Notice: The contact form functionality has been restored. Apologies for any inconvenience.

BAC Sequence – LE_HBa0045L17

>C03HBa0045L17.4
TAAACCTAAAACCCTCTCTGTTATGATGATGCCTTGGTATAAAAGAAGGCTTGATGAACTAAAAGAATGAGGTTAATGGATCGGGTGTCACGTTCTGACA
CCAGGATAGTATTAGTGGATCGGGTGTCACGTTCCGACACCAGGATAGTATTAGTGGATCGGGTGTCACGTTCCGACACCAGGATAGTATTAGTGGATCG
GGTGTCACGTTCCCACACCAGGATAGTAGTAGTTTATCGGGTGTCACGTTCGGACACCAGGATAGTAGTAGTGGATCGGGTGTCACGTTCCGACACCAGG
ATAGTAGGGGATCTGAGTGTCACGTTCTGACACCAGGATAGTATGAGGAGAATCGGAGTGTCACGTTCCGACACCAGGATAGTAAAAAGAATGAATCTTG
AATTATGTTAATATACTCAATTTAAAGAACCTAATTCCTAAATAAGTATGGTGTGGAGGCTTGAGTCCTCATAGATGTGCTTGGGTTGTGGCCAATGATT
ATGGTACTTGTTGTTGTTACCTGTTAAGTGTTATGGTTGATTTTATGTTATTATCTGATAGATATTGCTTTCTATTTTGAGTTGACCGATGATACCTACT
CAGTACTTGTGACTTGTACTGACCCCTACTTGTAATTTTCTTCTTTGTTATTTGTGGAGTGCAGCAAACGTGCCATCGACTTCAACTCGTCCTCAACTCT
AGCCAGTCTTCATCCCGTCAGACTTCAGGGTGAGCTATTGTTCCTAGCTCGGACTGGATTCTTTCCTTCGCATCTTGATGTCTTGAAGTTCGGACATGGA
CCATCTCTTTTACTTATTTTAGCTTCTTAGATACTCTTATATTTAGTAATTTGAGGATAGATTTTCTTGTGATGATGACTTCAAGATTTTGGGGATAATA
ATAGGTTTTAAATTTTTGAAGTTATTAATTGATTTCATTAATGAGTTTTAAGTCTTCCGCATTATATTCTGTTTATTATTGTTGAAATGGTGGGGTTTAG
ATTGGTTGGTTCGCTCACATAGGAGGGTAAGTATGGGTGCCACTCGCGGCCCGTTTTGGGTAGTGACAAACTTTGTATCAGAGCATTAGGTTCGTTGGTC
TCATCTCACAAGAACGAGTCTATTAGAGTCTTGAGGAATGGTAGGGGGACGCCTTTACTTTTCTTTGAGAGTCTATAGGACTTTAGGAAAATTCCATTCT
TTCTTTCTTTCGTGCTATTACTTTTATCCAATTGATATCTAGGTGATACAAATTGGTATATGATCATCTTCACTCTATTTCGCAGATGGTTAGAAATAGA
GCAACAACTGTGCCAACACCAACACCGGCGAGACAAGATGCGTCTGAGCCAGCCACTGGGGTTGTAGCTCGAAGAGGAGTAGTGGCAAGAGGTCGCGGTA
GAGGTCGCGGGAGGACGTCCTCTAGAGGAAGAGGACAAACACCTGGCCCATATGGTACTAGGGCGGTGACTCCTCCACCGAATGAGGAAGTAGTAAGAGA
GGGTGAGGAAGGGGAGAATGAACAAGTGCAGAATGAGGAATTACCACCCCAACCAACCCAGAGATGATTAATCAGGTTCTTGCTTATCTTAGCGGGTTAT
CTGATCAAGGCCAGACACCTCCAGTGTTTTCTGCACCAGCACCTCAGGTTCCGGGAGTACAACATGCAGCTGCTGTGGCTTCCCGCATGGATGCCTCATT
GGAAATAGACACATTTCCTCGGTTGACTACATGGCCTATAATGACAAGGGATCAGCATGAACTTTTCAGTAAGTTCTTGAAATTGAAACCTCTAGTCTTC
AAGGGTGCTGAATCTAAGGATGCCTATGATTTTCTGGTTGATCGTCATGAGCTACTACACAAGATGGGTATAGTAGAACGATCTGGCGTCGAGTTTGTAA
CCTATCAATTTCAAGGGAACACCAAAATGTGGTGGCGATTGTATGTTAAGTGTCAACCAGCACAAGCACCACCTATGACTTGGGCATCATTCTATAGCTT
GTTTATGGAGAAGTATATACCCCGGACCTTGAGGGATAGGAGGAGAGATGAATTCTTGAGCCTAGAGCAAGACAGGATGTCGGTTACTGCATATGAGGCT
AAGTTTTGTGCATTATCTAGGTATGCCACCCAGCTTTGCTTCAGTCCACAAGAGCGGATTGGCCGTTTTGTGAAGGGATTGAGGTCAGATTTGCAGATTC
TAGCCTTACAGGTATCTACAGCAGCAAAATCCTTTCAGGAAGTGGTAGACATTGTGATAGAGGTGGAGGCAGTGAAGCCAGATAACTTCACCATGGCATC
AGCATCTAAGAAGTTTCGTAAGGGAGGTGAATTTAATGGTTCTTACTCCAGAGGACAGGGTGCAGGAGGTTACCCAGCCCGACCTATTCAGTCTTCACTG
CAGGCTGTAGCTGGGGGTCCACCGCAGACCAGTCAACATTTATCTGAGTTTGGAGGTTATCCCTAGACTCCGTCGTTCTCACAAAGACCTATGCTTGAAC
CCATAGAGTGTTATGGTTGTGGGGAAATTGGACATATTAAGAGATATTGTCCAAAACAGAGTTACAGACCCCCAATAGTCAGAGGCAGAGGTGGTCATGG
AAGAGTCCTCTATTCTGGAGAACGTGGTGGCCGAGGTAATGGTGGTCACCAAATCAATCGGGGTGGCGGGCAAACTGGAACTTCTGCAGCATAACATGGT
AGGGGCAAAAGACAGACAGGTGATAGGGACCATTGTTATGTTTTCCCTGGGAGGTCCGAAGTGGAGACATCTGATGTTGTTATCACAGGTAATCTTTTGG
TTTGTGATTGCATGGCTTCTGTATTGTTTGATCCTGGATCCACATTTTCTTATGTATCTTCCTCATTAGCTACTGGTTTTGATTTACATTGTGATTTGCT
TGACATGCCTATTCATGTTGCTACTCCGGTGGGTGAGTCTGTGATAGTTGAAAAGGTGTATAGGTCTTGTCTTGTGACTTTTGTGGGGAGAAATACTCAT
GTAGACTTGGTTTTCCTAAAAATGGTTGACTTCGATGTAATTCTGGGTATGACTTGGCTTTCTCCTAATTTTGCAATCTTAGATTGTAATGCTAAAATTG
TAACGTTGGCCAAGCCTGGGACACATCCGTTAGTCTGGGAGGGTGACTACACTTCCACTACAGTTCGTATTATCTCCTTTCTTCATGCCAAAAGAATGGT
TAGTAAGGGTTGTTTAGCTTTTTTGGCACACCTCAGGGATGATACTACTCAAGTACCTTAAATTGAGTCAGTTTCGATAGTCCGTGATTTTCTGGATGTG
TTTCTTGCAGACCTTCCTGGTATGCCACCGGATAGAGATGTTGATTTCTGTATTGATCTGGAGCCGGGTACTCGTCCCATTTCCATACCCCCTTACAGGA
TGGCTCCCGCTGAGTTAAGAGAGTTAAAGGCCCAACTTCAAGAGTTGGTAAGCAAAGAATTTATTAGACCAAGTGCATCCCCTTGGGGTGCTCCTGTTTT
GTTTGTGAAGAAAAAGATGGAAGTTTTCGGATGTGCATAGACTACAGACAACTGAATAAGGTAACTATTAAGAACATGTATCCTCTTCCTCGCATCGATG
ATTTGTTTGATCAGTTACAAGGTGCTTGTACCTTCTCAAAAATTGATTTGACATCTGGTTATCATCAATAGAAAATACGGGCAATGGATGGACATTATGA
GTTCTTAGAAATGTCTTTTGGGCTTACGAATGCCCATGCTGCATTCATGAGCTTGTTGAACGGGATTTTTAATCCCTATCTGGATCTCTTTGTCATTGTA
TCCATTGATGATATATTGGTATACTCAAATACCAGGAAAGAACATGAAGAGCACTTGAGAATTGTATTGGAAATATTGAGGGAGAAAAAGCTTTATGCCA
AATTCTCCAAGTGTGAGTTTTGGATAGATTCAGTGTCCTTCTTGGGACATGTGGTTTCTAAGGATGGAGTGATGGTGGATCCTTCTAAGATCGAAGCAGT
GAAGAGTTGGGTGAGACCTACTAATGTTACAGAGGTAAGAAGCTTCGTTGGTTTAGCTAGCTACTACCGTCGATTTGTCAAGGGATTTTCCTCTGTTGCT
TCCCAATTGACAAACTTGACTAAACAGAGTGTTCCATTTGTATGGTCGGACGAGTATGAAGAACACTTTCAGAAGCTCAAGACTTTGTTAACTACTGCAC
CAATTCTCACCTTGCCAGTGAAAGGAAAGAAGTTCATTGTTTATTGTGATGCATCCTTTTCTGGTTTGGGTGCAGTGCTAATGCAAGAGAAGAATGTAAT
TGCTTACGCTTCGAGGCAATTAAAGGTGCATGAACGTAATTATCCGACCCACGATTTGGATTTGGCTGCGGTTGTGTTTGCATTAAAGCAATGGAGGCCC
TACCTATACGGGGTTAAGTGTGAAGTTTATACAGATCATCGTAGTTTACAGTATGACTTACTCAGAAAGATTTGAATTTGAGACAGAGGAGGTGGATGGA
ACTACTGAAGGACTATGATATCACCATCTTGTATCATCCGGGAAAAGCTAATGTTGTGGCAGATGCTTTAAGTAGAAAGGCAGGGAGCATGGGAAGTCTA
GCTCACTTGCAGGTTTCCATACACCCATTGGCTAGAGAGGTTCAGACTCTGGCTAATGACTTTATGAGGATGGAAGTACTAGGAAGGGAGGATTTTTGGC
CTGTGTGGAGGCAAGATCTTCCTTTCTTGACAAGATTAAGGGAAAGCAGTTTACTGATGAGAAACTAATATGGATTCGAGATAAGGTATTGCGAGGAGAG
GCTAAAGAAGCAAAAATCGATGAGGAAGATGTTTTGAGAATTAAGGAAAAAGTATGTGTACCCCGCGTCGATGATTTGATTCACACTATTCTTACAGAGG
CTCATAGTTCAAGGTATTCTATACATCCTGGTGCAACCAAGATGTATCGTGACTTAAAACAACATTTTTGGTGGAGTAGGATGAAGCGTGACATTGTGGA
TTTTGTTGCTCAATGCCCGAATTGTTAGCAGGTAAAGTATGAACACCAGAGGCCTGGAGGGACACTTCAGAGAATGTCCATTGCTGAATGGAAGTGGGAG
AGAATTGCAATGGACTTCGTGGTTGGTCTCCCAAAGACATTGGGTAAGTTTGATTCTATTTGGGTAATTGTTGACAGATTAACTAAGTCTGCTCATTTCA
TTCCGGTCAAGGTGACTTACAATGCAGAGAAGTTAGCCAAACTTTATATCTCAGAGATTGTTCGATTGCATGGAGTTCCACTTTCCATCATATCAGATAG
AGGTACGCAGTTTACTTCTAAGTTTTGGAGAACATTGCATGCTGAATTAGGTACTAGGTTGGACCTTAGTGCTGCATTTCACCCTCAGATCGATGGTCAG
TCTGAGCGAACGATTCAGGTGTTGGAAGATGTGCTTCTTGCATATGTGATAGAATTTGGTGGTCATTGGGATAACTTCATACCCCTAGAAAAGTTCACAT
ACAACAATAGCTATCACTCAAGTATTGATATGGCCCCATTTAAGGAACTGTATGGGAGAAGATGTAGGTCTCCCATTGGGTGGTTTGATGCATTTGAGGT
TAGACCTTGGGGTACTGACCTTCTGAGGGAATCGTTAGATAAAGTGAAATGCATTCAGGAAAAGCTTCTAGCGGCACAAAGTAGGAAGGAAGAATATGCA
GATCGAAAGGTTAGAGACTTGGAGTTTACGGAGGGTGAGCAAGTTTTGCTGAAGGTTTCACCCATGAAAGGGGTGATGCGGTTTGGTAAGCGAGGTAAGC
TTAGTCCAAGGTTTATTGGTCCATTTGACGTTCTGAAGCGCGTGGGGGAGGTAACTTATGAATTAGCCTTGCCCCCAGGGCTGTCAGGAGTGCACCCGGT
ATTTCGTGTGTCTATGTTGAAAAGATACCATGGGGATGGAAACTACATCAATCGTTCTGATTCAGTTCTTCTTGATGAGAATTTGTCTTATGAGGATGAC
CCTGTTGCTATCTTAGATAGAGATGTCCGCAAGTTCAGGTCAAGGGAGATTGCATCTATCAAAGTTCAATGGAAGAATCGGCTAGTTGAAGAGTCCACTT
GGGAGAAGGAGGCTGATATGCAAGAAAGATACCCACATCTCTTTACAGACTCAGGTCCTCCTTTTCGTCCTTGTTTTTCTTCTTGTGATCGTTCGAGGAT
GAACGATGGGTAAATTGGTATCTATTGTAACGACCCATTTAGTCGTTTTGAGCAGTAGAGTTTACTTCTGGTAATAACTGTCTGGGTCGACGGATCCCAC
CATGGACTGTCGATGGGGTCTCGTTCCAAAACACTTAGATTTTGAAAAATTGGGTACTGAGAACAACTCTCTGAACTTCGAGACGGAAGAGCAGGATGGA
CCATCGTAGGCACGACTGACCGTCACAGACTCCTTAACAAATAGAGTCTCTAAACTTTGTGACAGAAGTAGAAGGACAGACCGTCGCAGGCACGACGGGC
CGTCACAGGCTGTGTAACCCTGACTGGGTCGAATTTCTGTTAAATTTTTTAAGGGGCGTTTTGGACTATTCCTGCTTATAATCATAAAGTTAGTTGTTTA
ATGTTAATAATTCAATTACTTGGGGGTTAAATGAGATAACCTTGAATTAGTTAGTGGGTTACTTTTACCATCGTTTATACTTAATTATATGATAATTAGG
GTAAAAGGAAAGAGTTGGAATAAGGAAAAATAGAAAGAACAGAGAGAAGAGGGGAGAATAAACGAGAGAGGGAGAAACGAAGAGGAAAGCAAAGCATTGG
AGAAGTAGATTTCTTGATCACGATTCTTCGGTGGAGGTAGGTTATGGTTTATGCTATTTCATAGTAAACTCTTAATAGAGAATGATATGTATTGGTAGTA
TTGTAAAGTCTTGTATATGCTTAATTGTATGCTTGCATGATGTGATTATGTGATTGTAATGGGTTGGAAAGATGAGGTTGTGAAGCTTAAACCTAAAACC
CTCTCTGTTAATGATGATTCCTTTGTATAAAAGAAGACTTGATGAACTAAAAGAATGAGGTTAATGGATCGGGTGTCACGTTTCGACACCAGGATAGTAT
TAGTGGATCGGGTGTCACATTCCGACACCAGGATAGTATTAGTGGATCGGGTGTCACGTTCCGACACCAGGATAGTAGTAGTTGATCGGGTGTCACGTTC
CGACACCAGGATAGTAGTAGTGGATCGGGTGTCACGTTCCGACACCAGGATAGTAGGGGATCGGAGTGTCACGTTCTGACACCAGGATAGTATGAGGAGA
ATCGGAGTGTCACGTTCCGACACCAGGATAGTAAAAAGAATGAATCTTGAATTATGTTAATATACTCAATTTAAAGAACCTAATTCCTAAATGAGTATGG
TGTGGAGGCTTGAGTCCTCATAGATGTGCTTGGGTTTTGGCCAATGAATATGGTACTTGTTGTTGTTACCTGTTAAGTGTTATGGTTGATTTTATGTTAT
TATCTGATAGATATTGCTTTCTATTTTGAGTTGACCGATGATACCTACTCAGTACTTGTGACTTGTACTGACCCCTACTTGTAATTTTCTTCTTTGTTAT
TTGTGGAGTGCAGCAAACGTGCCATCGACTTCAACTCGTCCTCAACTCTAGCCAGTCTTCATCACGTCAGACTTCAGGGTGAGCTATTGTTCCTAGATCG
GACTGGATTAATTCCTTCGCGTCTTGATGTCTTGAAGTTCGGACATGGACCATCTCTTTTACTTATTTTAGCTTCTTAGATACTCTTAGATTTAGTAATT
TGAGGATAGATGTTCTTGTGATGATGACTTCCATATTTTGGGGATAATTATAAGTTTTGAATTTTAGAAGTTATTAATTGATTTCGTTAATGAGTTTTAA
GTCTTCCGCATTATATTCTGTTTATTATGTTTGAAATGTTGGGATATAGATTGGTTGGTTCGCTCACATAGGAGGGTAAGTGTGGGTGCCACTCGCGGCC
CGTTTTGGGTCTTGACAAACAACAAGTTTGTATTTATTTTTTATTAAGTTTTCATCATAATTGTATGCCATCAACTTTTATATTTTATGTGTTCACTTTA
CAATTCAAATTAAAATTGAATATCATATTGTAGTGGGTATTTTATTGTGATCATTTTGTATTTAACTCTCACATTGTATTCAGAATAAGTTTGTATTTTT
TTGTGTTCATCATAATGATATATCTACAAAGTCAACTTTGTATTCCAAATGATGTGAGTATTTATTTTGCTCATTTCGTATTTTAGTCTCAATTTCAATG
ACAACAAGTCTGTATTTCTTTTTATTATATTTTTCGTCATAATTGTATATCAACAATTTTTGTATTTTATGTGCTCACTTTACCATTTAAATTAAAATCG
GTGTTTTACTTTGATAGTGAAACTAAAATTGTATCCAGTGATCAAAACTGTATTACATAACTGCCAAATATATTTTTCTTTTATTTGTATTACAAAAATT
TTACGGATTGTATTCCAGTATAATCTAATCATTACATATGAATACGATTAAAGAAAGATACATGATTCAAGAAAAAAAATAGAGTACATAATTAAAATAC
TACATTTTATTGATGTTGATAAAATATTCTAAAAAATACAAATTTAAAAAATGCAATTTAATCAAATTCATTTCAACAGAAATTGAGTATTAGCAATAAA
AATTCAATTATACTTGTGTATTGTGAGAACTTTCATAAATTAACTAGATTATCACTTCAAAAAGCAATTTTCACAAGATATGTAAATTATAATGTACTAT
TCCATAACTTCTCAATAAAAGATTCTACCATAAATAGCCTCTATAAATCTCAAAGTATGAGTAAGATCTACATGCATTATATCTACTCAGCTTAACTTGT
TGAATTATACTTAATATCTTATTGTTGTTGATAATGATCATTTCTAAATTATGGACACAATAATTTTTTCATATATATATGAACTTTTTGTCCACATGAC
CTCAAATGTTTTCTAAAAGAACCTATAACATGTCCATTTGGAAATGGTAGGTTAATTGAATCAATAAACAAGACAACATTGAAATGTGGTTTTCACTTCT
CTAAACATGTATTTTGTGTAATTGCTTGATCATTAATATGTTATTAGTTATTGAAATTTTTTAATATCATAAGTCACTTATAATGTTATTATTTTACTTT
TAACTTTTATTGAACAAAGATTTTCCTTTCCAATTACCTTTTTTTTGTAGATATTGACACATTTTAATACTAATAAAGGTTGATATTTTTTATTTTTAGA
CAAGCTTACTCAAACTGAATATGAAAAACATGCTGCATTATTTTTGAAATATTATAACCAATCTTCAAAAAATGTCAATGAAGCTTTCAAAATGAGTTTA
TTATACGTACCATGTGCATAAAAAGAATGCAGGTTTCATAGCACTCTAATAAGGATTGCAGCATTTATCATGATTCTTTGGGTCATGCACGTTGAAAATA
TTTTGATAGTCCTTTTGACAAATATGTTTCTTTTCGCGCTTTGTTTTTTAAATATTATATTTTATATGCAAGTTGTAATTTTCAATTAGTTGTTCATATT
AAATTAATTCCCTTCTAATAGAACGATTTAACTTTCATAAGGAATGTAGTTATTAAGATCAATTACTAATAGTAAACGATCATAATAATATATTAAAATC
ATATAAATCATATGGATAAACTAGAACATAACTCGTTTTAAGATAAACTAACAAATTTGAAAATAACTTGCATGTTTAAGAAAAATATTTTAAAAACAAG
CATGAAAATAAAACATACATGCCAAAATAAATATCAATACACGTCTAATGCACATAAGCCAATAAATCATGTTACATTCTATATTCCTCCTTGGAACATT
AATAAATGTACATTTTTTTTACACTTGATACATGCGATAAATTTATCATGATGACCAAATTTATGTGATCCACGTACTTATTTGAAGACTTATTATAATT
TCTCAGTAGTATATAGTGTATACCACCAAAACTCTGTAACCATAAATAATGATTCAAATATTTTTATTTCGTTTTATCGAAGACTCTCTCTTTTCATATT
GCTGGAGTATGCTTGTCTAATAATAAAAAATAATCTTTTTATTAATACTTAAATATTAATTCATTTATCAAATAAGTTAATAAAAATGAATATATTTTTA
TTATAAAAAAATACAAGTACAATAATAACATTCTAAATGACTCAACGATAAAAAGAGAGACTATGATTTTAAATGATTTTAGTTGGTAAAAGTATATTAA
TGATTAATTGATTACACCATAATACATATATTTTAAGAAGGTAAACTTAGAAGTGGATGTAGACTTATGTCCTTGTTCAATTAAATCTGCCATTTTCTAA
ATGTACATGTTGCAGGTTCTTTGAGAAAAAAACTTGAGGTCTTACCTAATGTTGTTGTTGTTGATAATGATAATTTCTGATGGACAAATTAATTTCTATC
ATATATGTGAACATATTGTCCACACAACCTTGAAAGTTTTCTTAAAAAGCACATACCATGTCTTTTTGAAAAATAGTAGGTTGATTGAATCAGTAAAAAA
GACAACATTGGCATGTGGTTCTAATTTCTCTAAACATACATTTTGTGTAATTGCTTGATCATTAGTATGTTACTCCTTAGGTACTGAAATTTTTTAATAT
TGTATTACTTTTTTTCTTATCACGAGTCACTTATAATGTTATTATTTTACTTGTACTTTTTATGAAACAAAGATTTTCCTTTCTAATTACCTTCTTTGGT
ATATATTGCCACTTGTTGATAGTAATAAAGGTTGATTGTTTTTATTGTTTAACAAGATTATTCAAGCTGAATATGAGAAACATATTGAAAGAGAGTCCTG
GAAATAGAAGAATATATCTGAATATTTGTTTAGAATAGAAAGTTTCAATGATAAAGACAACACTATATATATTATAACCAATTTTAAAAAAATGCCAATT
TAGCTTTCAAAATAAATTTATTATATGTTCCATGTGAAAAAAAAGAATGCAGGTTCTATAACACTCTAACGAGGATCGCAGGATCTATCATGATTTTTTG
GCTTATGTACGTTGAAAATGTTTTGATATTCTTTTTGACAAGTAGGTTTTCTTTTCATGCTTCATTTTTTGAATACTATATTTTTCATATGAAGCTTTAG
TTTTCAATTTATTGTTCAAATTAAACGGAATCTCTTCTAATTGATCAATTTGATTTTCATAAATGAAAAGTTGTTATTAGAATCAATTACTAGTAGTAAA
TGATCTTAATAATATATTAAAATTATACAAACCATATTGATCGACTAAAAGAGAACTACTTTTAAGATAAACAACTAATTTGAAAATAACTTGCATGCAT
TAATTAAAATATAAAAAAAAATAAAGTATGAAAATAAAACATACGTGCCAAAATAAATATCGACGCACTTTCAATGCCATAAGCCAATATATCATAGTAC
CTCCCTCCTTAGACCGTAATGAGTGTTTCATTCTTTTTTTGTACTTGACACGTATTACAATGTCACGATCCAAATCCGGGCCGCGACTGGCACCTACACT
TACCCTCCTATGTGAGCGAACCAACCAATCTAAACCTTAACATTTCAATATAATATAAACAGAAAGTAATGCGGAAGACTTAAACTCATAAATAAAATCA
ATAACTATCATTATCCCCAAAATCTGGAAGTCATCACCACAAGAACATCTACGATTAAATGACTAAACTAAGAGTATTCTAAAAGCTAAAAATACATAAG
AAGCTAGTCCATGCCAGAAGTTCAAGGCATCAAGACTTGAAGAAGAAGATCCATTCCAAGCTAGAAGCATTAGCTCACCCTGAATTTCCGGTGTAGTAAG
ACTGGCTTGAATTACTGTTGAGTCGAAGGCGACAGCACGTTTGCTGCACTCCACAAATAAACAAGAAGAAAACATAAAAGTAGGGGTCAGTACAAAACAC
GGGTACTGAGTAGATATCATCGGCCAACTCAAAATAGAAAACATTATATATCAGATAATATCATAAAATCAACTAATATCCTTAGCATGCAGCATTTACA
ATTACCATAGCTCTTGGTTTCAACACCAAGCTCATCGATGAGGACTCACGCCTCCTCATCATACTCATTTGGGAATTAGGATCATTAGATTGAATATATT
AACATCTTTCAAGATTCTTTATCTTTATTCCCCTCGTGTCGGTACGTGACACTCCGATCCTCATATACTATCCTGGTACCGGAACGTGGCACCCGATCCA
TATTCTATCCTGGTGTCGGAACGTGACACCCGATTCATATTCTATCCTGGTACCGGAACGTGGCACCCGATCCATATTCTATCCTGGTGTCGGAACGTTA
TACTCCGATCCTCATATACTATCATGGTACCGGAACGTGGCACCCGATCCATATTCTATCCTGCTACAGAAACGTGGCACTCCGATACTCATATACTATC
CTGGTACCGGAACGTGGCACCCGATCCCCTAATCTCACTACTTTCATTCATCAAGCCTTCTTTTATACCAATGCATCATCATTAACAAAGTAGATTAAGG
TTTCTTTTCAAGATTTGGGATTCAATAGCTTCATCATGCTTATTTATTCATAATTACATAATCACATCATTCATGCAAGCATACAATTAAGCATATAGAA
GGTTCACAATACTACTAACACATATCATTCGCTATTAAGAGTTTACTACGAATAGCATGAAAACCATAACCTACCTCCACCGAAGATTAGTGATCAAGCA
AGAAAATTTTCTCCAAAGCTTTGTGTTTCCCCTTCTCGATCGTCTCTCTCTCTATCGATTCCCTTCACTCTCTTTCTGTTCTTTTCTTTTTCTTATTCCA
ACCCTCTTTCTTTTTCCCTAATTAAAATATAATTAAGAATAAAAAATGGCAATAATGCCCCACTAATTAACTTAAGGTTACCTCTTTTAACCCCCAAGTA
ATTAGATTTATTAACATTAACCCACTAACTTTATAATTAAGGCAAGAATAGCCAAAAAACGTCCCTTAAAACGTATCAAGAAATCCGACCCAGACTGGAA
TTGCGCAGTCTGTGACGGCCCGTCGCGCCTGCGACGGTCCGTCGTGCTGCCCGTCACAGAGTTCAGAGACTCAATTTCTCTGAAGGGTCTGTGACGGTCC
GTTACACCTGTGATGGTCCGTCCTGCCATTCCGTCACGAAGTTCAGAGAGTCGATTTTCAGTACCCAATTTCAGATTTTCTAAGTGTTTTGAAACGAGAC
CCTGCGACGGTCCGTTGTGCCCATGACGGTCCGTTGTGGGGTCCGTCGTTTCTGCCAGTTTCTCCAAAATTGAAGTCTGCTGCTCAAAACGACTAAACAG
GTCGTTACAATAGATACCAATTTACCCATTTTTCGTCCCTGAACGAACACAAGAAGGAAAACAAGGGCGAAGAGTAGTACCTGAATCTGAAAAACAGATG
TGGGTATCTTTCTCGCATATCTGCCTCCTTCTCCCAAGTGGCTTCTTCAACGGGTCGATTCGTCCATTGAACTTTGATGGATGCAATCTCCCTTGATCTC
AACTTGCGAATTTCCCTATCTAGAATGGCAACAGGTTCCTCCTCATAAGACAAATTCTCATCAAGCAAAACTGAATCCCAACGGATAATGTAGTTTCCAT
CCCCATGGTATCTTTTCAACATCGACACATGGAATACCGGATGTACCCCGGACAGCCCTGGAGGCAAGGCTAACTCATAAGCCACCTCCCCTATGCGCTT
CAGAACCTCGAAGGGACCAATATACCTTAAGCTTAATTTACCCCTTTTACCAAAACACATCACCCCTTTCATTGGCGAGACTTTTAGTAAGACTTGTTCA
CCCTCCATGAACTCCAAGTCTCTAACCTTCCGATCTGCATATTCTTTTTGTCTACTTTTCGCCGCTAGAAGCTTTTCTTGAATAGATTTCACCTTCTCCA
TCGAATCCCTCAAAAGATCAGTACCCCAAGGTCTAACCTTGAACGCATCAAACCAACCAATGGGGGACCTACATCTCCTACCATACAATGCTTCAAATGG
AGCCACATCAATGCTTGAGTGATAGCTATTGTTGTATGAAAATTCCGCTAAGGGTAACAAGCTATCCCAATGGCCACCACACTCTATCACACATACGCGA
AGCATATCCTCCAACACTTGAATCGTTCGCTCAGACTGACCATCGGTCTGAGGATGGAACGCGGTACTAAGATCCAACCTAGTACCCAATTCCGCATGCA
GTGTTTTCCAAAACATAGAAGTAAACTGCGTACCTCTATCTGATATAATGGAGAGTGGAACCCCATGCAATCGCACCACTTCCGAGATGTAAAGTTTGGC
TAACTTCTCTACATTGTAAGTCACCTTGACCGGAATGAAATGAGCAGACTTAGTTAACCTATCAACAATCACCCAGATGGAATCGTACTTACCCATTATC
TTTGGAAGACCAACCACGAAGTCCATTGCGATTCTCTCCCATTTCCATTCCGGAATGGGCATTTTCTGAAGTTTTCCTCCGGGCCTTTGGTGTTCATACT
TTACTTGTCGACAGTTTGGACATTTGGCAATAAAGTCCACAATGTCACGCTTCATTCTACTCCACCAAAAGTGTTGCTTTAGGTTACGGTACATCTTGGT
TGCACCCGGATGTATCGAATACCTTGAACTATGAGCCTCTGTCAGAATAGTGTTGATCAAATCATCGACGCGGGGTACGCATACCCTTCCCTTGATCCTC
AAAACACCTTCCTCATCGATTTGTGCTTCCTCAGCCTCTCCTCGCAATACCTTATCTTGAATTCTGCGCAGTTTCTCATCATCAGACTGTCTTCTCTTAA
TCTTGTCAAGAAAGGAAGATCTTGCCTCCACAGAAGCCAACAATCCTCCCTTCTCGTTTACTTCTAATCTCATCAAGTCAATAGCTAGAGTCTGAACCTC
TCTAGCCAATGGGCGTCTAGAAGCTTGCAAGTGAGCTAGACTTCCCATGCTCCCCGCCTTTCTACTTAAAGCATCCGCTACAACATTCGCCTTTCCCGGA
TGATACAAGATAGTGATATCGTAGTCCTTTAGTAGCTCCATCCATCTCCTTTGTCTCAAGTTCAAATCCTTCTGAGTAAAGACATACTGAAGGCTACGAT
GATCCGTGTAAACCTCACATTTAACCCCATATAAATAGTGTCTCCATTGCTTTAATGCAAACACTACCGCGGCCAATTCCAAATCATGAGTTGGATAGTT
ACGTTCATGCACTTTTAATTGTCTTGAAGCATAAACAATCGCATTCTTCTCTTGCATTAGCACGGCACCCAAACCCGAATAGGATGCATCACAATAGACA
ATGAAATTCTTACCCTCCACTGGCAAGGTGAGAATTGGTGCAGTAGTTAACAGAGTCTTGAGCTTCTGAAAGCTTTCTTCACACTCGTTCGACCATACAA
ATGGAACATTCTTCTTAGTCAAGTTCGTCAGTTGGGAAGCAATAGAAGAGAATCCCCTGACAAATCGGCGGTAGTAGCTAGCTAACCCAACAAAGCTCCT
TATTTCTGACACATTAGTAGGTCTTACCCAATTCTTCCCTCTCTCGATTTTAGAAAGATCCACCATCACTCCATCCTATGAAACCACGTGCCTCAAGAAG
GACACTACATCTAGCCAAAACTCACACTTAGAGAACTTGGCATAAAGCTTTTTCTCCCTCAACATGTCCAATACCATTCTCAAATGCTCCTCATGTTGTT
TCTTGCTCTTTGAGTATATCAGTATATCATCAATAAATACGATCACAAAGAGGTCCAAATATGGCTTAAAAATCCCGTTCATCAAGCTCATGAACGCAAC
AGGGGCATTCGTAAGACCAAAAGACATCACTACAAATTCGTAATGCCCATACCTCGTTCGAAAAGCAGTCTTTGGCACATCCGTTGCCCGTATTTTCAAT
TGATGATAACCGGATCTCAAGTCAATATTGGAGAAGACACAAGCACCTTGTAACTGATCGAACAAGTCATCAATGCGAGGAAGAGGGTACTTGTTCTTTA
TGGTTACCTTGTTCAATTGCCGGTAGTCTATGCACATCCGAAAACTCCCATCCTTCTTCTTCACAAACAAAACCGGAGCACCCCAAGGGGATGCACTTGG
TCTAATGAAGCCTTTGTTTAACAACTCTTGAAGTTGGGCTTTTAACTCTCTTAACTCGGCGGGAGCCATTCTATAAGGGGGTATAGAAATGGGGCGAGTA
CCCGGTTCAAGGTCAATACAGAAATCAATATCCCTATCTGGTGGCATACCAGGAAGGTCTACAGGGAACACATCCCGAAACTCACGGACCACCGAAACCG
ACTCAATCGAAGGTACTTGGGTAGTGTCATCCTTGAGATGTGCCAAGAAAGCTAAACACCCTTTACTAACCATTTTCTTAGCACGGAGAAAGGAGATGAT
ACGCACCGGATTGGAAGTGTAGTCACCCTCCCACACTAACGGATCTGTCCCAGGCTTGGCTAACGTCACCGTTTTAGCATTACAATCCAAGATCGCAAAT
TGCGGAGAAAGCCAAGTCATACCCAGAATTACATCAAAATCATCCATTTCTAAGATAACCAAATCTACATAGTTGTTGCTCCCCACAAAGTTCACCAAAA
AGGACCTATATACCTTTTCAACTACCAAAGACTCACCCACCGGAGTAGAAACACGAATAGGCATATCAAGTAATTCACAATGTAAATTTAGACCATAAGC
AAATGAGGAAGATACATAAGAAAATGTGGATCAAGGATCAAACAATACAGAAGCCATGCAATCACAAACCAGAAGATTACCTGTGATGACAGCATCAGAT
GCCTCCGCTTCAGATCTCCCAGGGAAAGCGTAGCAATGGGCCCTCTCACCCGTCAGGCCGTTGCCCCTACCATGTTGTGATGTAGTGGCTACAGGTTGCC
CATCACCTCAGCCGTTCTGGTGGCCACCATTACCTCGGCCACCACGTCCTCCAGAATAACGGCCTCTACCATGATCACCTCTACCTCTAACATTTAGAGG
TTTGTAACTCTGTTTTGGACAATATATCTTAATATGTCCAATCTCCCCACATCCATAGCACTCTCTGGGTTCATGCATAGGTCTCTCAGAGAAGTGTTGA
CCGGTCGGAGGTGGACCCCCAACTACAGTCTGTAGTGAAGACTGAATGGGTCGAACTGCGTAACCTCCGGAACCCTGTCCTCTAGAGTAAGAACCATCAA
ACTCACCTCCCTTTACTCACCTCTTTGATGTCGATGCCATGGTGAATTCATCTGGCTTCACTCCTTCCACCTCTACCACGAAATCTACCACTTCTTGGAA
GGATTTTGCCGTAGCCGCTACCTGTAAGGCTGAAATCCGCAACTCTGACCTCAACCCCTTCACAAAACGACGAATCCGCTCTTGTGGACTGAAACAATGT
TGGGTGGCATATTTGGATAGTGCACAGAACTTAGCCTCATATGCATTGACCGACATCCTACCTTGCTCTAGGCTCAAGAACTCATCCCTTTTTCTATCCC
TCAACGTCCGGGGGATATACTTCTCCATAAACAAGTTAGAGAATGAGGCCCAAGTCATAGGTGGTGCCTCTGTTGGTTGACACTCAATATGCGACCGCCA
CCACATTTTGGCGTTCCCTTAAAACTGATAAGTCACAAACTCCACACCAAACCGTTCTACTATACCCATCTTGTGTAGTAGCTCATGACAGTCAACTAGA
AAATCATAAGCATCCTCCGATTCAGCACCCTTGAAGACCGGAGGTTTCAATTTCAAGAACTTACTGAAAAGTTCATGCTGATCATTTGTCATTATAGGCT
CAGTAGTCAGACGTAGAAATGTGCCTATGTCCAATGAGGCATCCATACGAGGAGCCATAGTGGCTGCATGTTGTACTTCTGAAACCGTAGGTGTTGGCGC
AGAAAACACTGGAGGTGCCTGACCTTGATCAGACAACCCACTGAGATAGGCGAGAACCTGATTGATCATCTCTGGGGTAGGTTGGGGTGGCAATCCCTCA
TTCTGCACTTGTTCATTTTCCCCATCCTCCCCTTCTCTTATTACTTCCTCAGTCGGTGGAGGAGTCACTGCCCTAGTATCAGATGGGCTAGTTGCTCGTC
CTCTTCCCCTAGAGGACGTCCTCCCACGACCTCTACCACGGCCTCTTGCCGCTGCTCTATCTCGAGCTACAGCCCCAGTGGCTGGCTCAGACGCACCCTG
TCCCGTCGGTGCTGGTGTTGGTGTTGGCGTAGTCGTTGCTCTAGTTCTAACAATCTGCGAAAGAGAGTGAAGATGGTCAGATACCAATTCGTATCACCTA
GATACCAATTGGATTCAAGTAGTAGCACGAAAGAGAGAAAGAAAGAATGAAATTTTACTAAAGTCTTATAGCCTCTCAAAGAAAAGTAAAGGTGTCCCCC
TACCGTTCCTTAAGACTCTACTAGACTCGTTCTTGTGTGATAAGATTAACGAACCTAATGCTCTGATACCAAGTTTGTCACGACCAAAATCCGGGCCGCG
ACTAGCACCCACACTTACCCTCCTATGTGAGCGAACCAACCAATCTAAACCTTATCATTTCAATATAATATAAACAGAAAGTAATGCGGAAGACTTAAAC
TCATAAATAAAATCAATAACTATCATTATCCCCAAAATCTGGAAGTCATCACCACAAGAACATCTACGATCAAATGACTAAACTAAGAGTATTCTAAAAG
CTAAAAATACATAAGAAGCTAGTCCATGCCGGAAGTTCAAGGCATCAAGACTTGAAGAAGAAGATCCAGTCCAAGCTAGAAGCATTAGCTCACCCTGAAT
TTCCGGTGTAGTAAGACTGGCTTGAATTACTGTTGAGTCGAAGGCGACGGCACGTTTGCTGCACTCCACAAATAAACAAGAAGAAAACATAAAAGTAGGG
GTCAGTACAAAACACGGGTACTGAGTAGATATCATCGGCCAACTCAAAATAGAAAATAGTATATATCAGATAATATCATAAAATCAACTAATATCCGTAG
CATGCAGCATTTACAATTACCATAGCCCTTGGTTTCAACACAAAGCTCATCGATGAGGACTCACGCCTCCTCACCATACTCATTTGGGAATTAGGCTCAT
TAGATTGAATATATTAACATCTTTCAAGATTCTTTATCTTTATTCCCCTCGTGTCGGTACGTGACACTCCGATCCTCATATACTATCCTGGTACCGGAAC
GTGGCACCCGATCCATATTCTATCCTGGTGTCGGAACGTGACACCCGATCCATATTCTATCCTGCTACCATAACGTGGCACCCGATCCATATTCTATCCT
AGTACCGAAACGTGGCACCCGATCCATATTCTATCCTGGTGTCGGAACGTGACACTCCGATCTTCATATACTATCCTGGTACCGGAACGTGGCACCCGAT
CCATATTCTATCCTGGTACCGGAACGTGGCACTCCGATCCTCATATACTATCCTGGTACCGGAACGTGGCACCTGATCCCCTAATCTCACTACTTTCATT
TATCAAGCCTTCTTTTATACCAAGGCATCATCATTAACAAAGTAGATTAGGGTTTCTTTTCAAGATTTGGGATTCAATAGCTTCATCATGCTTATTTATT
CATAATTACATAATCACATCATTCATGCAAGCATACAATTAAGCATATAGAAGGTTCACAATACTACTAACACACACCATTCGCTATTAAGACTTTACTA
CGAATAGCATCAAAACCATAACCTACCTCCACCGAAGATTAGTGATCAAGCAAGCAAATTTTCTCCAAAGCTTTGTGTTTCCCCTTCTCGATCGTCTCTC
TCTCTATCGATTCCCTTCTCTCTCTTTCTGTTCTTTTCTTTTTCTTATTCCAACCCTCTTTCTTTTACCCTAATTAGTATATAATTAAGAATAAAAGATG
GCAATAATGCCCCACTAATTAACTTAAGGTTACCTCTTTTAACCCCCAAGTAATTAGAATTATTAACATTAACCCACTAACTTTATAATTAAGGCAAGAA
TATTCAAAAACGTCCCTTAAAACGTATCAAGAAATCCGAAGGGTCTGTGACGGTCCGTTACACCTGTGACGGTCCGTCCTGCCATTCTGTCACGAAGTTC
AGAGAGTCGATTTTTAGTACCCAATATCAGATTTTCTAAGTGTTTTGAAACGAGACCCTGCGACGGTCCGTCGTGCCCATGACGGTCCGTCGTAGGGTCC
ATCGTTTCTGCCTGTTTCTACAAAATTGAAGTCTGCTGCTCAAAACGACTAAACAGGTCGTTACGTACAATGACTTAATTTATGTGATTGACTGACTTAT
TTGAAGACTTGTTATAATGTCTTAAGAGTAGTGTATATCACCAAAACTTTGTAACCATAAAACAATGATTCAAATATTTATATTCCATTTTGTAAAGTAC
TCTCTTTCTTCATGTTGCCCAAGTAATCTTGTCTAATAACAGAAGATAATCCTTTTATTAGTATTAAATTATGGAGACATTTGCCAAATAATTTAATAAA
AATGATTATTACTTTATTTAATAAAAAATTACAAGTACTATAATAACATTCTAAATGACTCAATGAAGAAAAAAGAGAGTACTATTTTATTTCCTACTTT
ATTCAAATAAGGCAAAACTTCATGGCGATTCGAAAAATAATTAGTTAATTAAATTTTGAGAAATATAAATAATAAATAAATTTTAAAAGAAATCGCCATC
TAATTTTAATGAAACTAGAAAATCAATTATATGATTCCCGAAATATTAGATTCGAGATCATGTTATGTTGAAGGGAATGTGTTAAGCATTTTTCTAAATT
TTTTTACCGACCAACTTTGATCTATGAGATGACAACCATTACCTAAAATAACTCAAGCAACGATAATGCACTGAAAATATTACAGAAAGTAAATAGCTTT
AAACACAATATAATCCTAATTAAAGCAAAGTAGAATTAGAGCAATTAGAGAGTTACCAATCATAGAATAAATAATTTTTTTAACTAATACTTATATTAAT
CAAGGAAATAACACTTCAAAGAAATAAAAATTATTGAGAAGTAAACACTTACCAAGTCAAATCTTGAAGCGTGACTAGTGGTGAATGTTGTTGGTGGTAG
TAGGAATTTTCCGGTCAGATTTGGAAATCTTAAGCACGCCACCATGGTTCCTGGTTTGTTGAAGTGTCGTTGTTCGCCGGGATGGAGGGGAAAATGGTGT
GGGTTTGGTTCAGCTTGGAGCTTCGAGTATTATGGTGACCTGCAAAACAAGTAGAAAAACAAAAAATGAGGGAAAGGGGTAAGGGGTCCGGACGATGGTC
ACTTATTTTTTATTAATCAGGTTCATCGAAGCTAAGAGCTCCTCGCCGGAGTTTGTGATGGAGGTCAATTTGGATCTGGTTGGGTTTGCTGCTGGTCAGA
GTTGCAGCAGCGTGTGGCATTTTGGTTCTTTCCGGTGGATTTTTGATTGTGGACCAAGGAAGAAGATGCCTGGTTTCTTGTTCGCTTCTGTCAGAGAGGA
AGAATAGTTGGTGTTCGGTTGGCGGCTGTGAGAGCTTATAGGAGGAGAGAAAAACTTAAATATTTCTCGCCACCCTTAGCATTTGACCTAATAGTTATTT
AAATAGTGAATTGTTATTTAATGGTCTCAAATTATGGGCTTGTAATTGTGATTCAAAATCATTGATTAATTTGTTAATGAAGTTTTAGACTGTGCAAAAT
ACCAAAATAAATAGTAACAAATATAACAAATAAAATGAAAATTCAAAAAAATATAATGAACCTAACTAATAAAGTGTAAAAATAAAATTTTAGAACTAAT
TAATAAAATATTCTAAATTTGATAAATAAGGATAGTTATCGATAAACTTATTTAAAATTATAAAAAAAACTATTTTAAACTATTCAATAAATAACATTTA
AAATTACGAAATTTGAAATGTTAGGTCAAAATTTAATGTCAACAATTACAATATTAAATCATTTCAATTGGTAAAAGCATACTAATGATAAGGTGATCAC
ACCAAAATACATGCTTTAAGAAGCTATACTCAAAGGTGGATATAGATTTATTTCCTTGTTCAATTGAACCTACCATTTTTCAAATGTACATGTTGCGGGT
TCTTTGAGTAAAAAATTTAGGTCCCAAGAGAAATATGTCACACATATATGACAAGAATTAAGAAATACGCCCTTTAGTACTTATTATTATCAATAATAGC
ATAATATACTCAGTGTAATTTTATATGTGAGGTCTAACATAATATAGTAGGTAGACCTTACATCTTTGGGAGATAGATAGTGAGTAGATCTCAATTGAGA
AATAACAAGTACTACATTAGTTCACTTCTCTTATGAAATTTTACTTCTAAAACAACAACCCAGTCAATTTGTGATAGTCATCACAATACATAAAATGAAA
ATGGATAAGAAAAATTAATGCTAGAAATTGAGATGTAATTGAAAGTCGTTGTATGCTAAATACAATATTAAAATTCACTATTTGAACACTAATATTTTCT
ATTGAAAACAATCAAAGGCTATTATAAAAAAATTCCTAATTTGATCAGTAAGGAAGAAAATTGTAATGCAAGTGGAAACAAAAGTTTTCCTTTAATATTA
GCTTCTTTCGTAAATATTTTCACATTTTAATTCTAATAAAAGTAGTGAAAAAAATCTAATAAAAGTGAATTTTTTTGTTGTTAGGCAGGCTTACTCTAAA
TGCATATGAAAAACACACTGGAAGAGAGTCGTGAAAATAGAAGAATAATATTTGAATCTTTAGGTTGGATTACAAAATTTTATTGGTAAACACTGTGTTA
CTAAATTTTTTTAATCGACCTTCAAGAATGTCAATATATGAATTTATCATGCATAGCAAGGGCAAAAAAGTGCAGGTTCCATTGCTACTCTAAGGAGGAT
TGCAGAATCTGTTATGATTCTTTGGCCTGTGCACATTGAAAGTGATTTGATACTCCTGTTGACAAGTATGTTTTCTTTTCTCACTTTATTTTTTTAATAC
TATTTTTCATATGCAAGCTATTACTTTTAATTGGTTATTCATATTAAATGGAATGTCTTTTATATGATCAATTTGACTTTCATACAAGTAAATGATCTTA
ACATTTTATTTAAATTATAAAATGGTATTGATCAACTAGAAGAAAACTCTTTTTAACGTAAATAACGAATTTGAAAATACTTGCATATGCAAAATATAAT
ATTAATAAAATTAAGCATGAATAAAAAATATTTTTGCCAAAATGAATATCAAGACACTTCTATGTGTATTAGCTAATACATCATGGTACATTTTGCATTC
CTTAGAGAATCAATGAATCTACATATTTTTGTTGCTCTTGATATATACGATAAATTAATCACAATGTCTAAATTTATGTGATCCATTGACATATTTAAAG
ATTTATTATAAAATTTGTGCAGTGTAGTATGTACCATCGAAATTTAATAATCATCAATAATATTCAAATAATTTTATTTTATTTTATGGAAGACTCTCTT
TCATCATGTTTCTCAAATTTAACCAGAGTAAACTTGTTCAATAATAAAGGATAATCTTTTACTTAACTATAAAGACATCTATCAAATACAATAAAAAAAC
ATATATTTTTCTGTTTCATAAAAAAAATCCTAAGAACAAGTACGATAATAACATTCTAAATGACTCAGAGATTAAAAAAAATAGTAAAATATGTAATTGT
TTCAATAGGTAAAAGCACACTAATGGTTAAGTGATTACACCAAAATGCATGTTTAAAGAAGCTATACTCGGAGGTGGATGTGTAGACTACTTTACTTGTT
CAATTGAACCAACCATTTTTCAAATGTACATATTGCAGGTTCTTTGAGAAAGAAATTGAGGTCCTAAGAACAAAATGTTACACATATATGACAATAATTA
ATAAAGGCAAAATACATATATTGAACCCTAAACTTGACTTCAAATTTTAACTTTGATCTCCAACTTTCATAATGCACAAACAGACACTTTAACTATCCAA
CTTTTAAATAAATAAACACATGACGCAATACACGTAGGACACCACATATGACAAAAAATGACATGTAAGACATATGTGTCTGTTTGTTCAACTTTATACA
AGTTTAAGTGTCTACTTATGCACATCCAAAGTTGAAGGGCATGAATATATTTCAAAACCAAGTTAAAAGACATATTTATGTATTATGCCATTAATAAATA
CGTCCATTAATACTTATTATTATACACAATACATTCAGTATGATTTTACAAGTGAAGTCTAACAGAATATAGTAGATAGACCTTACTTCTTTAGAAAGAT
AGGTAGATAGTCCAATAGATCTCAATTGAGAAATAATAACAATGTATTAGTTCACATCGTGTGAAATGTAACTTCTAAAACAACAATCTAGTCATTATAT
GAAAAGCATCACAATACATACTAGGAAAAGCATCACAATACATAAAATGCAATTAGATAAGAAAAATTAATGTTGTAATTGAGATGTAGTTGAAAGTTAT
TACATGCTAAATACACTATTGAATGTCACTATTTGGACTCAAAGAATTCTATTGAAAACTTTCCTAGGCTATTGTAAAAAAAATTCACTTTGAATAGTGA
AGAAAGGAAATAGTAATGCTTTCATGTGAAAAAATTAGGATGCTTTTCACTATTGATTGATTTTTTTCTCACATGCATTTTTTGATTAGCTACTTTTATG
GACATCAAGTGAAAAAATTAGGAATCTTCTCACTATTTAGTAATGATTTACTTTTTGCATGCATAATTTAAATCGAAAACGAGTGATCATGCCAACTGAT
ATTTATGTAGGAAATATGGAAGGAAAATAGTATCTTTAGAGAATGCTCAAGTTTATTATGGGCTACTTAAGATCACTTGAGATTATTACAATCATCAACT
ATATCACTTTTTTTAATACTCAAAATAGAAAATAAAAATTCTTTCACAAATAACTAAATACATGTATCACAATTTACTAGATACATGTCTAAAGAGACTT
TTTGAAAAACTAAGAGATAATTTTGGAAGACTAAATATTGATGCATTAATTCCAACACAACCCCTTAATGCATTTGCCTGATAACTCCAATGTGTTCTCG
AAGATAGCAAAAAAAATCTAGAAAAGTTCTTCGGTGAAGATGACAGAAATTTGTTCTCCTGTCTTACAATAATGCAACGGAATTTCGCCTTTCTCTTTTG
CTTCTCGGATAAAATGATACTGTATGGAAATATGCTTCGATCTTTCATGGCTGACTGGATTCTTGGCAATTGCAATTGTTGATTTGTTATCATTATACAA
AACAATTCCTCTATTTTGTTTTTTTACCAATGTCTTCAAATATTCTCCTAAGTCAAATAGCTAGGGAAGTATCCTTGGATGCTGAAACATATTCTGTTTC
AACAGTGGATTCAGCAACAATACTTTGCTTTTTTGATAACTAAGAACAAATACTGATCCAAATAAGAAAGCATAACCAGAAGTACTCTTCATGTCATCTA
TAGTTCCAACCCAATCACTATCAGAATAAAAAATTAAGTTAAAATCTCCACCAAATTTGTACATTATCCCATAATCCATTGTTCCTTACAAGTAGCATAG
AACACGCTTTGCAGCTCTAAAATGCACTTAGCTTGGTTCTTACATTAATCTGGATAATAAACTAGCAGCAAACATAGTATCTAGACTTGTTTAAGTAAAA
TATATCGAACTTCCAATCAAGCTCCTATAAAGTGAGCTATTAACCTTCTTTTCTCCATCGTCTTTTCTAAACTTCTCATTTGCTGCTAATGTTATGGCTA
CAGACCTGGAATCCATCATTTTAAATTTTTGAAGAATACTTTTAGTATACTTCTTTTGAGAAATGAAAATTCCTTCTTTCACTTGAGAAACTTCGATGCC
CAAGAAATAATTTAGCAAACCAAGATCACTCATTTCATAAGCTTGCATCATATCTTGCTTGAAATTTTGCATCATCTTTACATCATTTCCTGTAAAGAGC
AGATCATCAATATTGCGACAAACAATGATAATGCTGTCATGTTCTTTCTTCACATACAAAGTGGCTTCACTCTTACTTTTCTGAAAATTAATTTTCAGAA
AGTATGTATCAATTTCATTGTACCAGGCTCTTGGATCTTGTTTCAGCCTGTAAAGAGCTTCTTTTAGCCTGTACACCTTCTCTTCTCCCCCTTGAACAAA
AAATCCTTAAGGTTGCTCAACATAAATCTCTTCATCAAGTTTTTCATTAAGAAATGCAGATTTAACATCAAGTTGAAATATCTTCCATTTTTTTTTTGTG
AACCAGCAACAATTATAGTTCTAATTATCTCAAGACAAGCAACTGGAGAGAAAGTTCCATAAAAATCACCACCTAATATTTGCATAAAACCTCTAGCAAC
TAACCTTGCTTTGTGATTTTTAATATTTCCTTCCTGATTGAGTTTGATTTTGTAAATCCATCCATAAAAATCACTACCTAATTTTTGCGTGAAACCTCTA
GCAACGAACCTTGCTTTGTGATTTTGAATATTTCCTTCCTGATTGAGTTTGATTTTTTAAATCCATTTTAGACTTACAACTTCTCTTTCTTTGGGTATAG
CCACAAGCTCCCAAGTATTATTTTTTTCAATCATCCGAATTTCTTCTTCCGTGGCTTTCTTCCAAACATCATGCTTTATTGCTTCTTCATAATTTTCTGG
CTCAACACCGGCAAATTTACATATTTGATAAATGTCACTCAATATTTTTTGTCATCTTGAAGGCAGTTCTCTATCATCTGAATTTGGGATTTCTCCCCCT
TTAGAGACATCTTCATCTTTCTCATCCTCTTCTTGATTTGAAGATATGATAGTAGTATTCTCTATTTTCTTATCCTCCCAAATCCATGTTGTTTTTCATC
AAAAATGACATCTCTACTAATAACAAGTTTGTTAGTTTTGACATCAAAAAGCTTATATCCTTTTGTCACATCACTATAAACAAGAAAGATATATTTTTTG
ACTTTTTCCATCAAATTTTGTTCTTTTCTCGGCAGGTGCATGAGCATAACAAATACACCCGAAATTTTTAAAATGACTTATAGAAGGTTTGATTTCACTC
GAAGCTTCAACTGGTGTCTAGTCCTTTAGTGCCTTTGTTGGACACCTATTAAGGATGTGATTTGTTATATCCACTTCTCTACCCAAAAATATTTTGACAA
CATTTTCTCATTCATCATAGTTCTGACCGTTTCAACAATTGTTCTATTTCTTCTTTCAGATACACCATTTTGTTGAGGAGTATACCCTGATGTAAGTTGC
TTCTGAATACCTTTATTTTGCAATATTCTTCAGATTCTCGACTTGTGTATTCACCTCTTCTATGACTGCGAATGATTTTGATGCTGCAACATTTTTTCTT
CTCAACAAGGGCTTTAAATTTATTGAATGTAGCAAATGCTTCTGACTTTTCTTTCAAGAAATAAACCCAAGTCATTCTTGAGAAATCATCAATAAAGATT
AGAAATTACCTTTGACTTCCAAGAGATGAAGTCTTCATTGGTCCGCAAATGTTGGTATGGATTAGCTCCAAAAGTACACTTGCTATCCAAGACACCCCTT
TTGAAAAAGACTTCCTATGTTGTTTTCCCATTATACAACTTTCACATGGATCCACCTCAGTATGTATATAAGGAAGGCCTTGCACCATGTCTTTGACTTG
AGAAGCTTTAAATTATGAAAATTCAAGTTAAAAAATCTTTTGTGCCAAAGCCATGAATCATCTACAATTTCATTCTTTTATGCATTGTAATGAAATTGCA
AAGGGAAGTTTCTTTTTATCTTCTTTACTTCAACAATGACTTGATTTTGACTCAAATTTATCATAAATCCTACAATAATTATCTCTAAACACAAGAGAAT
AACCATTTTCCATGAGTTGACCAACAGTAAGCAAATTTTTTTCCAAGTCAGGAAGATAAAAAACATCATGAATTTGCTTACTGCTCCCTTTCATGTTGAT
CGAAATAGTATCTTTACCTTTCGCATCAACTAAGGCGCCATTTCCCATTCTCACTTTAGTAGTGATGCTATTATTAATTGAGATGAAAGCCTTTTCATCT
CCAGTTATGTGATTACTACAACCACTATCAACATACCATTCATTGTTTTTTGTTGAAACATCAGATTTAGAAGCAAAGAAAAGGTTTTCCTCCCTTTCTT
CCTCTTGTTTTTTCATAAAAGAATGCTTGAAAAGGTTTTCCTCCCTTTCTTCCTCTTGTTTTTTCATAAAAGAATGCTTGCTCCCATTTTTTGTGCCAGC
AATCCTTCTCAATGTGGCCAAACTTTTTACAAAAGTTACATTGGGCTTGCCTTTATGCCAACATTTTTCTAAAGTGTGATTTATCTTTTTGTAAACTTTA
AAATAAAGACTAGAGTTTTTTTCACTTTTTTCTTTAACCTTCTTGAAAGAACCATCATGATCCTGCTTCTTTATTGGCTTGTACTTCTTCTTCTTTTTAT
TTTTTGAGAAATTTTGAGAATTTTCATTTCTTAGACTGGAAAGCCGTCTCTTTGGGTTGATCTTCACGAAAAAATCTTCGCTTTTCGTGTGAATGAAATG
ATCCAACTATCCTGGTACCGGAACGTGGCACCTGATCCCCTAATCTCACTACTTTCATTTATCAAGCCTTCTTTTATACCAAGGCATCATCATTAACAAA
GTAGATTAGGGTTTCTTTTCAAGATTTGGGATTCAATAGCTTCATCATGCTTATTTATTCATAATTACATAATCACATCATTCATGCAAGCATACAATTA
AGCATATAGAAGGTTCACAATACTACTAACACATACCATTCGCTATTAAGACTTTACTACGAATAGCATAAAAACCATAACCTACCTCCACCGAAGATTA
GTGATCAAGCAAGCAAATTTTCTCCAAAGCTTTGTGTTTCCCCTTCTCGATCGTCTCTCTCTCTATCGATTCCCTTCTCTCTCTTTCTGTTCTTTTCTTT
TTCTTATTCCAACCCTCTTTCTTTTACCCTAATTAGTATATAATTAAGAATAAAAGATGGCAATAATGCCCCACTAATTAACTTAAGGTTACCTCTTTTA
ACCCCCAAGTAATTAGAATTATTAACATTAACCCACTAACTTTATAATTAAGGCAAGAATATTCAAAAACGTCCCTTAAAACGTATCAAGAAATCCGAAG
GGTCTGTGACGGTCCGTTACACCTGTGACGGTCCGTCCTGCCATTCTGTCACGAAGTTCAGAGAGTCGATTTTTAGTACCCAATATCAGATTTTCTAAGT
ATTTTGAAACGAGACCCTGCGACGGTCCGTCGTGCCCATGACGGTCCGTCGTGCCCATGACGGTCCGTCGTAGGGTCCATCGTTTCTGCCTGTTTCTCCA
AAATTGAAGTCTGCTGCTCAAAACGACTAAACAGGTCATTACATACAATGACTTAATTTATGTGATTGACTGACTTATTTGAAGACTTGTTATAATGTCT
TAAGAGTAGTGTATATCACCAAAACTTTGTAACCATAAAACAATGATTCAAATATTTATATTCCATTTTGTAAAGTACTCTCTTTCTTCATGTTGCCCAA
GTAGTCTTGTCTAATAACAGAAGATAATCCTTTTATTAGTATTAAATTATGGAGACATTTGCCAAATAATTTAATAAAAATGATTATTACTTTATTTAAT
AAAAAATTACAAGTACTATAATAACATTCTAAATGACTCAATGAAGAAAAAAGAGAGTACTATTTTATTTCCTACTTTATTCAAATAAGGCAAAACTTCA
TGGCGATTCGAAAAATAATTACTTAATTAAATTTTGAGAAATATAAATAATAAATAAATTTTAAAAGAAATCTCCATCTAATTTTAATGAAACTAGAAAA
TCAATTATATGATTCCCGAAATATTAGATTCGAGATCATGTTATGTTGAAGGGAATGTGTTAAGCATTTTTCTAAATTTTTTTACCGACCAACTTTGATC
TATGAGATGACAACCATTACCTAAAATAACTCAAGCAACAATAATGCACTGAAAATATTACAGAAAGTAAATAGCTTTAAACACAATATAATCCTAATTA
AAGCAAAGTAGAATTAGAGCAATTAGAGAGTTACCAATCATAGAATAAATAATTTTTTTTAACTAATACTTATATTAATCAAGGAAATAACACTTCAAAG
AAATAAAAATTATTGAGAAGTAAACACTTACCAAGTCAAATCTTGAAGCGTGACTAGTGGTGAATGTTGTTGGTGGTAGTAGGAATTTTCTGGTCAGATT
TGGAAATCTTAAGCACGCCACCATGGTTCCTGGTTTGTTGAAGTGTCGTTGTTCGCCGGGATGGAGGGGAAAATGGTGTGGGTTTGGTTCAGCTTGGAGC
TTCGAGTATTATGGTGACCTGCAAAACAAGTAGAAAAACGAAAAATGAGGGAAAGGGGTAAGGGGTCCGGACGATGGTCACTTATTTTTTATTAATCAGG
TTCATCGAAGCTAAGAGCTCCTCGCCGGAGTTTGTGATGGAGGTCAATTTAGATCTGGTTGGGTTTGCTGCTGGTCAGAGTTGCAGCAGCGTGTGGCATT
TTGGTTCTTTCCGGTGGATTTTTGATTGTGGACCAAGGAAGAAGATGCCTGGTTTCTTGTTCGCTTCTGTCAGAGAGGAAGAATAGTTGGTGTTCGGTTG
GCGGCTGTGAGAGCTTATAGGAGGAGAGAAAAACTTAAATATTTCTCGCCACCCTTAGCATTTGACCTAATAGTTATTTAAATAGTGAATTGTTATTTAA
TGGTCTCAAATTATGGGCTTGTAATTGTGATTCAAAATCATTGATTAATTTGTTAATGAAGTTTTAGACTGTGCAAAATACCAAAATAAATAGTAACAAA
TATAACAAATAAAATGAAAATTCAAAAAAATATAATGAACCTAACTAATAAAGTGTAAAAATAAAATTTTAGAACTAATTAATAAAATATTCTAAATTTG
ATAAATAAGGATAGTTATCGATAAACTTATTTAAAATTATAAAAAAAACTATTTTAAACTATTCAATAAATAACATTTAAAATTACGAAATTTGAAATGT
TAGGTCAAAATTTAATGTCAACAATTACAATATTAAATCATTTCAATGGGTAAAAGCATACTAATGATAAGGTGATCACACCAAAATACATGCTTTAAGA
AGCTATACTCAAAGGTGGATATAGATTTATTTCCTTGTTCAATTGAACCTACCATTTTTCAAATGTACATGTTGCGGGTTCTTTGAGTAAAAAATTTAGG
TCCCAAGAGAAATATGTCACACATATATGACAAGAATTAAGAAATACGCCCTTTAGTACTTATTATTATCAATAATAGCATAATATACTCAGTGTAATTT
TATATGTGAGGTCTAACATAATATAGTAGGTAGACCTTACATCTTTGGGAGATAGATAGTGAGTAGATCTCAATTGAGAAATAACAAGTACTACATTAGT
TCACTTCTCTTATGAAATTTTACTTCTAAAACAACAACCCAGTCAATTTGTGATAGTCATCACAATACATAAAATGAAAATGGATAAGAAAAATTAATGC
TAGAAATTGAGATGTAATTGAAAGTCGTTGTATGCTAAATACAATATTAAAATTCACTATTTGAACACTAATATTTTCTATTGAAAACAATCAAAGGCTA
TTATAAAAAAATTCCTAATTTGATCAGTAAGGAAGAAAATTGTAATGCAAGTGGAAACAAAAGTTTTCCTTTAATATTAGCTTCTTTCGTAAATATTTTC
ACATTTTAATTCTAATAAAAGTAGTGAAAAAAATCTAATAAAAGTGAATTTTTTTGTTGTTAGGCAGGCTTACTCTAAATGCATATGAAAAACACACTGG
AAGAGAGTCGTGAAAATAGAAGAATAATATTTGAATCTTTAGGTTGGATTACAAAATTTTATTGGTAAACACTGTGTTACTAAATTTTTTTAATCGACCT
TCAAGAATGTCAATATATGAATTTATCATGCATAGCAAGGGCAAAAAAGTGCAGGTTCCATTGCTACTCTAAGGAGGATTGCAGAATCTGTTATGATTCT
TTGGCCTGTGCACATTGAAAGTGATTTGATACTCCTGTTGACAAGTATGTTTTCTTTTCTCACTTTATTTTTTTAATACTATTTTTCATATGCAAGCTAT
TACTTTTAATTGGTTATTCATATTAAATGGAATGTCTTTTATATGATCAATTTGACTTTCATACAAGTAAATGATCTTAACATTTTATTTAAATTATAAA
ATGGTATTGATCAACTAGAAGAAAACTCTTTTTAACGTAAATAACGAATTTGAAAATACTTGCATATGCAAAATATAATATTAATAAAATTAAGCATGAA
TAAAAAATATTTTTGCCAAAATGAATATCAAGACACTTCTATGTGTATTAGCTAATACATCATGGTACATTTTGCATTCCTTAGAGAATCAATGAATCTA
CATATTTTTGTTGCTCTTGATATATACGATAAATTAATCACAATGTCTAAATTTATGTGATCCATTGACATATTTAAAGATTTATTATAAAATTTGTGCA
GTGTAGTATGTACCATCGAAATTTAATAATCATCAATAATATTCAAATAATTTTATTTTATTTTATGGAAGACTCTCTTTCATCATGTTTCTCAAATTTA
ACCAGAGTAAACTTGTTCAATAATAAAGGATAATCTTTTACTTAACTATAAAGACATCTATCAAATACAATAAAAAAACATATATTTTTCTGTTTCATAA
AAAAAATCCTAAGAACAAGTACGATAATAACATTCTAAATGACTCAGAGATTAAAAAAAATAGTAAAATATGTAATTGTTTCAATAGGTAAAAGCACACT
AATGGTTAAGTGATTACACCAAAATGCATGTTTAAAGAAGCTATACTCGGAGGTGGATGTGTAGACTACTTTACTTGTTCAATTGAACCAACCATTTTTC
AAATGTACATATTGCAGGTTCTTTGAGAAAGAAATTGAGGTCCTAAGAACAAAATGTTACACATATATGACAATAATTAATAAAGGCAAAATACATATAT
TGAACCCTAAACTTGACTTCAAATTTTAACTTTGATCTCCAACTTTCATAATGCACAAACAGACACTTTAACTATCCAACTTTTAAATAAATAAACACAT
GACGCAATACACGTAGGACACCACATATGACAAAAAATGACATGTAAGACATATGTGTCTGTTTGTTCAACTTTATACAAGTTTAAGTGTCTACTTATGC
ACATCCAAAGTTGAAGGGCATGAATATATTTCAAAACCAAGTTAAAAGACATATTTATGTATTATGCCATTAATAAATACGTCCATTAATACTTATTATT
ATACACAATACATTCAGTATGATTTTACAAGTGAAGTCTAACAGAATATAGTAGATAAACCTTACTTCTTTAGAAAGATAGGTAGATAGTCCAATAGATC
TCAATTGAGAAATAATAACAATGTATTAGTTCACATCGTGTGAAATGTAACTTCTAAAACAACAATCTAGTCATTATATGAAAAGCATCACAATACATAG
TAGGAAAAGCATCACAATACATAAAATGCAATTAGATAAGAAAAATTAATGTTGTAATTGAGATGTAGTTGAAAGTTATTACATGCTAAATACACTATTG
AATGTCACTATTTGGACTCAAAGAATTCTATTGAAAACTTTCCTAGGCTATTGTAAAAAAAAATTCACTTTGATTTCACTTTGATTAGTGAAGAAAGGAA
ATAGTAATGCTTTCATGTGAAAAAATTAAGATGCTTTTCACTATTGATTGATTTTTTTCTCACATGCATTTTTTGATTAGCTACTTTTATGGACATCAAG
TGAAAAAATTAGGAATCTTCTCACTATTTAGTAATGATTTACTTTTTGCATGCATAATTTAAATCGAAAACGAGTGATCATGCCAACTGATATTTATGTA
GGAAATATGGAAGGAAAATAGTATCTTTAGAGAATGCTCAAGTTTATTATGGGCTACTTAAGATCACTTGAGATGATTACAATCATCAACTATATCACTT
TTTTTAATACTCAAAATAGAAAATAAAAATTCTTTCACAAATAACTAAATACATGTATCACAATTTACTAGATACATGTCTAAAGAGACTTTTTGAAAAA
CTAAGAGATAATTTTGGAAGACTAAATATTGATGCATTAATTCCAACACAACCCCTTAATGCATTTGCCTGATAACTCCAATGTGTTCTCGAAGATAGCA
AAAAAAATCTAGAAAGTTCTTCGGTGAAGATGACAGAAATTTGTTCTCCTGTCTTACAATAATGCAACGGAATTTCGCCTTTCTCTTTTGCTTCTCGGAT
AAAATGATACTGTATGGAAATATGCTTCGATCTTTCATGGCTGACTGGATTCTTGGCAATTGCAATTGTTGATTTGTTATCATTATACAAAACAATTCCT
CTATTTTGTTTTTTTACCAATGTCTTCAAATATTCTCCTAAGTCAAATAGCTAGGGAAGTATCCTTGGATGCTGAAACATATTCTGTTTCAACAGTGGAT
TCAGCAACAATACTTTGCTTTTTTGATAACTAAGAACAAATACTGATCCAAATAAGAAAGCATAACCAGAAGTACTCTTCATGTCATCTATAGTTCCAAC
CCAATCACTATCAGAATAAAAAATTAAGTTAAAATCTCCACCAAATTTGTACATTATCCCATAATCCATTGTTCCTTACAAGTAGCATAGAACACGCTTT
GCAGCTCTAAAATGCACTTAGCTTGGTTCTTACATTAATCTGGATAATAAACTAGCAGCAAACATAGTATCTAGACTTGTTTAAGTAAAATATATCGAAC
TTCCAATCAAGCTCCTATAAAGTGAGCTATTAACCTTCTTTTCTCCATCGTCTTTTCTAAACTTCTCATTTGCTGCTAATGTTATGGCTACAGACCTGGA
ATCCATCATTTTAAATTTTTGAAGAATACTTTTAGTATACTTCTTTTGAGAAATGAAAATTCCTTCTTTCACTTGAGAAACTTCGATGCCCAAGAAATAA
TTTAGCAAACCAAGATCACTCATTTCATAAGCTTGCATCATATCTTGCTTGAAATTTTGCATCATCTTTACATCATTTCCTGTAAAGAGCAGATCATCAA
TATTGCGACAAACAATGATAATGCTGTCATGTTCTTTCTTCACATACAAAGTGGCTTCACTCTTACTTTTCTGAAAATTAATTTTCAGAAAGTATGTATC
AATTTCATTGTACCAGGCTCTTGGATCTTGTTTCAGCCTGTAAAGAGCTTCTTTTAGCTTGTACACCTTCTCTTCTCCCCCTTGAACAAAAAATCCTTAA
GGTTGCTCAACATAAATCTCTTCATCAAGTTTTTCATTAAGAAATGCAGATTTAACATCAAGTTGAAATATCTTCCATTTTTTTTTTGTGAACCAGCAAC
AATTATAGTTCTAATAATCTCAAGACAAGCAACTGGAGAGAAAGTTCCATAAAAATCACCACCTAATATTTGCATAAAACCTCTAGCAACTAACCTTGCT
TTGTGATTTTTAATATTTCCTTCCTGATTGAGTTTGATTTTGTAAATCCATCCATAAAAATCACTACCTAATTTTTGCGTGAAACCTCTAGCAACGAACC
TTGCTTTGTGATTTTGAATATTTCCTTCCTGATTGAGTTTGATTTTTTAAATCCATTTTAGACTTACAACTTCTCTTTCTTTGGGTATAGCCACAAGCTC
CCAAGTATTATTTTTTTCAATCATCCGAATTTCTTCTTCCGTGGCTTTCTTCCAAACATCATGCTTTATTGCTTCTTCATAATTTTCTGGCTCAACACCG
GCAAATTTACATATTTGATAAATGTCACTCAATATTTTTTGTCATCTTGAAGGCAGTTCTCTATCATCTGAATTTGGGATTTCTCCCCCTTTAGAGACAT
CTTCATCTTTCTCATCCTCTTCTTGATTTGAAGATATGATAGTAGTATTCTCTATTTTCTTATCCTCCCAAATCCATGTTGTTTTTCATCAAAAATGACA
TCTCTACTAATAACAAGTTTGTTAGTTTGACATCAAAAAGCTTATATCCTTTTGTCACATCACTATAAACAAGAAAGATATATTTTTTGACTTTTTCCAT
CAAATTTTGTTCTTTTCTCGGCAGGTGCATGAGCATAACAAATACACCCGAAATTTTTAAAATGACTTATAGAAGGTTTGATTTCACTCGAAGCTTCAAC
TGGTGTCTAGTCCTTTAGTGCCTTTGTTGGACACCTATTAAGGATGTGATTTGTTATATCCACTTCTCTACCCAAAAATATTTTGACAACATTTTCTCAT
TCATCATAGTTCTGACCGTTTCAACAATTGTTCTATTTCTTCTTTCAGATACACCATTTTGTTGAGGAGTATACCCTGATGTAAGTTGCTTCTGAATACC
TTTATTTTGCAATATTCTTCAGATTCTCGACTTGTGTATTCACCTCTTCTATGACTGCGAATGATTTTGATGCTGCAACATTTTTTCTTCTCAACAAGGG
CTTTAAATTTATTGAATGTAGCAAATGCTTCTGACTTTTCTTTCAAGAAATAAACCCAAGTCATTCTTGAGAAATCATCAATAAAGATTAGAAATTACCT
TTGACTTCCAAGAGATGAAGTCTTCATTGGTCCGCAAATGTTGGTATGGATTAGCTCCAAAAGTACACTTGCTATCCAAGACACCCCTTTTGAAAAAGAC
TTCCTATGTTGTTTTCCCATTATACAACTTTCACATGGATCCACCTCAGTATGTATATAAGGAAGGCCTTGCACCATGTCTTTGACTTGAGAAGCTTTAA
ATTATGAAAATTCAAGTTAAAAAATCTTTTGTGCCAAAGCCATGAATCATCTACAATTTCATTCTTTTATGCATTGTAATGAAATTGCAAAGGGAAGTTT
CTTTTTATCTTCTTTACTTCAACAATGACTTGATTTTGACTCAAATTTATCATAAATCCTACAATAATTATCTCTAAACACAAGAGAATAACCATTTTCC
ATGAGTTGACCAACAGTAAGCAAATTTTTTTCCAAGTCAGGAAGATAAAAAACATCATGAATTTGCTTACTGCTCCCTTTCATGTTGATCGAAATAGTAT
CTTTACCTTTCGCATCAACTAAGGCGCCATTTCCCATTCTCACTTTAGTAGTGATGCTATTATTAATTGAGATGAAAGCCTTTTCATCTCCAGTTATGTG
ATTACTACAACCACTATCAACATACCATTCATTGTTTTTTGTTGAAACATCAGATTTAGAAGCAAAGAAAAGGTTTTCCTCCCTTTCTTCCTCTTGTTTT
TTCATAAAAGAATGCTTGAAAAGGTTTTCCTCCCTTTCTTCCTCTTGTTTTTTCATAAAAGAATGCTTGCTCCCATTTTTTGTGCCAGCAATCCTTCTCA
ATGTGGCCAAACTTTTTACAAAAGTTACATTGGGCTTGCCTTTATGCCAACATTTTTCTACAGTGTGATTTATCTTTTTGTAAACTTTAAAATAAAGACT
AGAGTTTTTTTCACTTTTTTCTTTAACCTTCTTGAAAGAATCATCATGATCCTGCTTCTTTATTGGCTTGTACTTCTTCTTCTTTTTTTTTTTTGAGAAA
TTTTGAGAATTTTCATTTGTTAGACTGGAAAGCCGTCTCTTTGGGTTGATCTTCACGAAAAAATCTTCGCTTTTCGTGTGAATGAAATGATCCAACTAAC
TCTTTGATAGAAAGCATAGAAAGATCTTTCGTCTCCTCAGTGATAAAAACAATGTAATCATACTTTTCTGTGACACTAATTATAATCTTTTCTACAACTT
GTTGGTGAGAAATTGTATCAGCATGATTTATCATTTCATTAACAATATTCATTACTTCTGTGCAATATTTATCAATTTTTTCAGATTTTATCATCTTTAA
ATTTTAAAAATCTCTACTAAGAGTTTGAAGATTTATAGTGTGTACCTTTTCGTCACCATACGCCTCAGCTTTCATAGAATCCTAAGCTTCCTTTGCAGTA
TCACAAGTAGCAATTTTTGTAAATTATGATCTTGAGACTCCCATTTGGATTTTGCTCAAGGCTTTTACATCTTGACGATACTAAGCCTCAAGATTTTTCA
TCTCTGCTGGTGTAAGATCACCATCGTTGTCTCGCTCTTCAAAGCCATTTGCAAAATTAGTCCACAAACCTTCAGCTTTCAAATGTGTTCTCATTCTTAT
CTTCCAGCATTCGAAATCAGTTCCATCAAAAAAAGGAGTAAGAACAATTGAAGAATCAACACATTCATTTTTTTTTGGATGCCGTATTTTTTTCTTCACC
TAACACCAGATTAAAAACGAACACCTTCTCTATATCAATTTGTAGGAAATATGGAAGGAAAATAGTATATTTAGAGAATGCTCAAGTTTATTATAGGCTA
CTTAAGACCACTTAAGATGATTAAAATCATCAACTACATCACTATTTATACTACTCAACATAGATAACAAAAATTCTTTCACAAATAACTTAAAATACAT
GTATCACAATTTACTAGATACATGTACAACGAAATTCTAAAGAGAATTCTTGAAAAACTAAGAGACAATTTCAGAAGACTAAACTTTGATGCATTGATTC
CAACAATTTATTGTAGTAAACTTCTAGTTTATCTTTGCATGCGATTGCATCATCATGCTTATATTTGTATACAATAAAAAAGAGAAAGGCGGGTAACCTT
TTATGTAAATATTTATAATCCACTTTGAATGTAGTAATCCGAAAACATTTAATATTTCAATAATTTACAGATCTCAATATAATATGTCTTTCAGTTCCTC
TGAAACTTAAAAATTTTCTTTTGAGACTTACTACAATCTCAATATTATGAACTAATTTCATTTCTCGATAGTAACAAATAATTATTTTGAAACTCTTAGT
TAAGTTTGTGTATTGCCAGAAATTTCGCAAGGCCATTCTTATGGTGAACATCTCCTTCAAGAAGAAAATTATATTATTGTTATGATTAAAATTATTAGAG
TTTTTGGCCAAAAACATCCTTAAAGTATACCCCAACTTTAAACTACATCCTTAAAGTGTTATTCTTTGCAAAAAACATTCTTCGAGTATTTGGATGAAGA
ATTTTCATCCTTCTGTTTGATATCATAAAAAAGCTAAGGATTCGTACAAAAATCTGAGCAGTTCACGTGACTATCAACAAAAGTTTTTCTGCATAATTTC
ATTATATGCTATAAGAAGTTCTTTAGAAAAATATTAAAAATCTTAGACAATATTTCTTAGTGAAACAAAAAATGTTTGGAAGGTGTGAGCATACATGATC
TACTCTTTTTGTTTTTAGTAATGGAACGAAGGTGGAGCTTAATTATATTTACCTTTTTCATAGTCAAATTGTATTTAGATCAATAGATTTTTGGACCAAT
CTAATACACAAGTGATCAACATATTAATTTTGTCTTTTATTTGAGTTTCATTCTACATTATTAGAAAAGGAAGTCTCCAACAAATGCAACTTCTAGCATA
TTCGATTAAGAAGAAACATATTTCTGCTAATATATTCAATTAAGAAGAAACACATTTCAACTAACAATATTTTTAATATCAAATTAATCCTAAACTCAAT
TTCAAGTTCACGATAGTATTTTGATGTATCTAAGAATGATAACTATGAGGAATGAATTGATTTTTTTTGGGAATTTTCTAATAAATTCAAGTAGAATGAT
GAAAATTGTTTACTTTTAAATACTTGAAGAACATTTTCTGCGAAGAATGATACTTTAAGGATGTCGTTTATGTTTGAGGTATATTTGAATGATGATTTTC
GCCAAAAACATGCTAGACTTATTTCTTGACAACTAGTGACAAATTAGTGTTGTCACAACAACATTTATTTTGGTCATGACCACAACCTTTATAGAAAATA
ATTTTGTTTTTGTCCTCCAATAGTTCATCATAAAATATATGAACAAACTTCTCGTAGAGGTGAATTGTGACATTTATCTAATAATATATGAACATCTTCT
TGTCCAGATGAACACAAGTCACATATTCTTTGAGAAATGGACCATAACCACTTGTATATGAACTTATTGTCATGTTCTGACACTATCAAATTTATGTGAC
TCATATCGACATCACTTTAAGAGGTCAAATATACCAAATGTACTATCGTTTTGTATTCCTTTATTTTGATGGACAACCTACTATTGTTTTTAAATTGGGT
TCATCAACAACAATGTGCACAATATCTTTTCATACCACTTTGATGGATAAAAATTACCTTCACATTTGAAGGACCATCTTAAGAATTCATAATGTTCTTC
CTTTTAATTACAACAATTTTACCACACTCATAATAACACATTCAACTACTTGTCATTTTCCATACATATTATGTATGTATTGCTACCACAATCACATAAA
AAAAATGGAGTAAATTAATTGGAAAATTTTTATGACTTTCAGTAAAAAAAAAGTGTATAACTTTATGTTAGTCATCATCATATCATCACCATATTACATT
AGGACTAAAACTCAATGCTTTACCCATATGAAGACACAAAAGCACCAAACCCAATTGGAAATACACCATTGCTGAGAGTTAGTTGAGTTATAAAAATTTG
TTGAGAGAAGGAACATTTATCTAAGCAAAGAAAGCGATAAGATTCTTTTGCCTCATCCAAATGCACCCCCTCCCCCCAAAAAAACTTGATTTTGAAAAAT
ATTTCAAAGCTAAGTTTTTAAAATGTTTTTACGCACTCTCCCAATAATCTATTTTAACCCAACCCAACCCAACCGGCTATACTAAAGAAACTCATACTAT
TCAAATCCCCAGTCCATGTGTTCTCCTGTTTAGCAACCCTTCCCAATTTTCCTACCAAAATAACAATGCAAATTCACAAGACCAAAGATTAATTCAATCT
GATTTTCAAGCTTAGTTTTCTCTTGCAAAACCAAATTCCAAATTGTTTTTCTAAATGCAAAAAGGAATACATTTTCATTATCATTGGATAAATATTCATA
AATACAACAACCAAATCCATTTTCTAATATCATATATCAAGCACAAACACATGAATTATTAATATTGATATCCGATTCTTAGAAAATATCCAAACACATG
AATTATTAATATTTATATCCGAATCGATCAAAGAAAAGATCGCCACAATGAATCTCACAGAGTTTCACTTATTGTCGACGGTTGGAAAAATGTAAATAAG
GGTAGCATTTACGGTAGTGTCGGAGGGTAATTCATAAATCATAGACGCCGATCTTCCATGTACTTGTCACGCCTCGAGCCTACACCTAGACGTGGCTGAA
ACTCGAGAACTTTTTCTAGTCCACAAGCGAAACTTTGTCCTAACTCATTACTTAACTGAAGACTAACTCAAGTGTCAATCCAGACCGACGTGATTGGCAC
CCACACTAACTCTCTTGTGGGAGAACAATTAATATTATCCAACTGAGCAATTTAACAAGAAACTAAGCATTTAAATATAAAAAAGCAAGTTTAAATGATA
GAAAAATATGGAGTTCCCGTAAACTCCGAAAGCTTAAACCAACAACTAAACATAACTATTACGGAAATCCTCCCTTAGAACTTGAAAGTCAATGTACCAA
AACTCTACTAAGTACTAGTCGAAGAAAAATGGGTGCAACCCCAAAACTAACATATATATAAGTCTAATTATAAAATCTGAGTCCGAAAGGAATGGACGAA
AATATAGAAGATACATGAAGCCAAGAAAAACTATCTCACCCTTACCTCCGCTCGCAATCAATAATCATTTCACTGAGGTCGGTTAGTAGCATGTCTAAAG
ATGCCAGGTACTCTACAAAGAAAAACAAGTGAAGTATTAATACACAAACGCAATGTATTGGTAGGATCACACGGCTGCTCCCATAAGCACAATGCACAAC
GAAAAATTAAAACATACTAAACACGTTTTAAAAAATTTACAAAGATCAGTTCTCATTTTAGGAGCAACATACAATTCCTCAATGTCAATATGATAGGTAA
CCAAGAATGTAACAATCATAAGTGGTCCTCTCATGGAACTCACACCCAAACTGTTAGTGTGTTGGAACGTGACATTCAATCAAATATATATGTGTTGGAA
CATGACGTCTGATCAAATATATGTGTCGAGACGTGACACACGATTCAATCAGGACAACCACATTCACAACCACATCATAATGAACAATACTCAAATCGTA
CAGTCAAGTAACATGTTCATGGCATGTAATGTCAGCAGATCATCATTTCATTAGATTGATTCACATTCCCTATTCACATACATGCACTCATATAATGAAG
AAATTATTCAACATATATCTTACAACAGGATATAAAATCATCACCTACCTCGAAACCAATCTTGATTACTCCTAAGACACTCGAGCTTTCTTTTCCTTAG
CAATTCAACTTGTTCTTGGTCAATAAACAAGTAATTTAACTCAAGGATCAATAAATAAGATCTAATTTACCACAATTATAACAAACTCAATCACCCAAAA
CCAATCCCATGATATTAACCTTCACTAGGGCTTTCCCCCCACCATCAACTTCATGCCAAAACTCTCTCCCAATGATAATTACCGAAGCTATTAAGTTCTA
GAAACCAAATACAAATTAAGGGAGTAATTTTCTTACTTTAGCATTAGAAATCATGGAAAACTGTTAAGAAGTGCCCTGGGCCATCTCGAAGCTCTTAAGA
ATGAAGTTTTACAGAAAATAACGAAATTAACGTTTTTCCCCAACTTATTTCATACTGTTCGGCCACAACAATCCAGCCCTGGCAGAACTGACCTGGCCCT
GACGGCTTGCACGAAGACAAAAGTTCAAAATTTGAGTTTCAAGCTCACATTTTACACAACACTTTCAATCTGGGATATTCTAAAACAAGATTTTTCACGC
CAAGATCTATTTCGGGAGTTCTACTCACCCGACTTCAAATTTGTAAAGCTGTATAGGATCCTTAACGTCTCGAATATCTACTTATGTGATAAAATTCTTA
ATTCGATTTCCCATGCATTACCAAATTTCCCTGGACTTCACATGACTCAAATTTCGTTTCAATCTGGCCAAGGCTAGAAATTTTCAAGTCACTACTCAAA
AATTCTCTGGCTCAAATTTCTTCCCATAGTCTTTTCCATAACGATGAAAGAAGGCCATTACATCAACTAAAATAGAAATATCAAATTCAAACTCAACTTA
TAAAGATACCATTGATGAAATAGTTAAACTAAGTATACTCTGAAATACTCAAAACTTAATTTTTAAACTTATGTCTTTAAAATATTACAAAAGAGATGGG
AAACACTCTCCAACAACTAATGTCTCTGAAGCCTCTAATAACTATGAAGGAAGTCGGGACAAGACCCACGACATCCTAACTAACTGGAAAATCAATGTTG
AACCCTCCGAAAATAAGGAGACTCACCAAAGCTAATTGGGACTGTAATTGATATCAATGGAGCGCATCTTGATGACCCTTATTACTTGTATTTTCATCAT
GAAAGTACGAGCATGTAACGGAATTCTTAAAATAAACACTAGCTTGAATTGATAAAAAAGGAAAATATACTCACCCAGTCTCAACTCAACTAAAAGTCAT
TCCTTTTGTTTACAACTAGATTTTAAAAGTACGAATTATAATTATATGACTTTTTTCTCAAAACATAAATCCTATGCATTTTTGATAATCCTATGAATTT
TTACTTAATACTTTACTAAATTAATTTTTTCTAAATTGTTAGTTTACATTTTTGAGTCATTAGTTATAATTAAGTTACCTATATTGTCTTGTTAAAATTA
AGAAGCTCGTTAATTAACCAACGCCAATTCAATTTATTTAAATTTTAGCTGAATTTAATAATCAACTCAATTTGGTTAAATTTTGAAATTCATTTGGCCA
AGATTGCAATACATTGGTCAAATCTTTAGCTCAAGATCTAATCCTTTTTTCAACCCATTGTGAAACCAATTTTGGGCTCTTATCCTAAGATGTTCAGACC
GCCCACTCCCTCTCCAGAAATCAGTATTCCAGATCCCTCCCTATTCCAATTCATCACCAACCCACCACTTTTTCCCTGACCCAGCCCTTTCCAAAACAAA
GAAACCAGAATGCTACAACGTCTCCTTCTTCAAATCCTTGTACAAATTTTCTCCAATTCCAGTTGTTGCCCCGTCCTGGCCAGCGAGAGATCATTCCATG
TCGACGCCCAGGACGCTGAAATTCATTCCAAGACTCCATCCCTTTCCTCTTCCGGAATGGGGTTGAAGCTTCAGAAAAAGGTGTTTAGCCTAAATGGAAA
AAAAATTTAGAGGTTTGAATTTTGAATAGTTTTGGTTTTGGTTCAAAAATTTCAGGTGATTCCCCCCCCCCCCTTTGTTTTTCCAAACCCTAATTTTCCT
TCTATATATAGTTTCTTATCTTTTTACTGTTGTAGTGGAAGAAAATATTGGAGAGACTTGGACAACGTTGAAATATATATAGATAGAAAAAGGTAGAAAA
AATTGGGAAAAAAAACAGAGAAAAATTGGGAAAAGTTGAGGAAAAAGGGTCGGAGATAATTACAGGGGTTGAAAAAAAATAAAGAAAACTAGAGGTTGAA
CGGGATATTAGAAAAAAGAAATTGAACAAAAAAGAGGTATGAAGTTACTCTTAATATACCAATAGAAAATATAGCTTAAAAGAGTCACTTTTTCGGTTTC
GCTTGAAATTTTTTTTGGGGGGTCTTGGTATTTGAATCAGAGCTCCTGCAATAGAAGAATAATGGAAGGTCGCTCCCCTACTCGTTCCTATCTCAGTTCG
TTGTCCAGAAAGAGGTAGACTCTTTTTTTTTCATTTAATTTTAGTTTCTTCTATGTCGTTCTTTTTATAATGTGTTATCTTGAGTTCTCTTTTATGTGTT
AACTTTGTTTGGATTTTCATATGTTAGGACTTGGTTAAAAAGTTTTAGCTAGTACTATTTTTTCTTTGTATATGAGTAAACATTTGAGTGTAAATCCTGT
TTGGAGTTGGTTTGGGTTTATTTACAAGTATGTTCGTTTTCTATCAAAAATATGTCACAAAATTGTGCTAAAATCACATGGTGTATTTTGTTGCCTAAGC
TTGTTTTATTGTCTGCTTGAAGTTGTGGAATTTGCTTTAAAAAAAGATAAAGGAAAAATCTCTCTCATTGTTTTCATGCCTAATTTTAGCAAGAAAAATA
TTGATATTTGTACTAATTTTTGGCTACTGCTTTGGCTCTAGCTTAAAATGTTTAATTTTATTCTAAACATAAATATATTGTTGTTTTTGCTTAGTATTAT
GTTGTATCTTAATCCTAATGACATAAACTTTCCATTTAGTTACTATTCGTCTTCACTATTTAGCTATCACTATCGTTGATTATCTTACTTTATCATAAGG
AGATTGGTTTAATTTTAAGTGGGTATACTTTCACTGCTGCATGTTTTCTTGGTCATTTTTAGCATAACATGGGTATAGTAAATTAAGCACATGTCATTTT
GATCTTATATTAGTTGGTTTAAATTTTATTTTATTTTGCCTTTATTATGCCATTTTAAGGTGTATGAATATCTACAAATCATGGTTCATCTCTACTTATT
CTTGTATTGCTAGTGGAAATGTTTGATCGTTCTTGTTGATATGGAAGTGGTATCGAATTTAGGTGTTGCATTGATGAAAATATACACAGGGTATTGCTCA
AAGCAATGCCTACATAACCCTTTGTCATGTTGCTAGCCATTAGTGGACTTTATTAGTGTTTGGAGTCACTATTTATTGTATTACCTGTATAGGCTTTAGA
TGTTTACTTCCTCAACTCTTGTTATCATTAAGTGTCAGTTGATATATAGTAGTTCATTCAGGTTTGTTTCAAGTCATCTTTTATTGTGATTTAATAATGA
TTTAGGTTTTCATCTTGGATCTTAAAATACATGAGTTAATTTGTTCTCAATCAAAGTTATGTCTCATTTGTTTTATTTGATTCATATGTGAATATTGTTT
CTTTCCTTTCTTGTATGAATCCATTACGAGTCCATAATGGAGTTCTTCCCTCTGCATTTCGGAATTGAGCCATAGAGGCTCAAACCTCTTTTTTGTCACT
AAGTCAGCCAAATCATGGGTGTACAGGAAATAGTTAGAAATGCTAGGGGTTGGAAATTGAATTTCAGATTCCAAAAAAGCTTAAAAGATAGTGGTATACA
TGAGTATACATTCTATATACATGATATATGGACCCAATAATTGGTATCCATGTTGAGGTGCAGTGAAACATGGCTTAAAATTGAAATGCAGGTCAAGAGG
CTCAAGAGAAAGTTGAATACATTAGATATACGTTCAGTATACAACAATGTATACACAACTTATTTTGGCACATAATTGGGCCAAGACCCAATTACACGAT
TGTTTTGATTCCAGCATTCCCAATTAAATTTTAAAATGAGGAAATTTTTCAAAATGTCAATATTTTGACATTTTATACGACTCATTGTCAATACTTTCAT
TATTTGGTAAAAATGTCAAAGTTTTAGTTTATTATATCTCATTTATTTATTTTTTTATTTGTTTTAATTGAGAGAATTAATGTTAAAAACAAAAAGGAGA
AATTGAGGGGAACGAAAAATACTAAAGATGAATGATTGACTAAAACCTTCATCAATTAAAAAATTCAAAAATAAAAATAATCAATCGACACTCCCATAGC
TGATGAATTCTTTGAAATTTTGATTTTCAAGATTCTCATACAATTGAAAGCCTCTTTTTAGTTTCTGTTTGATAGGAATAATTTTAGATCAAACCTGATA
AACAATGTATGGAGAAAGATTTTTCTACTACAAGTTCGACCAAATTGTTTGAATACAAATTTAACAAGGTAATTGTTGCTTCATATTTTTTTAATTGCTT
GTTATTTTGATATAAAATTTCAAAAATAACTGTAAAATGTAATTTGTTTTCATTTGTATTATGTTTTCGTTGTAAATTCTAAAAACTATGAACAACATAT
GAATATTTTATTTGTTGACTTTTTGTTTTGGTTGTTTATGTTTTGTTTGAAGACATGATTTTGTTGATTGGATGTTTGTTTTTAATGTTTTGAAATAAAT
TGTATCTGTAACAGAATACAAATAGGAGCAAATACAATTTTTAATGACAATCTTCAATTTTTTTTTGTTAATTTCACTTTATTTAAATACGTTATAACCC
TTATTGAAATATATATGATCAATGTAATGTATTTTATAAGTGATTATTTTGAATACAATTTCAATATTTGTTTAGTATACATATATGTTGGCAGACTACA
TTAAAATATGAAAAATACAGTTTTGTTCATAACATGATGCAAGTACTATTATGAATACACACATTTGTTACTTGGATACAATTTTGTTCATAAGAAGATG
CAAGTACTATTGTGAATACATATATTTGTTGCTTGGATACAAAAAAAACTGTGATCTTTGCATGCAAATGCAGTTCCCTGAGTAAATGATATATGTAAGA
AAAAAAAGTATTCAACTTGGCAAGCATAAAAATATAATAAGTATACATAATATAACTTAGAAACTACATCACATAAAAACTAATTTAGATAATAATGTAA
CTTTGAAAACATTCAAATAGCATTACTATTTGTTTAAAAAATGTACATATTTTAGATGTATGTTTACTTTATTGATACAAATAAGACTCTCACAAACCAT
AATGAATACAAACACATCTATATACAAAATCATCCAAAATGAATTCATTAGTAAATATCATACAACACAAATATATGAAAATTACGTACCATACAACACA
AATACAATAAATACACCACAACGAATACAAAACCATCCAATTAGAATTCATTAAAAAATCTGAGATACCATTTTTATGTAAAATGTATTCTTAAATTATT
GAATATCTACCAATGTAAAAAATAAATAAAGGAATGATTAAAAATTTGATACATTATCAAAAATAACAATAATTGTCGCCAAAATACAACAATAAAATAA
AAAAGGAATACAAATACAAATTAACAAAAACTGCACGGTCTACCTATGAAATTTGTAAATATATTCAATACACATACTAAATTGATTTTGGATACATAAA
AGAAATAAAATCAAACTACATTGTTGAAATTTTTTTTTAACTTCAACTTAATATGCAAAATACTAAACATGCAAAAATAATTAATTACCTTTTTATCAAC
TATTTGATTTTCTCCATCCTTTTCAAGTACCCCACGAGTAGATGAAGATACTACATTTTTTATCTGAATTTGAGGAAGAATTTGTTCTGATCGTCTCTCT
TCCCTCATTTTAGAAGTGGATCCTACATATCCGCTATTTCTTGAATAATACATAGATTAAAGGATGAAAAATCACTAGAAATTTGACGATTAAGTTGAAT
AACTCTAGTAAGTCTCTTAGATTCATCCATTGAAGATTGTTATAGTGGTATAATCGAGATTTATTCTACTTTCAATGATTATTTAGATAAAATAAAATCA
GAAAATAAATCTAAAAAAAAAGATAAAGATGAAATACCTTAATTAATGGGATTTGTGTGAATTCAATTTCTGAAGATAAAAAACACCAAAAATTACGGTA
GAGAGATATGAGAAATTTGAAAGTTGAATGATAATATAAATTAGAAAATATGAAAGAGAGAGAAAAACACTTTTTTTTTATATATATATGAGCCAAATTG
GAAGAGAGATACATAGGAAACATGAATAAATGGAAACTAAAGATTTTTATTTTTTAAAAAATAAAAATAGTTGGGTAACATGTATGAATGGGATATACAT
GGGAAACCTGAATAAGTGGAGTTAAATAAAGTAACTTTTTTTATAAAATTAGTTGGAAAACATGTAGGCAATATGAGATAAAATAGAGATTTAATTAGGA
TACATATTGTTTTTCAAAATATTATTGACATTTTTACTAATATTTTTAATGTAGTGAGGTTTTTACTAATTCTGTTATGGATTTTGACTAGTTTGCTAAT
TTTTCCTTTAAAATGTGGATTGAAACCCATGAATTTAGTTTAGGACAAGTTGAAAAAAAGTTGGGCTTGCTATCTCATCAATTCGAAATTTGGGAGAAGG
CCCAAGTTTATTACCTCATCTTACCTTTTATTGTATTTGATTATTTTTTGTCGAACTAACCTTTGTTTGCATTGGTTTTTATTTGATTAAATTCCCCAAG
AGAACGTTATTCTTTTTATGTTCAAGATTATAATATTTCTTCTTTTATTTACCTAGTTTTGTTTTATTTCATCAGTTGTCTTGCAACTTGAATTATTTCC
TATAGAAGATTTCCCGCTAGTTGTTCCTCTTAAAAAGTAAATAAATAAAAATAAATTATATATCCTTAGTTATAATTTGAAAAGTCAATTTTAGTCAAAT
CGTCGGTCAACCGCGAGTTAGAGGACATTCCGAGGGCTTAACACCTTCTCGAAAATGTATATTTGAACTTCGAACCCCTTTTCAACTGATTTTTATCTGT
TTAAATTTTTTGAAAATAATTATATGTTTTTCTTGATTTTTTTACTAAAAATTAAGTGGCGACTCTGTCAATTTAAAAAATTGATTTCTCTTAAATCATA
AGATTAATTGACTTTTTGAAACTTAGCCATTTTTTTAAATTCATTTTTGAGTAAAACAATTCACATTATGACTTATGGATTTCCAAGACAAATATGTATT
TTGTATTATTTGTAAAAAATGTGCATATAATTCACACTATGACATGGACTATCAAGTGTCTTGACCCGAGTCTACACTTTTGGTGTGACTATATTCAAGA
TCACGGATGATTCCAAGCGGACCCTTGGTATGGACATGTTACTAATGAATTGATCCGACATATTATGAATGAGATCGAAAATTGAAACTTTGTCAAGTGA
AATATATACTAAATATAAGTTTGTGCATTTTAAAAAAGACAAGATTTCAAGTACTTGTGACATGTTTACTCGAATCGAGGGTCTATCAGATATAGTATCT
TTACCTTTAGAGGGTAAGTACAAACATTGTTGTTTATATTAATTTGAGTGATTGTACCATTATGAGTTCTATATATTGGCTTTAAACAGGCGATGTTTAT
TAAACTTTTTATAATTTTGTTTGATAATATACTGATAAAGGGGTTTAGTTAATTAGTGCTTTGTGAAATAAGATTAATTTCATTATGACTGATGTCGTTT
GAGCATGTTGACAAACAAAATAGTTTTGTTGAACACTTGCCTTATTGCAAGAAACGATTGTTTTTTTCACGCCAAATCACTGAAAAATTTTGTGATGTAG
AATACGATTTTATCACTCATAATTTTCACTTAATTACCTCATTGAAAAGGTATCGTGAAGGAAATATTCTCATTAAGATGAGGAGAAATTTCTTCATTAT
GCCATATGAAAATATAGCTATTTTTTTTCCTTCTCGTCAATTAAACCAAAATATTTTAGTAGAAAAGTTCAACGTGAAAATAGTAATTTTTAGAGAAAAT
TAGCAATTTAGTCAAATATCTAACTTAATTAGTAAAAATCTCTATACTTTATAAATATTAGTAAAAATGTCAAAAATGTCATTATTTCGAAAGGGTTGTG
TATTTTAATTTACTTCCTATTGTATCTTATTTTAATTACAAATTTTCCAACTAATCCTCTCTTATATGTTTTTTAAAAATGAACTATTTTCTATTTCATA
TTTTCATAATCTAATTCTTTTTCATTTAAAAATCTTCCTCTATTCTTCTTTTTTCGAAATTAAAAAATATATTTATAAAGATATTCATAAAATTACTTTT
CTTAAAATACGAGTCTTTATCCATTTTCTAATATTTGTTTTATGATTTTATTTTTGTTTACATCATTCAAAATTGTTGTTTATAGTGGAAATCACGTTTT
GGGTTTGATAAACTCTAAATCACTCTCCAATGGCAGAATCTAATAGAATTACTAGAGGTATTCAACTTAATCAACACTGTTCTATTTTTCAAATATCACA
ATTTTCTACTAAAAACGCAAATGACGATAATTTTAATTTTAAATTGTTGATTTTCTATTTCAATATCACTTTGTATACAAAAAAGTTCTATTTTTTTAAT
TTGGTATTTATCATAATGTATACCAACAAATTCACATTTGTATTTCAATTGAATTGCGTATCTATTGTGCTCATTTTGTATTTCAATCTTAATTTTCAAT
GACAACAAGTTTGTATTTCTTTTTTATTAAGTTTTCATTATAATTGTATGCCATCAACTTTTATATTTTATGTGTTCACTTTACAATTCAAATTAAAATT
GAATATCATATTGTGGTGGGTATTTTATTGTGATCATTTTGTATTTAACTCTCACATTGTATTCAGAAAAAGTTTGTATTTTTTTGTGTTCATCATAATG
ATACATTAACAAAGTCAATTTTGTATTCCAACTGATGTGAGTATTTATTGTGCTCATTTCCTACTTTAGTCTCAATTTCAATGACAACAAGTCTGTGTTT
CTTTTTATTATGTTTTCGTCATATTTGTATATCAAGAATATTTGTATTTTATGTACTCACTTAACCATTTAAATTAAATCGGTGTTTTACTTTGATAGTG
AAACTAAAATTGTATCCTAGTGATCAAAATTGTATTACATAACTGCCAAATATATATTTCTTTTATTTGTATTACAAAAATTTTACGGATTGTATTCTAA
TGTAATCTAATCATTACAGATGAATACGATTAAGGAAAGATACATGATTCTAGAAAAAAAATAGAGTACATAATTAAAATACTAAATTCTATTGATGTTG
ATACAATATTCTAGAAAATATAAATTTTAAAAACACAATTTAATCGAATTCATTTCAACAGAAATTGAGTATTAACAATGAAAATTTAAAAACCGATACT
AGAAATTTAATGAACAAGTGGGATGAGTTCTTTGTGTTTATTTTATTGAATTTGTATTTATTTTTGAATTTTTGTAACTGATGAGACTTTTAAACACTTG
TTCCTTTTTTAAGAAAATCTCTCCCCTAAATTTCTCCTTTTTGTTAGTTAACAATTATATTCTTTAAACTAAAACAAATAATAAAAATTTAAATAAGATA
CATATATAAATTAAAATTTTGACATTTTTACTAAATATTTAATAGTTCCTATTAAATATTAAGATATTGACATTTTGAAAATTCCCCTAATTTTTAGTAT
TGTTTGTAGCATCTAAGACTTTCATTATACAACTATGTCTCAATCCCAAAGTTATTTATCCTTATCCATCCTTTTGAACCAATTCAATTGTACTTATGTA
TTGTGAGAATTTCCTAAATTAACTAGATTATCACTTCAAAAAGCATGAGTAAGATCTACATGCATTATATCTATTCAGCTTAACTTGTTGAATTATACTG
AATATGTTATTGTTGTTGATAATGATCATTTCTAAATTATGGACACATTAATTTTTTCATATATATATGAACTTTTTGTCCACGTGACCTCAAATGTTTT
CTAAAAGAACCTATAACATGTCCATTTGGAAATGGTAGGTTAATTGAATCAATAAACAAGACCGCAATGAAATGTGGTTTTCACTTCTCTAAACATGTAT
TTTGTATAATTGGTTGATCATTAATATGTTATTAGCTATTGAAATTTTTTAATATCATGAGTCACTTTTAATGTTATTATTTTACTTTTAATTTTTATTG
AACGAAGTTTTTCCTTTCCAATTACCTTCTTTAGTAGATATTGACACATTTTAATACTAATAAAGGTTGATATTTTTTGTATTTAGACAAGCTTACTAAA
ACTGAATATGAAAAACATGGTGCAATAAAGTCCGAAAAATAAAAGAAAATATCTGGATCTATGTTTAGGATTACAAAATTTCAATGATAAAGACTTTATT
TTTGAAATATTGTAACCAATCTTCAAAAAATGTCAATTAAGCTTTCAAAATGAATTTATTATACATACCATGTGCAAAAAAAGAATGCAAGTTCCATAGC
ACTCTAAGAAGGTTTTCAGGATTTATCATGATTCTTTGGGTCATGCACGTTGAAAGTATTTTGATAGTCATTTTGACAAATATGTTTTCTTTTCGCGCTT
CGTTTTTTAAATATTATATTTTTCATATGCAAGTTGTAATTTTCAATTAGCTGTTCATATTAAATTAATTCTCTTCTAATTGAACGATTTGACTTTCATA
AGGAAAACGGTTATTAAGATCAATTACTAATAGTAAACGATCTTAATAATATATTAAAATTATATAAATCATATGGATCAACCAGAAGATAACTCATTTT
TAGATAAACTTACAAATTTTAAAATAACTTGCATGCTTAAGAAAAATATTTTAAAAACAAGCATGAAAATAAAAAATACATGCCAAAATAAATACCAATA
CAGGTCCAACGCACATAAGCCAATAAATCATGTTACATTCTACATTCCTCCTTGGAACATTAATAAATGTTCATTCTTTTTGTATACACTTGATACATGC
GATAAATTTATCATGATAACCAAATTTATGTGATCCACGTAATTATTTGAAGACTTATTATATTGTCTTAGCAGTGTAGTATATACCACAAAAACTTTGT
AACCAAAAATAATGATTCAAATATCTTTATTATGTTCTAGAAGACTCTTTTTTTTTCAAGTTGCTGGAATAAGCTTGTCTAATAATAAAAAATAATCCTT
TTATTAATATTTAAATATTAAGACATTTGTCAAATAAGTTAATACAAATGAACATTTTTTATTTTAAAAATTCATAAGTATAATAATAACATTATAAATG
ACTAAACGATAAAACATAGAGTATGGTTTTAAATTGTTTTAATTTGTAAAAGTATATTAATGATTAATTTATTACACCAAAATACATATATTTTAAGAAG
CTATACTTAGAAGTGGATGTAGACTTATGTCCTTGTTCAATTAAACCTGCTATTTTCTAAATGTACTTGTTGCAGGTTCTTTGAGAAAAAAAATTGAGGT
CTTACCTACGTTGTTATTGTTGATAATGATGATTTCTGATGGACAAATTAATTTCTATCATATATGTTTTTGTCCACAAGACCTCAAATGTTTTCTAAAA
GAATATATAACATGTCCATTTGAAAAATAATAGGTTGATTGTGTCACGACCCAAAACGAGCCGCGAGTGGCACCCACACTTATCCTACTATGTGAGCGAA
CCAACCAATCTAAACCCCAACATTTCAACATAATAAACAGAATTTAATGCGGAAGACTTAAAACTCATTAATTTAACCAATAAATAACTTCTAAAATTTA
ATACTTATTATTCCCAAAATCTGGAAGTCATCACCACAAGAACATCTATCCTCAAATTACTAAATCTTAGATTATCTAAGAAGCTAAAATAAATAAACAG
CTAGTCCATGCCAGAACTTCAAGGCATCAAGACATGAATGAGAGAGAATCTAGTCCGAGCTAGGAACAATAGGTCACCCTGAAATCTGACGTGATGAAGA
CTGGCTAGAGTTGCGGATGAGTCGAAGTTGATGGCACGTTTGCTGCATTCCATAAATAACAAAGAAAGAAACATACAAGTAGGGGTCAGTACAAGGCACA
AGTACTGAGTAGATATCATCGGCCAACTCAAAATAGAAATCAATATATATTAAACAATAGAATAAAATTAACCATAATACTTAACAGGTGACAACAACAA
GTACAAGGATCATTGATAACAACACCAGGCGTACCCATGACGACTCAAGCCTCTACACCATACTCATTTGAGAAATAGGTTCTTTAAACCTTAGTATATT
AGCATAATTCAAGATTCATTATTTCTCTATTATCCTGGTGTCGGAACGTGACACTCCGATCCCCTACTATCCTGGTGTCGTAACGTGACACTCCGATCCC
CTACTATCCTGGTGTCGGAACGTGACACTCCGATCTCCTACTATCCTGGGGTCGGAACGTGACACTCCGATCAATTAACCTCATTCTTTTAGTTCATCAA
GCCTTTTTTTTTATACCAAGGCATCATCATTAATAGAGGGGTTTTAGGGTTTAAGATTCAACAGCCTCATCATGCTAATTCATCACAATTATATAATCAC
ATCATGCAACCACACAATTAACCATATAGAAGACTTTACAATACTACCCAATACATATCAATCGCTATTTAGAGTTTACTATGGAATAGCATAAACCATA
ACCTACCTCCACCGAAGAATCGTGATCAACCAATCTACTTTCCCAAAGCTACGTTCTTCTCTTTCTCTCGATCGTTCTCTCCTTTTCTTTCTGATTTTTC
CTTATTCAAACTCTTTCTCTTTTACCCTAATTATCATATAATTAAGTATAAAAGATGATAAAAGTAACCCACTATTTAGTTCAAGGTTTTATCATTTAAC
CCCCAAGTAAATAAGTTATTAAACTTATCCCCTTATTTCATACAGTTTGTCATAAATAGTCCAAAATGCCCCTTTAAAAACTTTTAACAGAAATCCGACT
TACTCAGGGTTACGCAGCCTGTGACGGTCCGTATTGCATGTCCGTCACAAAGTTCAGAGAGTTAATTCTGTTGAAAGATTTGTGACGGTCCGTCGTGCAA
ACGACGGTCCGTCCTGCCATTCCGTCGCGAAGTCCAGAGAGTCGATCTCAGTACCCAAATTTCAGAATCTAAGTGTTTTGGAACGAGACCCTCTCGACGG
CCCGTCGTGCCCATGAAGGTCCGTCGTGGGATCCGTCGACCCAGACAGTTACTACCAGAAATAAACTCTACTGCTCAAAATGACTAAATAGGTCGTTGCA
ATAGATACCAATTTACCCATCATTCGTCCTCGAACGATCACAGGAAGAAAAACAAGGGAGAGAAAGAGTACCTGAGTCTATAAAAAGGTGTGGATATTTT
TCTTGCATATCAGCCTCCTTCTCCCAGGTGGACTCTTCAACTAGCCGATTCTTCCACTGAACTTTGATGGATGCAATCTCCCTTGACCTCAACTTGCGAA
CTTCTCTATCTGAAATAACATTAGGCTCCTCCTCATAAGACAAATTCTCATCAAGAAGAACTGAATCCCAACGAATGATGTAGTTTCCATCCCCATGGTA
TCTTTTCAACATAGACACATGAAATACCGGGTGCACTCCTGACAGTCCTGGGGGCAAGGCCAATTCATAAGCTACCTCCCCCACGCGCTTCAAAACTTCA
AATGGACCAATATACCTCGGACTAAGCTTACCTCGCTTACCAAACCGCATCACCCCTTTCATTGGCGAAACCTTCAACAAGACTTGCTCACCCTCCATAA
ACTCCAAGTCTCTAACCTTTTGATCTGCATATTCTTTCTGCCTACTTTGAACCGCTAGAAGCATTTCCTGAATGCATTTCACTTTATCTAACGAATCCCT
CATAAGGTCAGTACCCCAAGGTCTAACCTCAAATGCATCAAACCACCCAATGGGAAACCTACATCTTCTCCCATACAGTGCCTGAAATGGGGCCATATCA
ATACTCGAGTGATAGCTATTGTTGTATGAGAACTCTGCTAAGGGTAAGAAGTTATCCCAATGACCACCAAACTCTATCACTCATGCACGAAGCATATCCT
CCAAAACCTGAATCGTTCACTCAGATTGACCATCGGTCTGAGGGTGAAATGCAGTACTAAGATCCAACCTAGTACCTAATTCAGCATGAAATGTTTTCCA
TAACTTAGAAGTAAACTTCGTACATTTATCTGATACCAAGTTTGTCACGACCCAAAACGAGCCGCGAGTGGCACCCACACTTATCCTACTATGTGAGCGA
ACCAACCAATCTAAAACCCAACATTTCAACATAATAAACATAATATAATGCGGAAGACTTAAAACTCATTAATTTAACCAATAAATAACTTCTAAAATTT
AATACTTATTATTCCCAAAATCTGGAAGTCATCACCACAAGAACATCTATCCTCAAATTACTAAATCTAAGAGTATCTAAGATGCTAAAATAAATAAACA
GCTAGTCCATGCCTGAACTTCAAGGCATCAAGACATGAATAAGAGAGATTTCACCATCAGACCGATGGTCAGTCTGAGCGAACGATTCAGGTTTTGGAGG
ATATGCTTCGTGCATGTGTGATAGAGTTTGGTGGTTATTGGGATAACTTCTTACCCTTAGCAGAGTTCTCATACAACAATAGCTATCACTCGAGTATTGA
TATAGCCCCATTTGAGGCACTGTATGGGAGAAGATGTAGGTCTCCCATTGGGTGGTTTGATGCATTTGAGGTTAGACCTTGGGGTACTGACCTTCTGAGG
GAATCGTTAGATAAAGTGAAATGCATTCTGGAAAAGCTTATAGAGGCTCAAAGTAGGCAGAATGAATATGCAGATCGAAAGGTTAGAGACTTGGAGTTTA
TGGAGGGTGAGCAAGTCTTGCTGAAGGTTTCGCCCATGCAAGGGTTTATGTGGTTTGGTAAGCGAGGTAAGCTTAGTCCGAGGTATATTGGTCCATTTAA
TGTTCTAAAGCGCGTAGGGAGGTAGCTTATGAATTAGCCTTGCCCCCAGGACTGTCAGGAGTGCACCCGGTATTTCATGTGTCTATGTTGAAAAGATACC
ATGGGGATGGAAACTACATCATTCGTTGGGATTCAGTTCTTCTTGATGAGAATTTGTCTTATGAAGAGGAGCCTGTTGCTATTTTAGATAGAGAAGTTCA
CAAGTTGAGGTCAAGGGAGATTGCATACATCAAGGTTCAGTTGATGAAAGAAACATACAAGTAGGGGTCAGTACAAGGCACAAGTACTGAGTAGATATCA
TCGGCCAACTCAAAATAGAAATCAATATATATTAAACAATAGTATAAAATCAACCATAATACTTAACAGATGACAACAACAAGTACAAGGATCATTGATA
ACAACACCAAGCGTACCCATGAGGACTCAAGCCTCCACACCATACTCATTTGGGAAATAGGTTCTTTAAACCTGATTATATTAGCATAATTCAAGATTCA
TTCTTTCTCTATTATCCTGGTGTCGGAACGTGACACTCCGATCCCCTACTATCTTGGTGTCGAAATGTGACACTCCGATCCCCTACTATCCTGGTGTCGA
AACGTGACACTCCGATCCACTACTATCCTGGTGTCGGAACGTGACACTCCGATCCCCTACTATCCTGGTGTCGAAACGTGACACTCCGATCCATTAACCT
CATTCTTTTAGTTCATCAAGCCTTCTTTTATACCAAGGCATCATCATTAATAGAGGGGTTTTAGGATTTAAGATTAAACAGCCTTTTCATGCTAATTCAT
CACAATTATATAATCACATCATGCAACCACACAATTAACCATATAGAAGACTTTACAATACTACCCAATACATATCAATCGCTATTTAGAGTTTACTATG
GAATAGTATAAACCATAACCTACCTCCAGCTAAGAATTGTGATCAAGCAATCTACTTTCTCAAAGCTACATTCTTCTCTTTCTCTCGATCGTTCTCTCCT
TTTCTTTCTGATTTTTCCTTATTCAATCTCTTTTTCTTTTAACCTAATTATCATATAATTAAGTATAAAAGATGATAAAAGTAACCCACTATTTAGTTCA
AGGTTATATCATTTAACCTCCAAGTAAATAAGTTATTAAACTTATCCCCTTATTTCCTACAGTTTGTCATAAATAGTCCAAAACGCCCCATTAAAAACTT
TTAACAGAAATCCGACCCAGTCAGGGTTACGCAGCCTGTGATGGTCCGTCAGTAATGTGACGGTCCATACTGCATGTCTGTCACAAAGTTCAGAGAGTTA
ATTTTGTGGAAAGATTTGTGACGGTCCGTCGTGCAAACGACGGTCCGTCCTGCCCTTCCTTCGCGAAGTTCAGAGAGTCGATATCAGTACCCAAATTTCA
GAATCTAAGTGTTTTGGAATGAGACCCTCTCGACGGCCCGTCGTGCCCATGATGGTCCGTCGTGGGATCCGTCGACCCAGACAGTTACTACCAGAAATAA
ACTCTACTGCTCAAAATGACTAAACAGGTCGTTACAGATTGAATCAGTAAACAAGACAACATTGACATGTGGTTCTAACTTCTCTAAACATGTAATAAGT
GTAATTGCTTGATCATTAGTACGTTCTTAAATATTGAAATGTTTTAATGTTGTATTACTTTTTTTCTTATCATGAGTCATTTATAATGTTATTATTTTAC
TTGTAGTTTTTACAAAACAAAGATTTTCCTTTCTAATTACCTTAATTGGTATATATTGCCACATTTTGATAGTGATAAAGGTTGAATGTTTTTGTTGTTA
GACAAGATTATTCAAGCTGAATATGAGAAACATATGGAAAGAGAGTCCTGGAAATAGAAGAATAATATTTGAATCTTTGTTTAGAATAGAAAGTTTCAAT
GATAAAGACAACACTATTGATATATTATAACCAATCTTCAAACAATGCCAATTTTGCTTTCATAATAAATTTATTATATGTACCATGTGCTAAAAAGAAT
GAAGGTTCCATTACACTCTAAGGAGGATCGAAGAATCTATCATGATTCTTTGGCTTATGTACGTTGAAAATGTTTTGATATTCCTTTTGACAAGTAGGTT
TTCTTTTCACGCTTCATTTTTTTTAATATTATATTTTTCATATGAAGCTTTAGTTTTCAATTAGTTGTTCATATTAAACGGAATCTTCTCTAATTGATCA
ATTTGATTTTCATAATGAAAAGTTGTTATCAGGATCAATTACTAGTTGAAAATGATCTTAATAATATATTAAAATTATACAAAACATATTGATCGACTAG
AAGAGAACTCCTTTTAAGATAAACAACTAATTTGAAAATAACTTGCATGCGTTAAATAAAATATAAAAAATTAAGTATGAAAGTAAAACATACGTGCCAA
AATGATTATCGACACACTTTCAATGCCATAAGCCAATACATCATAGTACATCCCTCCTTAGAACGTAATGAGTGTGCATTCTTTTTTTGTACTTGATACG
TATTACAATGACTTATTTATGTGATTCACTGACTTATTTGAAGACTTATTATAATGGCTCAACAGTGTAGTATATATCACCGAAACTTTGTAACCATAAA
ACAATAATTCAAATATTTATATTCCATTTTATAGAATACTCTCTTTCTTCATGTTGCCGAAGTAATCTTGTCTAATAATAAAAGATAATCCTTTTATTAG
TATTAAATTATGGAGACATTTGTCAAATAATTTAATAAAAATGGATATTATTTTATTTAATAAAAAATTACAAGTACTATAATAACATTCTAAATGACTC
AATGAAGAAAAAAGAGAGTACTATTTTATTTCCTACTTTATTCAAATAAGGGAAACGTCATAGTGATTCGAAAAATAATTATTTAATTAAATTTTAAGAA
ATATAAATAATAAATGAACTTTAAAAGGAATCTCCATCTAATTTTAGGAAAAATAGAATATTATTTATATGATTCCCGAAACATTAGATTCGAGTTCAGG
TTATGTCGAAGGGAATTTGTTAAGCATTTTTCTAAATTTTTTTGTCGACCAACTTTGACCTATGATATGAGAAACATTATCTAAAATAACTCAAGCAACG
ACAATGCACTGGAAACATTACAGGAAGTGAATAGCTTTAAACAAAATATAATCCTAATTAAAGCAAAGCAGAATTAGAGCAATCAGAGAGTTACCAATTA
TAGAATAAATAATTTTTTTAAACTAAAACTTATATTAATCAAGGAAAAAGCACTCCAAAGAAAGAAAAATTATTGAGAAGTGAACACTTACAAAGCCAAA
TCTTGAAGCGTGACTAGTGGTGAAAGTTGTTGGTGGTAGTAAGAATTTTAAATCTTAAGCACGCCACCATGGTTCCTGGTTTGTTGAAGTGTCGTTGATC
GCCGGGATGGAGGGAAAAATGGTGTGGGTTTGGTTCAACTTGGAGCTTCGAGTACTATGGTGGCCTGCAAAACAAGTAGAAAAACGAAAATGAGGGAAAG
GGGTAAGGGGTCCGGATGATGGTCACTTATTTTTTATTATTCAGGTTCATCGGAGCAAAGAGCTCCTCGCCGGAGTTTGTGATGGAGGTCTGTTTGCTGC
TGGTCAGAGTTGCAGCAACGTGGTGGCATTTTGGTTCTTTCCGGTGGATTTTCGGTTGTGGAGCAAGGAAGAAGATGCCTGGTTTGTTGTTTGCTTCTGT
CGGAGAGGAAGAATAGTTGGTGTTTGGTTGGCGGCTGTGAGAGCTTATAGGAGGAGAGAAAAACCTAAAAAAAATTCGCCACCCTTAGCTTTTGACCTAA
TAGTTATTTGAATAGTATTATGGACTCAAATTATGGGCTTGTAATTGTGACTCAAAATCATTGAATAATTTGTTAATGAAGTTTTAGACTATGCAAAATA
CCAAAATAAATATTAACAAATAAAAAAAATTAAAAAAAATATAATGAACCTAACTAATAACGTGTAAAAATACAATTTTAAAATTAATTAATAAAATATT
CTAAATTTGATAAATAAGGATAGTTATCGATAAACTTATTTAAAATTATAAAAAAATTTATTTTAAACTATTAAATAAATAAAACTTAAAAATTGAAAAT
TTTGAAATGTTAGGTCAAAAATTAATGTCAACAATTACAATATTAAATTATTTCAATGGGTAAAAGCATACTAATGATTAGGTGATCACACCAAAATACA
TGCTTTAAGAAGCTATACTCAAAGGTGGATGTAGATTTATTTCCTTGTTCAATTGAACCTACCATTTTTCAAATGTACATGTTGGAGGTTCTTTGACTAA
AAAATTTAGGTCCCAAGAGAAAAATGTCACACATATATGACAAGAATTAATAAATACGTCCTTTAATACTAATTATTATCAATAATAGCATAATATACTC
TATGTAATTTTATAAGTGAGGTCTAACATAATATAGTAGGTAGACCTTACCTCTTTGGGAGATAGATAGTAAATAGATCTCAATTGGGAAATAATAAGTA
CTGCATTAGTTCACTTCTCTTATGAAATTTTACTTCTAAAAGAACAATCTAGTCAATTTATGATAGTCATCACAATACATAAAATGCAAATGGATAAGAA
AAATTAATGTTAGAAATTGAGATGTAATTGAAAGTCGTTGCATGCTAAATACACTATTAAAACTCACTATTTGAACACTAATATTTTCTATTGAAAACAA
TCAAAGGCTATTATAAAAAAGTTCCTAATTTGATCAGTGAGGAAATAAAATTGTAATGCAAGTGGAAACAAAAGTTTTCCTTTAATATAAGCTTCTTTGG
TAGATATTGTCACATTTTAATTCTAATAAAAGTGGTGAAAAAAATCTAATAAAAGTGAATTTTTTGTTCTTAGGCAAGATAACTCTAAATGAATATGAAA
AACACGCTGGAAGAGAGTCCTGAAAATAGAAGAAAAATACTTGAATCTTTAGGTTGGATGACAAAATTTCATTAGTAAATACTGCGTTACTAAATGTTCT
TAATCGAACTTCAAAAATGTCAATATATGAATTTATAGTGCATAGCAAGTGCAAAAAAAGTGCAGGTTCCATTGCTACTCTAAGGAGGATTGCAGAATCT
GTTATGATTCTTTGGCCTATGTACATTGAAAGTGATTTGATACTCCTGTTGACAAGTATGTTTTCTTTTCTCACTTTATTTTTTTAATACTATATTTTTC
ATATGCAAACTCTTCTTTTCAATTGCTTATTCATACTAAATGGAATCTCTTTTATATGATCAATTTGACTTTCATACAGGTAAATGATCTTAACAATGTA
TTTAAATTATAAAATGGTATTGATAAACTAGAAGAAAACTCTTTTTAACGTAAATAACGAATTTGAAAATACTTGCATACGCAAAACATAATTTTAATAA
AATTAAGCATGAAAAAAATATGTTTGCCAAAATGAATATCAAAACACTTGTATGTGTATTAGCTAATACATCATGGTACATTTTGCATTCCTCAGAGAAT
AAATGAATCTAAATATTTTTGTTGCTCTTGATATATACGATAAATTAATCACAATGACTAAATTTATGTGATCACTTGACATACTTAAAGATTTATTATA
AAATTTGAGCAGTGTAGTATGTACCATTGAAATTTAATAATCATCAATAACATTCAAATAATGTTATTTCATTTTATGGAAGACGGTCTTTCATCATGTT
TCTCAAATTTAACCAGAGTAAACTTGTTCAATAATATAGGATAATCTTTTTATTAGTACTTAACTATAAAGACATCTATCAAATACGATAATAAAAACAT
ATATTTTTCTGTTTCGTAAAAAAAATCATAAGAACAAGTACGATAATACCATTCTAAATGACTTAGAGAAAAAAAATAGTATAATATGTAATTGTTTCAA
TAGGTAAAAACACACTAATGGTTAGGTGATTACACCAAAATGCATGTTTAAAGAAGCTATACTCGGAGGTGGATGTGTAGACTAATTTACTTGTTCAATT
GAACCAACCATTTTTTAAATGTACATATTGCAGGTTCTTTGAGAAAGAAATTGAGGTCCTAAGAACAAAATGTTACACATATATGACAATAATTAATAAA
GGCATAATACATATATTGAATCCTAAACTTGACATCAAATTTTAACTTTGATCTCCAACTTTCATAATGCACAAACAGACAATTTAACTATCCAACTTTC
AAATAATAAACACATGAGTCCTACATGGCACAATCCACATAGGACACCACATATGACAAAAAATAACATGTAGGATGATATGTAAGACATGTGTGTTTGT
TCGTTCAACTTTATACAAGTTTAAGTGTCTACTTGTGCACATCCAAAGTTGAATGACATAAATATGATTCAAAACCAAGTTAAAAGACATATTTATGTAT
TATGACATTAATAAATACGTCCATTAATACTTATTATTATACACAATACATTCATTATGATTTTACAAGTGAAGTCTAACATAATATAGAAGATAGACCT
TACTTCTTTAGAAAGATAGGTAGATAGTCCAATAGATGTCAATTGAGAAATAATAATAATAATAATGTAGTAGTTCACATCATGTGAAATGTAACTTCTA
AAACAACAATCTAGTCATTATATGAAAAGCATCACAATACATACTATGAAAAGCATCACAATATATAAAATGTAAATGGTTAAGAAAAATTAATGTTGTA
ATTGAGATGTACTTGAAAGTTATTACATGCTAAATATACTACTGAAAGTCACTATTTGAACTCAAAGAATTCTATTGAAAACTGTCCTAGGCTATTGCAA
AAAAAAATTCACTTTGATTAGTGAAGAAAGGAAAGAGTAATGCTTTCATGTGAAAAAATTAGGATTCTTTTCACTATTAAGTGATTTTTTCTCACATGCA
TTTTTTGATTAGCTACTTTTATGGACATCAAGTGAAAAAATTAGGAATCTTCTCACTATTAAGTAATGATTTACTTTTCGTATGCATAGTTTAAATGGAA
AACGAGTGATCATGCCAACTGATATTTATGTAGGAAATATGGAAGGAAAATAGTATCTTTAGAGAATGCTCAAGTTTATTATGGGCTACTTAAGATCACT
TGAGATGATTACAATCATCAACTATATCACTTTTTGTAAGACTCAAAATAAAAAACAAAAAGTCTTTCACAAATAACTAAATACATGTATCACAATTTAC
TAGATACACGTACTATGAAATTCTACAGAGAATTTTTGAAAAACTAAGAGACAATTTTGGAAGACTAAATATTGATGCATTAGTTCTAACACCCCCCCCC
CCTAATGCATTTGCCTGATAACTCCAATGTGTTCTCGATGATAGCAAAAACAATTTCTAAAAAGTGCTTTGGTGAAGATGTCAGAAATTTTTTCTCTTGT
CTGACAATAATGTAACTGAATTTCGCCTTTCTCTTTTGCTTCTCGGATAAATAGATATTGTATGGAAATGTTCTTTGATCTTTCATGGCTGACTGAATTC
TTGGCAATTGCAATTGTTAATTTGTTATCACAATACAAAACAATTCCTCTTTTTTGTTTTTCACCAATGTCTTCAAATATTCTCCTAAGCCAAATAGCTT
GGGAAGTAGCCTTGGATGCTGAAACATATTCTTTTTCGATAGTGGATTGAGCAACAACGCTTTGTATTTTTGATAACCAAAAACAAATACTTGATCCAAA
TAAGAGAGCATAACCAGAAGTACTCTTCATGTAATCTATACTTCCAGCCCAATCCCTATCAAAATAAAAAATTAAGTTCAAATCTCCACCTAATTTGTAC
ATTATCCCATAATCCATTGTTCCTTACAAGTATCGTAGAACACACTTTGTAGATCTAAAATGCACTTGGCTTGGTTCTTGCATGAATCTGGATAATAAAC
TAGCAACAAACATAATATCTAGCCTTGTTGAAGTAGAATATAGCAAACTTCCAATCAAGCTCCTATAAAGTGAGCTATTAACTTTCTTTTATCCATCATC
TTTTCTAAAATTTTCATTTGCTTGTAATGGTATGGCTACAGACCTGCAATCCATCATTTTGAATTTTTGAAAAATACTTTTAGTATACTTCTTTTGAGAA
ATGAAAATTCCTTCTTCCACTTGAAAAACTTCGATGCCCAAGAAATAATTTAGCAACACTAGATCACTCTTTTTATAGCTTGCATCATATCTTGCTTGAA
ATTTTGCATCATCTTTACATCATTTCTTGTAGAGAGCAGATCATCCATATTGAGACAAATAATGATAATGCTGCCATGTTCTTTCTTCACATACAAAGTG
GCTTCACTCTTACTTTTCTTAAAATTAATTTTCAAAAAGTATGTATCAATTTCATTGTACCAGGCTCTTGTAGCTTGTTTCAGCCCGTAAAGAGCACGCC
TTCTCTTCTCCCCATTGAACAAAAAATCCTTGAGGTTGCTCAACATAAATCTCTTCATCAAGTTTTTCATTCAGAAATGAAGATTTAACATCAAGTTGAA
ATATCTTCCATTTTTTTGTGCAACAGCAACAATTATAATTCTAATTGTCTCAAGACGAGCAACTGGAGAGAAATTTCCATAAAATCACTACCTAATTTTT
GTGTGAAATCTCTAGCAACGAACCTTGCTTTGTGATTTTTGAATATTTCCTTCCTGGTTGAGTTTGATTTGTAAATCCATTTTAGACTTACAACTTCTCT
TTCTTTAGGTATAGCCACAAGCTCCCAAGTATTATTTTTTTCAATCATCAAAATTTCTTCTTCCATGACTTTCTTTCAAACATCATGCTTTATTGCTTCT
TCATAATTTTCTGGCCCAACACCGGCAAATTTACATATTTGATAAATGTCACTCAATATTTTTTGTCATCTTGAAGGCGGTTCTCTATCATCTGAATTTG
GGATTTCTCTCCCTTGAGAGACATCTTCATATTTCTCATGCTCTTTTTGATTTGAAGATATGATAGCAGTATTCTCTATTTTCTTATCCTCCCAATTCCA
TGTTTTTTTTAAATCAAAAATAACATATCTACTAACAACAAGTTTGTTAGTTTTGAAATCAAAAGGCTTATATCCTTTTGTCACATCACTATAACCAAGA
AAGATACATTTTTTCTGACTTTTTTCATCAAATTTTGTTCTTTTCTCATATGGTGCATGAGCATAACAATTACACACGAAAATTTTAAAATGACTTACAG
AAGGTTTGATTTCACTCGAAGCTTCAACTGGTGTGTAGTCCTTTAGTGTCTTTGTTGGACACCTGTTAAGGATGTGAATTGTTGTATCCACTACTTCTAG
CCAAAAATGTTTTTGCAACCTTTTCTCATTCATCATATTTCTGACCATTTCAACAAATGTTCTATTTCTTCTTTTAGATACACAATTCTGTTAAGGAGTA
TACCCTACTGTATGTTTCTTCTGAATGCCTTCATTTTTGCAATATTCTTCAGATTCTCGACTTGTGTATTCACCTCTTCTATAACTGCGAATAGTTTTGA
TGCTGCAACATTTTTGCTTCTCAACAAGGGCTTTAAATTTCTTGAATGTAGCAAATGCTTATGACTTTTCTTTCAAGAAATAAAACCAAGTCATTCTCGA
GAAATCATCAATAAAGATTAGAAAATACCTTTGACTTCTAAGAGATGAAGTCTTCATTGGTCCGCAAATGTCGATATGGATTAGCTCCAAAAGCACATTT
GCTCTCTAAGACACCCCTTTTGAAAAAGACTTCCTATGTTGCTTTTCCATTATGCAACTTTCACATGGATCCACCTCAGTATGTATCTTAGGAAGGCCTT
GCACCATGTCGTTTTGCTTGAGAAGCTTCAAACCATGAAAATTCAAGTGACAAAATCTTTTGTGCCAAAGCCATGAATCATCTACAATTTCATTTTAAAT
GCATTGTAATGAAATTGCAAAGGGAAGTTTCTTTTTATCTTCTTTACTTCAACAAGGACTTGATTTTGACTCAATTTTATCATAAATCCTACAATAATTA
TCTCTAAACACAACAGAATAACCATTTTTCATGAGTTGACCAACACTAAGAAAATTTTCTTCCAAGTCAGGAAGATAAAGACATCATGAATTTTCTTATT
GCTTCCTTTCATGTTGATCGAAATAGTATCTTTACCTTTCGCATCAGCTAAGGCGCTATTTCCCATTCTCACTTTAGTAGTGATGCTATTATTAATTGAG
AGGAAAGTCTTTTCATCTCCAGTCATGTGATTACTACAACCACTATCAACATACCATTCATTGCTTTTTGTTGAAGCACCAGATTTAGAAGCAAAGAAAA
GATTTTCTTCCCTTTCTTCCTCTTGTTTTTCACAAAAAATTGCTTGCTCCAGTTTCTTGTGCCAGCAATCCTTTTCAATGTGGCCAAACTTTTTACAAAA
GTTACATTGGGCTTGCCTTTGTGCCAACATTTTTCTGCAGTGTGATTAGTCTTTTTGCAAACATTACAATAAAGACTAGAGTTTTTTCCACCTTTTTCAT
CAACCTTCTTGGAAGAACCATCATGATTCTGCTTCTTTTTTGGCTTGTAATTCTTCTTCTTTTGATTTTTTGAGAAATTTTGAGAATTCTCATTTGTTAG
ATAGGAAAGTCGTCTCTTTGGGTTGATCTTCACGAAAAAATCTTCGCTTTTCGTGTGCATGAAATGATTCAACTAGCTCTTTGATGGAAAGCTTAAAAAG
ATCTTTCGTTTCCTCAGTGATAACAACAATGTAATCATACTTTTCTTTGATACTAACAAGAATCTTTTCCACAACTTGTTGGTCCGAAATTGATAGGAAA
GAAACAAATTGCGGAGATATATTGTTTTGTGAGTAAAACACAATGGAGAAGAAGCGAGGACTGATGGAAAAGAATTTTTTTAATTGACTGAAAAAAAAAC
TGCAATGCAGTCATTCTACTAAGCAAAAATATAGTAAACGTTAAGCTAAAATATAGTAACTATCCAACAAGATTTTCTCCTAAAAACTAGGTAACAACCC
ATGTTTAAACTACTTCCTAAAGACTAGGACAAACAAAACAGATAAGAATTTATTTTCTAACAGAACTCTAATTTACTAAACTGAATTATTAAAACTAACA
CCCTCCCTTAAACTGAAAGTTCTCAAGCTTCAGTTTAACTTCAGCTTCTTGAACTCTTCCATTGTGTGGATGCCCATCAACCTCCTCAGCTTTTGGAAAG
GGAGAGACCTGAGAGGTTTAGTAAAAATGTCCGCCAACTGATCTTCACTTCGCCAATACTGCAGCTACTGTTCCTTCTTTATTGAGATCTCACAGGAAAT
AATAATTCACATCGATGTGCTTGCTTTTTCCATGTAGAACATGATTTTTCGATAGCTTAATGGCAGAGTTGTTGTCACAGAAAATTATAGTTGCTCCTTT
TTGTTTGAATTGTAGTTCTTCAAAAATTTTCCTCAACCAAATAGCTTGACAAGCACAGGCTGTAGCAGCAACAAATTCTGCTTCAGTGGTCGATAAAGTG
ACAATTTTTTGCTTCCTGGAAGACCATGAAATAGCCCCTGTGCCTAGCACAAAAACATATCCTGAAGTGCTCTTTCTGTAGTCTTGATCACCTGCATAAT
CGTTGTCAACAAAACCAATCAAAACAGATTTTTCACCCTTCTTGTAGAACAAACCGAAATCCTTAGTTCCTTGTAAGTAGCGAAGGATTCTCTTGGCAGC
TAGCAGGTGAATTTCCGTCGGGCTCTCCATATACCTGCTTATAAGACTTACACCATACATGATGTTGGGCCTTGTGGCAGTAAGATACATCAAATTACCT
ACAATTTTCCTGTAGAGTGTGTTGTCTACCTTATGTCACGGACTTTTCAATTCGGACAATACTCCGTGCGTAACTTGACGGTTTGCTCACGATTCTTTCA
CGATCTCGCAAACTCAAGTAATCCTTTCACTACTTTGGATCGCTAAGAGAAATAAGAAAGAGATACAAAGACATATTTTGGAAGAATGGACTAGTATATT
ATTAGTCAATTGAATTGTTGGATGTCTTTACAAATACAATGACCCTACTATTTATACTACTCTAATGACTAAGAGTAATTAAATACAACTATACAAGTCC
CTATGTTCATGCACTCAAGGCATGACTACATTCTAAGAATGTCTAAGTCTTCCAAAAAGGACTCCTAGCCTTGACTAGTCTGCCCCCACGTCCTTGAGGC
CTTGAACAAGCCTCTTCAAGGCTTGTAATAGCCGCCTCTCCAGCTGCAGTAACAGCTGTAACGGCTGTAACTACTGTAACAACTGAAACGGCTGAAACTG
CCGAAACTGTTGTAACGGCTGCCCCTCCAACTTCTACCTGCTTGAGCGCCTGCACCTTGGTCTGCTGACAGGTGTGGGCTGCCTAGGCAGGTCAAAAACT
GCCTGGGTATCTGGAGGGTCGTGACAAACTCCCCCACCTGATGATGCGACGACCGCGTCGCATTGCGTCCGTATCGGCGTTGAGTTCTACCAGGCGACCA
TCAACTCGCGTACTCGATCAATCCCTTCGAGCAGCCTATTCATCGATGTCCCGACCTTTCTCGACCCGATCTTCCGAACTTCCTCCTTCAACGGAGGCAA
GTGCTCCGACGGCTTTTTTATCACGTCAGCATTCCTACTCGGAACCCTCTTACTGCGCGGTGGAAAGGTCTTTCCAGCACCATTGTCTTATCTCAAACTG
GCAATGGTTGCTTCCGCTGTTAACCTTCTTCTCACGTCGACCCTCTCGAGCTTCATAGCTGTCACTCAAGCCTGTCCCTCCGTCGCCTGCGCCTTCACCA
TGGGAACTGTATATTTCCTTCTTTTCTCCATGATTGTCAATTTTTGGAGATGAGGATCGATTACTGCATGGCACTGCTGGAAGAATTTCTGCCAAAGAAT
AACATCAAACATATTGATGGGGGCGACCATGAACTTTGTTTTCCCTTGCCAATCGCCTACCGTGATGTTCACCCCGTGTGCAACTCCAACTATAGGAGTC
GGTGATGCGTTGACAGTCCTGATTTGGGCGTTGCTTGAAGTATATCACAACCCCAACCTCGTTGCTGCCGCCTTGGTCATAACATTGACCTCCGCACCGA
TGTCGACCAACGCACGAGCAATCTGCCCATTGACCGTGATGTCGACTGTTTGAGCCCACGCTATAGACTTCGCAAGTCCCTTATCAGCATGCTTCGACTC
CGCTTGCCTTTGCTTATCTTGCCTTGGCCTCGTCGATGGTTGTTCAATCGCAGCTCCGCATAGGCTTACCACGCCCAACTGCTTAGTCTCCCTGACTTCC
TCTTGGGATTTCTCTTCCTTCCACTCACGAAGGATAGCACCAAGACTTTTCAGTTCAGGGCATCTTTTGTAACCATGCGGCCCTTTGCATATGAAGCAAC
CATCCTTGAAATCCCTTACCGTCTTGCCACGATCTTTGGGCTTCTTGCCGCTGGACCCGTAGGTGTCACACCTTTTGGGTTGTAGAATTTGCTCCTCGCC
TTCGCCACTGTCTTCCCCACTATCATCATGACTGCCTACCTCATCGTCCTCTTCGGCACTAATAGACTTCTCTTGCCTGAAGTTTGTCAAGGCTTCAGCC
TGCGTGATGGCATCGTCTATAGTCCTGACTTGACGCCGTTCCAACTCCGTTCTGGCCTAATTTTGCAGCCCATCCATGAAGTAGAACAATGCGTCGTTGT
CCATGAGGTTGGGAATCTGAAATGTAAGGGTGGTAAACTCCCGCACATACGCGCGTATGCTACCCTTTTGTCTCAACTCCCGCATCTTGCGCTTTGCCTC
ATAGACAACGTTTCTAGGGAGGAACGCCTTCTTGAACTCCACACGGAACTGCTCCCATGTGTTCAACGCGCATGTCCCCTTTGCGATGTCAAACTCTTTA
CGCTTCCACCATAGCATGGCCAACTCTGAAAGATATAACACAGCAATGTTGATCTTGTTCACATCACTACGGACCCGCATACACTTGAAATAATTTTCCA
AGTGCCAAAGGAAATTATCCACGTCTTGCGCGTCACGGACGCCTTTGAAGATTGGTGGCTTGGGCGCCTCAACTCTGGCTTCCCTTTCCCGGTCATGTGA
TGAGGATCCACCAACCTCTCTATCCTCCTTGAGTGCTGCCACTTCGGCCTTAAGCGACTCAACTGCGCCAAGTGCTCCCCTAAGCCTGAACTCTAGGGAA
GTAATGGCCTCCTTTGTCTCGTACTCGGCTCGCTGGTGTGCCTCCAACTCCTTCCGGACGCTCTCAACTTCTTCAAGGGAGTACTCTTCAAGAGTTTTGA
GATTTCTGTCCGTTCTGTTCAAGCGCTGGCCTATGATCTCAACAGTTTGCCTCGCCATTTCGACCCTTGCAATCCACTCCGGTCCGACAGTAACGTCCAC
GTACTCCTCGTCGGTGTCTTCGTCACTTTCATCGACAATTTGGGGAGGGAGAGATGTTTGCCCTTCGCTTGGTGTAGGAACACTTGGTGGAGGAACACTT
GGGGGAAGTACAGGCAGATTGGGTTCATTACCCGTCTGCTGCTTCTTCCCTTCCTTGTTCTTCTTGCCACCATCAGTACGGACGTTAGGGGTGCTGCTAG
CGCCGTCTCCTTCGTTCGTCATTCTCTTACGATGGACCTGCTCTGATACCAATTATCACAGACTTTTCAATTTGGACAATACTCCGTGCGGAACTTGACG
GTTTGCTCACGATTCTTTCACGATCTCGCAAACTCAAGTAACCCTTTCACTACTTTGGATCGCTAAGAGAAATAAGAAAGAGATACAAAGACAGATTTTG
GAAGAATGGACTAGTATCTTATTAGTCAATTGAATTATTCGATGACTTTACAAATATAATGACCCTACTATTTATACTACTCTAATGACTAAGAGTAATT
AAATACAACTATACAAGTCCCTATGTTCATGCACTCAAGGCATGACTACATTCTAAGAATGTCTAAGTCTTCCAAAAAGGACTCCTAGCCTTGACTAGTG
TGCCCCCACGTCCTAGAGGCCTTGAACAAGCCTCTTCAAGGCTTGTAACAGCTGCCTCTCCACCTGCAGTAACAGCTGTAACGGCTGTAACTGCTGTAAC
AGCTGAAACGGCTGAAATTGTCGAAACTGTTGTAACGGCTGCCCCTCCAACTGCTGCATGCTTGGGCGCCTGCACCTTGGTCTGCTGACTGGTGTGGGCT
GCCTAGGCAGGTCGCGAACTGCATGGGTATCTGGCGGGTCGTGACACTTAGCTCCTCTACCAACATTGTTTAGCTTTAGGCCAAACTCAACTGGAGTATC
GACGGAATTGCAATTCTTCATCTTGAATCGGTTTAAAATTTCCCGCACATATTTATTTTGGGAAACAAATATACCATCATCAGATTGCACTACTTCAAAA
CCAAGAAAATAATGCATCTTACAAAGATCAGACATCTCGAATTCATCTATCATAGATTTCTTAAAATAAGAAAACATGGCACTATTATTCCTGGTAAATA
TAAGATCATCAACATATAAACACACAATGAGCATTTTCCCAAACTCTCCAATTTTAACAAAAAGAGAGTGCTCATATGGACATTTCAGGAAACCAACTTT
TAGAAAGTAAGCCTCAATGCGACTATACCAAGCTCGTGGAGCTTGTTTTAGTCCATAGAGAGCCTTTTTCAACTTGTATACCTTATGCTCATCTCCAATT
TTAATATAACTAGAAGGTTGTTCAATAAATACCTCTTCATCCAAGTATCCATGTAGAAAAGCTGATTTGACATCCAATTGAAAGATAGGCCACGAATTTT
GTGCCGCCAAGGCAATTACCATTCTAATGGTGTCATGCCTTGGGACTGGAGCAAACACTTCAGTGTAGTCCACACCATGCTCCTGCTTGTATCCCTTAGC
CACCAATCACGTCTTATACTTGTCAATTCCACCATCTTCTTTTAATTTTGTCTTATAGACCCACTTGACACCAATGGTTTTTTGCCCCTTCGGAAGATCT
GATAACTCCAAGGTACCATTTCTTTCAATAGCATCAATCTCATCATCCATAGCATTCCTCCATTTCTCCTCTTTGACAGCATTCTCAAAATTTGTAGGAT
CGCAATCTGCAAACAATGCAAAATGGGAAACATCTTCATTAACATCAATTCCTGTTACCTTATAATCCGTCATCCACGCGGGCCTTCTGCGAGCATGACG
AAGAGGTTGTTCAGCTGCATCAGTTTCTTCTAAAGTTGCTGGTACAGTTTCAGCAGTTGGTGAAATTTCAGCAACAACTGGTAGAATTCCAGCAGCTGTA
GAAGCTGAATTCTCTGCACTTTCAAGCATCACATCTACTTCTTCGGCTCCAGTATCAAACGCAATTGGAGTAGACTTCTCCATACTCCATTTCCAAGTGT
TTTGTTCATCAAAAATGACATCTCTGCCTATCACAACTTTCTTTGTCAAAGGATTGAACAGCTTGTACGCCTTGGATGTGTCGCTAACACCAATAAAAAC
ACATCTCTCACCTCTATCGTCAAGCTTCTTTATTTTTTCTTCTGGGACATGTGCATAATCAATGGACCCAAAAATTTTAAAGTGGTCTATTGCCGGTTTC
CTTCCGCTCCAAGCTTCCTCAGGTGTAACCTCTCGAAGAGCAAAAGTGGGACATCTATTCAAGATGTAATTGCGCCAATTCACTACTTCCGGCCAAAATT
CCTTTGGAACTCTTCCCCTAGCCAGCAAGCTACGAACCATATTGAGAATGGTTCTATTCTTCCTCTCTGCCACACCGTTTTGTTGCGGTGTGTATGCTGT
TGTGAGCTCTTTCCAAATGCCACTAGTCTCACAAAAATCAACAAATACCTTAGAGCAATATTCTCCTCCGCGATCTGTCCGAAGGTTCTTAACAGTCCTT
CTAGTCTCATTCTCTACGCGAGCTTTGAAGATTTTAAATACATTAAAGGCCTCCGACTTTTCTTGCAGAAAATACACCCAAGTCTTCCTGGAATAATCAT
CAATAAAAGTAATAAAATACTTTTTACCTCCACTCGAGATCGGTGTTATTGGCCCTTAAATGTCTGAGTGTACCAACCCCAATACCTCTTTGGCCCTGCA
TGACTTACTTTTCGGAAACTGAGAACGATATTGTTTGCCAACAACACAATCTTCACACACTTGGGAGGGAACAACAATTTCAGAAGCCCCGTCACCATAC
TCTTCCTTTGAAGGATCTTCAAGCCATCAAAGTTCAAGTGACCATATCAAAAATCCACAACCATGATGGGTTTTTCACTTCTGCCATAGAGCAAGAATGA
ACATTTTCAATCTTCAAAGGAAACAACCTATTTTGACTCATTTTCACAATAGCAATAATTCCTTTGGAAGAATTAGAAATTTCACATGCATCATTCCTTA
AGATGATGACATATCCTTTTTCTAACAGCTGACCGACACTCAGCAAATTGCTTTTCAAAGCTGGAACATAGAACATATAAGATATGATCTCCACACACCC
ATTTTTGGTTCTAAAATTTATATTACCCTTTCCCGTCACATTCACAGTAGATAGATCACCAAAACTAATTGTCGATCGGAAGCTTTCATTTAAATAAGTA
AAAGAAGACTTACTTCCAGTCATGTGGTTACTACAACCGGTATCCACATACTAAAGAGCTTGTTGGTCAGGCTCTTTTTCAACATGAACTGCCATTAACA
AAGTTTCTCCTTCTTTGTTCTCAACAAAATTTGACTTCTCTTGTTTCTCATCAGGCAGCCTAGTATAACATTCAGAACGATAATGACCAAATTTATGACA
ACGATAACATTCTACCTTAGAATTATCGAAATACCTTTCTTTGACTTTACCGTAGTCATTACCTCTAAAATATCTACAGCCTTCTTTGTTGCCTCCGTCT
CTATTTCCATGATCTGCTCTTCCTCTTCCTCTACCTCTACCCCTTCCTCTAGAATTGGAAGAAATAAAAGTAGAAGCCTTCAAGGCCTGCTCCTCAGAAG
TTGAAGTTCGATTCATCTTCTGTTCATGTACCAATAAGGAGCTTTGCAATTCATCAAGCGATAACTCATCTATATCTTTTGACTCCTCAATGAAGCAAAC
AACATAATCATACTTCGGCGTTAAAGAGCGCAATATCTTTTCAACAATTGTGACATCGTTCATCTTCTCTCCATGGAATCGCATTTTGTTGCTAGTCTCC
ATCATTCTAGCACAGTAACTCATTACAGACTCTCCTTCCTTCATCTGCAAAGTCTCAAAATCCCTTCTCAAGGTTTGAAGTTGTGCGCGCTTCACTCTAG
CAGTACCTTGATATTTCTTTCTCATGGAGTCCCATATATCCTTGGAAGTTTCTTTACAAAGAATAGTTTCCAATGTAGGACGCTCAATAGCCTGAAAGAG
GTAATTTTTTGCCTTCAAATCTTTCAACTTTCTTGCTTCGAACTCCATCTTTTGAGCATTCGTCAAAGCCTCGACTTCCGTTGGAGCGCTGATGCCATCC
TTGATAATTTGCCAATACTCTTTTGACTGTAAAAAAATTTCCATCAGCATACTCCAAAGGTCATAATTACCATCAAAACGAGGAATGGTTGCTCGCACAA
AGTTACTCTCTGAAGCCATAAACTCACAATATCACTCTTTGTTTTCTTTTTGAAACTAACCTGCAGCTTTGATGCCACTGATAGGAAAGAAACAAATTCC
AGAGATATATTGTTTTGTGAGTAAAACACAATGGAGAAAAAGAGAGGACTGATGGAAAAGAATTTTTTTATTGACTGAAAAAAAACTGCAATGCAGTCAT
TCTATTAAGCAAAAACATAGTAAACGTTAAGCTAAAATATAGTAACTATCGAACAAGATTTTCTCTTAAAAACTAGGTAACAACCCATGTTTAAACTACT
TCCTAAAGACTAGGACAAACAAAACAAATAAGAATTTATTTTCTAACAGAACTCTAATTTACTAAACTGAATTATTAAAACTAACAGAAATGGTATCACC
ATGATTTATCATTTCATTAACAATATTCATTACTTTTGTGCAATATTTATCAATTTTTTCAGATTCTATCATCTTTAAATTTTGAATCTCTCAACTAAGA
GTTTGATGATTTATAGTGCATACCTTTTCGTCACCATACACCTCAGCTTTTAGAGAATCCCAAGCTTCCTTTGCAGTCTCACAAGTAGCAATTTTTGTAA
ATTATGCTCTTGAGACTCCCATTTGGATTTTGCTCAAGGCTTTTGCATCTTGACGATACTTAGACTCAAGATTTTTCATCTCTGCTGGTATAAGATCACC
ATCGTTGTCTAGCTCTTCAAAGCCATTTCCAAAATTAGTCCACAAACCTTCAACTTTCAAAAGTGTTCTCATTCTTATCTTCCAGCATTCAAAATCAGTT
CCATCAAAAAATGGAGTAATAACAATTGAAGAATCAACACATTCATTTCTTTTGAATGCCATATATTTTTTCTTCACCTAACACCAGATTAAAAACGAAC
ACATGCTCTATACCAATTTGTAGGAAATATGGAAGGAAAATAGTATCTTTAAAGAATGCTCAAGTTTATTATAGACTACTTATGACGACTTGACATGATT
ACAATCATCAACTACATCACTATTTATACTACTCAAAATAGAAAACAAAAAGTCTTTCACAAATAACTTAAAATACATGTATCACAATTTACTAGATACA
TGTACTATGAAATTCTAAAGAGAATTCTTGAAACACAAGAGAAAATTCCAGAAGACTAAACTTTGATGCATTAATTCCAATAATTTATTGTAGTAAACTT
CTAATTTATATTTGCATGCGATTGCATCATCATGCTTATATTTGTATACAACAAAAAAGAGAAAGGTGGGTAACCTTTTATGTAAATATTCATAACCCAC
TTTGACTGTAGTAATCTGAAGACATTTAATATTTCAATAAATTACAAATCTCAATATAATATGCCTTTCGGTTCCTCTGAAACTTAAAAATTTTCTTTTG
AGATTTACTACAATATCAATATTATAAACTAATTTTATTTCTCGATAGTAAAAAATAAATTTTTTTGAAACTCTTAATTAAGTTTGTGTACTTCCCGAAA
TTTCACAATGCCATTCTTATGGTGACCATCTCCTTCAAGAAGAAAATTATTATTATTATGGTTAAAATTATTAGAGTTTTTGGCCAAAAACATCCTTAAA
CTATACCCGAACTTTAAACTACATCCTTAAAGTATTATTCTTGGCAAAAAAAACTATTCTTCGAGTATTTAAATGAACAATTTTCATCCTTCTATTAGAT
ATCATAAAAAAACTAAGGCATCCTACAAAAACATGAGCAGTTCATGTGACTATCAACAAAAGTTTTCCTGCATAATTTCATTTTATGATATAAGAAGTTC
TTTAAAAAAAATATTAAAAATCTTAGACACTATTGCTTAGTGAAACAAAAAATGTTTGGAAGGTGTGAACATACATGATCTACTCTTTTTGTTATTCAGT
AATGGAACGAAGGTGGAGCTTAATTATCTTTACCTTTTTCATAGTCAAACTGTATTTAGATCAATAGATTTTTGGATCAATCTAATACACAAGTGATCAA
AATATTGATTATATCTTTTATTTGAGTTTCATTCTACATTATTAGAAAAGGAAGTCTCCAAAAAATGCAGCTTCTAGCATATTCGATTAAGAAGAAACAT
ATTTTTGCTAATATATTCAATTAAGAAGAAACACATTTCAACTAACAATATTTTTAACATCAAATTAATCCTAAACTCAATTTCAAGTTCACGATAGTAT
TTTGATGCATCTAAAAATAATAAATGTGAGGAATGAATTGATTTTTTTGGAATCTGTTATTTTCTAATAAATTCAAGTATAATGATGAAAATTGTTTACT
TTTAAATACTTCAAGAACATTTTCTGCTAAGAATGATACTTTAAGGATGTCGTTTATGTTTGAGGTATATTTGAACGATGATTTTCGCCAAAAACATGCT
AGACTTATTTCTTGACAACCAGTGATAAATTAGTGTTGCCACAACAACATTTATTTTGGTCATGACCACAACCTTTATAGAAAATAATTTTGTTTTTGTC
CTCCAATAGTTCATATTAAAACGTACCACATTAATTTGTGTAGTACTCAAAGTATATGATCAAATAATTATTTATGTCAAAATATCTATCTTCCATCTCT
CAAACTTCTCGTAGAGGTAAATTGTGACATTTATCTAATAATATATGAACATCTTCTTGTCCAGATGAACACAAGTCACATATTCTTCGAGAAATGGACC
ATAACCATTTGTATATGAACTTATTCTCATGCTCTGATATTATCAAATTTATGTGACTCATCTCGAAATCACTTTAAGAGGTCAAATGTACCAAATGTAC
TATCATTTTGTATTTCTTTATTTTGATGGAGAACCTACAAATCTTTTCAAATTGGGTTCATCAACAACAATGTGCAAAATATCTTTTCATACCACTTTGA
TGGATAAAAATTACCTTCACATTTGAAGGACCATCTTAAGAATCCATAATGTTCTTCCTTTTAGTTACAACAATTTTACCACACTCATAATAACACATTC
AACTACTTGTCATTTTCCATACATATTATGTATGTATTGCTACCACAATCCCATAAAAGAATGGAGTAAATTAATTGGAAAATTTTTATGACTTTCAGTA
AAAAAAAGTATTCAACTTTATGATAGTCATCATCATATCATCACCATAGTACATTAGGACTAAAACTCAATGTTTTACCCATATGAAGACACAAAAGCAC
CAAACCTAATTGGAAATGCACAATTGCTGAGAGTGAGTTGAGTTATAAAAACTCATTGAGAGAAGGAACATTTATCTAAGCGAAGAAAGCGATAAGATTC
TTTTGCCTCCTCCAACTGCAGCCCCTCCCCACAAAAAAAATTATTTTGAAAAATATTTCAAAGCTAAGTTTTTAAAATGTTTTTACGCACTCTCCCAATT
ATCTATTTTAACCAACCTAACCAGCTACACTAAAGAAACTCATACTATTCAAATCCCTAGTCCATGTCTTTCCTGTTTAGCACCACTTCAATATTTTCCT
CCAAAAATAACGATGCAAATTCACAAGACCATAGATTATTTCAATCTGATTTTTCAAGCTTAGTGTTCTATTGCAAAACAAAATTCCAAATTGTTTTTCT
AAATGCAAAAAGGAATACATTTTCATTGGCATTGGATCAATATTCATAAATACAACAACCAAATACATTTTCTAATATCATATATCAAGCACAAACACAT
GAATTATCAATATTGATATTCGATTCATAGAAAATATCCAAACTCCAAGTTCAGAATGATACCACAAGAACATTGTTGTTGACTGACATAACAACCAAAA
TAAACATATAACCAATTGCCGAATCGATCTCAGAAAAGATCGCCACAATGAATCTCACAGAGTTTCACTTATTGTCGACCGTTGGAAAAATGTAAAGAAG
GGTAGCATTTACGGCAATGTCGGAGGGTAATTCCTAAATTAGACGTCGATCTTCCATGTACTTGTCACGCCCCGAGCCTACACCTAGACGTGGCCGAAGC
TCGAGAACTTTTTCTAGTCCACAAGTGAAACGTTGGCCTAACTCATTACTTAACGGAAGACTTACTAAAGTGTCAATCCAAACCGACGTGATTTGGCACC
CACACTAACCCTCTGGTGGGAGAACAATTACTATAATCAAACTAAGCAATTTAACAAGAAACTAAGCATTTAAAAATAAAAAAGCAAGTTTAAATGATAG
AAAAATATGGAGTTCCCGTAAACTTTGAAAGCTTAAACAAACAAGTAAACATAACTATTGAGGGAATCCACTCTGAGAACTTGAAAGTCAATGTACCAAA
ACTCTACTAAGGACAAGTCGAAGAAAAATGGGTGCAACCACAAAACTAACTTATATATAAGTCTAATTATAAAATCTGAGTCCGAAAGGAATGGATGAAA
AAATAGAAGATCCATGAAGCCTAGAAAAACTGTCTCACCCTTACTCCGATCGCAATCAATAATCATTTAACTGAGGTCGGTTAGTAGCATGCCTGAAGAT
GCCCGGTACTCAACAAAGAAAAAACAAGTGCAGTATCAATACACAAACACAATGTATTGGTAAGATCACACGGCTACTCCCATAAGCAAAATACACAACA
AAAAATTAAAACATAGTAAACACGTATTAACAAATTTACAAAGATCAGTTCTCATTTTAGAAGCAACGTACAATTCCTCAATATCAATATGACAGGTAAC
CAAGAATGTAACAATCATAAGTGGTCCTCTCATGGAACTCACACCCAAACTGCTAGTGTGTTTGAATGTGACATTCAATCAAATATATATGTGTTGGAAC
ATGACATCTGATCCAATATATGTGTCGAGATGTGACACACGATTCAATCAGGACAACCACATTCACAACCACATCATAATGAACAATACTCAAATTGTAC
AGTCAAGTAACATGTTCATGGCATGTAATGTTCGCAGATCATCATTTCATTAGATTGATTCACATTCCCTATTCACATGCATGCACTCATATAATGAAGC
AATTATTCAGCATATATCACACAACAGGAAATAAAATCATCACCTACCTCGAAACCAATCTTGATTACTCCTAAGATGCTCGATCTTTCTTTTCCTTAGT
CTTTCAACATGTTCTTGGTCTATAAACAAGTAATTTAACTCAAGGATCAACAATAAGATCTAATTTACCAGAATTATAACAAACTCAATCACCCAAAACC
AATCCCATGATCTTAACCTTCACTAGGGCTTTCCCCCCATGATCAACTTCATGCCAAAACTATCTCCCAATGATAATTATCTAACCTATTAAGTTCTAGA
AATCAAATATGAATTAGGGGAGTAATTTTCTTACTTTAGCGTTAGATATCGGGGAAAACTGTTAAGAAGTGCTCTGGGCCATCTCGCAACTCTTACGAAT
GAAGTTTTATCGAAAATAACGAAATTGAGGTTTTTCCCAACTTATTTCATACTGTTCGGCCACAACAATCCAGCCCTAGCAGAACTAACCTCGCCCTGAC
GGCTTGCACGAAGGCAAAAACTCAAAATTTGAGTTTCAATCTCCCATTTCACAACACATTTTCAATCTGGGATATTCTAAAACTACATTTTTCGCGCCAA
GATCAATTTTGGGAGTTCTACTCACCCGACTTCGATTTTTTAAAGCTGTATAGGCTCCTTAACGTCTTGAATATCCACTTATGTGATAAAATTCTTAATT
AGATTCCCCCATGCATTACCAAATTTCCCTAGACTTCACATGACTCAGATTTCGTCTCAATCTAGCCAAGGCTAGAAATTTTCAAGTCACTACTTCAAGC
CCAAATTTCTTTCCTGTTGGATTTTCCATAACGATGAAAGCAGGTCATTATATCAACTAAAATAGAAATATCAAATTCAAACTCAACTTATAAAGATAAC
ATTTATGGAATAGTTTAACTTAGTATACTCTAAAATACTCAACTTAATTGTTCAACTTATGTCTTTAAAATATTACAAAAGAGATGGGAAAACACTTGCC
AACAACGAATGTATGTGAAGCATCTAATAACTATAATGGAAGTCGGGACAAGACCCACAACATCCTAACTAACTGGAAAATAAATGTTGAACCCTCCAAA
AATAAGGAGACTCACCAAAGCTAATTAGGACTGTAAGTGATATTAATGGAGAGCATGTTGATGACCCTTATTACTTGTATTTGCATCATGAAAAGATGTA
GGCCAAATAAAATTCAATTACATTGAAAGTACGAGCATGGAAGAGAATTCTAAAAATAAACACTAGCTTGAATTGATTAAAAAGGAAAATATACTCACCT
TGTCTCAACTCAACTCAAAATCAGCCCTTTTGTTTACTACTAGATTTTAAAAGTACGAATATAATTATATGACTTTTTTCTCAAAACATAAATCCTATGA
ATTTTTTATAATCCTATGACTTTTTACTTAATACTTTACTAAATTAATTTTGACTAATTGTTAGTTTACATTTTTGAGTCATTAGTTATAATTAAGTTAA
CTATTTTGTCTTGTTAAAATTAAGAACCTCGTTAATTAACCAACACCAATTCAATTTATTTAAATTTTAGCCGAATTTGATAATCAACTCAATTTGGTTA
AATTTTGAAATTCATTTGGCCAAGATTGTAATCCATTGGTCAAATCCTTAGCTTAATATCTAATCCTTCTTTCAACCCATTGTGAAACCAATTTCGGGCT
CTTATGCTAAAATGTTCAGACGGCCCACTCACTCTCCAGAAATCAGTAATCCAGATCCCTCCCTATTCCAATTCATCACCAGCCCACCACTTTTTTCCTG
ACCCGGCCTTTTCCAAAACAAAGAAACCCAGAACGCTACAACGTCTCCTTCTTCAAATCCTTGTACAAAATTTTTGCAATTCCAACTGTTACCCCGTCCT
GGCCAGCGAGAGATCATTCCACGTCAATGCCAAGACTCTGAAATTCATTCCAAGAGTCCTCCCCTTCTTCTTTCGGAATGGGGTTGAAGCTTCAGGGAAA
GGTGTTTAGCCTAAATGGGAAAAAATTCAGAGGTTTGAATTTTGAATAGGTTTGGTTTTGGTTCGAAAGTTTCAGTTGAGGAAAAGGGTTGGAGATAATT
ACAGGGATTGAAAAAAAATAAAAAAAATAAATAAAACTAGAGGTTGAATGGGATATTGGGAAAAAGAAATTGAACAAAAGAAGAGGTATGAAGTTAGTCT
TAATCTACCGATAGAAAATATAGCTTAAAAGAGTCACTTTTTTGGTTTCGCTTGAATTTTTTTCGGGGGGTCTTGCTGTTTAAATCTGAGCTCCTGCAAT
AGAAGAATAGTGGAAGGTCGCTCCCCTACTCGTTCCCGTCTCAGTTCGTTGTCCAGAAAGAGGTAGAATCTTTTTTGTTTCATTTAAATTCAGTTTCTTC
TATGTCGTTCTGTTTATTATGTGCTATCTTCAGTTCTCTTTTATGTGCTAACTTTGTTTGCATTTTCATATGTTAGGACTTGGTTAACAAGTTTTAGCAA
GTAATATCTTTTCTTTGTATATGATTAAACATTTGGGTGTAAGTCCTATTTGGAGTTGGTTTGGTGTTATATACAAGCATGTTCATTTTCTATCAAAAAT
ATGTCACAAAATTGTGCTAAATTCATATGGTGTATTTTGTTGCCTAAGCTTGTTTTCTTCTCTGCTTGAAGATGTGGAATTTGCTTTAAAAAGAGATAAA
GGAAAAATCTCTCTTATTGTTTTCATGCCTAATTTTAGCAAAAACAGTGATATTTATACTAATTTTAGGCTACTGCTTTTGCTCTAGTTTAAAATGTTTA
ATTTTATTCTAAATATAAATATATTGTTGTCTTTGCTTAGTATTCTGTTGTATCTTAATCCTAATGACATAAACTTTCCATTTAGTCACTGTTCGTCTTC
ACTATTTAGCTATCACTATCGTTGATTATCTTGCTTTATCATAAGGAGATTGGTTTAATTTTAAGTGGGTAAGCTTTCAATGGTGCATGTTTTCGTGGTC
ATTTTTAGCATAACATGGGTATAGTAAATTAAGCACATGTCATTTTGATCTTATATTAGTTGGTTTAAATTTTATTTTATTTTGCCTTTACTATGCCATT
TTAAGGTGTATGAATATCTACAAATCATGGTTCATCTCTACCTATTCTTTTTTTGCTAGTTGAAATGTTTGATCGTTCTTGTTGATATGAAAGTGGTATC
GAATTTAGGTGTTGCATTAATGAAAATATACACAGTGTATTGCTCAAAGCAATGCCTACATATCCCTTTGTCATGTTGCTTGCCTTTAGTTTATTTTATT
TGTGTTTGGAGTCACTATTTAATGTATTACTTGTATAGGCTTTAGATGTTTACTTCCTCAACTCTTGTTATCATTAAGTGTCAGTTGATATATAGTAGTT
CTTTCATGTTTGTTTCAAATCATCTTTTATTGTGATTTAATAGTAATTTAGGTTTTCATCTTGGATCTGAAAATACATGAGTTAATTTGTTCTCAATCAA
AATTATGTCTCATTTGTTTTATTTGATTCATATGCGAATATTGTTTCTTTCCTTTCTTGTATGAACCCTTTCCTAGTCAATAATGAAGTTCTTCCCTTTG
CATTCCGGAATTGAGCCATAGAGGCTCAAACCTCTTTTTGTCACCGAGTCAGCCGAATCACGGGTGTACAGGATAGAGTGTGAAATGCTAGGGGTTGGAA
ATTGAATTTTAGATTCCAAAAAAGCTCAAAAAATAGTTGTATACGTGAAGTATAAATTCTATATACATGATATATGGACCCAATAATTAATATCCAGGTT
GAGGTCCAGTGAAACATGGCTTAAAATTGAAATGCAGGTCATGAGGCTCAAGAGAAGGTTGTATACATTCAATATACGTCCAGTATACATCAGTATACAG
CTATGTATACACAACTTACTTTGGCACAAAATTGGACCAAAACCCAATTACACGTTTGTTTTGATTCCAGCAGACACAATTAGATTTTAAAATGGAGAAA
TTTTTTAAAATTTCAATATTTTGACATTTTATAGGACCCATTGTCAATACTTTCATTATTTGGTAAAAATATAAATTTTTTAGTTTATTGTATCTCATTT
ATTTATTTTTTATTTGTTTTAATTGAGAGAATTAATGTTAAAAACAAAAAGGAGAAATTGAGGGGAGCGAAAAATATTAAGATGAATGATTGACTAAATC
CTTCATCGATTACAAAAATTCAAAAATAAAAATAATTTATCGATACTCCCATAGATGATTAATTCTTTCAAATTTTGATATTCAAGATTCTCATACAATT
GAAAACCTCTTCTTAGTTTCTGTTTGATAGGAACAATTTTAGATCAAACCTGATAAACAATGTTTGGAGAAAGATTTTTCTACTACAAGTTAGATCAAAT
TGTTTGAATACAAATATAACAAGGTAATTGCTGCTTCATATTTTTTTTCTAATTGCTTATAATTTTGATATGAAATTTCAAAAATAACTGTCAAACGTAA
TTTGTTTTCATCTGTATTCTGTTTTTGTTGTAAATTCTAAGAACTATGAACAACATATGAATATTTTATTTATTGACTTTTTGTTTTGGTTGTTTATGTT
TTGTTTGAAGACATAATTTTGTTAATTGGATGTTTGTTTTTAATGTTTTGAAATAAATTGTATCCGTAACAGAATACGAATAAGAGCAAATACAATTTTT
AATGACAATCTTCAATTTTTTTTTTGTTAATTTCACTTTATTTCGATACTCTGTAACCCTTATTGAAATATATATGATCAATGTAATGTATTTTGTAAGT
GTTAAGAATATGTTGGCAGACTATATTAAAATATGAAAAATACATTTTTGTTCATAACATGATGCAAGTACTATTATGAATACACACATTTGTTACTTGG
ATAGATTTTTGTTCATAAAAAGATGCAAGTACTATTGTAAATACATATATTTGTTGCTTGGATACAAAAAATTATGATCTTTGCAAGCAAATGCAATTCC
CTGAGTAAATGATATATGTAAGAAAAAGTATTCAACTTGGCAAACATAAAAACATAATAAGTATACATAATATAACTTAGAAACTACATCACATAAAAAT
AATTTAGATAATAATGTAACTTTGAAAACATTCAAATAGCATTACTATTTGTTAAAAAAATGTATAAATTTTAAATGTATATTTACTTTACTGATACAAA
CAAGACTCTCACAAACCATAATGAATACAAACACATCTATATACAAAATCATTCAAAATGAATTCATTAATAAATATCATACAACACAAATACATGAAAA
TTACATAGCATACAACACAAATACAAAGAATACAAAACCATCCAATTAGAATTCATTAAAAAACCTTAAATATCATATTCATGTAAAATGTATTCTTAAA
TTATTGAATATCTACCAATGCAAAAAAAATAAATAAAGAAATGATTAAAAATTTGATACATTATCAAAAATAACAATGATTGTCGCCAAAATACAAGAAT
AAAATAAAAAGAAATAAAAATACAAACTAACAAAAATTGCACGGTCTACCTAAGAAATTTGTAAATTTATTCAATGCACATACTAAATTGATTTTGGATA
CATAAAAGAAATAAAATCAAACTACATTGTTGAAAAAAATAATTCATTAACTTCAACTCAATATGCAAAATACTAAACATGCAAAAATAATTAAATATCT
TTTTATCAACAATTTAGTTTTCTCCGTCCTTTTCAAGTACCCCACGAGTAGATGAAGATACTACATTTTTTATCTGAATTTGTGGAAGAATTTGTTCTGA
TCGTCTCTCTTACCTCATTTTAGAAGGGGATCCTGCATATCCACTATTTCTTGAATAATACATAGATTAAAGGATAAAAAATCACTAGAAATTTGACGAT
TAAGTTGAATAACTCTAGTAAGTCTCTTAGATTCATCCATTGAAGATTGTTATAGTGGTCTAATCAAGATTTATTCTACTTTCAACAATTATTTAGATAA
AATAAAATCAGAAAATAAATCTAAAAAAAAAAGAGATAAAGATGAATACCTTAATTAATGGAATTTGTGTGAATCCAATTTCTGCAGATAAAAAATACCA
AAAATTACGGTAGAGAGATATGAGAAAGATGAAAGTTGAATGGGAATATAAATTAGAAAATATGAAAGAGAGAAAAAAAATTTTGTTTTTATTTTTATAT
ATGAGCCAAATTGGAAGAGAGATACGTAGGAAACATGAATATATGGAAACTAAATATTTTTATTTTAAAAAAAATAAAAATAGTTGGGTAACATGTATGA
ATGGGATATACATGGAAAACCTGAATCAGCGGAGTTAAATAAAGTAACTTTTTTATAAAATTAGTTGGAAAACATGTAGGCAATAGGAGATAAAAATACC
GAATTTAATTAGGATACATATTGTTTTTCAAAATAATGATATTTTTGACATTTTTACTAATATTTTTAATATAGTGAGGTTTTTACTAATTAAGTTATGG
ATTTTGACTAGTTTGCTAATTTTTCCTTAAAAATATGGATTGAAACCCATGAATTTAGTTTAGGACAAGTTGAAAAAAAGTTGGGCCTGCTATCTCATCA
ATTCGAAATTTGGGAGAAGGCCCAAGTTTATAACCTCATCTTACCTTTTATTTTATTTGTTTATTTTTTGTCGAACTAACCTTTCTTTGTATTGGTCATT
ATCTGATTAAATTTCCCGAAAGAACGTCATTTATCTTTTTTATGTTCAAGATTACAATATTTATTCTTTTATTTACCTATTTTTTTTATTTCATTAGTTG
TCTTGCAACTTGAATTATTCCCTATAGAAGATTTCCCTTTAGTTGTTCCTCTTAAAAAGTAAATAAATAATAAATAAATTATATATCCTTAGTTATAATT
TGAAAAATCATTTATGGTCAAATCGTCGGTCAACCGCTAATTAGAGGACATTCTGAGGGCTTAACACCTTCTCGGGAATGTATATTTGAACTTCGAACCC
TTTTTCAACTGATTTTTATCTGTTTAAATTTTTTGAAAATAATTACAAGTTTTTCTTGATTTTTTTACTAAATAATTAAGTGACGACTCTGTCAATTTTA
AAAATTGATTTCTCTTAAGTCATAAGATTAATTGATTTATCAAAACTTAGTCATTTTTTAAATTCATTTTTCAGTAAAACAATTGACATTATGACTTATG
GATTTCCAAGGCAAATATGTGTCTTGTATTATTTGTAAAAGATGTACATATAATTCACACTATGACATGGACTATCAAGTGTCTTGAACCGAGTCTACAC
TTTTGGTATGACTATATTCAAGATCACGGATGATTCCAAGAAGACCCTTGGTATTGACATGTTGCTAAGAATTGATGCGACATTTTATGAATGAGATCGA
AAATTGAAACTTTGTCAAGTGAAATATATACTAAACATAAGTCTGTGCATTTTAAAAGAAGACAAGATTTCAAGTACTTGTGACACGTTTACTCGAATCG
AGGGTCTATCAGATATAGTGTCTTTACCTTTACAGGGTAAGTACAAGCATTGTTGTTTATATTAATTTGAGTGATTGCACCATTATGAGTTCTATTTATT
GGCTTTAAAGAGGCGTTGTTTATTAAACTTTTTATAATTTTGTTTGATAATATACTGATAAAGGGGTTTAGTTAATTGGTGCTTTGTGAAATAAGATTAA
TTTCAATATGAGTGATGTTGTTTTAGCCTGTTGACAAACAAAATAGTTTTGTTGAACACTTGCCTCATTGCAAGAAACAATTGTTTTTTTTTCACGCCAA
ATCACTGAAAAATTTTGTGATGTAGAATACCATTTTATCACTCATAATTTTCACTTAATTACCTCACTGAAAAGGTATCGTGAAGAACATATTTTCCTTA
AGATGAAAAAAATTTCTTAATTCTGCCATATGAAAATATTACTATTTTTTTCCTTCTCACCAATTAAACCAAAATATTTCAGTAGAAAAGTTCAACGTAA
AAATAGTAATTTTTAGAGAAAATTAGCAAATTAGTCAAATAACCTAACTTAATTAGTAAAAATCTCTATACTTTATAAATATTAGTAAAAATGTCAAAAA
TGTCATTCTTTTAGAAAGGACTGTGTATTTTAATTTACTTCGTATTGTATCTCATTTTAATTACAAATTTTCCAACTAATCCTCTCTTATATGTTTTTTA
AAAATGAAATATTTTCTCTCTCATATTTTCATATTTGAATTCTTCTCCATTTCAAAATCTGCCTCTCTTTTTCTTTTTTCGAAATTAAAAAATATATTTA
TAAAGATATTCATAAAATCCCTTTTATTAAAATACGAGTCTTTATCCGTTTTCTAATATTTGTTTTATGATTTTTATTTTGTTTAAATCGTTCAGAATTG
TTGTTTATAGTTGAAATCACGTTTGGGTTTGATAAACTCTAAATCACTCTCCAATGACAGAATCTAAGAGAATTACTAGAGGTATTCAACTTAATCAACA
TTGTTCTATTTTTCAAATATCACAATTTTCTACTTAGAACACAAATGGCGATATTTTTAATTTTAAATTACTGATATTCTATTTCAATATCACTTTGTAT
ACAAACAGGTTCTATTTTTTTAATTTTGTATATCATAATGTATACCAATAAATTCACATTTGTATTTCAATTGAAGTGCGTCTTTATTGTGCTCATTTTG
TATTTCAATCTTAATTTTCAATGACAACAAGTGTGTATTTCTTTTTTGTTAAGTTTTCATCATAATTGTATGCCATCAACTTTTATATTTTATGTGTTCA
CTTTACAATTCAAATTAAAATTGAATATCATATTGTGGTGGGTATTTTATTGTGATCATTTTGTATTTAACTCTCACATTGTATTCAGAAGAAGTTTGTA
TTTTTTTGTGTTCATCATACTGATTTATCAACAAAGTCAATTTTGTATTCCAACTGATGTGAGTATTTATTGTGCTCATTTCGTACGTTAGTCTCAATTT
CAATGACAACAAGTCTGTATTTCTTTTTATTATGTTTTCGTCATATTTGTATATCAATAATTTTTGTATTTTATGTGCCCACTTTACCATTTAAATTAAA
ATGGGCGTTTTACTTTGATGGTGAAACTAAAATTTTATCCTAGTAATCAAAATTGTATTAAATAACGGCCAAATATATTTTTCTTTTATTTGTATTACAA
AAATTTTACGGATTGTATTTCAATATAATCTAATCATTACATATGAATACGATTAAGGAAAGATACATGATTCTAGAAAAAAAAAAGAGAACATATTTAT
AATACTAAATTCTATTGATGTTGATACAATATTCTAAAAAATACAAATTTAGAAAATGCAGTTTAATCGAATTCATTTCAACAGAAATTGAGTATTAGCA
ATGAAAATTTAAAAATCGATACAAGAAATTAAATGAACAAGTGGGATGAGTTCTTTGTGTTTATTTTTTTGAATTTGTATTTATTTTTTAATTTTTGTAA
CTGATGAGACTTTTAAACACTTTTTCCTTTTTTAAGAAAATCTCTCCCCTAAATTTCTCCTTTTTGTTAGTTAACAATTATATTCTTTAAATTAAAATAA
ATAATAAAAATTTAAATAAGATACATATATAATTTAGAATTTTGACATTTTTACTAAATATTTAATAATTCCTATTAAATATTAAGATATAGACATTTTG
AAAATTTCCCTAATTTTTAGTAGTGTTTGTAGCATCTAAGACTTTCATTATACAACTACGTCTCAATCCTAAAGTTATTTATTCTTATCCAATTCAATTG
TACCTGTGTATTGTGAGAATTTTCATAAATTAACTAGATTATCACTTCAAAAAGCAATTTCCCCAAGATATGTAAATTAGAATGTACTATTCCATCACTT
CTCAATAAAAGAGTACCATAAATAGCCTCTATAAATCTCAAAGCATGAGTAAGATCTACATGCATTATATCTACTCAGTTTAACTTGTTGAATTATACTG
AATATGTTATTATTGTTGATAATGATCATTTCTAAATTATGAATATTGTTTTACTTTAAAAATACTACTATTAGTTTAAAAATGGAAAAATTGATTATGT
TTCGAAAAATCAATTAATCTTATTATTTAAGAAAAATTGACTTTCCAAATTACGGAGTCGCCACTTGATTTTTGATAAAATCAAGAAATTTGTATTTCAA
AAGATTAAAAAAAACCAGATAAAATCAATTGAAAAGGTTTGAAGTTCAATGTACATCCCGAGAATGTGTAAGACTCCGGGATGCCCGCTAACTCGCGGTT
GACCGGCGATTTGACTAAATGACTTTTAAAATAAAATTTTTAGTTAAGTAAAGAGAAAATTTATTTTAATATTTTTTATTTCATTATTTTTTTATTTTTT
TACTAAAGGGAGATATTTTGAGGGAATTAATTTAAGGAAAACTAAATGGTGATAAAAGTAAAAAAAAATAGTAAAATTTAAATAATGAAAAATGGCTACC
CTTTAGGAGATTATTAAAATTCTACCAAGATATTAAATAATTCAAACAAATAAATAATAGAGAAAGAAATATTTGAACTTGGGCTTGATTATCCAAATTC
TTTCATTTGGGCTTTGGCTCACCTGTCCTAAACTAATTCTTATAATTGGGCTTTCTTTAAAGAAAAATTTAGCTAACTAGTCAAAAAAATCAAGTTATTT
AGTGATAGTATCCATACTTTAATAATATTAGTAAACATGTCAAAAATGTCATTATTTTAAAAATAAATAATTATTATGATATTATTAATATTTTCTCTCT
CATTATTTATAGCTTTTCTTTCTCTGTCATATATTACACATTTTTTTATATTAATGTCATTTTAATTTTTTTCTTTCTTTTCTTAAGTTTATCAATTTCT
CTCTCTTACATTCTTTCGAATCAAATTTTCAGATTTTTCTCTCTTTTCTTATTCTTCTTTTTAATTTTTCTCTCTAACATTCTTCCAAATCAATTCCATA
GATTTTCGATTCAATATATTAATATTTTCTACTATTCTCATTTAATTTTGTTGCAAGATTTGATTTAAAGATTAACATTGATTTGGGTATTATGTTTTTC
AGATTCCTTATTTATTTACTTACTGATTTTAGTGTTTTTTTTTTAATTTTTTTGTTGTCCTTAAAATATTTTTTAGGGTTTGAGATTACATAATTCTCTC
TTCAATTGACGTTTTCAAGATAGTTACTAGAGTTGTTAGACAAAATAATCAAAGTTCTTCCGATTTTTCATCATTTATTTTTTTTACTCAAGAATTAAAC
AACAATGTAGGTTCCACTTCTAAGGAGGATACACGACGGAGAAACTGAATCCGTCGATGGGCAAAATCCCACACAAATTCATAACCATGAAGTTGAAGAA
GACCAATTTGTTGGAGAAGAGGTTTTTTTTTTTTTACATGTTTTATGTCTTGCATGTTAGTTTAATTTGTTTAGTAATTTTTAAGATTCAAAAAAAATCA
TGTTACAATGCTTTTGGAAGTGTATATGGAATTTTTATTGTGTTATAGTTAGTATTTATTTTTGTATTTCATATATTTATTGTATTTTGTAATCTATTTT
TTTGTGTGTGTTAGTTATGTCAATATAACACATTATATGAGTTTGATTGTGTATATTTCATAGTTTTGATGTTTTTTGTATTCATAGATTTGGAAGTGTA
TATTGAATTTTGTTGTTGTTTTAGATGACGTATGTATTTTTGTATTTCATTATTTTATTGTATTTTGTATCCATAGATTTGGAATCGTATTTCATATATT
TAATTCATTTTGTATTATGTTTTTTTTTATAGTTATGTCAATGTACCACAGTTAGTATTTATTTTTGTAATTCCTAATTTTATTGTTTTTTGTATTCATA
AATTTGAAAGTATATATTGAATTTTGATATTGTTTTAGTCAGTATGTATTTTTACAATTAACAATTGTATTCATTCAAAAATTATGTTGCATTGTTTCTA
AATTTGACATTTTTTTCTAATTTTTATTTATTCTAAAGGTATGTCAACTAGTTATGTATTTTATTTAAGAATGAGTACACCAAATATTCAATTATTTCTT
TTCAATTTTATATTTCATTCACTTTTTTCATCATACTAATTTTTTGTATTTTATATATTATTATACAAAATTCTAATTAAAAACTAGAATAAATAGAATT
ACAAATAAAATACATATTGAAATGAATACATACAAGATTTTTGATGAAAAATTAACTATATAGGGAAAAAATATATGAAAATACAAATATATTTCTTAAA
TGACTATATAGATAAATTCGACATACCTATTGGAATGAATACAAACTAATAAAAAACTATAATAAATATAAATAGAATATATTGTGAAATGAATATAATT
TTAAAAAGGTTAAAATTCTGGAGAAAAAAAAAGAATAAAATTTAAGTTTTATTTGAAAATGTAACTAATGAGAAAATTAATGATCCTTACCTTTTTTGAA
ATATTCTCTCCCTTGATTTTCTCCCTTTTGTTATTAAATAATTATATTCTTTAAAAAATAAAAATAAAAACATAAATAAGATCATAACAAACTAAAATTT
GACATTTTTGCTAAATATTGAAAGTGTTGCTAATGAGCCCTCTTAAATGCTAAAATATTGACATTTTGAAAAATTTCCCTTCTTTAAAACCTGCAGAAAC
AAATGGTCTTTGGGCCTGTTAATAAAAAAAAGGCTGAAGGGCCCTGGTCCAATCCCGGAAAAGAGACATAAAGTATACAAACGATGTATATTGCTGTATA
TGTATATTCAATTCATTTTTTGGACTTTTGAGCCTTGCATTTATTTGAATACGCGTTTCTTTCTATTCACCCCGTATTTCCCACATCGTTTCTGCGTATT
TGTACCTGTATCATTTTTAAACATGCTTAAGAATTGTATATCGTCACCCAAAATATGTATACCAATGTATACAGGCTGTATCCTATGTACGTATTCGTTG
CCTGTTTTCGTATTTCATCTAAAATTGGCATCTCTGTACGTTAACCTGCAATTCGTATTTTTTACACATATTTATAGTATTTGTCTCTGTATATCAGTGT
ATACAGGTTGTATATCAACCTGTTTTTCAACTTTCGACAGCTGAAAAATAATTTCCAGAAGTATATCCTCACTGTTATCAACCTGTATTTCGAATTTGGT
TCCCTGTACATTTTTTTGACCTGTATACTAATGTATAAAGTATGTATACAGCTGCTATACAGCTTCATCAACACCTGCCAACACAGTTTACAGCCTCTTT
CCAGGTTTTGATGAACCTGCAATTAATTTCCAGCCATTCGGTTTTTTTGTGTTCAACCTGTACGCCAGTTTTGAGGGGGTCTACGACTCAAGGATGACAG
TTCAAGCCTTTACGGCTCAATGAGAAAGTCCAACGAGATGGGTTAAAGTCCATGAGGACTCGAGGAGATTTCACATGCAATAAAACAAACAAAAAAAAAG
AAGAACTAGCACCTTAAGCGATAAACTAATAGAATGCGTCTTGAACAAAACGGTAATAGAAGATGTGAGCTATTTTAGAGATATGAGTTAGGAAAGGGAT
ACAAAATCTCAACACACATCTCATATGAAAGCAACACAGGGACTCCTCATGCATGCAACACTAATCAAATGTTCAAAAGAATAAAATGAAAGTCATCATC
TGTCAAGGTTCATTAGTGATAACTTGAGGCTGTGTGAATCATTTCAAACCCAAAGACAACCACACGGCAGTGAGCAACAAATATACTTTAGACCAAACAC
AGAGGAGAATTGATCCCTTTTTATCATTCAAGCCATTGAATGCACATAAAGGGCATATATGCAGAAGCCATCGATAACCAAAATTACGTCAAAGAAAAAG
GCCTACCCGTAAGACAAAGTCTAAAATCCTCCTCCAAAATGGTCACAATTCGAACACATAAATGTTTCTAACCCCTTAGGACAACTAAGAATACGATAAA
GAAAAAGTCACCGACATTTACTCGAATAAAACTCGATTAGAAACCTAGCTATAACGTACTCAAGACAAGCGAATACGAAGTTTGTCCGACAAACAAGACG
AGAACTCGTCCGAGCTTTCACATTCACAACCAAATATGACCGAAGTATCTAGTGTCTATATCAATCTAAGTGTAATGACCTGTTTGGTCGTTTTGAGAAG
AAGAGTTTATTCTAGTAATAACTGTCTGGGTCGACGGATCCCACGACGGACCGTCGAGGGTGTCTCATTCCAAAACACTTAGAATTCTGAAATTTGAGTA
CTGAGATCGACTCTCTGAACTTCGCGACGAAATGGTTGGACAGACCGTCACAGGCATGGGCCGTCACAAACTCTTCAAGGAATTGAGTCTCTGAACTTTG
TGACGGAAGCAGCAGGACGGACCGTCGCAGGCACGATGGGCCGTCACAGTTTGCGTAACCCTGCCTGGGTCGGATTTCTGTTAAATTTTTTAAGGGGCGT
TTTGGACTATTCCTGCTTATAATTATGAAGTTAGTGGTTTAATGTTAATAATTCAATTACTTGGGGGTTAAAGGAGATAACCTTGAATTAATTAGTGGGT
TACTTTTGTCATCTTTTATACTTAATTATATGCTGATTAGGGTAAAAGAAAAAGGGTTTAAATAAGAAAAATAGAAAGAATAAGGAGAGGTAGAACGAAC
GAACGAGAGAGAGGAGAAACGAAGAGGAAACCAAAGCTTTGGAAAAGTTGACTTCTTGATTACGAATTCTTCGGTGGAGGTAGGTTATGGTTTTTATGTT
ATTTCATAGTAAACTCCTAATAATGAATGATATGTATTGGTTAGTATTGTAAAATATGCTATATGCTTAATTGTATGCTTGTATGATGTGATTATGTAAT
TGTAATAAAATAAGCATGATGAGGCTGTTGAATCTTAAACCTTGAAACCTCTTTGTTAATGATGATGCCTTGGTATAAAAGAAGACTTGATGACCTAAAA
GAATGAGGTTAGTAGATCGGGTGTCACGTTCTGACACCAGGATAGTATTAGTGGATCGGGTATCACGTTTCGACACTAGGATAGTATTAGTGGATCGGGT
GTCACGTTCCGACACCAGGATAGTATTAGTGGACCGGGTGTCACGTTCCGACACCAGGATAGTATTAATGGATCGGGTGTCACGTTTCGACACCAGGATA
GTATTAATGGATCGTGTGTCAGCAGGATAGTATCAATTGAAAATACGGGCAACGGATGTGCCCAAGACTGCTTTTCGGACTAGGTATGGACATTATGAGT
TCTTAGTAATGTCTTTTGGGCTTACGAATGCCCCTGCTGCTTTCATAAGCTTGATGAACGGGATTTTTAAGCCATATCTGGATCTCTTTGTCATCGTATT
CATTGATGATATACTGGTATACTCAAAGAGCAAGAAAGAACATGAGGAGCACTTGAGAATGGTATTGGAAATGTTGAGAGAGAAAA