCCGAAAAGCATAGATAAACAACATAATTTTCTTCCGAATGGGTTCGGATTGGCTCCGCCTCTGAACTTAGCTTGAAGATGCTAGTACAGGACAAACA
AAATTTGCCTATATGGGTCTTATGTTCTTATATTTCCATAATCTAAATTTGTTTAAGAAAAAAGGTTTCTTTTTTCCATTTCCCTCCTCCTCCTCTCCCA
GTACTCACCGCCAATCAAGAATCAGTAAAACCCACATCCCAAAATAACATACAAATTCTATAACACAACACAAAAAAAGACATAAAAGTTGAATACCATC
ACTATAAAGACACAGAATTTGCAGTGAAACTGAATAATAAACCATAAAACAAGAAACTTCACAATTTTCATACCCAAAAGAAGGTTTCTTTTTACCATTT
CCCTCCTCCTCCTCTTCTCCCAGTACCCACCGCCTCAACGCCAATCAAGAATCAGTATAAACCATATCCCAAAAACAACATACAAATTCAATAACACAAC
ATAAAAGACACAAAAGTTGAATATCATTCACTATAAAGACACATAATTTGCAGAGAAACTGAATAGTAAACCATAAAACAAGAAACTTCACAATTTTAAT
ACCCAAAAGAAGGTTATTTTTCCCATTTCCCTCCTCTTCCTCTTCTCCCAGTACCCACCGCCTCACCGCCAATCAAAAATCAGTAAAACCCACAACCCAA
AAACAACATACAAATTCAATAACACAACATAAAAACACAAAAGTTGAATACCATTTACTATGAAGACACATAATTTGCAGTGAAACTGAACAGTAAACCA
TAAAACAAGAAACTTCACAATTTTAATACCCAAAAGAAGGTGTCTTTTTCCCACTTCTCCTCCTCTCCTTCTTTTCCACTACTCACCGCCTCACCACCAA
TCAAAAATCAGTAAAACCCACATCCCAAAAACAACATACAAATTCAATAACACAACATAAAACTTGAATACCATTTACAATAAAGACACATAATCTGCAG
TGAAACTGAACAGTAAACCATAAAAACAAGAAACTTTACAATTTTAGTACCCAAAAAAAAGGCTTTTTTTTGCATTTCTCTTCTTCTCCTTCTCTCCCAC
TACTCACCGCCCTCACCGCCAATAAAAAATCAGTAAAACCCACATCCCAAAAACAACACACAAATTCAATAACACAACATAAAAGACACAGAACTTGAAT
ACCATTTACTGTAAAGACACATAATTTGCAGTGAAACTGAACAGTAAAACCATAAAGCAAGAAACTTTACAATATGAATACCCAAAAGAGGAATTTAAGG
AAATCAAGAATCACAGAGAGAATAGTACCTATAAATCTTCATTGATTTAGCACAAAAATGAGTTCATCTGTACAGAGAGAAAAGGAAAAAAGGGGTTTTT
GTTTTTGAGTATTTCTTTGGTTGGAATTTGTTGGCGTGATTATGGGAACATGTGACGCTCAGATGAGATTTTGAAGCTTCTACTTGTTTGACACTTGTTC
TACCCAATGACTTTGTAAAGGAAAATTTTCATAAATACAATAATTTGACTTCTATTTACAAAATATAGCAAATAGTTTTGTACTCTCTTCCACCCTAATT
ACTCGTCTATTTTGACAAATCAACAAAAAATAATTTTTTAAGAGAAAAAGAATAAATATATCCGAACTATCGTAAATAGTATGCAGATACCTCCTCTGTC
ATACTTTCGGAACATAGTGTCTCTGTCGTCCAAAAATTAGAACATATATACCTTTATACTAACGGACATACACGTGTCATGGTTCTTATCCATTGATCCG
ACATCGGATCGATGAATAAGATTGTATCACATGTCACTATTTAATCTTCTGTTAGAGCGAAGGGCATATATACTCTAGTTTTTGAACGGCAAGGGCATCA
ATATCCCAAACGTATGACGGAGTATATCTGCATACCAATTATGATAGTTCAGGGATATGTTTGTCATTTTCTCTTTTTTTACCTATTATACCTAAATTAA
ATGACTAATTACTTTGAAAAATGTAAAACTTTTCATTCATTTCATAATTAATAGGGGTAAAATGGTAAACTCACTACGCCATTAATTATTTTCTAAATAG
GTGTGTCAATTCAAAAGTGAACAAGTAAAAAGGGTCGAAGAGAGTATTAATTTTACGACAATCGATAACTATAACCTTTGATTTTAATTTTGCACAAATA
AATACTTGAATTTGTATAAAATTAAACAAAGACATATATATACTATATGACAATTTTGTTGTCTTATGTACTATGTCAGATAAAATATATGTCTTACTTA
TATATATATATTTAAAGTTGATAGGTATAGTTGTCCATTCAACCTGAATTATTTACAAAATATAGTAGTTATAGTTTGTGTATGTATGTGTTAATAAAAA
ATACATTATATTTGTGTAAGAGTAGAACATTCTATATGGCACACACTTCAATACACTTTCAACTCCCTCCGTTTATAAAAAATGATCTGGTTTGACTTGG
CACGGAGTTTAAGTAAATAAAGATGACTTTTAAATCTTATGGTTTTAAATTAAAATTATCACATATACAAAATTATTTTTTAATCTTGTGACCTTAAACA
TGTCACATAGAAAGTTAAAGTTAAAATGTTACTAAAAAAAGTCATTTTTTTTAAACAGACTAAAATGTAAAGGAGGTTATTTTTTTAAACGGAGGGAGTA
ATAACTATCCTATCACGAATTAGGAATTAGGAATTATCTCAAATTTTTTTATGTATTAATTTATGATTTTTTTAGAAATATGTGATCGATTTTGTTTGAA
CTTAAAGTTTGTGCATAACCTCAAAAGACGCATCCCGCTTTTTTAGAATTTATGTTATGAATCAGGACTTTAGAATTGTTTCACATTTTTGTGTATTAGA
GCATGAATTTTCTCAAATGCGAGTAATCGTCTCTGTTTGTTCTTAAATATTGTTGGTCCATTGATAAGGACTCATTAAATGAATACTTATTATTTTCGAA
ATACTAAGATTATCTCAATTTTTTGTAATGTATATGACCAATTTTATTTGAGCTTAAATTTTGTGGATACATTCGTGACGATAAAGCAAAATACTTTTTA
AGACTTTATGTATCACATAATTGTCTTTGATTATTAGTGTGCATTAAGACCATATGTTTTCTAAAATATATGTGATCGACTCTATTTGAACCCAAATTTT
ATGTGCTCATTATTATGGCCTATCAAATCATACTCAATTGTTTTTAAAATCCATTTTGGAGTTTGTATGCCAAATAAAAAAATGAAAATTATTTTAAACT
TTTCGTGTATACAAACCCATGAATATAGCGTAACCAACTATAACAGTCATTTTTTCAAGTTTGTATCACAAAAAAATAGAAATTTAAGATTATCTTAATT
TTCGTGTGTATAAATTCATGAATTTTCAAAATATGTATGAAAAGAGTGTTTTTTTTACGACAAGAAAAACCCGCAGCCGCTACCCTTTGAGTGCGCACAA
AATAAACTCCCGCTCCTATGCAATAGCTCACAACCACATAGGAGAGGTAACCCGCATCAGGCTCGACCCACAAGGCTAACCCCTTGCTTTCGCTGGCAAG
AGGGTTCGAACTTAGACCTCCAACATAAAAAAAATTATTTTAGCTCAATTTTTGTGGTTCCATTGGTTTTATGACACAATAATCTAAGTTCCAAACTTCT
CTTTTTTTGAAAACCGAGAAATCTGTCTGTGATCCGCCTTTAGACCAATCACAACCTCGACAAAATTACTAACAACAAATATACATGAAAAATTTTCAAC
TGCACACAGCAAAGGTGCTTTGTCTATTAGACAACACAATAATATACATTTTTATTATGTTACAGTATGAATTTCAGAATCAATGAGATCACTAACAAGA
CACAGATAACAACAATACAACCAAAAAAGAAAGGACAGAGATGAGTACAATAACGATACCTCGAAGTATACAGTACGGGAGAAACCTATACGCTATAATA
CACAAAGGATATACAGATGATGGGAGCGTTGCAGCTTCCGTTTTGCAATTAATTCCATGGAGGAGATGAAGGTTTGTACATAGGTTGATGAGATGTTGAT
CCATAGTTTAGGTCAAGGTTATGGAGTTGTTCCATCAGCTGAGAGCGTCTTTCCTTGAAGAAGTCTAAACGTGTTGTTAATTCAACCAAAGTGGAAGATG
CAGCCGAAGGGTGTCGTGTATAATCCATAGCCTGCTAAAACAATGGTCAAAAGACAACATAAAATGACACTAAACATTTCAGCATATGTACCAACTTCAT
CTTAAAAGAAAGCTAACTCTATGTGTATATTTCTACTAAATTCTCGTACGGCTAGATTTAAAAGTGATACAAGCAAACTGTGGCCCGAATTTGGCTAAAG
TGGCATTTATGGGTGTAAACCATGGAAACCAGGGTTCAAATCTCTACCTAAGCCTTGGTAAACAAAATTACTCGATACTTATACTAGTGAGGTGTGGAAC
AGTCAAGTCGAGGTGTGCACAAGCTACCATCTATAGAAATGATCTAGCAAAATTGTGATGTATTGTCTCTACATCAGTGGGGTCATCCATATGTGCTGAT
GTGTTGGAGCCTTCGTGTGCCCACTCGTGCATGCTTTTGTGTGAGATTAAAAAGATGAAGTTTCCACTTGTTACCTCAGTGGCCTTTGAAGTGGGATGCA
GGGGGGAAGAATCAACAGCATCGCAGTCACCCACAGACAGACCAGTTGATGCTTCAGTACTCTTAGAATCACTTAAGCTCGTCTCTCGGAGTTGTTTCCG
AGTAGGCTGCCTCATACCAGAGGTGGATGTCAGTACTTGTCCTTTCATATTCCTTAAATCTGCTCCCAGCAATTCCTGCATCGTTTTAGAACGTTCACTA
TATGAGAAACTTTTATAAACTACAAACATAGATCAACAAATCAATTTAAAACTCCATAACCTAAGCATCTAGAATGTTAGCATTTAATTCTTCTTTATAA
ATGAAAGAAAATCTCTCAACTTCCAGCATCTAAAACATCATAATTTGCATCTACTCTCTTTTCTTTCGCGAATAAATAAATTAGTCAGATAAACATTCAC
ATTTTTCAAGTCCATAGAGCTCAGCCATAACAACTCTTAAAACCCTTTCAGCTTTTGCGAATTCCAAATGGAAAAAGAAAATTATAGCATGCTCCCTGGA
TGAATATGTCATAGAGAGAAAATTCAGTTAATATTTTTCAGGTGTGGATGAGGTTTAAGACTGCATTCGTTCATATAAATCCGCTTATATTTTTTCTTAT
GAATAATAGGCCATCACATTTATTTTTTCTTATGAATAATAGGCCATCACATTTAGCTGTAAAAGTATTGAACTTTTAAAATATCAAGGGAAGGAGATCT
TTTAAATTAGCTCACAAATTATATAAAGTAAAGCAAGATAAAGCACAAAGGAATCTATTCACAACAAGCAGTCTCCCCTAATGGCTTCTTTCTCTTTCTC
CCTCCCTTTTATGCTGGTCTTTTTTCTTTTTTAGCTCTATTGAGTGATCAAGTGCATGACCAAAGATACAATAATGTTCAACTTAATAGCTCAAAAACAC
ATCACTGACAGCATGACCAAGAACATGCAAAACCAGAGAGGATGTTGCATGTTTGACTTTTATCGCGGAGACATAATTCGAAAAGAATGTGTGAAAGCCG
AAATTGTTCATACAAAATGCATGACCACTAATATGCTTATATTAACCCATTATATACAGGAGGACAAAATCACCTCATTTCTTTGTCTTCTTTCATGATT
ACAGAAAGCGAGTGTCGTGTCAAAATCTTGCTGGTAATATTTCCTACAGACGGAGAATACACTTGGTAAGTAAGAGAAATTTATCAAAATATAAATATTC
AAAGAAACGGAAAGTGCATGCAATGCTCCAACTAGGATCACTTCCTCGTTCTTATTGGAAAGGGACAGTGCATCTGTGTACTCTTAACATGAATGTCGTA
CAACCAAAAAAACAGAAAAAAAACTAAAAAAAATCAGCTGCTATATAAGAAAGGCTTGAATATTTCATGTAGAAAAAACAATAACAATGCAGAGATAAAT
GTACATCTTAAAAAAAACATATGTCTGCTTGTGCTTATGGCATACTCAATGAGTGTTGAGTAGCTAGTAACTGAAAACCTGCAACATCCACCACTAGACT
ACATAACTAAAACTTATTTAGACTTGTATGTTATAAGACAAGCACTTCTCAGTCAAATTTACTACGATAGAATGACATCAAGTACGTCAAAATGCAGTAC
TTAAAGAGTACTTAGAATTGAAGCTAATCAACGAAGCAATCCTATATTTTCACATACAGGGACCGTCAGATATGATATATAACACTACGCTTAGTGTCCC
ACATTGAAAATTAAGTACTTAGTACTGTGGAAAGTATGCATATAATAAGGGCTTTGTGTAAGACAGGAATGTTGCGCATCTTAATAGTACTCTCCGGTAT
CTTAATTTCTCACTGGGACATATTGATTATTTCTACAACATACCCAGTGCAATCCCACAAGTGGGGTTATGCCCTAAAAATCTCTCTTATCCTTTTCCTA
CTGATTTACCAAGAGCTATCATGAAAATCTCAATTATTGGCAGCATCACTAGCAGTTGCAATGATTCAAGTGATTTTCTGGTTATAACAAGGAATAAGAA
AAGATATCATTAGCTCGGGAAACACTTGGTGCTGGAATTAAAATTTGATTTACAGTTTAGATAGTCATGACTCATGTTGACATGATAAAATGGAACAGCC
CGTGATCAAAATGGAATTCTCTTCTAGTCAATTATAAACAACAATAGCTTCTCAATTATTGCATTTGCATGCCACTAAGAAGCACTTGAAATTGAAACAA
GGACACTTGAAAAAGTACCCAAAAAACTGAAATTACACTCACAACTGAGAATTATGGTTTGGCCCATTTTGATAACGATCACAAGCATCAGCTAATGAGC
CATAATGATGCTGCCGTTGCTGATTAAGTTGATTGTGCAACTCAGCAACTTTCTGCTTTAATCTAGCCACATCTGCTTCCGCAAGGGCTATTTCTTCAAG
CTCAGCCCTAGTCTTCATAAAAGTAAAATACCTTATTAGAAATATAGCAAATCAATGGGAAGGAAAATGCCAACAGTTACTAGATCATCAGTACAACCTT
GGAATCCATTGCACGAGAACCTGACAACTGTCCAGAAGACATGCTCAAACCAACTTCTAGTGCAGCTCTCAAGTCTCTCTCAGCTTGTAACTGTTCTTGT
AGTCTAGCCACCTTCATAAAAGTTACACGTGGTTTAATAATTTACCAGATAAAAAGTGTGAAAACTTGTGAGTGCAAAAACTTCAGTCTACAAAGTGCAG
AACACATCTTAAGAAGAATTAGGAATTATACAAGAGTAGCAAAACCAGCTATATTTACAGTTGTGACCAAAAGATGAAAACTTGGACAAAGTAGAGAAGA
AACAGAAACAGATGATTGGTAGGGATACTAGTAAACAGCAGCCAACTAACCACATAGAATAAGGGAATTTTTTAGAAATTACAATTGATATGCATATATA
GAAAGGAAAAGAAACAAAAGGTTATCAAGAATCATGCAATGCAATTGAGTTTTGCAGTTGCTACATATTATTAAAGAGAGAATAAATAAATTAGTTTAAA
TGGACAACACTTTGTGGTCTTAACAGGGGGTAATTACTCTCATACATCTTGTTCAAGGGCCAAGCGACGCTCGTGCAAAGCTTGTTTTCGTCTCTCCAGG
CTTGCTTGTAGAATCGCATTTCCTCTTGCCTAAACACAGGTTAAAACTAAATGGACTTAGCAAAGAAGAGAATGAAACTCATGAATAATAAGATAGAACA
CAAACTGGGATCTATACCTCCTTCGCAATCCTATGGCGCAAGTCATTTTTTGTTATCTCAAGTCTCTGTATAGCAAGCCTGTTGACATGTCAAAAAGGCC
CATCTTAGAGACTTTGAATGATAAAAGGATGAAACAAGGTGAAACTAACGATGTACTTTGCCCAAAAATTCATTCATAGAGGCCATCTTCTAAAGTTTAT
AACCCACGAACAAGCTTTGAAACAGGAAATTTAGTGTCACTCCAGCTTACCTGAAGCATTGTCTCTTCCAGTGTTGAATTACAAAGAGGATACAAATCAA
CAGAATACAAAATTTAAATTGGAAGGCACAGAGAAATAGATGAGCATTGAGTCAATGAAATATCAATGCAGAAATTGTCAGCTAGCAGGATACAAGCATA
ATATGCATATTTGCAAAAATAGCAAGTGTTGACATCAGATGGCATTGGTACACTGACAAACCAATGCAGCAATTTCCAAATAGCACGATACAAGTAGTAA
AAAGATGCCTATTTGTACAAACATTTTATTTAAATAAAAGCATTATTTTAATCGCACAATGTCCCCCTCCTTTTGTTTCATTAGATTAGAGATCATGAAT
TTTTGATAGGAAGAATACCTAAAACTTCCCTAAACTTGGCACATTTAATTCAGAGCACACCAAGACTTTGCATTGACATAATCACCTTGCTCACACCCAC
CCTGAACTTGACTATTTATTAGTATCTTCCTTCTACTAGTTTAGTTGAAGGACAAAAGACTAGTCAAAATTCAGCTACAAAACTATTTAAGGTATTATTC
TTTGTTACTACTTGACCAATCTACAGCTCCCACATCCCAGAATCTTATCTTTCTCCCAACTTTGACCAAAAACAAGATATACAATTTATAGATAATTAAA
CCATCTAGATATTAAAGAATTTAAAATCCTTTTTGTACCATAGAGACACCCATCCATAATTCTTCTTCAATCAAGACGGAAACATATTTCAATTAACTCA
AATTCTAAAATAAGCCTCTAAATACCAGGAGAGAGAAGAAGCCTTACTCTTCCTCTCCAGAAGAATCAATTGATTCTGTTGATGGAGTACTTCTACCCTG
TGCAGAAGTAACAATCAGAGGATTAGATTCCTTATTCAGCAATCATGATACATCTAATGAAGCAGACAAATTATCCTGTTTATATTTGTTATAATTAATA
CAGAAGCAGATGTATATATTCAATGATTTTATCAAATTTAATCTCAACTTTTCACAGATGAGGAGGGTACTGATGTGTTTTCCACAAATAATAATGTTTA
TGAATGACAATTCCATCATAATCAGCACGCACATTTAGCTGTTGTCAACATTATGTCAGCAAGAAATGAGTACAGGTATGCTTCCCATCTTGCATATCCT
AATCACCAGCTCTATCAAAATGAAGTCACAGACTCACAGTTCAAACTTAAGGATCTAGTGTAGGCTATTCTAGACACGAGAAAATCTGTGGATTTTTCAC
ATCAATCCTAGCATGAGTAAAACAGCACCTGCTATGGAATGCTTTATGCAACAAAAATCAACATTCTAATGCAATCATGGAATTAATGCCTCATATTTTG
CACCAAGAACATCGGGTATTCATCGGAAAATGAAGTTCACAAATAAATGCTAACACTCACATTGCTTCTCCCCCAAAATGTTGACCTTTTAACATTCTGG
TTAGAAGGTGTTAGCTTGCCACTCGGTTTCTCTATGCCAGAATCAGGTACAGGGACACCCAGGGGTGGCCCAGGATCCATAGATGAGAGTATCTCACCCA
TAGATCGCTGAGACTCAGTAACAGCTAATTCGTGAAAAGCATTTATCTCATTTCCACGTCTTTCCAATTGTTCATGCAATGAGACATTAGAGCCTGCAAG
TGGCTGAGGGTCCACTTTCGGTTTCAATTTCACTCCTTGTAAACAACCATCTCTTGGAGATCCAATATCTGAGTCATTCCCTCCAACCCCCTGTGCAGAA
AATCAACGCAATCCAAATAAATACTCACAGAACATAGCATACAGAGGCTATATAGGGGTTCTAAATTCCTCATATCCATCTAAGAAATTTAACAATTTTT
TTTTGATAAGGTCTAAGAAATTTAACAATTATAAGGCCAGATGACACAGATATCAAAGTAACTTCCTCTGAGTTTCTACCAGCTTATTATGGAGTTATTT
TTCATGTGTACATGATTAAGGAGTAATAATGGACACACTGCAATTACATTTTGTGCAGACCGTCACCCATTTGAATTATAGTGCCATAACATGACTACTT
CGCAGGAAGTCTAGAAGTAATCAATGATGACACTTAATCTACTAAGAAAAATGTGGTCAAAACCTCAGATTCTGTTCCATAACAATTCAAATTGAGTCAT
CACAAAAACAAGTGACTTTTGTCAAATGAAAAAAGAAAGAGGAGAAAGAGAGAACTTCAAAAGTTATTTAGAGGACAGTTTTACATTCGCCAAACTGGTG
ATAAATTATTAATTTTTTAAAAGGAAACAGTTATATTCCATTAGCAAAGAGGCAGTGCTAAAAGCCATATTTACAGTAGCCATATTAACAGGTTTTAGTT
GCTTGGGGTAGGTGGAGAGGGGGTCGGTGTGACTGTTGGCTCTAGAAAGGGGGTTTCCCTGGATTCTATTGAGGAACATTCTTCTAAATCTCGTCCCTTT
TGTCTTGACCCCTGCTTTGGGTAATAAGGAGTAAGTACTGTTTCAGAAGGAACCGGGTCCTTTAAAACAGCATCTCTGCCTTCACAAGGTAGGGGTTAGG
TTTGCGTAGCCTATGTAGATTATCATCCTCTAAGAAAACACAACAAATAGCTAAGCACGTCCACCGATAAACATTGTCGTAGGATTTACTATGTTAAACC
ACTCTCCCCAAACTCCACTTAGTGGGATGTTGTTGTTGACTTCTCAAAAGCTTGGACCAACAGACTATTTATTAAGATTACAACAACATACCCAGTATAA
TCCCACAAGGTGAGGTCTGAGGAGTGTAGGGTGTATACAGACCATACCTCTACCTTATGGAGGTAGAGAGGCTGTTTTCTGAAAGACCCCTAGCTCAAGT
AACAAACAAACTATTAAGACTAAAAAGGAAAAATAGGAATACGACAAAATGGAAGACAGAGAATCTTCAGTCATGAGAATGAAGGGAATAAGAGAGAACC
TTATAATCATAAAGATCACTGGCAGCGGAACCACTGCTTTCGCTTAATTTACCACTCAATATGCGATCACAATCATCATCCGTATCTGGGTCAACCTCAT
TTTCAGCATCATGATAACCATTGTCCTTCATATCCATATTCTCATTATCTGATGATTCTTCACTCCCACTATGTCCAATTTGAGAATCCGCTGAAATAGA
GCACCTATGTAGATTATCATCCTGTAAGAAATATAACAAATAGCTAAGCACGTCCACCGATACACATTGTTGTAGGATAAACCAAGCTAAAACCAACAAC
AGTAAATCAAGGGAAAAAGATGAAAGAGATAATGTTAAAAGATTTTCACTGTTTTTCTTTTCATCAATGATTGCAACTTACATCGAAAATATTCTCATAC
TCCTCGAGAAGAGTAGTAATGATAGCCTGGGCATTATTGGCTGCATTAGCAGCAGCAAGAAGCTGAGCAGAATTGTCACCATTGAAGTCAAAATCATCCT
CCAACTCACATTCGCCAGCTAAAAGAGGCCTTAAAAGTAATGGTGCCATACAAGCAGCAACAGCAGATGGTGTCATACGATTTTCAGATTGATGTGAAGA
AATTGTATACATCATCTTCAGAATTCTGCACTAGCAACTTCACAGGTTAGGTTGGCGAAATGATAGGTTTCTTTTAGTTAAACAAAAAACAAAAAATATT
TGCATTAGCCTACAAAATTCATCTTCTTCAAATTAAGACAGAAGAAACTAAAACAATGTACAGATCTAAAGTGTATTACTAGAAAATTGAGGATTTAAAG
AGCGTCTCCTCTCATAACTAATCTTCTTGGTTGAAAAGTTCGCAAAATGGACATACAACATGGGCAGTAAAAGGAAATATCTAAGATTGGCCAGAATAAC
CCCAGGGATTAACCACCTCTCATCAGGATAATTGCAAATAGAGACACAGAAGGCAGTCCAGCATAAACCAGTGAGGTGCATTAATTGGGTGAAACCATTT
GGAGAAAGGGGGAAAGGGCAGGTTTATAGTTGTGTAGTGACCAACACGGACATATAACTCCACACCAAGTTGTTTTAGTATAATTAATTTTCTACCACCA
ATAACAGGCCAAACTGCAAACAGAACATTATAATCAAGCAGATCAACTGTCCTTTTGAGATAAAAAATAGTCAACTGAATGAGCTTTAATCATCAAATAG
CTCTTTTGAAGAATATAGAGATTCCTCAGTCAGTTCACAATAGTACACTGGAATCCCCTATTTAATTTTGGAACCCTAGATGATCAACTGTACTTTCTTT
AATTTTGCCTCTTGTTTTATACCATAATTTAGTATATTTATTATTTTATAAACCTCCAATAAGATGTTCATGAAAATATATAAACCTGTACCTTTTGACT
CCTTACTATCATCTGCTCCTCTAGAATTCAATTTCATTCAGTTCCCCACTTTCTCCAATTAAGTTTCAGATAAATGAAGTTCATTTTAGACAAAAAGAAT
TAATCAATCATTACAATAAGTTCATTTTAGACAAAAAGAATTAATCAATCATTACAATGGTGCATCACATCACATGAATATGGTGCTACATGAAAAACTG
CTATACAAAAGAAAGTTTTTCGTCCCCCGCACACATTTAACATATGGAAGCTAATCAAGGGCCTGAAATGTAGATCCTTCTTGTTTTTCCATTTATTTTC
TAGACATTTTGGCGATGATTAAACTAATGTCTTATCCAAAAATTCATGGACAGACAATGAAACCATTGTCCAGCAAACCATAACAATTTCAAATCCAGAT
AAAATACAGTTTGTCTCAATAAAAAGTTAATGGACAACAGGCAGAAACAATTGCTCAGCATACAATACTGATATTCCAAATAAATTTGTTTCTTGTGACA
GTAACAAATCAGTAAGATTTCCAAGGATTTATTTGGCCAAGAAATCCAGGAATTACAATGATCCACTCAGCATTACATAAAACAAAGAGATTGTAAGCAT
TCAATTGCCAAAACAGATCCATTATATATCATAAACTTTTCACCTAGTAAAACATCATTGGCCACATAAAAAATAGTAACAAAAAATAAAAACAAAGGAT
CAAAACAGAAATACACAACCATATCAGCAGATCACTAAAAGAGTATACCTCTGTAATAAGCGCCTATTTGGATCAGGAAATGTTTCGAGAATGGCAGAGC
GCATAGCATTAACTCGGGCTTCCTTTCGATCAATTTCTTTGGGCCAAAAAGAGAAACAAGTAGAAGTTAGAAAACTGATTTGTTTAAGTTTTACCTGACT
AAACTGAAGAATGTTAACTAAATACAAGCAAGTAGCACATGTAACCATAATGAACAGAAACAGTTCTGGCGACCAACAAATGGACCAATAGATAATTTCA
TATCTTGAGAATATACGACTGACAAAGAAAGAGATGAATTAAGTTCCTCTCAAAGTTCCAAGAACTTCAATAAATCTTAAACTTCTCAAATCTTACTACT
TCAAAACTTTAGCCTTTGATAATTGGAAGCCCAAAAAATTTGAACTATTTATTAAGGCACTCTCTCCATCGGATATATACAGGACAATAAGAAAACAAGT
AAAATTGTGAAAAAAGAAACTACTAGAAACATCAGGAAGGGAGCTGTGATGGTTGTTAGAAATAACCGCAAAGTAACAAGCACTTGAATACTCTGAGAAA
TAATTGCAAAAATGTCTTAACAAATGTTGGCAAGTTTACTTACTATAAGCTTCCAACAGAGCCGTACAGCAGGAAGCAGGAACAGGAGATGAGGGAAGCT
CACGAAGTACATGCTGCATAAAGGGTAGCTCCAATCATAATTAAAGAGAATTAAGATGTACAACACCAGAATGAGATGACAGGATCAAACAAGTAATAAG
TTCATCAGACCAATACCTTAACACAGTCACCAATTACATGAGCATCCTCTCCCGGGCCAAATTCAGTTTTGCCTTCAAACAGTTTGACATGGATTAGCAA
TAGAAAATATGTTTATTCTAAAACAGCAGGGCTGAGGGCACGTAATAAACGCCTACAAATTCTTAGTTCGTCTTCTCCAACGGTGTAGCAGTTAGCCAGA
CCATATTTCTAAAACACCATAGACAGGATAGGAAAATAAAGGCAAGAAAAGGATAGTAAGTGAATCACATTTTAATATGTCTATAGCAAGTCAGCATTGC
ATGGAAATAAAACAAGAAAAAAGGTATCAAGGAAACAAGTAAACTTCAGCCTCTCTGACTGTCTCTTTAGCATGTTTTCAACCAAAGGGAAGTGGCAATC
TAGCTGGCTAAAACTAGATCTGGATCAACATTTAACCACAAGTGACCAGAAACGGACATGAAGGACAAACATAAGTTTGTTTTTAGTACAAACACGTATT
CTAACTAGGAAAGAATTCAACACTGCATAATTATAGTATCTGATTAATTGATTCTAACTAGAAAACACAACTTTTATTTGATAAAGAAAGGGATATTCAT
TTTAAAAAGCTTCAAGAAGATGCAAAAAAACAGATGTTACAATAGAGAGATTGCGTCTGCTCATATACAAAAGTTAGACTATAGAACTACTTTACTCAAT
ATTCTCAATGGGAAATATTCCATCCAAACATGCCAAGCTATTAAATATTTCAATTCTTCCCGTGTGAAGAAAAAAGATAGCATCAGACAACATACAAGCT
TTCTTCCAAATGTTTCAATATTCAAAAAATTTACCTTCTTCATATTCTTTTACCCTCCGCTCCACTTCCTCGACATCTGCAGACTGCCGTAATATACCTT
CGACCTTGGTACCTGCGAAAACAGAAATTATATAGCCAGATTCAATTAAAACAGAATCTAATTTTCTCTGCACCCATTCAACATCTTCAGTAAGGACAAC
AATGCACATGCCTTACTGCAGGGTGAGAATGTTTTAACAAATTCAATGTAATTCTAAGATTATCCACCTTTCCATCAGTTAAAATTCTTGTCCTTGGATC
ATTCTTCTTTCTTCCTAATTAGAAAGTTTTCTTACTATAAAAAGGAAGCTAGACCATAAATGTAACCGCAATTGAAGAAAACTAGCCATCATTCCAGAAA
GACAGATGGTTGTTGTACTTAAATGATATTAAATAATACTAAAATAACCAAAAAGGTCACACAATAATGTCACTGTGAAACCTACACCAAAGGCCTTCAC
AATGGATCAAGGGTGGGCTTACCATACTTCTCAAGAAATTTCAGTGCCTTCTCAAGAAAGGAAGGGCCTCCATCTATATCTTCTAAGGCAAGCAGAATTG
GTCTCCCAACAACAAAAGATTTAACAGGGTGTTTATCCTTCCCTGAATGAAAAGAAAACTTCTTAAAATAATGAAAATTAAACAAATCAATGATCATCTG
CTCATCGAAGATGAAACTCAATGAGTCTAGCAGATAACAGTAAAGAGTGCACTAACATTGGTGGAAAGACCCTTCAAAGGAATCACTAGCATCATTCCGG
AAAATGCCATCCTGTCCCATCACCAAAGCAGCACTAGGTGCTTGTGCAAGAGCATGCTCCAGCGCAGTCTTCCACTCATACAAATCCTCTGATGTCTCTG
CCTACAGTAGAAAGCTTGGGGCTTAGTAGAGAAAATTCAATTGATGTGTGACTGAGGTATATATAAATATTAAACATTCAACAAGATTGCATTTTTTTCC
GGGTGTCGGTGTAGGGAGATTCCATATACATTTATTGTCAGTGGAACAATTCTACACATGTAAAATGAGTTATTTGTCAATATAAGAAGATAAGATGCCT
CACCAATTACTGATTAAAAGAAAGAAAGGATACCAATTTAAAAAGAAAAAAAGATGCCTCATCAAAAATAGTTTCAGAAAAATAATTATTAATACTATTT
CGGCAGCACTGCTATGATTAGCTAATTCAATACTCAGATTATGAAGTATGGAATACAACACATACTGAATTACTGATACAAAACTACCCAAAGAGGCTTA
TAAAAAACTCAAATGAATAGAATATGATGAAAGACCTATTCTGCTAGCAACTGGGTCATTTCTCAGATACATCACAAGTTCTGAGTTTCTGAGAACATTT
TTTAATGTAGAACAGTGTGTGCATCAGTGGGTGGGTGTACGGTAGGTGGTGAGTTGGAGGGGATTCAATCAAGGGGAGATAGAGAGGCAGAAGCACCTTA
AGTGTAAAAGCTCGTCCATCGCGTCCGTCTGGAAACAGTACAGTCAATAGCTTTTTATCTTCTCTGACAACAACACTGAACAGCAAGCAGTTGTTAGCAG
AAAGATATACACGAATTAGATGACCAGAATATGATGTGTGTATTACCTCCCTGAATTATTCAAGTCGATTCCCCCCAAAGTTAGATTCACTTCACCACCT
CGCTGAGGAAGTGTGCTCTACATGAGGAGCATTAACTGTAAGCATTTATGTACAGAAATTCAAACTTGACATCGGTAATTAGTAGAGACTTGATAATCAA
GTACACAGAGACAAAATAAGACATGGTAACTAACCACCAAAAGTTTAAGAGTCTCAACAAGCTAATAGTGAATATATTAATAGAGAAAATAATTACATGA
CATGCAAGTAAAATCAAAAACTCGACTACTAGTTGACAAAATAAAGTGTGATCCTTCAGCATATTGTATCTCGAACTTTTTCGGCTCTCCGTGTTTTTGG
AAACCCATTTGATAGGTTGACAATGATAAAGAGATGTTATGGATTCAATACATCAAGGTCACTCACATCCAAAAGAGAGGACGAAAACACTAAAATAGAA
CTATTCAGATGGAATTGGTAATTGAACATGAATCACTTGATTCCGAGAAAGAAAGGAAAAAGAAGCAGGACCAAAATGTGAGTTCTTGGACTCCACAGCG
TAATAAGACCTCCCAGTATGGTCCTCCTTCCTCCCAATGTTCCATAATCCCTTCCACCTCCTATAAGTAATGCCCCATGAGATTCCTTGGTTTCCTCTCT
TTTTTTAATATAGTAATCCTTGGTCTTTTATTGTTAGTAGTCAAATATCATAGTATTCCTACTATTTTTTTTATTTTTTATTTGGGGGGGGGGGGGAGGC
ACTCTGTAGTATTCCTGTTATTTATCACTCTACACCTAGAGGATATGATTCCCTGTGAAACCAATTTTAAAAACCTAAAGGAAATGTTCCTCTAGAGGTG
TTTCTTGCGAATTGAATTCTCCTGCCATTATCCATTCTGAATACCTTGTATTGTGAAAAAGTATCTTTTCCCGTCGTAATATCCTTCGATGAACCAACTC
CAAAAGGATTCATAACCTCTTTGAGAACAACCAATCAATGCTAATCCACATTAAGGAGTTATATCCTCTAGGTAATACATTCTCCTCATAGGAAAATCTT
GATAACTATTACCTACATAATGCCAAGCAGAATGTTGACAAATGTCGAATCCCAGCAGTCCAGCACCCATTCATTGAGGCCTCTATTGTCTTCCATTGAA
CCAAAGATGCTACCTTTTATTCCCCTCCTCTACATCGCACAAGAAGTATCTCCATATCTAATCAACCAAATGATATTTTTTATTCCCCTCTTCTTCTTTT
TCTGAAAATATTTCTCCAACTTATTTTGGTACTGCTTGGCATACAGAACAAGAACCATGTAATATGTTGATTATTTTAGGTAAAATGGACTTCACAAAAA
TAATTCTCTCCCTTGGACATATTGCATATTTAATTCACCCAACCTTTTTCAACCTTGTCAGGTGATTCCATAAATCTCTATCTTCAACCTTTCTCCTAAA
TGGTAGTTCTAAGTAGGTCATGGAAAAATCCGTCACCTTATAGCTTTGCTGTTACAACTTGAAGAGTACTACACCTTATAGCTTTGCTGTTACAACTTGA
AGAGGACTATATCCCTTAATAGCTTGTGCAAGGATAACTATCCCTCGACCATAAGAAAACAAAATCAGGAAGAAATCTTGAAGCCGTGCAATTGACATTT
CCATCATCTCTTAACAAGAGTTTTCTATTAAGTCAAGTATCAAAGTATTTTCAATTAAAAAAAGATACTTCTTGATGCCTCTTAGGATAGTTAACTTTTC
AGCCACTAAAAAAAAGTACAAGATGGAGAGATCTGGAAATCCTTAAATTAATGAAATCCTACTTCACATTATGTAGTCCCTAGATTAATTAATAAACTTT
CTTGTTGTTACTTTTAAAAGAAATAAATCAAACAAGTATCAACATTGCCTTGAACCTGTACAAAAAGAAAACATCTCTAGATGATTTATCTATGTAAATC
ATGTGCCACCATCAATGCATGAAACATCAACTGTTCATATATATTTCTTTGATCAACTATGCTGCAATTCGAAACTGACAATTTTTACACATTAATACAA
TTTATTGATAGCATCCCGTACAGAAGCAGTACATAAAAGCAGAGAATTTCACACAAAATATGACCTCCACTAAATGGCATACCAACCGTATACAATTATT
GGAATCTCATAGGTAACAAAAGGTCATAGACATGAACATCATAGGACAAAAGTAGCTCTAACTTCAACAACTTGTCTGTGTACAAAGTCTTAATGAGGTA
GTTTAGTGAAGAGTAAGTTCAATGTGATCTTCCATTAAATAAAAGTCAGTATCAGGATAAAAGATACTAACCGGATCATGCTTGAAAAAGACCAAAGATG
TGCGTGTAAGGATGAACCAGCGCTTTTTCCAAGACTTCCAACCTAGTCCTGCAGGAAGTTAAAAAATCCAGTTTACACCATCAACAACCAACATTTAGAA
CTTCTTCATGTGGTAAGTTGCTCTTTGGATTTTCTTTTGTTGGGATAACGAGTCCAAATAATAAAGGAAATTCAGATTGTAAAAAATAAATAAATAAAAG
CACAGAAGAATTATATAAATTACAGAGAATCAGAAAGTTGTAAAGTATGGGACAAACTTTTGCTTGAACTGAAGGGAAGTCAAAAAGACCAATCTATCAC
AGGCACATGGGGGAATATAATGATCTTGAAGATTCAAAATCTTTTTACAACCCAAAAACAGATAACCATTACACGCATTGTTCTCTTCCAAACAGTTTTT
CCCTCCTCCCAAAATACAATTATGTTTCACTTGCTCTTCTCCTTCTTCATCCCCCTACCCCCATTTTTCTTACTTTATATAGGGAAGTCATTTCCCCTAA
ATTGGAGGAAAATAAGTCCATTTGGAGACATTTAAGCCATCAAACAAGAGAAAACTAGAAAACACCTGCATACTAAACACACCCTATATGATCCCTCAAT
TCCCATATTAACACATTCTTATGGGTGAAATATGAATTGAAGCCCAAATTTTACTAATTAAAATATGGGCGAGTTGATAAAATACGGGCTTATTTTGTCA
GCATTACTCCTGTAACTATCTTGAAAGAGAATATTTTCTACTCATCAACTAAGTATTTTCAAAATCTTTTCTCCTTTAAGATAGTAATTCTTCAACATTA
GCTCTCATGGGTGTATCTCGGAAAAATATCTTCCCTCTTCTACAGTTTGGATTGAATTGTGCTCTCGTCATCCTTCCATTCAAGGAACAAGTAGTTCTAC
CATCGTGTACAAATACTTAGTAGGTCAAAGACCACCGGATCTTTATGTTCTACGATGTCTGATCCCATCAATTAATTATTCAAATGTTATCATGGTCATG
ATAAGCATCCTTCTAATTATCTGCTAACAACAAACTGTTCTTCCAATATTGGATCCAAAAGAGATGGGGCAAACATAAAAAACCTGCCCTTCATTTAACC
TAAAAGTCCAGTCTAGCAAGTAGAAGTTTGATAATGTTCTGAGTTACTTGTGTAAGCTAGAGCATGACCAGTCTAACAAGTAAAAGTTTGACAATGTTCT
GAGTTACTTTTGTAAGCTCGGGCATGACAAATCATCATGGACCATAATATCCAATTATAAGAAGGTCTTAAGGAAATTAAAAACATCTTTACTGACCTTT
GGAAGAGATGAATAGTGGTCCACTCTTGAAAACCTGCAGATTATTACATAATTAGAGCTTTAAGAGCAAGAAACAAAGTAAAAGAAAATTAGAAGCATTT
GCATGTAACAAACTTTTTGGAGAAAATATGGATAGAGACCATGAATAATAAAGGAGATATTATGTTTATAGGCTTCAATAATGACACCACAAAGTGAATT
TGAAGTTGTTCATACTGTAGGAAATTCTAGATCTAAACAGAAGTAATTCTTTTGCTCCATTTTGTTTCTAGATGAAGCCATTACGTACAAGAGAAATTTG
TGAACTCAAGAGGAAGGACCCTAGTATTTCAGAGGATACAGGGAATGGGTCCACCATCCCTAAGTTTCTAAATTAAAACAGTGAAATTTACCGGTCAAAA
ACAAATATTGTATCCTGTCGAGAATAAAGACAACTAAAGGAGACGAAGGATAATAATAAATTTCGAACAATAAAATAAGAACAACAACATGAATAAACCA
AGGAAACAATAGAACCCCGTTAAGAACACCTCCATACAATTAAAGACTTGGCTTGATGAACCATTAACAGAGATAAGAACTTGGTTATCAAAATGAGACA
AATGTCGACAAGGTGTAAACTAGAAAAAAAAACCACAGTGCTCTCTCTCCAGCATTTGGCATATAAGAAATGCAAAAAAGAAATCACTTGTTCGTCACTA
ATTTCCCTTAAAAGACAAAGTACTTAAGTACTGAGATGAGATGGCAATGGAGCATACTTAATATTCAGGATTCAAGTAATCCATCCCAATGAGTTCTGAG
ATACTACCTATTAATCACAGTTCGACCAAGAAAAATCTTTTGAGTAAATCTAGTATAACCCAATTTAGAGAACTAATCTTTATGAATGAAAATCATTTGA
CCCCAAATTTTCCCTTTCTTAATCTTCATATTGAGTTAAACAAGTACAACATCAACAAAAGAACAATATTTTCCTCATTAGACTATCATTGACTAGGACA
GAAGACATCTTTGATGTGCTAGATTGTTCATAGGCAGCAGTTTAGTCTTCTATTCTGTAAGTTGTAACACTTTCAAAGGGGAACTACACTTTTGTTGTAG
TATACCTGTGGATATATAGACTAAAGTTACCAGTTTCAAAAAAAAGACTTATCATTGACAACACAATGACCCCAAAATTTCTCCTTTTGCAAACTTCTTA
CATTTCCAACAAACAAAACCCAGTAAAACAAGATAGACAAATACAACAACAACAACAATATACCCATTGTAATCTCACAAGTGAGGTCCAGAGGGTAGAC
TTAAAGAGTATACAGAAAACTACCCCTACCTCATTTGACTATCATTGACATCACAATGACCCAAAAATCTCTCCTTTATTTCAAATTTCTTACATTTCCA
ACAACCAAAACCCATCAAAACAACATAACCATTGCTATCCCACAAGTGAGGTCCAGAGCTCATTTCACTATCATTCACATCACAAATGACACCAAAATCT
CTCCTTTTACCCCAAACATCTTACATTTCCAACAAAACAAGATAGGCAAATACTACAACAACAACAATATACCCATTCTGAGGTCCGAGGAAGGTAGAGT
ATACACAAAACTTAAAAAGATACTTTTTGACAAAATAAGTAAAAAGCAAAAAGAATAGAACTTTACCGCAGAAGAAGAACCAATTCTTGGACGCTCAAAT
GCAGCAAGTGAAGCAGACATTTCCCTTCTTGGGGGTTCAATAAACTAAAGCAAAAAACATAAACATTGCACCATAATACAGCAAAATCAAGAAAATGGGG
TTGTTTCAGATCAAGAAAAAAACTCAAACAACTGATGAATCAGAAGAGATCTGATAAAAAAATAAAGTTTTAGGGTTTTGCTACACACACACAAAGAAAA
AGGGTCTATTTGCTCCTCTGTACAGTATTGTCTGGTTACTTTTGTTTTCTTGTTCATCTGGGGGTGGGTGGATTTTTGATTAAGTGGCGTAGATTGTAAT
AGTAGTAAAGTACATGTTAGGAGAAGTAATTATTCTATGGAAACTAATACTAAATTTGAGTAAATTTTGTTATTTATTTTGGTTGCTTTTCACCTACTTT
TGGCTGTGACTTGCTCTGTATATTCATTACAGAGAGAGAAAGAGACAATGGAAGGGGAAATGAGAGAAAACAGAGGAAAGTGGGGTAGGGGGTGAGGGGG
AGTGGAGACCACGTTAGTTGCTTTTGGTGGTTTGGAGGGGATGAGGTTAAGGTAACGAGATGTTCAATCGTGAAATTTTTTCGTAGAGTTGAATTTTGAA
AATAATGTTTAAGGTTGGGGGACCGGGGGAGGGGGAGAAGTTAAGATAGCGAGATGTTTTGATCGTTAAGAGTTTTTAGAGTTTGGATTTCGAAAATATG
TTGAAAAGCGAGGGTGTGAAAGGACATGTATCAGCGTATTAGGTTAAAGGTAACAGGACGTTCGATCATGAAATTTTTTTAAAGTTGAATTCGGAAAAAA
TATTTAAGGTTGGGGAGACGGGGAGGGGGAGAAGTTAAGATAACGAGATGTTTTGATCATGAAGATTTTTTAGAGTTGGATTTTTGAAAAATATGTCGAA
AAGCGAGGGTGTGAAGGACACGTATCAGCGTAGAAGGTTAATAGATAGTATAGTATTGTTTACTGGATAAAAAGGTTGATATTTGTCATTGGGTGAGAAT
AGTATTCAAACTGTCTCTTTACTTCAGGGGTATGAAACGTTTAAATCAATGCATTAAAATATTTTTAGTGTATTTGGATATTTAATAAAAGTATATATCG
TGTCTCGAGGCATAAACATACATAACTTTCGAAAGTTAACACGTGCACCCTCATAGGACACGTACGTCCGCCTCTGGTCTATTAATATAATATTTGTGTT
GATTATTTGATTATTACAATATTCTATTGTTACTTGTTATGTTTATGTTGTCTTGATCTTTTATGTACCTGAATTTGTTGTACGTGAACAAATGATTTTT
CAGGGACAGTCTTTCTATCTCCATGAGGTATTAATCAGATCTACGTATATTTTATCATTTTTTTAATTTCTCTTATAAATTTCCGCTCGATATCTTTTTC
TACTATTTTTACTTTTTAAAATTTAATATTGAAGTAGATAGTGTGAGGTGGGTGGTGTGGGGGTGGGGGTGGGGTCCCCTGTGGTCCCACAAAGTGAAAA
TGACATTGACTGTTGTTTGGCATATGACTCATATTATTTTTTTGTGGTATATTTTTCTCACAAATCCAACTCAAATGTGCAATTAATTTATGATGTGATT
TTACAAAATTATATTTGGAAGTTTCCATTAAAGTATAAGAAAAATGTAAAATTTATTTTTAAAATTATAGAATCTCTAATAGTTATGATCTTTAGTTTTA
AATTGATATTCCTTAATTATAGCTTTATTATTTTGAATGACAGTATTATTTGTATGTATTTTGTAATTATTTTGAGTAAAAATAATGATAAGAAATATTT
TAATTATAAACATCTTAATTGACCCCTTCATATTAGATTTGCTAATGTACAAGTACTCCTCAATCTTTATTCGAGATCTCAGAGACACACTTATACTATA
TCAAGGTCCTATTGGACTATGATTATTTTGAGTTTACATTTTGTAGTGTCATGAACTTTTTTATATTCTAAACCTCAAATTCGAAATTTTTAATTAAGAA
AAGAATATACATTTGTTGTATTATATTAATTTATACGAGAATCATATATATATATATATATATGTATATATACACACACATGAATTTATGTTTTATTTGA
CTTTTTTATGATAATACGTACTCTATCTGTTCATTTTTATTTGTCACTTATTCCTAAAATAAATTTTCATTATTACTTGTCATTTTCAACAAATTAAGAA
AAAATAATTATCTATTTCATGATTTGTCCGTAGTATTAAATACTATTCTCCAAATCTTTTTTCAAAACTTGATATTACTTCCGTTCACTTTTAGTTGGCA
TGATTTCAGTTTTGTAGAATCAAACAATGAGTACTTTGACTAATATTTTACGTTGTATTATTGATCATATTGATATGCAATAAATTGAAATTTATAGTAC
TTTTTGTATAGTTTGTGAATATTTAAGTTTTTTTTTGTTTAAAATATCAAATTATTATAATCTACTTTCACTTTAAAAAATAATTAAATTGACTTTCGAA
AATGCGCAACATGATAATTAAAAGTGGATAGAGAGAGTACTAAACATCATTTAGTGGAATAATAAGATAAACTTCGTATATCAATAATTATTTTCTTAAT
AAATATATCAAATCAAACAGTAACAAGTAAAAATGCTCATATTTATATTTATAATTATTAATTGCTCCACTTCTGTTTTGGTTGTTACTCTTGCTCAATT
AATTACGCATTTAGTAGATCATTAATTTCCATTTTGACTAATTTAATGTCATAAAGTCGTTATCCACCTAAGTTTATTTGAAAAGTTAAAAAAGGGTTGA
TACTTCCTTAAATCTAAAAAATCATTCACCCTTTTTTAATAAATATTTTAGAGTCTTAGTCAAATTGTTTATTTTAGAAAGCATTTAAAAAAAATAATTT
GGGAAAGTGTTTTTTTTTTAAATAATAGTTTTTGTTTGGCTAATTTGTTTGAAAAGTGTTTTTGATAAATAAATTGTGTTTGACAAACATCAATATACTT
TTGATATTAAAATTATTTTATACAGAGAAAACAATTTTCAATATGAAAAAAACATACCTGAACCAGGTGTTTACACCAAATTCATTATTATGTGAGTTAC
TCTCTCCGTCCGACAATGTTTGTCATGTTGTGCTTATAGAAAGTGAATTTGAATAATTTTCAAAGGTAAATTAAATCACATTAATTCGATATTTTGATAA
AAAAATTAGATATTCTAAAACTATATCAAAAGTACTATAAATTACAATTTTTTTTGCATTTTAATATGATGAAAAAATGCATCTTAAAATGTTATTCAAA
GTTTTTATATTTTGATTCTAAAAATAGAAACCATGACAAATAATACCGACGGAGGGAGTAATGAAATAGAACACATGTTAATTAATTAAGATTGAGTAAA
ATGAACTATAAATTTAAACACGCGGCATGTATGTATTAAATTGATGCAAACACCTGATGTGGATAAATTTAACCCTTTAAAATCTATAATAAAATTTTCA
ATTGACTTTTTTTTATTACATTAAATTATTATACCCTTTTTTGGTTGGGCCAAAATCTTAATTTGCTGGGTTTTTTTCTTTGCAAATATTTTGAAACTAT
TTTTTTCCAGTCCAAAGTTTGATTTGGTGTGTTTAAAAGAACAATTCTATGCTTATCCATGTATTATTAACAAAGCGCTATAGCACAAAAACCTCATACA
TTTACATATCGTAAGAGTGAAACTAATGGCGTTGAATGGTTAACGCGCTCTAGAGCAGCTAGAAAGAGATTCTTTAACCAAAAACAATTCGATTTATAAC
ACTTGAGGCAGCAATTCAACCATCAGTTTTCCTTTTCTTGTTTGATTTTTGATCTCGAGAGTGATCGAAGGATCCTGAAGAGGTCAATACACTACGACCA
CTTTTGCCCGAATCTTGAACAGATTGGCCATCACCGTGTTTTCTAATGGTCGATTTGGATGAACTCCCTGATTGCATAATACTTCGCGTCCTAGTACTTT
GACTAGGAGTTGCAAAACGACGAGAAGAATTGGTCAATGTAGTAGTAGTACCTGATGATCTCTGAGCCATCATCTGCTTCAAGTTTATGCTGTTCTGTTT
AAGCTCACTTGGTTCCGGGTAGTGGATAAAGGAAACACGTCGCGAAATTTTACCAGCTGCCAAAACATGCAAAAGCATTATAATTGGTGCAATTAAACAT
CTCACATGGTGCTTACTGCTCAACAATTATAACAGTGAGGGAGAAAAGGATCATAGTATAGTTTCGTAAACAGGATAGTCTTCGTAAAACAGGATAGTAT
TAAACATCAGAGAGAGTCTTGAAGAAGTGGACACTAATTGACATATGATTATACTGTTTGAACGCAGTCCACGCTCGGCTCTGTGTGCAATCTTTCGAGA
ACAATTTCCTTGATAAATGAAAGCTGGAGTCATAGGTACAGTCTAGGCGCAAATATCTTACACGTAAAAGTTCTTTATATTGCTCACTAGAACAACTTCA
GAACAGATCACTGTTAAAATCTGCTCAAACGCCTTAATTTTGTGCTTGAATGGGAAATTAACAGCATTGGATCATATAGAGGTTTACATTAAGGAATAAC
AATAAGCTCTACCAAAAATATAAACAGAAGAGCATTAGTAGTTGGATTATGTGTAAGTTCCGCACAACTAAGAGAGAGCAGTAAAATTTCAATATGCAAA
CAAAACGAGCATGTCATATATTGAAATCATCAAAGATGTTGAGTCACATTAGCTTTAGTATTCACATGACAACAACGCATCGTACAATCATAATGGTTTG
TACCATGCAAAATTGCATGTTTTGAGTATTGCAAGATCATGAGTGAATAAGCAGACAAATAGACAGCAAAATGCAAAGGAACTAAGAGTTACCGATTTTT
GGCTCAGACTGGGAAGATAGAAAGACTACCGCATCTGGGTCTTGTGCTCTACAACTGACCACTTCATATGATTTACCTGTTATAAAAACAACATTGAGCA
AGATGTTAAGAAATTAAAAGCATCTTTCGTTATATTTTAAAAAGGCTGATACGACTACTAGATTGGTTGAGGTGGGGAGACAAAAACTCAATTATACGTA
AATGTTATTCTTCAGACTATACTTGCCAGATGAATCCTCAAAGCTGCCCATATGCCCATCATGATGGAGCTTCAACGAAACTTCTTGCCCATCAAGACCT
GGATGCTGGAGTAGCCAATTGGAAATGTCATAACTCAGAACCGTAAGTGACAAGGACTGAAATATATATTTACATCCTCAAGTGCACAATTATTCTCATT
CTGTCCAAAATCATAGTAAATCTCATAAGTAAACTCTCTCTTTTTTTTAGAGACTAGGGAAGGATGGTTAATTTTTACATGGTTTGTCCCAGAAAAGGAA
ACAGAGAGAGACAGAAAATCTCTTCACTTAGAGACCATGGCATCTGAGTTTCTTCCCTGAAATCTCTTATTTGCTCCCTGTATTTATGAAGGAACAGAAA
AACTTTGTCTCACATTTGCCGTCATTTTGTATTCCTTTCCTTTCTCACTTTCCAAACAAAACTTCAAGGATTATAAAATTATCTTCTAGAAGAGAAGATG
CACAAATGCCCTAGTGGAGAGCGAGAGGTTGGCTATAGTGGATGTAAGGAGTGGTAGAGGCAAAGAAGATGCACATATGCCCCAATGAGAAGTGAGAGGT
TGACTATAGTGGATGTTAGGAGAGGTAGACTGAAGAAGTTATGGAAAACGATAGTTAGACAAGACATGGACCAGCTATAACTTATAAATGACATGACCCT
AGCTAGGAAGATATAGGAAGATATGGAGGAAGAGTAAAAGGTTAATAAGTCGAGCCTTGTCTAGTTACATTTCTAGTATTGTTATTATTCTTCGATTTAG
CATTACCCGTTGTTTCATTTTCATCTACCGTTCTCTTCTCATTGTTTTCCGCATGACTTCTTTGCGATTGTATTTTCTTTACATACTTGTTTTTTATACG
CTTTACTTGAATCAAGAATCTATTTGCTTTACATACTTGTTTCATTTTCATCTACCGTTCTCTTCTCATTGTTGTATGATGACGAAATTCATATTTTCTT
TGAATACATAAATAAGGTCTCATAGATAAAGAAAAAGAGAGACAATAATGTACATCAAACTATGGTAATGTGAGAATGGTCCTTAGAGACTATGAACATG
TAAGAAAAGAATATCATCTTTTGTGCACTAACACACATAGATGTTGAAATGAACTTGTTCCGATATTATTTTCAATAGTCACTTGAATGATTGGGGAAAA
AAGAATGCACCTTATTGCATCCTAAAATTAGAAGAACAATAAATTCTCATGAATCTTACTTGATTAAAGGGCCACTGTATAAGCCAGAGCTCAGTTGAGA
CTGCAATGTTAAGATTGACAAGTGAATCCTTTTTGACCTCCTCAAATTCCGGGGGTGGTTTGTAGCTCAGTTCATTCAGAGCATCCATAATGATAGAATA
TAATCAATAAGAGCACTTGAAAATGGCAGACAAAACAGCTCCTGAACGAAAGGTTTACACAGAAAAACATGAACAACGTAAGCTAACTCAAAATTTTAAA
ATCTTTCGAGTTGATACACATTTGACCAACAACAACAACAATAGCAACAATAAAACCAGTGAAATCCCACAAAGTGGGATTTGAGGAGGGTCGAGTGTAA
GCAAATACCATTATCACTTGTTTCCGAAAGAGTAGTATAAGAACTAATAGCAACGTATTTAAAAGAACTAATAGCAAAGTAGTGTAAGGCATATACGCAA
GAAATCGTAACATTAACAACAAATTGCAATCAATTAAACACAGTAAACTATAGGTATAGATGATAATCACAAATCCAAATCCCATTAGCTGAATATATCA
GCAAGCAAATTCAGTTATAAAAATTCTTTTCAAGTCATGATCAACAACCTCATATTTAAATCAAAAACTTGCTTCTAATCTAACGCTAAAATGTCAATCG
AATGCCTAATAAATCCTTAAGGACAAGTATACCCCGAACTATCATAAATGGTATGCAAATACCCTCCGTCATACTTTTAGGACATTGATGTCCCTGCCGT
CCAAAAACTAGAGCATATATGCCCTTTATACTATCAGAGTACACGTGTCATAATCTTATCCACCGATCCGACACTTATCGACGGATAAGATTGCGCCACG
TGTTCGTATTTAGTTTTCCGTTAGAGTGACGGACATATATACTCTAGTTTCTGGACGGTAGGATATCTGCGTATCGTTTATGATAGTTCGGGTACATTTA
GCCTTTTTCCCAACTTTATAATAGATCCCAGTAACATTAAAGCAGACGATTAGAGAAAATTGTAAATTAATTACTAATCTGTGTGTCTTACTCCTAATCA
GATGCAATAAAAGTGTATTAATATTAGAAATGAGAAAACATTCCTTACATTTGAGACTGCATAATGGGGAATCAAGCAAAAACTTCACATTAATCAGCAA
ATAAGTAGTATTATTGACGACATCTCACTGAGATTTCAAAGTAACAACAAGTTTACAACGTTCAATCAGCAAACGTTAATCGATTTCAATGGAATTATTG
TTCAACTCTAGATTTAATCCTACAAAAATAAGTGTTCACTGTGCTGATATCATCGGAGAATGGTCTCAGAATTTTCGAAAATTAAAAAACCCTACCTCCG
ACGAGCGGTGCCGCTGCAACTTCCGGTGTTGCTCGATGTGGTGTTGCGAAGGTTTAGTGTTGTAGAAAATTAATGATTAATAGGTATATTTTTAAGAGAA
AGTGGATAAATATATTTCGACCTATCGTAAATGTTATGCAGATATTTTCGTCTTATTTTATGAACATTGATACTAATGAAAATACACGTGTCATAATTTT
ATCCACCGACCAAACATCGGATGGATGGATAAGACTGCGTCACGTGTCCATATTTGGTCTCCCGTTAGAACAAAAGGGCATATATGCTCTAGTTTTTTGA
GGACAGAGGCATCAATTTTCCAAAAATATGACGAAGGATATCTGCATATCATTACGATAGTTCGAAGATATACTTATTCTTTTCACTTTTTTTTTAAAAA
AGGCTTTAGGGGTCGATTTTATTAAAAATAATTAGATAAAATATAATATACTGACCTCTTGATGTTGATATTAGCTGAACTTTAATAATAATAAAATTAA
GAGAAAAGACACAAAGAGACCATCGAAGTTGTCCCATATTTGCATAAAGACACCTAAACTTTTGAAGTGTCCTATCACACCACTAAACAACTATATATTG
TTGTAAATTGGCCATTTTTACCCATTAACTCATCTGGGTTGTTTACACGCACGTTAGGCGCGTGATGGGCCATTTTTCCTTTTTATTTACCACTTTAAAA
CAGCCACATGTCATTTTCTTTCTTTAATATTAATTATTTAATCAATTTTTGTATCTTCCCCAATTTAAACTCAAAAATAGCCGTTGGTAGCCATAAAATT
TTGATTTCCATGGCAAGAACAATATTGGTGTTCTCTTTTTGACGACTTCTTCATCTTCCTCAAGAAAATAAGGTAGGAATTCGTCTTTTCTCTTTTAATT
TCCAGTATAAACGTTAATTTAAAGTTTTTTTATGGTTGAATTTCTTCTCAATTTTGTGGTTAGTTTTTGATTGAAAATGTCAAATGCAATGTTGAATCGT
ATTTGTAATGATGAGAATGATCCGATTTTGCGAGTGAAACTGCGATGCAAACATGGTGACTTACTATCAATGCAAACTTCATGGTCGGAGCATAACCCAG
CTCGAAGATTTTGGTTTTGTCCACGCTATCGTGTATGTTTACTAATTTTTTTATGGAGATCTTTTGTTTATGTATTTTTCTTTAATTTGTGTTTTGCATA
TTTTAGGAGGATGCGTGCAACTTCTTTAGATGGAGGGATCAAGAAGAAGTTGATATAAGATCCAAGTATGTTATTCCGAGATTAGCAAAGAGAATTAAGG
AGTTGGAAGAAATATTGACATCTTATGAAAGTCGTGTTGAAAGTAACCAAGTCATGATGAAGGAGAAAAAGAAGGGCAAATGTTGTAGCTTGAAGCTAAT
CGTCTTGATCATTATTGTGTGTTTTCTATGTTTAAGTCTAACCAAGAATGTGAAGGATGTAAGTTGTAGGTGTGTACAACCAAAATTGCCATAGACATGT
TTAGTTACTTTCAAATTTTTGAAATTGTAGGCGTGTGTACCTAGAAGCTAATTGTCTTGATCTTGCTAGTTGTAGGTGTGTGTAACTTGAAAGATTGTTG
AATGTTCAAGTTATTGTTGTTCTTTGTTGTCGAAATTGTTATGATTTGAACAATTAGTTAATGTATTTGGTTCTCTAATCTATATTATCATGGCAACCAT
TTGAGAAGCTTCACAAATATGTCAATTACAATTAAAAAGGCAATAACAAAACTGACAAAAAAGAAGACTTCATAATCGAGTTTGATTCCAACCATTCAAG
TTTGTTTGGTTACACCCAAAATTGAGTTTGTTTCCAATAAAAAACAACACAAATATATGCTTAGTTAAATTTTGTTTGTCAAAATAAACAAGACAACATC
AAAATGCCCTACTTCCATGGCACAAAAGTTTTTCTACTTGAAGTTGTTTGGCCTTGGCTATTAGCAGCATTAGCAGCAGCTACAGACCTAGTTTGGATAA
CCTTTTCAGCCCTCATTCTTTCCAGATTGCTACTTGTAATAGTTGTCTTCCCCTTCCATTTGAATCCACGTACTGGTGTGTAGCCAATATCACCAGTGAC
AACATCAGCCCTCTTTGTAACTTTTGTACCAGTATTGATGACTCTTCTACTTGTCAATCCAGGCTGCTTAGTCAAATAAATACACAGTCAAATATTAGAC
AATTACATTGAGGTTTGCAATCACAATTGTAAACTTGCATTGATAGTTGTAAACTTACATTGAGAGTTGTAAATCCATCTTTAGCTTGGTATATGCCAAC
ACCTACCATTCTTGGCCTTTTAAAAGGTCTTGTTTGTCCTCCACTAGTGTCTTCATGTTCTACTGGTCTCTTCGCTCTTCCTAGGCCTCCTCTACTGTAG
TTTGCTTCTGAACTAGTTTGACTATGTTGAGTCATTCCTCTTCCTCTACTTAGTCCTTCATTCACATTTCTTTCTTGAGCCATTTCTCTTCCTGATCCTG
CTCCTCTACCTGTACCTCCACCATTTACAGTCTGTACTTTGAAATCAAATATTAAAGCATATCTATATTATCTAACAATGATATAATAATTAGATATATT
ACCTCTGTGTTTGTAACATTTTCATGTGATTGAGCTGGAACACCTCTGCCACTTGCTCTTCCTGTGCCTTTTCCTCTACCACTTTCAGTAGCCTGTATAT
TAATATATCAATATATATACATCCACATATAACATACATTTGAGAGTAACAAATAAAAGTACCTGTGTATGAGAAGATGGTTCAGATGACTTACTTGGAC
CAGTACTTCTTGCTTGAGAAACTGGTTCAGTTGATTGACTTGGATCAGCTTGGTTTCTTGTAGGACATCCTCTTTTATTGTGTCCTTGTGTGCCACATTT
GCTACAAGTCATTACAGCACCTCTTTTGCTCAACTTTTCAGTTTTTCTGCTTTCATCTGCTTCCTTTCTTCTAACCTTAACTGGTCTTCCAGGCAACTTT
CTGATCTTTGGTGGCTTTACAATTGGATTATTTGATGTTGACCACATTTTCATGTTATTCATTGGCTGAATAAAATGGGCATATGTGCTGAGGTAGGTTT
CCTTGCTATAACAGCTAGCCACATAATGGATTGGTTCCAAGTTTTTGTAATGAAGGGCAGCAACACCATGAGGACAAGGAATTCCCCTAAGCTGCCAGGA
TCTGCAACTACACCTCCTATTAACAATGTCCACAGTGTGTGTAAATCCATGGTGTTTAATCTCAAAACCTCTTTCTCCATTCCAAGTCAAGTTACATTGC
ATAGACTTTTGAATGTTTTCTTGCAAAATCTTTATCAGTGATCCAAGTGTTTGAGAACTCTCTCAAATCACCAATTCTTTTCATCATCTTCACCCTTATC
TCCTCAAGCATTATAATGATGGTTTTATACCTTGCAGACACTATCCAAGCATTAAAGCTTTCTGTCATATTGTTGTCCACAACATCACATTTGCTATATT
CTTCAAAATACTTCTTGCACCATGTATTCAAATTGTACCATAAAAGATTATCTAAACCTTCTTGTCCTAATTTCCTCATTATCTCTATATTGTCCTTCAG
CTCAGCTTCAAATGTGGATTTAGCAATCCTCCAAAACACTCTTCTTCTTTCAACTCCTTTCCAATTTTTTGACCAATGTGCAAGAACATGTCTTGCACAT
TTTCTATGTTCAACAAGTGGCAATAAAGTATCTACAACAATTTCTAGTCCCTAACAAACCAACATAACAGAAAAAGAATCAATTTAAGTGAAAAACTCAA
CAACAATAAAATAGTAAGATGGATATCAGTAATTACCTTTTGCATATCACTAATGATGGATAGTTGATGCCCTTCTCCAAGTTCAAGATCATTCTTCACT
AGTTCAAGAAACCATGTCCAAGTATACTGATTCTCAACCTCAACAACTGCCCAAGCAATAGGGAGCATTTGGTTGTTTCCATCTCTACAAACTGCCACTA
ACAACTGGCCTTTACACACACCTTTGAGAAAACACCCATCAAAACCAATCAACCTTCTAGCACCTCCAAAAAATGCTTTCTTTAAAGCATTGAAGCAAAC
ATAAAATCCTTCAAAAATTTTCTGCCCAGTTTCAGAATCTTCTCCAACCTTCACTACACAAGTACTACCTGGATTACTATTTAATATTTCATCTCTATAA
TAAAAAATCCTACCATACTCCATAATGTGATTACCCATGATCTCTTGTAACACTCTAGTCCTAGCTCTTCTCACTGTTGTCCTACCAACATTAATATCCA
ACTCCTTTCTAATAATGTCCTGCAACAAGACAATGCTGATGTTTGGCTGTTGAGTTATTCTTTCTTTGTATTTGGTGGCCAAAAACTTTGAGTTGCACAG
GTAGTTATGAGTTGATGTCAAACATTTATGGATAGGGTTGTATGTTTTAACAATGAAATCTCCACTAGTTTTATTCTTACTTGCACACAACAACCAAGGA
CAACTCTCTTTACAACATCTCACTCTAACTCTGTCAGGCTCATTTACATATTTTTCAATTTGAATATGTTCTTGGATTGCATATCTTGTCACTGCCACTC
TAAATTCTTCAACAGTTCCAAAAACCAGTCCTAATTCCCAAACAATCTTTTCAGCAGTTGTATCAAACACAACTCTATTTGTGGTTTTCTTCCTCCTAAC
AGGTTTATGCACTACTTGATCTACCTCTTCACCATCTATTTCAAAGCTAGGAACTACATCACTTAGATAATAAGGTTCATCACCTCCTAGCTTACCAACT
AAGCTTTCCCTAATACCATTATTTGTCTCATCATACCCTATATCTGGACCTTTCTCATTAACATTAATCTGATCTGAAGTAGTTCCCCTACTTCTCCTTT
GTGACCTTTTGAAATGCCTCTTGGTTGCCCTTATATCTACATACTCTTGATGAACATCACTGTCAACCTCAGTATCTTCACTAGTATCCCCTTCAGATCC
TGATTCATCTTCCACTTCATCATCAGTTGGATCATCATCTATTACAGGATAATCAGATGAAGGAGGAGGCACAATAGAAGGAGATGGTGGAGGCATAGTA
GAAGACTGAAATTCAAATGGAGTGCTGGAAGTTTCAGAAGGACCAGTTGTAGGGATGGAAGGAAAAGTAGAAGTAGGAGGCTGATTATTAGGGTTAGAAG
TCTCATTAAAAGATTCCTCACCTACCCCACTTTCAGTCACATGGGGACAAACTCCAATTCAAGTGGGGCCTGATTAGCTTCACTAACCCCATGAAAAACA
TACACCTTCACTGTATCCCCATCATTCACCATATTGAAAAGGTCAAATATAACCTTATCATTATCAACAAGGACCAATAACCCATCCCACTTGATGAAAA
AATCACAATCTATTGTATATCCTAGTTCCTTTATGTAGTCCCTCAACTCAAAATAAGACATTCTATCAACATCTACACCTAAGAATTCTGTCACATGCCC
CCCAATATATTTAGGTGGTGGACCAAAATCTATTTCCCCCCCATGATACCATCTTAAAGTTATAAGAGTAAAAGTCATCTTGAAAAATCATGTAACAACA
ACAAACACAATTCAAACACACATTTCAATAACTAACTCTAACAAGTTGTACACAACAAACATAATCACTAACAAATAACAACAACAGAAACACTAACTAA
CAACAGTAGAATAAAGCACTAACATTAAGCTTTAACAGTACTAACAGAACAAAAACACTAACATAAGCAGTTGTTATTGTACAAATTGAAGTCTACAAAT
GAATAAGAGACAAATAATAACATTCGAACTAAGTGGATAACATCTAACCCTAACCTAAAACACAATCACAAAACCCTTATCATTAACAGTTGCATTAAGT
CAATAACACAATACCCTACACTAACTAAGTCGATTACCCAACATACTCAAAAATATCCTAACAATGGCAACTGTAGGAGGTCGATTCTAACAATCCTACA
CTATAATAATCCATAAAATCAGAATAATCGTAAAAAAAAAGTGCAGATTTTAGAACCCTAACCTGTTAGACCTTCAATCTCCAAAAATCTTCACAAATAC
ACATCAACAACGATCGACAATGATGAAAAACAAGAATGTCAACAACAACACTATCGTCAACAACAAGAACACAGTGTATTTCGTTTGATTTTTTAGGAAA
AAGTTGAGAAATGAAATGAAAGGAAGGAGTTCACAAATTTTCTTCAAAAAAAAGGGTTGGGTCGGGTCGGGTTCCTAGAGAGTGAGCAGCACGCGCATTA
CATAGAAGATGGAATGACTAAAAATGGCCAATTTACAACGATATATAGTTGTTTAGTGGTGTGATAGGACACTTCAAAAGTTTAGGTGTCTTTATGCAAA
TATGGGACAACTTCGATGGTCTCTTTATGTCTTTTCTCTAAAATTAATCATGTTAAATTAAATAATATTGATATTCAAAGGAATTTTGTTCTTTTGATAA
TTGTATTACGCATTGTAGGTTGGTTTTACTAAAACTAATTAAACAAAAATAAAGATATCGACTTCTACTAGTCCCTATATAAATATTTTAATGAAAATTA
ATTTAATAACGTAAAATTTAATTTTATCAACTTTCAAAGTTGATATTAGGATTTTTTTTATTTTTTATTTTTCATATAATCGTCCTCCAGAGGACGGTTT
AATTAAATTTATCATAATTTTTTTTATTTTTCATATTTAATTGAGATAAAATGAAATACTATTATTTATTTATTAATTCAATATAGACTACAAGCGATCT
GTATTTCTTGTATTTATTTATTTTTCGTGAAAATTTTCAACCTCCAGATGTCTATACGTGGTTTTTTTTGTATTTTTTTTTCTTGCATAAAATTTGATTT
CAGGGTGTCGATTTTCTTTAAAAATTTATTTTATATTTTTTTAAAACAATACCAACTTTCATTAGAAGTAGATAATTTTGAGGTCAGTATTCACAGTTTT
TTTAGTAGTGACTTTTAATTTTTTTTTTTTTTACATTTAAGCAGGGTAGTTGAAACGGAGGCTAGCACTATCCACTTTTCCTAGTCAGAGTACGGGCTTG
GGCTTCGGTGATAATGTTTGGTAAGAACAATTCGCTAAAGCTTATATGTAAGTTCTACATCGTGATGATCAAACTTATTTTCTTGTATGAGGCAAAATGT
TAGTCAATCATGAACACACACATTAAGAAGATGAAGATCGTGACAATGAGGATACTCTGATGAATATGTGTGAGTATGCTAAGATAGATGAGATTAGAAA
TAATATTATACGTGACAAGGTTGGAGTGACCTTTGTGGGGATATGATCAAAAAAGCGAGTTGAGATGGTTAGGACGTATAAAGAAAATGTGCTCAAATTA
ATGCACTAGTTAGGAGGTGTGAGAGGTTGTCGATAGCAGGTTATACGACATGTAAAGTAGGCTAAAAAAATATGTGTGAGAATATTAGATAGAATATGAC
ATATCTTTATCTTTCGAAGGACTAATTTTAGATTAAAAGTATTGAAGATCGAGAATCGGGATAAAATTACAAAACACATCATATCTCGATCAGGGAAAAA
CAAGGTTTGCTTCAGTAGTTGAGCATTTACATTATCAATTGATAAGTTGTGGATTTAAATCACGTTAAATAATAAATGAAAATACTACTGATCTTTCTGT
ACCTGATCCAAATCAAACCACCCTAAAAACCAAATTGTATTTTTCAACATACCTATATAAAATCTACAATCTTATCCTTCTTTAATTTCATCACAACAAA
TAATCTATTGTCTTTTTGATTTTTTTCATACATTTGATGATGAAATTAATTACTTTATGCTACAAATGAATCCCTTCTTTTTCTTGGATTCATTGTTGCT
GCCTCTGGATTTCCTTTCTTCATCATTGCTACAAATTCATCATAATTGATTCGACCATCCTAAAATAATAAAATACATTATGATCAATAAATCGCGAAAT
TAATTAATAATTGCGATTATGTATATAATTTTTTGTTTAATTTTGACTTACATGATCAGTATCAACTTCGTTAATGATTTCCCTTAGATCATTTTCATCA
TCCATACCAAATTCTCTAAGTGCTTGCTCTAACTCTTCTCTTGATATATATCTAAGGAAAAAAAAATAACATTCGTAATTGAGAATATGTCGAATATCAA
TATTCAAAGTATAAGACAACTCATTGCGCTAAGCATCCACATTCAATGCAAGGTATGGAGAATAATCGCACGCACCCCATGTGACACAAACAACCTATAA
TGATACAAATATACGATTGATTTCACTACTCGAACTCACTAAGGAGTCTGATGCAGACAATCTATACTATTACAAGTATCAGTGACTGATTTCACAGCTC
GAATTTATGAGGGATGTGATGCAGACAATCTATGTTGATGCAAGTATCTGATTTCACAGCTCGAACTCACTAAAGGGTGTGATTGCAGACAACCTATGTT
GAGACAAGTATCGATGACTAATATCACAGCTCGAACTCATAAGAGGTTTGATATAGATGGCCTATACTGATACAAGTATCAATGACTGATTTCACAGCTC
GATAAAATTAAAAATAATCACATCTATGATAAAAAAAAAAAAGCTTACCCACTATGATCCTTATCAAAATATTGGAATGCAGTGTAAAGATGTTCTTCTC
TATCCATTTTGTTCATGTGCACTGTTGCTGTGATGAACTCTTCATAGTCTATTGTTCCATTTCCATCAACATCAGCCTAATTTTATTTTATTTCCAATAT
ATATATATAAAAAAAAGGTAATTAATTAGCATTAGAATAATAATAATAAAAATACTATGTCATGGTAAATAATTTAGGTTTAAAAAAATTAAAGAAAAAA
TCATTATTGAATATGTACATGTATTTTTTTTAACTTCATAAAAAAGATAGTTCGAGTCAGTTATATATATATATATATCGTCAATAGTCATTAAAATTCA
AAAGGATAAAACTTACTGCTTCCATTAGTTGTTTAATCTCATAATCAGATAATTTAGTCCCTTGTTTGGCTAATCCTTGTTTTAATTCCTCAAGTGTTAT
TGTTCCACTATTATCAGTATCCATATTTTTAAACATTTGCTTCAATCCCATAATTTCTTCTTCTGATAAACATCCTGCAATAACCTAAAAAAAATAAAAA
TCAAAGTAATTAATTTAGTCTATTTTTGAAAATATTTAACATAATATCTGACGAATAAATTTTATAGCTAAACAATAAAATACACGATTACCCGAAGAGC
GACTTTCTTGAATTTGTTCATAGCTCTAAATTGTTTGAGTCTATGTAATACAGCATTATCAAGAGGTGTGTCTGGTGCTTCTCCATCTTCTTTGATCCAT
GAATGATCTTAATATATATATATATATATATACAACAATTTGTTAGACATGAACATGAAGGTTTTAAAAAATCTTAAAAAATGGATATAATTATTATTTT
ATATAATATTGGTTAAATATATATATTTTATTTAGTTTTTCATTTACACTATGTTTGGATCGTTGTTATCCATTGTATTGTATCGTATCGTTACTGTACC
TACAATGTTTGTTTTGATTGTTACTTAAAATGTATTGTACTGTATTGTTAAATTTCGTTGTTGCGTAACATTGAAAATCCCTATTTTATGGAACAACTAA
TTTGGTGTGTTCCCGTTGTTACTTAATTTCTTTTTTTCAATTATATCTTTACATAATATTTCAAAATACTATTTTACCCTTCACCTTAATTATTTAAATC
TAGCCAATCCTAGAATAATTATGGATATTTTAGTAAATTTATAAATTACAATACGATACGATACAATCAAACCAAACAACTAAAATGTTATTAAACAACA
ACAAACAATACAGTCTAGCCAAACATTGTATCTATTGTACAATACTGTACATTAGCGTACAATACAATACAATACCTTATGAAACAATAGGTAACAATGA
TCCAAACAAAGTGTTAGTGTTTGATTCACCTTCAAGGCCCGACTAAAAAAAGATAAATCACTCATATCAAAGATGTTATATTAAGGGCTCGAACCAGTAG
TCTTTAGTTAAAGATAAAAGAATGTTTATCATCCCGATCATCACAATCTTGGTTGGTGTATATTAATATACAAAAAATATGTATTAATTATGTACCTTTG
TAGTTAAATATACAAAAGTTATATATATCCCTAGAAGTAATAAGTAGCGTGATCAATTCTACCAAAGATGACTTCATTTTAAGGGTTCGAAGCTGTAGTC
TCTAATTAAGAATAAAAAAATATTTATCTCTCTTGGTTGATATATGAACAAAAATTATGTATCTTTGTAGTTAAATATACAAAAGTTTATATATATATAT
ATATATATCAAAATAATAAGTAAAAATAACTTACTTAGGACTTGCATAGCTGTTAACCTCTGCCTAGGGTCAACAGTTAACATCTTTCTGACTAGGTCTT
TTGCTCCACTTGAAATTGAAGGCCATGGATCACTAGAAAAATCAATATGTCCACGTAATATTGCATTGAAAATTCCATTTTCATTTTCTGTAAAATAAAT
AAATAAAAATAATTAAAAAGTATATAATGAATTTAACCTAGCTATTGTTATTTTTTCATTATATACGAGAACTATAATTTTTCACGATAGATTGATTCTA
ATACTCACTATTAATTGTGCATTTTTCTTTCAGTGACAAGACTTTCGGTAATGGAAATACTAAGGTCTTTTACTTGAGGTCCCTTGTAAGTAGGGGCAAA
GCTATAACCACCCCAGAGTATTTAACTGGGCACTATTCGTCGGAAAATTACGTTATATATATAGCGAGAGTTGGACACGCTTGACAAAAGCTACACCCTG
ACACAGTAGTAATGGGTGACCATTTGAATCAAGAAGTTCCAGATTTGAACCTCAAAAAACATAATATTTTTTTTATTTTATTTTGACAGTCATACACTAT
TATTCTTGGACACCCTTGATAAACTTTCTGGCTACGCCACTGGTTGTGAGTTGGGAAACCGTGTATTTCTTTTAGAAATCAATTTCCTAATTGTTCCAGA
GCAACTAGAAAGAGATTTGCTTAACCAGAAAGAATTCGGTTCAAATGTACAATATCTATCCAGAAGTTTACGTAACTCAATCATATTACTAAAAGGTAGT
TCGGTGCACTAAGTCATGTCCCCTGAAATAAGGCCTAAAATAAAAACGAAATAAGTGTTTCCACGACTCTACTTTATTCACGGTGACGTATCTTCCTAAC
TAATGAATGAAAAATTCTTTCCCATGTTATATCAATCCGAATTTCATTTCCGTTAGAGATAATTCTCAATAATACACGTGACATTTGATCCAATAATATT
TTATCAGAATATTATAACGCGGTGTTCGAAGAGGGTCAGATTTTTCTCAATAATTATATATGTAGTGGTGTAAATTTTTTACCTGCCCAAAAAGGAGGAA
CTCCACAAAGAAGAATATATAACATAACACCAATACTCCATATATCAACTTCTGGTCCATATCTTCTTTTCAATACTTCAGGTGCAATATAATATGCACT
ACCTACAATATCCTTAAACACATCTCCTGCACAAAAAAATAATAATTATCCTTTATAAATCTTCCTTCATGCTGTAATTATATGTTTTTTAAGGAAAATA
AATAGGTTTCTTACTTATTTTCTTATGTCTGGCATATAAGCAAAAAATTGTTATTCGTATTTGTGTATAATCTAGACAAATACTATAAAAGGTGAGATGG
AGATAGAGGTGTAGGTGAGGTGGTGGGGATACGGGAACGGGGATGTGCATAAGATGTATTAGAGGATGGGGAGAACACAATCAATACGAAATGTTATTTA
TGTAAAACTTATTTTCCATACTTCCACTGGGATAGTCATTTTTTTCTACAGAAATTGTTTTCTTATGTCCGGTACCATGGTACGTAAGCAAAACATGTCA
TCCTAAACGTATTTGTATGTGATATAGACAAATACTATAAAAAGGTGAGACGAAGATAGAAGTGTACATGAGGTAGTGAGGGTACGCGGGTGAGGGGTGA
ACATGAATTGTGCCGAAGGGTGGGAAAAACACAATCAATATGAAATGTTATTTATGAAACTTGTTTTCCATACTTATATTGATAGAGTTATTTTCTCGTT
ATTCTTAAGAAACTGAACATGAGAAAATTGAAAAATATTTTCCTCCTTATAAAACACATTTTATATTATGCCTTGTTGGAGTAAATGCTAAATAGGGTAG
AATTGTAACAAACCGAAAAACCCTAATTTTTTTTCTTGAACTTTCTAGAATGACTTTCTAAATACATTTTTCATTGAAATCATCGCACCTAACGTCCAAC
CAATCATAATTTAGACTATAAAACGACAGATAAAAATGATCGATATATACATACCTTGCTTATAAAAGACGGAAAGACCGAAATCGGTAGCCTTAAGAGG
TGCATTCTCATCTTTACTAAGTAGTAAAAAATTTTCAGGCTTAAGATCTCTGTGTATAACTCCCATAGAATGACAAGTATCAACAATTTGAACAATTGTT
CTTAACAACGAAGCTGCAGCGCGTTCTGTATAATGTCCTTTCGCGATAATTCTATCGAAAAGTTCACCACCAGCACATAATTCCATGACCAAATGTACAC
TATGTTTGTCTTCATAAGCCCCTTTAAGTTGTACAATGTTTTCTTGACCTGTTAAATGATGCATTATTTGTACTTCTCTTCTAACATCTTCAATATCTTC
TTTGCTAACTAGTTTTCTCTTTGCTATTGTTTTGCATGCATATTGTTCATTTGTTTGTTTTTGTGTACATAAATGTGTTACACCAAATTGTCCTCTACCT
AGCTCTTTACCTATAGTATATGTTGATCTAACATCTTCCATTGGTCTACCTAATACTAGTCCTATTGGTGATTGTTTTGAGGGTTTTGATGATGGACTTG
GAGATGTTTTTGTTGGTGTTGGTGTTGTTGAACTTTGATCAAGATTGTTATGTTGTGTAGATGAATTGTTTTCTACATTTTTAGGGTTGTTGATTTCGTT
GTTGTTGTTGTTGTTGGTTGTTTCATTTGGTTGTTGTTCTTCTCCACTAGAGCAACAATTCCCCATTTTTATTTGGGGATAGAAAAAAAAAGAAAGGAAA
GTAATTAGAGAGAGATTACGTAAAGATGACAATTATTACGTCTCGATCTGAAATAGAATGAAGGAGATTTGAATAGATTTAAATGAAAAGTGAGGAAATT
ATGGAGAGATTCAGCAACGATGCAATGATAATTGTTATTACGTCTTTAATCTCAAAAAGAGTTCAACAACGAAGACGTAATGACAACAATTATTACGCCT
CAATCTTAAAAAGGAAAGAAGGAGATTAAAACAAACCTAAATGCAAAGAAATGAAGGTGAGGAAATTACACAATAATGGAAAGAGATTTCAACAACGACG
TAACGAAAATAATTATTACGCCCTCAATCTCAGAAAGAAATTAAAAACAAACCTAAATGCAAATAAATGAAGGTGAAGAAACTACACAATAACGGGGAGA
GATCGATTTGACAACGACGTAATGTCAATAATTATTACGCTTCAATCTCAAACAGAGAGAATAAGATTACAACAAACCTAAATGCATAGAAATGAAGGTG
AAAAAATTACACAATAATTGAGAGGAGATTCAACAATACCATAACGATAACAATTATTACGCCTCAATCTCAAATATAGAAAAAGAAAATTAATTAGAAA
AACAAAAAAATGTATTAGAATCAAATGAGTAAAAAATTGGGGGGTCAATAAAAGAAATAATTATTGTTTAAAGAGAAAATATTCATTATGAATTTTACTT
AAGATTGATTGTGAGAAATTGTAGGAATAAAAAATAATGTTTTTTTCTTTTCAATTTTCTTGGTTTTCTTTCTTTTGTTTTTTTTATAAAAAAAATTAAA
TAAATTTCTTAGTGTTCCTAATTTGTTTTTATAAAGAGATGAAAAAAGAAATGTTTGTGATAAATATGGAGGGTTTAGAGTGCTTTTCGAAATTACTATT
TTTAGTAAATAATAATTTTATAAGTTTATTTTTTTATAGTAAGTAAAGTTTAATAAACGTACACAAAGTAATTTGGGGAGGAGTATTAAGTTTTAAAAAT
TATGTTAATTTCCCATTTTTTTTGGTCTAATATCTATAAAAAAAAATTTTCATAACGAATTAATGAGAATTTTATATCGTAAAATATATTTTTTTATCAC
CTAATTTACATCTATAAAAGAAAATAGAGGGTGCAAAAATGGAGTTAGTCTTCGTACTTTAAGGGAATATTTAGCCTCTTTACACTTATTAATCGAAAAA
AATATATATTTCTAAACTATTATAAATAATATGCGTGTATTAATTTTTACCCAAAAATTAAGAAAATGTCATAAATAGTCCCTTAATTGTAGAAGTATGT
CTAAATTAGTCTCTTAACTATACTTTTATTGATTTAATCCTTTAAACTGTTTAAAAACTTACCAGATTTATTTCGTTAGTATAAGCTATTTGTATTAATA
TTTAGAAAAATTTATTTACATAGTATCACGTGTCGTTCCATTTGGCTTAAGGATATATATGATCTAAGAATATATCGATAAGGATATATTCAGCCCCAAG
TATAACATTATGTATATGTATATCATTTATAATAATTCGAGAATAAATATATTGTTTATCGCTTATTAATTGTCTAATTAGCCTGCTGTCAAGTAAGAAC
AAATTTAAATCAAACTATTGAACGATACTCCCTCCGTTTACAATTAATCGTCATGATTTTCTTTTTAAGTTAAACTATAAGAACTTTGATCAATATTTTA
CGACGTATATTGTTACCATATTGATATGTAGAAAATTGCAATTTATAGTATTTTTTCTTATAGTTTTAGAATATCTAATTTTTTCTTAAAAAATATCCAT
AATATAATCTAACTCAATTTCAAATATTAATCAAATTAGCTTTCGAAAAACGCAATATGACAAATAAAATAATGCTTGTGATAAAATATTAGAGACGGAC
ATATCCACTCAATTTGGCTAAAATATTAATATTTTCATAGAAAATTAATATAATTCATAGTGAAATAAAGTATAGTCTATGTGTATAAAATAACACCCCA
CCCCCACCCCCAACACACAAAAGAAAGAGAATGAAAAGAGACTCAAAAGACTACAGTTTTGTTTTTTTGCTGAAAAAAACTTTTGTTGATTTCACTGATT
TACTAAACTTTGAAGAAGAAGAAGAATAGGGGTGCAAGAAAACAAGAAAAAGATTGAGTTTTTAGTATCTGATTTTGGTTTATCTGTTGAAGTCTCAGTT
TTTTTTGTCCAACAGACCCTTCTTGTTTTTGAACGGTAAGTTACTTTCCCCTCTTTATCTTCAGTTATCATGTATTTAGATGCTTTTTATGTACTATTTT
TAGATGAGGGTGTCTGTGTTTTGGGGCTGAAGGTGCAAAGATTTGATCTTTTTGAGGATTTGATGAATTGGGTTTTATTATCTATGTGATGCAAATGATT
CTTGATCATATGGCTCTGAGGCTTAGCTTGATTTTAAGTTTGTCTATTGGGTGATTCTTTAGCCTGGATTGTTGTATTTTCATGTTGTTCTTCCTGCTTG
TTGCTGCTGTTGTCTTTTCTTTTATCTGTTTTGAGGGGAGGGTCTATCGAAAATTGTCTATCTACCTTAGTTAAGGTAGGGTAAGGTGTGCGTATACTGT
GTACCCTCCCCAGACCCTACTTGTGGGATTACAATGGTATGTTGTGGTTGTTGAGATGCAAATGATTCTTGATCATATAGCTCTGAGGCTTACCTTGATT
AAAGTTTGTCTATTGGGTGATTCTTTAGCCTGGATTGTTGTATTTTCATGTTGTTCTTCCTGCTTGTTGCTGCTGTTGTCTATCGAAAATTGTCTATCTA
CCTTAGTTAAGGTAGGGGTAAGGTGTGGGTACACTGTGTACCCTCCCCAGACCCCATTGTGGGACTAGAATGGTATGTTGTGGTTGTTAAGAGGCAAATG
ATTTGTGATCATATAGCTCTGAAGCTCAGCTTGAATTTAGTGTGTTTATGGGTTGATTCTTTAGCCTTGATTATTTTATGGATAATCTAGATTGACGAGA
CCTATCTAGATTATCCCGAAGTTCAATATTATTGGTAGGGCATTAATTTTAAAATGGAGAAGGCAATGAAAAATTAATGAGAAAATGATGATTACGAAGA
ACTTCAGCATATGCATGTAGCACTATTAATTTCACATTAGAGACTCAAAACAATAGGAGATATCTGATTAGAGGCATCACCCAATCAGAGAGTAGAGCAC
TATATGCTAAAGGGTTCTCAAAAATGTTGAATCTATGCTATGTTTTTGTCTCCTTGTCGTATAAGCCTAGCCCAGTGGTCATCTGATACCGGTAGAAGTG
GCTATGTTTTTGTCTCCTTGTTCAGCTTGCGATAATTCTAAGGCAGTTGGCTCTCTCAGGTGTTTCTTAAATGAGTGTTTCCTTGAGCTTCTTAGAAGAA
TGATTAGATTTTCTTGTAGGTTAATTTGTGATGCATGAGATCTGATGGCCAATGATAGTGGGGCTGAAGCCTAGTACTAAATATGAGATAGATGTGATTT
CTCTTTGCTATAGCTAAATGTTTGGCACATTAGCTTCCATTATAGTATACAAAATCTAGTGTTCATGAAGTGCTATTTTTCAGTACTCATCTTTAATTTG
CTTTGTCTGGACTCACGTCTGGTATACTTTGCAAAGCTCAGTAGGTGAAGTTTCTTTCACATGTTGATACAGTTGTACAGTATCTTTCTGCAGTTGTCAA
CTTAATTTCATCAAGTCTATCCTTATTGGACATCATGTTAATCAGTTCTTTTACAGAAATAAACGAGTTCCCAATCTGAAGTGGTTGTACGTGAAATTGG
TGGTACTACACGATGGCAGACGTCAGTGCTATGACTGATACGTCAACAGATGTTGATACAGATGATAAAAACTTGAGGGTATATCTGTTATTGCTTTCTT
ATCTTATTTAATGTTTTCAAATTTCAGCTATAGCTTTTCTAGATTTAAATAAGCATTTATCTGAATATTTTGATTGATAATTTCTGGTTTATCTTCATTC
AAAGTTTGGTTAAAGTCCAGTTGGCACGCCAATGTTCTTTTTTTATAAAGTGAATAGGTAGTTCTTGTGCTTTTATTCTTGGCGAGTTGAACAAAATTCT
AGGCAATAACATATAACTTCTTTTGATTTTTTTCTTAGTTTATATAATTGAGATTCTATCCCTGTAAATTCTGTTACCTCTATCTACTTCTACAAAAATC
TGAATGATTCACCTTATATAAGATAGTTCCAGGCCAGACATTACTGTGCCATATGTTAATTAAAAATGAAGTTATAAGCTTATTTGTCTTCCATTGATTA
CCAAGGACAGTGCTTAAGGTTAGTTTGTGGTGCAGTGGAAGGGAAGCACCTGACCTAATATAAGCTTTCTAACATGACTA