BAC Sequence – LE_HBa0003C20

>C05HBa0003C20.1
AAGCTTTTGTCAATTTTTATTAACATGGTGTGTAGAGTGATGCGGTAAATGTGAGATTGTGGAGCTTGATTAATATTTAATATATTGTTATATATTAATG
TTCTTGTGATTCAACCTAAAATACTCTGAATTAAGTTTACTCACGGGGTGTTACCACGAAATATTGGTTTCATTCTTTCTGTCTCTAGATCTCTCTCTCG
AAAGTTCTTGTGTTCTTCATTCATCAAGTGTGTGTGTGAATTCGATCATAACAGTAAAGTTTATATATTTTTTTATGATATAGATAATACTTATTCGTGC
TAGATGACCTAAAATTTGAGAAGGTGTTAATTATTCTTTATTAACGTTTTGAATTATCATTGTTATGCCTTTGTTTAACTAACATCACATGAAATTTGAA
AATTTATTGCGATAAATGCCTTATTCAATCACAAATTCTATATAATAAACTCTTTTTTATGCGCGATTTTCTATTAAATGAGTCTCACTTGATATGAATA
TGAATTAGTAGTGTTAATAAAGTCCAAATCCCTTAAAGATTTTGTTAGGCCGAAACTTTAATTTGCATTGAAGGACTTAACTTCAAGTTATTAGAAGTAG
GATTAGACATTTCATAGAAATGATCTTCTTTATTTATTTTAGTTTGTTGATTTTGGGATTGGAAATTGGATTAAAGAGGAATTAAAATAACTTTTTAATT
CAGATTTGTGTCAGAAAATTTTATTTCGAGGGAAGGGGAGGAGAATTAGGGTGGATGTGGAGGCAGAGCTGGTAAGGGCTCAAGAGTTTCGGAGTCCTTT
CATCAGAAAATCAAATTAATATTTATACATGGTTAAAATCAGTTGTAGATCTTAAAATCTCTTTTGATTTGTTTGTGTTACTTTTCGTATTTTAAATCTC
GTTAGTGAAAATTCCGACTCCACAACTAGAAATGAGAAAAAAAAAATGGTGAGGAATCTTCTTTAACCAGGGTCCTCAGGTTCGAGTTCCCTTGGATACA
AAGTCTCTTTTGTTAGTGAGTGTTTTACCCCTTCAACGTAAAATTTTTCAATATAAACCTGGATTTAATTCGACTTTAACATGAATATCGTGAGAAACCA
AAAAGAAAAGTAAGGAATCTAATTCTTATAAATAAAGTGACAATTCTATGATCAACCAATTGATTTACTAAGATCCTCGTGAAGTGCTCCGAATAGATTT
AATTTGTTCATATAGGATTCTATTAACATGGTATGTGGTGGAAGAAAACAAAAAAGCAAAAAAGAGAAATCCAAATGGAATTTTGTAAATTGGAGTAAAG
AGACAAATAGAGAGCATGTGCAATTTCCTCCATTACCGCACAATCCCTCAAACTTTTCAACTTGTCATTTTCAACCCCACCAATTTGCAGAAGAAACAGA
TTTTATGAAAATCATTACGATTCGTTTGATCATAAAAATTATTTATTTATTTTTGTAAAAAAATAAAATTATCTTATAGTTATATATAAGTATATCTAGT
GTAAATATTATTTTTTAAAAAATATAATCAAATACAAATTCATCGGTCGGTCTGACTCAACTTGATATATAGTTATGATTTTATTTTCTTATATCGTGTT
TTGTCAATTTTTTTGAGGTCACAATCTTTCCTCAATGTGAAAAGTGCAATTCAATTGACAATTTTAGGAATTTATGTGAGGTTATTATAAAGAAAAAAAA
AAGAAAAAAAAAGGATAAGTTTTTGGATTTTGTGTGATCTTTTATAATCCAACCAAAAAAATAAAAAAGGATAGATTATAATATGTCAATTCAATGTATA
AAGAGTGAGTCATGAGACTTGATGGAAGTTTTTTTGTTAAACATGTGTTGCCTTTTTAAATTACAATAATTATATATCAATTTCACACATGTACTATACC
TTCATAAATAATTAAAATTAAATTACTTCAATTTTGAAAATGAAGCAAATCTTTTTTTAAAAAAAGAAGTTGATAGACCACAAGAGTTCACAAATGAAAT
AATAGTGGATCACAAATTTGAATTATTGATGGTATTAAAATAGTCAAATATCTCTTCATCGACTTTATATACTGTCATAAATTTGAATCATAAACTTCTA
ATAATAATTGAATCAACGTAATAATTTAATAGCAAAATTGTATTAACAACTTAATGATACAATAACTACAATTATACTAACAATCACTTGATAAAATGAG
ATTAGACCAATAATTTCGGTTAGTTGATTCAACTTTAATATTTCAACTAACCTCATAGAATATAATAATTAAATAGATCACAACTTTATTTGAAAAATTT
CAAAAATGTACCACCTAGTTAAAAATAGCTAAAAATAATAATTTATTCATCTCATTTTATACGAGCATGTAAGATGAATAAAATATTATTTTTCTTTTGA
AATTGAATTAAAATTGTCTAATTTACACATTTTATTTAAATATTCAATCGATATAAAAATTAATTCAAATACCTAAATAAAATATTTTTATAATGTATAA
AGCTTATTACATGGGTAGGTTGTGCAGCCATCATATAAACTTCTATTTAATGTGGAGAAACAATAAACTAATAATATTAATATGAATTTGTACTAGTGTT
TAAGTGAATTATTTTTATTAAATTCTGCTACCAAAAAAAATCTCACTATTTAATTCACTCACTTTTAATTAATGTAGTGTGCTATAAATGGCCTAACCAC
TAGAAAAAACAGTAGAATTTATTCTATTCTTTTTTTTTATTATTATTTTAACTGAAAAAGCTGATATAGTATTTAATTTCCAGTTTTTGTAGCAGATGCA
ACACTTATTCTCATTATTAAAGTTTTAACTAGCAATTTGTATGGACAAAACCTTAGATGGTTGTACTCTCCGATCTCAAAATATTTATCGTATTTTTTAT
TTACACGTTCTTAAAAAATATTTGATAAGAATAAAAAATTATTATTAAATAATTTATTATCCTATTTTCATTTTCAAAATACATTTCAAAAAAAGTATCA
TATGATTTGTTTAATGTCTTTAATTTAATATTATAATATTTTTTATAAAATTTTTATAGTAAATTAAAATCAAACAAATAAATTCAAAACGTTTTAAATT
TTAACCAACAGAGGAAAAAACAGAAGACCCTACTTGGATTTTGGGAATTTTTGGTGTTATTACAAAATAGCACAAACCTACAAAGATTCACGCGGTTTCA
GCCCATTAAACCTATTTTGTCCAGGCCCAAAATAAAATAAAGAATTTTTCCCTTTAATTTTTCATAAAATTTACTAATTTAACCCTTGAAATAAATTCGT
CTTTAATATTTGTCCTTCAAATATGTTAGTCTTAAATATATATTTTTTTTAGCAATTATACTTGTGTATATTGAAACATAAGTTTGTTTTTTTTTTTTAG
AAATTGAAGCATGCAGACATAATTTATGATTTGTTTTAATTTTTTTGTCTTACTTTATTTGATCGGTTTTAAATAAAGCTTTTTATTTTTTTTAAACAAT
TCTTGAATTCTATTTTTTTCTCACATGACACATTTAACACTACGAGATAAAAGGATATGTTGATATATTTTACATATAGTTAGTTTAAAAATACAAAATT
AAAAAATTTCTTTACTTTCTTAAACTTAATGCCTTGTAAAAAACAGATATACAAATCGAAACGAAGGAAGTACTCCCTCCATTCACTTTTACAAACATCT
ATTTTTAGTATAGTGAACAAGTATTATAAATCAAAGACCACAAAAACAGTAGCAAAACTACACCAACAAGAACTGTGGATTGTGCTGGAGTGATAAGTAC
TCTTTGATCTTTAACTAGAGTTCTTGAATTCGAGTCCCTCTAGATATAAAATCATCTTTTTTAGAGAAACTTTCTTGCGTAAATTCAAACTTTAGAAGAA
CTTTAATGTGGATTTTCAGAGATATTGAATGGTAAGCCAAAAAAGATAGGGAAAAATGATAAATATATCCCTATACTATCGTAAATGGTATGCAGATACT
TACCGTCATACTTTTGGGACATTAATGTCCATGCCATAAAAAAAATTAGAGCATTTATGCCTTTCACTTCACTTTAACGAAAGACTAAATAGGGACGCGT
GACTCAATCTTATCCGTCAATCCAATATTTAATAAATATCAATCAGTGAATAAGATTATAATATGTGTATGTCTGTTAGTATAAAAAGTATATATGTTCT
AGATTTTGAACGACAAAAATATCAATATCTCAAAAATATAACGAAGAATATCTACCTACCATCTAGGATAGTTTAGGTATATATTTTTTTTTCCCAAAAA
GAAAAGATAGCAAAAGTGCAAATGACCCTCAATTCCCACCACCAAAAACTCAAAAAAATTTAAATCAAAACTCATTATTAAATGGTTCCTCTCTAAGGCA
GTTTTTGGTCCCCTCAACAGCCTAAAAAAAAAAGTGTCAGTCAGTTGTATAACTGTAGCACAAGCTTAAAGGCCAAACACCCCTTAAAATCCCTATTTAT
ATCCCCCTAAATCCCTCCCAATTTTCCACACCCAACTCCCATTTTCACTCTTCATTTGCTTAGTCACTACATTCCCTCTTGCTAGAGTCAAGGCTCACTC
TCCAAAGTAAGAGTCTTTCTTCTCTTTTCTTGAAAATGCAACAATGAAACAACACAATTTTCAACATTTCTTGAATGTATATCTTAGAACATGCTAAAAA
GTTGTAATCTTTATGCAAAAAAATAAACATAGTTGAAGAACACCATTTTCAAGATTTGTTAACATTCTTGAGTGTAATGCCAAAAAGTTGTAATCTTTAT
TCAGACAACATGGTTTAATTAACAGTTTTTCTACTTTGAAGAACACCATTTTCAAGATTTGTTAACATTCTTGAGTGTAATGCCAAAAAGTTGTAATCTT
TATTCAGACAACATGGTTTAATTAACAGTTTTTCTACTTTGAAGAACACCATTTTCAAGATTTATTAACATTCTTGAGTGTAATGCTAAAAAGTTGTAAT
CTTTATGCAGGAAACATGGCTTATTTTGGGATTTGCTTTGTTGGTCTTCTTGCAATGGTGTCATCTGTTTATGGTTATGGTGGAGGAGGTTGGATTGATG
CTCATGCAACTTTTTATGGGGGTGGTGATGCTTCTGGAACAATGGGTATGCAACATTTCCTTTAAATTCCCCAAAAGTTTGATTTTTGAGTAAATTTAGG
GTATAAATTTGTGCTGATTCTTGATTTCTTTGAATAGGTGGGGCTTGTGGATATGGGAATCTTTATAGTCAAGGGTATGGCACAAATACAGCAGCTTTAA
GTACTGCTATGTTCAACAATGGGTTGAGCTGTGGTTCTTGTTTTGAATTAAGGTGTGTAAATGACAGACAAGGGTGTTTGCCTGGTTCTATTGTGGTTAC
TGCTACAAATTTTTGCCCACCAAACAATGCCCTCCCTAATAATGCAGGTGGCTGGTGTAATCCTCCACTTCACCATTTTGACCTCTCTCAGCCTATTTTC
CAACACATTGCTCATTACAAAGCTGGAATTGTCCCTGTTGCTTATAGAAGGTAAATTCTTGGTAAAAATATGTTAGTTGTAGAACTATATGCTGTTTGTA
TCTTGCTATGTATGTATGATGTTGTTTGAGTACTATAAAAGAGTGGCAAGGAGAGTTTTGTCTTTTCACAAATGCTAAACCTTAGTCATGTCTAAATTGC
TTAAGCCCAAAGGTTTGAAATTTCTAAATGGTCCCTTTTAAATGACCTTAATTTACTTGTGCATGCTAATAGAAAAATGAAATGGTGGAACCACATGGTG
TGGACCCTTTTGATAAAGGTTTTAACTTTATCACAAGAAGTTTCCCATTTGGCTATTTTCAATGGAGTACTCTTTAGCATTTACTTCTTTCTTGGTTGTT
GTAATAGTAGAAGATTCATAAAGTTACATATATTGTTCCCATTTGTCTCTTTACTTGTTTCAATTGTGCTCTTTATCCTTGACTTGTTTCTTAAATTTGG
TAAAACTTGGAAAAGCATGAGAAACAAAGTTACAAACTTTAACACCATATAAAAACATAACATAACCAATCTTGCAAATTTTAATAGCTTAGTTTGTTGA
CAAGCCATACCTTTACCCTATGAACAATCTTGATAATCTTATTAGCTTAGTAAGTTGACTATCTGAAGTTTCACGTTTCGACAAATCTTGTTTATTTTAG
TAGCTTAATTGTCTCACTATCTAGACTTTCATATTATACAACCAATCTTAGTTGTTAGAATACCTGAACTTTTTATGTTATGACTAATCTTGACAATCTC
AGTAGCTCAATTGGTTGACTCCCTGAACTTTTCATGTTATAACTAATCTTGACAATCTTAGTAGCTTAGTTAGTTGACTATCTGAATTTCCATGTCTCAA
CTAATCTTTTGTCGAAATAAATTACAGGGTACCCTGTAGAAGAAGGGGAGGAATAAGGTTCACAATCAATGGACACTCATACTTCAACTTAGTACTAGTA
ACAAATGTTGGTGGTGGTGGTGATGTTCATTCAGTAGCTGTTAAAGGATCAAGAACAGGTTGGCAGCCAATGTCAAGAAACTGGGGACAAAACTGGCAAA
ACAACAACAACCTTAATGGACAAACACTATCATTTAAGGTTACAACAGGTGATGGTAGAAGTTTGATCTCATACAATGTTGCACCTGCTCACTGGTCATT
TGGACAGACATATACTGGTGCTCAATTCCACTAAAAAAAGGCATTAAATGGGGTTTTTTTTTTCTTCAAGTTTTTGAAAGTATATTTACTAGAATTACTA
TTATCATTACTAGTATTAGTATGCATACTGATTTGGTCACTAGTATTAGTATTGTGACTATTTAGTATAGAGGTATTTTGGTTGTAAAGGTGTGGTCTTT
AAGGTAAAAAAAAATGAAAAAAGGGCATATTTTAAAATTGTCCTCTTTTTCATTTTGATTGAATTAAGGGTATCTTACTTTTGGGGACCCTAATTCTTGA
GGCCACACTTAGTAGTTTTTTTTGGTTTTGGAGGGTATTTTGGTAATTTTTCCTTCTGTTAAGGGCAGAAGTGGAAAGCAGTGGTGGACTTTTACCACCC
GCAGTTGGTAGGTGGGGGTGGGGGTGGGGTGGGGTGGGGGTATTTTTGGCAACTTTTTTTTTAAGCTTCAGCCTGTAGCTGAAGATGGACTTTGTATGTG
TGAGACTATGAAATGTAAAGAACCATTTAACTAGTAATGATTCAAGAAGATTATGGTTATGTATTTTAACTTTTGTAATGCCTCTCTCGGTTTTAATTTG
TTTGACAGATTATAGTTATATATTTTAACTTTTGTAATGCTTTTCTCGATTTTAATTTGTTTGTTTGATTTATAACTCGATGTATAGTTTATAAATATGA
AGACGATTTTTGAAATTTTTTAGTTTTAAACTAAAGATTTGTATAATTGATCAGAATATTCTTTAATTTTGTGATATTATTTATGTCACGTGAAAAATTA
AAATTAAAAAATAATTGAAATAGGCCCCAAAGTACCTAGGGTTACAGTGCATTTTAAAGTAGCAGCCAAATTTAAAAGCCAACTGTCATTAGCCTAACTT
TCTGACTAATTATGATGAACCATCTTTTTAGTAAATACTTAAGATTTATGTATTCATTAACTGAATGTTTATACAAAAGAAAAAGAAAAGTTGAAAATAC
AGATGATTTTGTTCCAATGTTTCAAACTTGTGAGGATTGAGATTCTTGTCACAAGTCATTTGTTTTGCAAAGAAGATTTTATGGTTGTGAATTGTGATAA
AGTTTGTGGTTTTTAGTGTAATGTTTATAACTTTTTTTATTTCTCGAATGAAAACGAAGAATTTTTTTATTCTAAGATTATTACTAAATGCATCTGGCAG
AGGGTTAGACGAGTATCGTCACATTACCTCTCTTATTTTTTGAAGTGATTTGCATTGTCTTTCTTAGTTTGAACTATAAAAAATTCTTTTCATGTTTAAT
CTGACAAAGAACTCACAATAACTTTTCAAAAAAAATCACGTAATTGTTTATGAAACATAAATAAACGAATAAAATTACTATTCAACATATGCGTCAAAGC
AATTAACAAAAAAACATCCCTTTCTCTAGTTTTTCCTGGTAACAAAATTTCTACCTTCTCAAATAAATAAATTAAATACCTATTGAAATACACAACTTCA
TTTTTGAAACCATTTTTTCCAACATTTTTTTGGTCCAAATGACTTTAAGAAAGTCTCACAAATAGTTGGAACTTTCCTAGAAATTTCATTGAATTGTATG
GAAAAATATTTTTGTTCCCATTCTGATGATAGCAATGTTAAAATAACATCTACTATATTTAATTCACAAGCAAACATTCAAGGAAATTCCACAGCTTTTA
TGGCTTGTTTTAATTAATTCAAAGTGGCAAAAAAAAAAAAAACAGTACATTTTTTTAAACATAAATGTGTATCTACCTATTCTTGAAAGCTACATTAGCT
CTGAGGTAGAAATTAATGCCATTGCATATGGTCAATGGTATGTGACATTTTTAAAAAATTTGTTCATACATAAATTTATAAAAATATTCATAGCAAAATT
ATATAAATTTATCAAATGTTCATAGCAAAATTAGAACATGATTGAATTTTTCTTGACAACCAATTGGTTTAAGAAAATTCTTAAAATCCTCCTTGCATGG
AAATTAAATAAACTTCAAAGAAGTCTAAATCATTTTACGTTTGAGATATATAATCTAACAATCTATATAGAATCAACACAAACGATTTATCAATAAAATT
ATGTTTTGTTATAAAAATATATTAAATACATCAACTCCCCTAGAGTGGTCCAATTTGACACTTGTAAGTCAAATTTCGAATAAACTTTGGTGTTTTATGT
GATAGTTAGCCTGAAATATATCTTAACTGATTTGTAAGACATCACATAATCCAATGTGTTTATTTATTTAATTTTATATAAATTTAAAAGTTTATCAATT
GAACTCAAATTTAAAGTGCATTTACATATTATGTTTATTTTTTAAAATTTTTTAATTATATATTATCATATAAATTAAAACGGAAGAAACGTAACGAAAT
ATTTAAAACTTGAAAAGTGGGATGAATGAGGGCATGCTTGATGCCCTGAAAAGGCTGACAATGACTAGTCAAACACCCCTCACCTTCTTCCATCTGCCCT
TCTTTTCTCTTCTTGTGTTTTGAGCCTAGTGACTCAATATCCCATTAACACTCTCTTAATTTATTTTATTAATATGTAGTTAATGATATTTAAATATGAA
TATTAATATTGGAAAAAGAGTGTCATATTACAAGTATTTTACATTAAATTAAAAAGACCAACATGAAAACTCTTAGGTTAAAATTAGGGGTGGGCATTTG
GTAATTTGGTTTGATTTCGGGTTTTTTTTTTATTTTCGATTCTTGTATAATGTGTACCGAACACGGAATCAAAATAATTCAGTTCGGTTCAGTTTTTATT
ATTTCGGTTCGGTTTTTATTATTTTATTTTTTTTAATGGGCCTGCTTAGTTGGACTTTTAAAAATTTACAATTTTTTTTGTTTGTTTCAACTTAATGGGC
TAAAAATAATTACATAAAAAAATGTCTTTTACTTTTTACTTTTTTTTTATTTTAAATTATAATATTTATTATTTTTACATTAATAATTAATATAATATAA
ATATATATTATAATATAATATATTTCGGTAAACCGAAATACCGAATAACACAAAATTACATACCAAAAACCGAATCGAAATACTGAAAAATACAAAAACA
TATACTGAATACCGAATCGAAAACCGAAAAACTGAAACCGAAATACCAAAAAAAATCGATTCGATACGGTATTTCGGTTTTCCGGTGTTTATGCCCAACC
CTAATTAAAATCACATCTTTTAAGTTTTTATGCTCAAGTATCACTAATAACATTAATCCACAATAAATAATCCAACATTAGGTAATTAGGAACTTCCTTT
CAATGGCAAAATTCATCTAAATCCTAGTTGATACTTTTTTATCTTCTATCAAAATGATAGACGACTTTATTCTTTATTTCTATGTTTGATTTCTTTTGTT
ACTGTCTAGCTCGTTATCATCTATATTGAAAAAAGATTTGATATGCGATCGAAAATGAATAAAGACCAAGAATCTTCAATAAATTAGGCTTTTTGAGGGC
TCCACTTTACTATTCGGCCATTTTGGCCAAATAAAATTCTAGAAATCTTAGATGTTGTGGGGGTATTCAAAGCGTCAACCTAAACGTCAATCACTCAATC
TCTATAGTCGTTATTTTTTGTTGAATTTCATCCTTAGGTTTACTCGTATTATTCCAAAACTCTTTCAAATTTGCATAAATTTACCTTTTCACTCTATAGT
AGTTCATACATCTCTCGATATCCTATTAAATATCAACTTAATTGCAGCTACAATTGAAAAATAAATAATATTTTACAATATAATATAATTCGATAGCTAG
AATTGAACGTATAATTAAACATAACTCAATCTCCGATTTATAAAACTCTATAGTATCAATTTTTGTGGGAGCTAATTAATGGAGCCAAAAAAATAGAGAT
ATGGGGGATCTTTGGGGATGTCATATTCTTTTGGACATTTTCACATGTGAATTTTTTATTTTCTCCGCATTTATCGCTCAATTTACTTGTCCTACTTCTC
TTCTTATTCTATTTTTTATTTTATATATTTCTAAAAAAATAAATACATATTATTGTGATGTGAAAATGAAAAGAAAAAATTCTAGAAGAAATAAAAAGTA
AAAACAAAAAGTTTCACGCATCTTATTTTTCAATGTGAAATGACCAATTAAGTATCGATATGTATATTATTAATTTAAAGAAGGTGATAAACTTAGGTAG
GTAAAGAGTATGATGAATTATTGAGATATGCACATTATAATTTATATGAGCTCAATAATTCTGATTCAAACTCGAACTCATTGAGTCTGTTATCTTAAAT
CGCCATAAGATAATAATTTTATCATAGAGCTACTGTTCAATTTCTAGTCCTATTCATTTCCATGAATTTATTTTCCTATGTTACTTCTGCTTTATTTTTT
TTAAATTGAAATATCATCGATTGAAATTCAGTATTTTTCAACGAAATGGGTCTAACTATGTTAATCTCGTGTTGTCTCACTTGGTGAATTTTCTTAAGCA
TTGGGCTAGACATTATGTCACAGTCCACATTAGAGGCCCAATAACTTTGGGCTCGTGATATATCTCCTTGTTTTCGCGAGTTCAATTTACGCAAGAGGAA
TATATAGGGGAAATCTCACAAAATACGATAGTATATTTTGAAATTACGTTATGAAATGATACTTTAAATAATTATAGATCATGTCTCTCCTCTTTCCTTT
CTCTCACACCTCTCTTTGCTTCTGTTTCGTTCGCCACTCTCCTATTTTAATCAAGATATCTTTCATGCCACTCGTTAAGAGGTTATATCTCGTGACACCT
TCTCTCTCTCACCTCTCTCGTCTCTTGTACATATATATATGATACCTAAGTGTGTTCGTGTACTATACAATGTATTTGTCTTTCATAATATCGAATTGAA
CAAGATAAAATATACATTTATCCAGATACATGTATCTTGTATCCTGATTCCTGTAGTATCAAATATCAAAGTATACAATGATGTATACACTGTATGTGTG
CATAGATACATAATTCTAAGAAGATACATGTATCTGGTATCAAATATACACTAATATATTTATCAAAATAAGAGTATCTCACTCATATTCTGCTATTTGT
ACAATAGAAAATGAGTTGTATATAAGGATCCCATCTTCAAGCCTTTTGAATGTATCCTACAGAAAGAACTTGGGCTTTACCATCTTCAAGGATTTGATAT
TGGAAAGTTTTGAAATTCGTAGATGATGATAGGTATGTAATCAATATACATATAATATACAAATATTATAGTATTCGTACTTGAAATATTACTACCATTT
ATATATAAAAAAAAGTGAATAACTCAAAGTTAAATCGTGTTTCAAATGAGCGTTTAATAATTCACTTAAAAGATTTAATACGTATAATAGTTGAGACATA
AAACTCACGTAACGAAAATAGTTTAATGCAATAGGGATAAGGAGATAGGCTATAGAAATAACAAAAACACAAACTCAAAAAACTCATCTTTGTTGATAAA
ACTCCAAACACAAAGCATGCAAAAAGAGTCCTTTCTTCTTCAATGTTACTTCAGCTACCTGAGATGCTAACATGGATAAACCCTCCCAAAACCCTAATCC
CCTTTTCTTCCATCATCCCAAACCCTTCTTCTCCAATACCCATTTGCTCAATTTCTCCAAAACCCACAAAAACTTCACTCAAATCCCTTCACCTTTCTCC
TCAGCACACCCTTACTTCAACTGACTGTGGTCTCAAATTCAGGGAGAAAATACTCTATCTTCAAGAACTCAATATCAATCCCAGTAAAGTTCTTCAACTA
AACCCCCATTTACGATCAGCAACGCTCGATTCAATCAGATCTGTTGAAGTATGTCTGTTTTCAATGGGGATTGAACGGTCGGCAATTGGTCGAATACTTG
ATATGCATCCTCAGCTTTTAACCTCCGACCCATATATCCACCTTTACCCAATTTTCGATTTCTTGTTAAACGACGTCGTTATCCCTTTCCATGACATTCG
GAAATCCATTATCCGATGTCCGAGAATTCTTGTTTGTAGTGTTGAAGATCAATTGAAACCCACATTTGAGTTTTTGAAGGAATTTGGGTTTGTGGGTCAG
AATCGAATTACTTGTCAGACTACTGTTTTGCTTGTGTCCAGTGTTGAGCTAACTTTGAACCCTAAAATTGATTACATGTTGAGTTTGGGATTTGAACTCG
ATGATGTGGCTAATATGGTTTTGAGATCACCTGGGTTGTTGACATTTAGTATTGAGAAAAACTTTAGGCCAAAAGTTGAGTATTTTTTGAAGGAGATGAA
TGGGGATATAAGGGAATTGAAGAGGTTTCCTCAGTACTTTTCGTTTAGTTTGGAGAGGAAGATTAAGCCTCGGCATAGGCTTTTGGTGGAGCATGGGTTT
ACGCTGTCTTTATCGGAGATGTTGAAGGTTAGTGATGGAGAATTCAATGCCAGATTGATTGAAATGCGATTGAGGTTAGTGGATGATAAGCAAATGTAGT
ACGTAATTAACTCTTTTTCTATGGTTAGAGTCGAGTTTGTCTATGTTGGAGACTCATTAGAGTTAATACTAAATGTTTGACATATATAAATTGTTGTTAG
ATGTACATTTTTCGCGATAAAGTAATGATTTTTATCCTTGATATGGTGTTCTTTGTTCATGGTTTTCATTGTATCTCGTTGAATGCAATTCGAATTTTGC
TATGCTCTTGTTTTTTATAACGGATATGATCGACATATGATGTATCATATTGAATTATTGCTCTCGAGCACGCATGTTCATCTAGTATTTTCTTCTCAAA
GATTACATTTTATTTATATAGTTGCGACCAGATGTAATTATAGCCACACCGATGGTAGAGGGATGTGATTTTCCTTGGTGTGGTAGGAGATATTAAGCCT
TAAAACAGGCATTTCTCTGTGTATATAATGATAATGAGACTCATTGACCACTGCTCTGTCCTTACTATTGAAGTTAGGATTCATCTCTTTAGATATCCGA
GTCTCTTAACAAATACTTTCTCTGTTCTTTTTATATGACTACATTAGTCTGAACGGAGTTTAAGATGTTAATTTGATTCTATACTATGTTAATAATAGTG
AAAGAAAATATTACAATACTGGTTGAAAAGGTTTAATGCAGAAACTATCAGATCAAAGTCAAAATTTTGAATAGTTGATTAATATTTAGTTCTTGAAGTT
GTGAAAGTATTATCAAAATAGAATCAATCCAAATATTTGGGGATGACCCAAAAAGGGAAATGTCATACAAAATTGGAACGGAGACGATACTATTTTAGTG
TGTTTGCAATTTTGCAAGGGTTAGTTCATTAGCATTGGCGATTAATGTGATGATTAGATGATGCATAAGTTTAATGGTTGAATGACTATGTTAAATGATC
GATTAATTGAAGTATGCTAGAAACCTGTTATTCGAGAATTCTGTTGCATTCTCTTTTCTCATGCTGAAACCAATGGTTCAACAATGGGCAGTAAGCAAGC
AATTAACTGTTCCTTTCTATAACACCTCATTTGACATTGCTCAGCTTTCTGCCGGCCAGAAATTTGTGTAACTCCAGATTTTCACCTTGTTTTCTCCAAT
TCATAGAGCAATGCTTACATTTCTTATTGTGAAATTAATCGAATCTATAAGTAGCTCGATCCCAGACTGGTTCTACTGAAAGATGTGCTTCTCCACGTCT
GTAGAAAATCCTTATACTTTATTGTCTAATTTGCTGTTGACATGACATATTCTTGTTGGTTTTCCGTTATCTGGCTGTATAGATACTCGAAATAATATCA
TACATGTACTTTCGAAGTTGGTTGAACCTTGAAGGTTGCTATTGAAGTTTCCTCCTATAAAATCATGGTTTCTTACAAGATTATATTATAGCCAAGTAGT
GAAAATTAAATATGACAACTATTCTAGTTAGGCATCAAACAATTTTACATACTTTCCATCTCGTTATCTTATTGTATGAAATATGCATGTGTATTTATAT
TTTTTGCATTTAAAAGTTTTTGGAATAATATAATTGTTTGAAGGATAAAATGGCCGTATATGTATGATATAATTAGCAAAATGATATGAGATTATCATTA
TTTTAACATATAAACAATACACCAGTAAATAAGAAGGAAAAGAAAGAAAAAAAAAGACATTTATATATAGATACTATAAATGAAAGAGAATGTGAATGTC
GTAACTCGTATTAAATTGATTGATTTAAGTATGAGCATTAAAGTACTATTGCTTCACTTTCAAATCACCCGTTTAATTATAATTTTATAATATCGAGGGT
TATAAAAGTAAATATTCATAAGTTAAGGGTAAATTCGGCATTTTCAAGTTTTTATTATTTTAATCTTTTGATGGCTTTTGTTAGTGGAAAAAGGGCAACG
GTAAACAAATAAATTAATTTGTCAACTCTTCTTTGTTTCCTTGACAAAAGTCAGCTTTCATTAGTGTGACAGAGAATTTTATTTAGATTATTTTTTATTG
TTGAAGACTGATCAAAGCGAATGTTAATACAAGCTTTCACGTTTCAAGTGGTACTTGTTTAATTCTTCTTTCTTGTATATAACTTTGTCCAAAATATCAT
CAATTGATCTCATCCATACAATTTATTTTTAATCGAATCTATGGCATCTTCTTCTTCTTCTTCTGCAAGTAATTCAAAGTATTATCCTCGATGGAAGTAC
GTTGTTTTTCTAAGTTTCAGAGGTGAAGACACTCGAAAAACATTTACAGGTCACTTATACGAAGGTTTGAGAAATAGAGGAATAAACACATTTCAAGATG
ATAAAAGACTAGAGCATGGAGATTCAATTCCAAAAGAACTCTTGAGAGCTATAGAAGATTCTCAAGTTGCACTTATCATTTTCTCAAAGAATTATGCTAC
ATCTAGGTGGTGCTTGAATGAACTAGTGAAGATCATGGAATGCAAAGAGGAAGAAAATGGACAAACAGTCATACCGATCTTTTATAATGTGGATCCATCA
CATGTTCGATACCAAACTGAAAGCTTTGGAGCAGCATTTGCCAAACACGAATCAAAGTATAAGGATGATGTTGAGGGGATGCAGAAGGTGCAAAGATGGA
GAACTGCCCTAACTGCTGCCGCAAATCTAAAAGGATATGATATCCGTAACGGGTTAGTTGAATACACATAATTACTTTTAATGTTTTTACTGTTAAAAAG
GCATAGTCCAATCAATTTAATTAGAGAAGATACATAAAAGTCCAAAAAACTATTCAAGTTTTGCAACTTCCATACTTGAAAACTATAGAGTATTGTTATT
ACCTGAACTATTCTATTTCCTATTTAATACCCTGCTGATTATTAACAATATATATAGAGTATATGAAATACTTGTTGGTATTTGACTTTCTTACATTGTC
CACAATCAATTTTCTTCTTTATGTAGGATTGAATCAGAGAATATTCAGCAGATCGTAGATTGCATCTCTTCCAAATTTTGTACGAATGCTTATTCTTTAT
CTTTTTTGCAAGATATTGTGGGAATAAATGCTCACTTAGAGAAACTAAAATCGAAACTTCAAATAGAAATCAATGATGTTCGGATTTTAGGGATCTGGGG
AATAGGCGGAGTCGGTAAAACAAGAATAGCAAAAGCCATTTTTGATACTCTATCTTATCAATTTGAAGCTTCTTGTTTTCTTGCTGATGTTAAAGAATTT
GCAAAAAAGAATAAACTGCATTCTTTACAAAATATTCTTCTCTCTGAACTGTTAAGGAAAAAAAATGATTACGTCTACAACAAGTATGATGGAAAGTGTA
TGATTCCAAACAGACTTTGTTCTTTGAAGGTTCTAATTGTGCTTGATGATATAGATCATGGTGATCAGATGGAGTATTTAGCAGGTGATATTTGTTGGTT
TGGTAATGGCAGCAGAGTTATTGTAACAACTAGAAACAAACATTTGATAGAGAAAGATGATGCGATATACGAAGTGTCTACACTGCCTGATCATGAAGCT
ATGCAATTATTCAATATGCATGCTTTTAAAAAAGAAGTTCCAAATGAGGATTTTAAGGAGTTGGCGTTAGAGATAGTAAATCACGCTAAAGGCCTCCCTT
TAGCCCTCAAGGTGTGGGGCTGTTTATTGCATAAAAAAAATCTCTCTTTATGGAAAATAACAGTAGAGCAAATAAAGAAAGACTCTAATTCAGAAATTGT
TGAACAACTCAAAATAAGTTATGATGGGTTGGAGTCCGAAGAGCAGGAAATATTTTTAGATATAGCATGTTTCTTCCGCGGAGAGAAAAGAAAAGAGGTC
ATGCAAATTCTTAAGAGTTGTGACTTTGGAGCTGAATACGGATTGGATGTTCTGATTAATAAATCTCTTGTGTTCATATCTGAAAATGACAGGATTGAAA
TGCATGATTTGATTAGAGATATGGGTAGATATGTGGTGAAAATGCAAAAGCTTCAGAAAAAACGTAGCAGAATATGGGATGTTGAAGATTTCAAAGAAGT
GATGATAGACTATACGGTAAGTAAGCTTAACAATGCAATGATATTTAATTTCTAATTTTTATATTCCAAGGAACTTATAGGCTAATCAATACAGTTTATG
AATAATTGACTCATTGATCTTTATACCAGGGGACCATGACAGTGGAAGCAATCTGGTTTAGTTGCTTTGAAGAAGTACGTTTTAATAAGGAGGCAATGAA
AAAAATGAAAAGGCTTAGGATATTACACATATTTGATGGTTTTGTCAAATTCTTCTCTTCGCCTCCCTCTTCCAATTCCAATGATTCAGAAGAAGAAGAT
GATTCCTACGACTTAGTCGTAGATCACCATGATGACTCTATTGAGTACCTGTCCAATAACTTGCGTTGGTTAGTCTGGAATCACTATTCTTGGAAGTCAT
TGCCAGAAAATTTTAAACCAGAAAAGCTTGTTCATCTTGAACTCCGTTGGAGTTCGCTTCATTATTTATGGAAGAAAACAGAGGTAACATTATTATTTAC
TTTACTTACCCTCCTCCAGGAGCTTCAACCCCTTTTGCTCTCTTATTTACTCGAACCCACAACCTTTTGGGTTGGAAGTGAGGGTGCTCAACTCCCTCTT
GTCATTTTTGGTCTGACACAAAGATCATTATTCTTTCTCTATTTTGAATAACAGCATTTGCCGTCTCTACGAAAGCTAGATCTCAGCTTATCTAAAAGTC
TGGTGCAAACACCAGATTTCACGGGGATGCCAAATTTGGAGTATTTGAATCTGGAGTACTGTAGTAAGCTTGAAGAGGTTCACTATTCCCTAGCATATTG
CGAAAAACTCATTGAGTTAAATTTGAGTTGGTGTACAAAGCTTAGGAGATTTCCATATATTAACATGGAATCTCTTGAATCTCTGGATCTACAATATTGC
TATGGTATAATGGTGTTTCCAGAAATCATCGGAACGATGAAGCCGGAGTTAATGATTCTCTCAGCAAACACTATGATAACTGAACTACCATCATCTCTTC
AGTACCCAACTCATCTCACAGAGCTAGATTTGAGTGGCATGGAAAACCTTGAAGCTCTTCCAAGCAGCATTGTCAAGTTGAAAGATTTGGTGAAGCTAAA
TGTGTCGTACTGCTTAACGCTTAAAAGCTTGCCTGAAGAGATTGGTGATTTAGAAAACTTGGAGGAACTTGATGCTTCGCGTACTCTAATTTCACAGCCT
CCATCTTCCATTGTCCGCTTGAACAAGCTTAAATCCTTGAAGTTAATGAAACGAAACACATTAACAGATGATGTGTGCTTTGTGTTTCCTCCTGTGAATA
ACGGGTTACTCTCATTGGAAATTCTGGAGCTCGGTTCCTCCAATTTCGAAGATGGAAGAATTCCGGAAGATATTGGATGTTTATCCTCTTTGAAAGAGTT
ACGTCTCGAGGGAGATAATTTCAATCATTTGCCTCAAAGCATAGCCCAACTTGGTGCACTTCGATTCTTATACATAAAAGATTGCAGGAGTCTTACAAGT
CTGCCAGAATTTCCACCGCAATTAGATACAATATTTGCAGATTGGAGCAATGATTTGATCTGTAAGTCACTGTTTCTAAATATCTCATCATTCCAACATA
ACATCTCTGCTTCAGATTCGTTGTCGTTAAGAGTGTTTACGAGTTTGGGGAGTAGTATCCCAATCTGGTTCCACCATCAGGGAACAGATACAAGTGTTTC
AGTCAATTTGCCTGAAAACTGGTATGTA