BAC Sequence – LE_HBa0036B17

>C03HBa0036B17.1
AAGCTTATTCTAGTGAAAACAGAAGACATACATCAAATTAAACATCATCAACACCAATGAAGTTCTGGTCTAAAGACCCAATATAAAGTTTGTCATTATA
TTCTTGAACTTCAGTTATCCCATTAAAACTCATATATTGAGCTGTGAAATCACGCGTTTCCACTAATTTTCCTGACTGATTTATCCTTTGTCCTGTCGAA
ATTATGGTGGGAATGATCAACACCTTTGTTTTCACGGTGACAACAGCAACCCAAAAATCTCCGGACACAGTCCGCTTAATGTTATCTGGATTTCCATCAA
TGTTAGCGAAAACATCAGATGAATTTGCTTTTGCACCTTTCAGCCAAAATCTCCGAATTCTTTTACCAATAGCTTCCGAGACTAATAAAAATGATTTGTC
TTTGCTGAGTGCTATCCCTGCTGGCCCTGAAAGTTTATTTAGTAATAACGTGACTTGTTTCGTTGCTATATCATACTTGAACAATCTCCCTGTTGTATCT
CCACTTAAAGCTATTAGTACTCTGTTGCTGCTCAGTTTTTCAAAAGATGAAATAAAATTAGTTAAATGCAATATTGACAAATATGAATGGACTTTGAGCC
TAATTTTCAATTAAAAGTTTTAGAGTGACGAACCCAGTTCGGAATATGGCTCCTGAATCTATAAAATAAATGACTCCCTCTTCCTGGTCGATGTCTAGTG
AGTCGAGAAAGGAAAAAGGCGTGCCCTCGAAGCTTGTAACAAGTGGTGTAGCGAGCCCTCCGCTTGGTTTAACCACCAACAGGCCATAATATGCATCAGT
TATGTATAGATCACCAGTTTTGTTGTAAAATCCAAGGCCATACGGTCTTCCACAAGAAATTTGTGATATTGGGTCGTTTGTGCCATTACATATTTGTTTG
GTCCTAAACATACATAATATATACGAAAATTTGTCAGTCGCTAATTCCTATTTTGTTAAAAAGATCAAGGTTAGAAATGGAATTTAATAACCTATTCGGT
GATGTAATAGCAAATTCAGTGAAGCCAACATTTGGACCTTGATATTTCATTACTCTGCCATCTCCAACACCGGTGTAAGGTCCGACACCTTTTGTGTCGA
AAGCAGAAGAGTCAGGGCCAAAGGCTTGTAATGGAAGTTGGAGTCGTGAAAATGCACAATGAACAAGGTAAGGTGAGGCATTTAAGAATATAAGAATCTG
GAGAATTAGGAACATTGCTTTTGTAATTAAGATTATTCCCATGTTTGTTTGTGTTGTATCAATAACATAATCAACTGTTGATATTTATACTACCAATTGC
TCCACAGGGTGCTAGGGGTTTATCAAAATTAATTTAATTTAATTTTAAAAATTAATGAAATCAGATTCTTGAAAAATGCAAATGGAGTATAATTCTAAAT
TTACTGCTATGAAACTCTATAAATTAAATGAAAGCCGTAAGATCTATATAGCCACAACGATAACGTGGCAAAATTAAGTTACCAAACGTATATTTCCCTG
AGGAACCATTTCAAAATCCTAGTTACAGTAACTTTCCAGGCATAAGTGTGGTTCCATCGGAACTGGAAGAAATACGTATTAATTTTTTTATTTTATTTAC
GTTTAGTCTTTTTAAATTAAAATGTATTTTTCTTTTGATGCAATTTTTGAAATTTAATCTTTCACGTGATTTGTTTAAGATTATAAATTTAAAATATATT
TTATTTTTATGATAGATTTTAAGATTCAAAAACTTTCTTTTTTCTTTTTAAAACTATGTATTAATTTAAAATCAAACAAACAAATAAAAAAGAAGACGTA
ATTACTTTTACAATGGTTACAAAGTAATGTGGTTAATTTGGTGACTTATTTTTTCTAGCCAGTTGCTAAAAAAGTAAAATCCGTAAAGATTTATTGGCAA
AACAAAGAAAAAAACAAAGGGAACAATGGGTTTCGTTTCCCTTTGTATTTTTCGAGTAGGCTCAAAACATGGGGTGATTTCATTAAAAAAACTACATAAT
ATGAAAAATTTTAATATACATTTAAATAATATAGCTATAGTTTAATTTTTTATGTTATATGACTATAATTATACAATAAATAACTTATTTAATCGTATAT
TAATAATTGTTTTTTATATATTTAATATAAAAAAATAATAAATAGAAAAATTAATATTAAACTCATGATTAATTATGTATTCATATCTTCTCTTTCATCA
ATATCCTTATATTATAGATTTTTTTGTATTTTTGTCTCAATTCCTTCCAATTCAAGATCCTTTTGTATGATTGTAGGAGTGATTTTTGTGGTTCAATTCA
TTATATTTATATATATACTTATATTTATGGTTTAATCAAATGTCAAATATTTATATTTAATAATACTTATATACATTATAATTTTGAAATTCAAAGTTTT
CGTCAATTTTGAACCAAAATGGAAAGGATCTTTAATGACTGGAGAATAATTTAGAATCTCAAAATTTTTGATACTCTTGAATCAAAATCGAAAAGATATT
TGATGAACTTGAAGATTTACAAAAGAAATCGTTTGTCCAACAATAATTTCATACAATCCTTCATAACTCATCCCGCTTTTCAAAATTTCGACATATTTTT
TTATGAAACAGAGAGAACGATGAACAAGAAGAAGAAATTTATTTTTTTGATATTTTTGGATTGTTACACTATATGATTTTGAATTCTTGATAATAATTTT
GAATGAAATAACGTAATTTTGTGGAATCTTAATTTAATTTTCAGTTTTTCCCCTTAATTAGTGAAACAAATGGATACTATGAGATTTTAAATTGATTTTA
CAGTTTTTTTTCCTTAATTAACAGATTGATACATAATATATCAACAATAATATATCCGAATTATCTGAAATATCTAAAAAATATGAAATTTATATAATTA
TAAAAATAATAGAAATAAAAGGTAATTTAGATTTTTACACTATGATATTTACGGAAGTTATACATTAAAATTTATGTCCCATAAGCAGCATACATCAATT
CATGATAAAATCTGTTCAACTAAGCCGAATATTCAAAAACACCCCTTATGGAACCCATAAAAGCCCCACTTGAATTTTTTTTTGACTTGGCCTTAAACCC
TAGTGGTTTATCAAATTCCAATTTCTCCCCAATTCGTTAAACCCTAGGCCGACGTTCAAGAGAGAGATGGGTGGTAGTGATAGCGAAGTAGAGAAAACGG
CACAAAAAGATACGGAGAGAAAGAAGCTATTGGCTGTCGCCCCTATTGCTAAACCACTCGCTGGAAAAAAAAAACTCAGCAAACGAACCTTCAAACTCGA
TAGACGAGGTATCCATAATCATTATTTTACTCTTTTTGTGATGTTGTGTAATCGCCATTCTTCTGTTTTCAGTTACGGAACATAAATGCTTGAAGAGAGG
AGTTAAAGAAGTAGTGAAAAGTATTCGACGCGGTCAGTCCACTTTTTCTCTCATTGAATTCATAGTCAAAATTAAACTGTCTCAAAATTAAATACGAATA
CCGAAAGAAATAAATTTGAATCTAATTCAGCCTCAAAAAGTTAATCACGGAAGTGGTACGTCTTTCATAAAATCAAAATTGAGTTGTGGTGAGCATGAGA
TGAAAACTGGAAAATTGTGTATTTTTTTTTTTATGATTGTCCTCAGTCTGTAGTAGGATAGTCCTGTAGTGTTTAGATCTAGCCTCATGCTTTAGAATAG
ATGGACAAGTACTTCTAGCCCTAGGCCAAACCTGAGTTCCGTGCTATAATGCCCCTGGAATGTTAGGGTTTTGGGGTTTGGTTTGGATAATTTTTTTATT
AAAATATAAAAATTAAATTAAAGTGATATTTATATTTCTAAAATCAAATAAAAACAATCGATTTGGTTCGATTTATTACTTGATGATGATAAATGATAAT
AGTAAAATAAAATAGACATGTGATAACTATTTTAAATGAACATTAGGAATCAACATTTCTCTTTACTATAACAAGATGATGGAAAAACCTCCTCTTCACA
TGTCTAATATCCACGAAAACAATATACTAAAACATTAAATAGATGTTCTAGTCCTTCGAAAATCAGGGCAAAACCAATGAAGAGTGAGCAGATAAATGTC
TTAGCAAAGAAAATTTAGAGGGTGTTTGGATAGGCGTCTGATAAATCTACTTTTAAGTCAGTTTTTAACATTCGAAAGTGTTTGATAAATATAAAAAATA
ATTTACCATAGGTTTAAAATGACTTAAAATATATTACGAAGTGTTGGCAAGTTATAGGGTGTTTGTATTGACTTAAAAGTTGGTCAAACCTATTTTAAGT
CGTTTTTTTTTTACTTCGGAAAGTGTTAAGACAAATATAAAATCAATTTCAAATAAGTTAGAAAGTATTAGGCAAAACTTAAAAATAAATTTATAATGAC
AAAACAAATTAAAAATATAAAAATAACACTTCACACACATTTAAGATAATAAATATCAAGTTATAAACATACTTTTTAAAAATAAACTACTTATAGCATA
TCATTATCGAATTATAGCATATCAAGAAAAAATATATTAAAAAAATTTATAATTAATTATTTCAATAATAATTTATTTATTTAAATAATTACATTAATTT
TTTCAGTTACCTTTTTTAAAACAAACTCTTTAATTTTTTATGATACAGTTACCTTTTAAATTACATTTTAAAGTTTTAACAATTTAAAATAAAACAAATT
ACTATTAGCTAAATTAAACATTATGTAGTTACCTTTATAAAGACAATTACAAAATAATAGGGATTTGATTACACCCTAATAACTATCCACCACCATCTAA
ACCAATACAAGATAATATTTCTCTCATTACACTCAACCCATACACGCCTATTAGCCTAAAAATATCACCAGATTTTCACCGGAACCGCCACACGCATAAA
AAAATTCATCTTTCCCAAATCTTCTACATACACGCCTAAAAACATCATCATATTCACCTACGTCGTCGCACACCTAAACATTCATTTTCACCAAATCTAC
TGTTTTTTACGAAAATCTTTCACATTTTCACTCACATATCAGTTCATCCCAAAATTAAACCTTCATACTTAGCATCTATACAATGTCGAAGAGAGATAGT
GAAATCCCACGTAAAAGTAGGAGATTGAACGATGAGTTAAGATGTGAGGGCTTTCATGCTCCCTCTTTCAACATTTTGTCACAAACTCAAACTCAAACAT
CAACTGCAAAAGAGAAGTCTAGGTCAGAAAAATCGAAAATGAAAAAAAAAGAGGCAAAGGAAATCAGAAAGAAGAGAAAAAAGGAAAAGAAAAACAAATC
TCCTGTGAATCTGAGAAAGAGGCAAAGGAAAGAGGGAAGAAGAGAAAAGGAAAAGAAATTCAATACTCATCAGATTCTGAGTCTGATTTTGTTGATGAGT
TCATAAATTCAAAATAAAAAAAAGCAAGAGGTACTGAAATTGGTAGGTCACAGATAAAAGCAAGAAATAAACCAAAAAAAATTGTAAAGGTTAGTAAAAG
ATTTTTTTGAAATTTAAATTAAAATAGTCTGTTTAATTTTGATTTTAATTGTCAGTAATATAGTACATGATTTATGTTGTGTTATTTGTGTATAAAATAA
TTAATATTTTTTTTATTATAGGAGTGTATGAATTAGTGTATTAAGTTTGTATAAAATGCTATATTGTTTTATTACACTATCAATGTATGAATAATGTATC
AATGTTGTATATTTTTGACTATTACTATACATATTAAAACTAAATAGTTTATGCTTTGGTTTTTGTGTATTATTTTTGTATGAATTGTGTATGAACTGAT
ATACATTTTTTGTATGAGTTGAATTGAATGCCCATTCAATATAGAAGTTTTTTATGATTGTATATGACATTATATAGTATGATAAACGTATTAATTTGAT
TTTAAAAAATTTTTAGGAGAAGAAAACACAAACACATTTGTCTTCATGCATTAAAATGAATGTGTTTGCGAATCTGTTGACCTTTCTAGGTCAAGAAAAG
TTTCAACAATTCTTAAAAGAAACATTGTTTCGATTTTTTTTATAATTTGCATAATATAAAAATCCAATGTCAATTGTTAAGACACATATTTCTTCTTGAA
AATGAAAATTTAGGGATAACATGTTTGTTATAAATGTACCAATTAGAAATATAATTTACAACTTATTTTATTATATTCTATAATCAGAAAATTAAATAGG
ATAAAAATTACCTCCCGAATCTATTGTGCTGGCAGTTAACATTGTACTACCATATGAACATTTTAATCCTGCCCCATCAACAACTACAATTGGCCTACAA
TATTCTCAACCTCTAATACAAGCTTCTAACGCAACAAATGCGTATAAAAATTTGTCAGCTTCTTTCCTTTTAATTTTCAAAACGAATCCTGGATATGTTT
GCTCCAAAATGTAAAAATAACCTGAAATATAACGGTCCAAATCATACAAAAAAAATATACATAAAGAATACACGAAAAGAGATTAGTCCAATTCAGTAGG
TAATCTTTAAATTCATTCTTATTTCAACATTACCGGGTAATCTTGCATATGACTCTGCTGGATCTCCGCGCACCAACTTTATTGCGTTTTCTTTAGCTCT
CCATTCCTGTATGTACGTCAACGAAACGCAATGCAATTTCAACATATCATCAACTATATCTTTTGGAGTATATAACAGATGGATCAATATACTTTTCCAT
TATCAAGACAACTACAACGTCAGTTATCCCCTGACGTCTGGTATAAACTCTTTCTCTAACAGAACAAGTGTGCTGAGGAATATACTTCCTAACTTTGAAT
AAATTTGATTTATTCAAACTAGATGCCCTCATCATCCAAGAACAAGTTTTAGAAATACAATTCAGGTGATAACTGTTTCGAAATTAAGAAAATATACATT
ACAATTATGTACAGTGAAACAAATCAAATAAAAAAAATAATTTAAAAAAGTTTTATACACTTACTTAGATGCATTATAACGCGCAACATGACAACTGAAT
TTTTCAACAAGTTCAACTTTCCTCATAACCTCCTTAAGTGTTTCTCTATTATTATAAATCTGATTATCAGCTACAAATAGGTTGAAATGGTCACATATTA
CATCATTATCTATATCACTATTATCATTGACAACTCCGTCTAAATTCATTCCGATCAAACGGATAGAATTGTTGGAGTACAAATCAATGTTAGTTTGTGA
TAATCTAACATCAGAATTTATTCTATCAATAATAACAACTCTATGACCTTCATTATACATCTTACGATCTTTCAAAGTGATGCATAATGGATATTTTGTA
AAGAAATTCAAATTCATCCTCATCTGACCTAGAAAAACCTTTACCCCAATATTAATAGGTGGAAGTATCATATAGGATGCCCTCCATCTCAATGTCGACA
TATTTTCCTGTTTAACAACATTAAAATTACATTTAGTGCACCACACTATAAAATCACGAAATAAGTCATACAAAATTCATACACAATTAATATATCATTC
ACTGCTATAACAGATCAAAAAATTTACGTGGGATTTCACTACCTCTCTTCCACATTGTATAGATGCTAAGTATGAAGGTTTAATTTTGGGATGAACAGAT
AAGTGAGTGAAAATGTGGAAGATTTTCATAAAAAACAATAGATTTGGTGAAGATGAATGTTTAGGCGTGCGGCGATATGGATAAATATGGTGATGTTTTT
AGGCGTGTATGTAGAAGATTTGGGGAAGAACAGTAAATTTGGGGAAGATGAATTTTTTTATGTGTGTGGCGGTTCCGGTGAAAATCTGGTGATACTTTTA
GGCGTGTAAGGGTTGAATGTAATGAGGGAATATTATCTTGTATTGGTTTAGATGGTGATGGGTAGTTATTAGGGTGTAATCAAATCCCTATTATTTTGTA
ATTATCTTTAAAAAGGTAACTACATTAACTAATGATAATTTGTTTTATTTTAAATTGTTTAAACTTTAAAATGTAATCTAAGAGGTAACTGTATCAGTAA
AAAATTAAAGAGTTTGGTTTAAAAAAGGTAACTGAAAAAATTAATGTAATTAAATAGTTTGATTTAAAAAAGATAACTGAAGAAATAAAGGTAATTATTT
AAATAAATTAATTATTATTTAAATAATTAATTATAATTTTTTTAAAAATATATTTTTTTCTTGATATGCTATAATTCGATAATAATATGCTATAAGTAGT
TTATTTTTTAAAAGTATGTTTATAACTTGATATTTATTATGTTAAATGTGTGTGGAGTGTTATTTTTATATTCTTTTTATTCGATTTGGTTTGGTTTTTC
ACCAAACTGTGGACACCCCTGCTGAAATGATATTGAAATACCCTTACATAAAGAGCTGGCTATATAATTACGACTTACGCAGTAAGAATAGCTAGTGTGT
AAATTTTAGGCTTTTTAGTTACTCCAGACTCTTAAGTCTTAATTGAAGCCATTAAATCAATGTACCTAATTGTCGGTAAAGAGTCAGTACCTTGTTAGCT
GCTCTGTAGCATAGCCCATAAGCACTTGTACAATCAATTCCACACCTAGCAAATTTTGCTCAAAGGTAAATTTTCTACCCTGAAATATTTGTGACATGAA
TTTGTCTACATGCCATTTTTGTGAATTAACAAGCTTATGAAACATCATATTTCTTCTGGGAACTGCAGATTGTGTGTCATAGCTGGAAACATTTCTCCTA
TCGATGTCATTACTCACGTTCCACCTCCTATGTGAGGAAGCTGATATGCCATACGTTTATGTTCCTTCAAAAGAAGCTGAAGTTTTTATCTCACACACAC
ACTTACTACTATTACATTCTTGATATGTTATCCTGCAAGTTACTTCCGTGATCATGATAAATCTTTGCATTCAGGATCTTGCAAGTGCTGGAGCCACTAA
GAGGCCAACTTGCTGCGTTTTGGTATCGACAAAGCCTACTAAGGGGGAACTTGGGCAGGAAGTTCAAGAGAAACTGTAGGAAGAGTACGATCAAGTTGTA
TAGGAAATTCAAGAAACAACTTCCTCCTTGTTTCGATAGACTGAATGATGATCTATTGATGGTTTCACTTAATTGCCCTCTACTTAGTTTAGGAACATGT
TTATGTATCTGCCATTTATTTACGTTACCATTCAATCATCTAACTGACAGCTGATAAGTAACAAGACATAAAGAATGAAAGATCAGTCGATTTTTACCCT
AACTTGATCAGAAATTCATGAAACATATCCACGAAACAACAAAAATTAATGAGGATATCAAAACAAAAGACCGAACAAAGAAATATTCGCTCCATCTGTT
AGAGACAATTACTTCATCTTATTCATGTATGTATTGGTTCATCAAACATACCAAGGCTAGAAACATGCATCTACACTGTTAAAATTTTCTATTAATATAT
GTACATCTTCTACGTAGTTAACTGTTTCATTAGCCATAGTTGGTTCAGTTATTTTTGAGACAAGGTCCTGAACGAGCATAGTTAACTTTTTCAGTAGCCA
TAGCCGATTCAGTTATTTTTGAGATAAGGTCCTGAACAAGAAGATACCTACACCGCCAACAGCAAGGGTAAGAAGCAGAGGAACACCAATCCATTCAACA
ACTTCAGCCATCCCCTCGGTCCTATCCGTTCTCCCTAGGCGAGATCCATTGAGCTCACGGAGGATATTGCTCAGATTGTCCATCTGATGCATGATCTGAC
GCTGTGATCTCCCAATGAGAAGTACCTGCTCCCAATTATGTTTGCATCAGAAGCATAATTGTCTAATCAATTTCTCAATATTCTTCAGACAAATGTGTTG
AATCTGGACTATGGTTGTTTTCAGAGAAACTTTTAGTTCGTGGAAACATAAGTTATTAACACCCAATGCAGTCTCAAGTACAATAATAGCATACCCAATG
TAATCCCACAAGTGGGGGTCTAGGGAGGGGTAGTGTGTATGCAACCTTACCCCTACCTTTTGAAGACAGAGTGGATGTTTCTCATAGACCCTCGACTCAA
GTAATGATAAGGAAAATCATCACAGTAAATATTAACGATGCAATTGAAAGTTCTGGTGCCTAGATTGGCAAATCAATTGAAGTTTTCTATTAAACTGGCG
AACAATGTAAAAATGATGGATCAAAGAAAACACTCGTGCACTCTCTAGTGTTCTTTGTGAGATAAAAGAATTATTTTCAAATGGATAAATTATGCAATAA
CCAAATTCACTCTAAAAATTGGTCATATTGAGTGAGAAGGCAAAAATTGGACAACTATTGGGAGAGTATATCAAACTACCCGCATGCCTCCTTTTGTCTC
TACTTAATGCAAAAAAGATGAGCACGGGATGATCGTATTATACCTCTTCCATTAGTGAAGACTCTCTTGCCAGTTGGGAAGATGATGATGAATGAGGTAA
AAGAGAACCAGCCAACGAGCCATTGCCTAACCCACCCACAAAAAGAGAAGTGGGTCCAGACCCATTGCAAGACTCAGTGTGCACTGCCAAATTTTGTTGG
CTAGCAGAAACTTTATTGGCAGATATTTTTAAGTTTAGCTCTTCAATCCGAGATGTGAACTCATCCATTCGCTCGCTCAATGTTGAAATTTGCTCTGTAA
GTTGAGAAACAACTCCCTGAAAAAAGGCAATTCTTGAGTGATTGAGGGAAAGAAGGAACAAAAAAGGTTAATGTAAGATTGAGCATATTATAAACAATTC
AGCATAAGTGGGACGTACTGGTAGTAAATTGATTTCTCTTCTGATGTATAAGAAATATGGAATTAAGCAGGAAAACCCGCACACATATTCTGCTGGACAT
TAGGAATATATGAAACAACATTCACGTTTTTTGTTCTTGCTTAAATTGGTAACATACAACATATAAAAAGAAGAATATTTGGCCCAAAAAAATGTAACTC
ATTGTACTTTAGAGTATCCCCGTGCACATTAAAAGTATTTTCCACTCTCTTAGCAGATAAAGTTTCCAGTACCAAGTCTCCATATCAATGAAACAAAGTA
ATTTTTTATGTTTTTTGCGAACATGAATGGATTATTTTTTTAAAAAATAATGATTAACATAATTTAATTGATGAAACAATATGGCTACAATTCAGTTTGC
TCCCTTGATTATTATTCTCTCTTGATTATCTCTGTGATTTGAGGGATGAAGCAGCATGTATTTCTCGACTAGGATGATGCGGATTCAATTTCCATGAGAA
AAATGATTCCAACAGTTAGGACATTTCATTGATATATATTCCCTATTCCTAGTTGCTGTTTTACAGAATACTGGAAAGAGTGGGACAAGGCATTCAAATA
TTCCTGCCGATGTATTTTGACACCCCACAGCTTCAGCAGATCGCTTAGCCCTGTTCATTTTCGGCACAAGAGCGCTCGATTAGTGAGATGTTACACACTC
GTTCAAGGGTGTATAAACACTTAAAAGATTTATAGGACTTGAATTAAAGTCTCTTCTCAATATTTTATTAATTAAACAAGCAAATATGCTTTCTGTACAT
CTATACGAACAACTGTAAATCATAAAAAAAGACTTGCTGTTTTGCATGATTAAAAAGGGATCCATCAGCTTTTAGCAGGAATTTCCAGTCACGATCCCCA
GGGTTGCCAGCTTATCATCATTTTACTTCCTTTTCAAAGTTACAAAGTCAACTTACTTTGCTGGTTCTGCAGATGACGAGATCCTAGTGTGTTTTCTTAA
CTCCTACATGAAGGACTCATTTCATTCTACTGAACAAACTTTCAGCAGGATTCTATTTCCAAACATCCAAGCAAATGTAAATCTTTCCACAGGTTAGTTG
GTTTGAGTTACGGCTTACACCATTCTGATGTAAGGGAATATTTAAATTACCAAAAGACTTGATAGCATGTAGCTGTTGTCAAGGGTGTGGTTATGAGTTC
ATGCTGGTAGTGGAGAGAAATGAGCAGGAAAGGGTGATATCATTCTTGAGTATCAATAAGAATCGATTAATGGTGTTCAGAATTGGTATATCACTTGTAT
ACAGCCAAGTTGACCTTGTTACTATCCTTACCAAAAAAGTTGGCCTTGTTACTACCAATGAAACCTTTTACTTGATTTAAAAAAATGGTGTTCAGAAAAT
GATCTAAGACGGTGGATGGAACTCTTTCCCTTTTCCTGGAGTAAATTATTATATTAAAGCTAAAGTTGCGCAACTATGTCAAACAGATGCCCCCAAGTAG
GGTAAATGAGAGTCAGTTCACACACCAAATATAACGTTAATATGTAGCCAAAATTATGGAGATACAAGATTATTTTAAAAAATGAACCTATTGCTCCGAA
TAATTACCTGATTAGCCACTGGCGCTGGAGAATCAGGGGTTCTTCCGTCATATCTTCTAGTATTAACCGCAAGTTTTGTCAGCTTGGACAGGTGTTTTTC
TCGTTGTGTTGAGTATGAATGTGGAATACCACTGCCAATAGTTACAGGCGAACAGATAATGCTTTTCCGTTGCATGACTTTTGCAGAAATACGCAAGTGA
TGATTGTAAAAAGTAAAAACATCCAAACAATACCTATAGAATACTTTGAGAAGCAGATAACAATTTAGCCTATGACCTACCGATTAAGAAACTTTGTTCT
CCTATCTGCAGAGGCTCGGGATAAAGCTTCTCTAGGGCTTGAGACCAAATCATCATCTATGCTCAGCTTTGTCTTCAGATCATCTGGCAATGCCTGCATG
GACTATAATATTGAGAACCAGGAACAAATAACAATGGAAAATTTGGTATTCAACTAAAATTTAACGCACCATAACATCATTTAAAAGCTTCTCTAGCTGA
ATTTGTTCGATGTAAGTGCGAGGAACATATGAACCATCCAAACCCAGCGAGTCGGCAACATATTTTACATGTAAGCGATCTCTTCCTTGCACCTTCATAA
GGGAAAAAACGTAGTTAATGATAGTAATTAACTCCCGAGGCTATACAATGCCAGAGTTGAGAAAGAGGAAACTCATTCTCACATACTGTCTTCAGCAAAA
GGAAGATTTAAAAATGAACTCACACATTCATCAGAATATTTCTTCATTGATATTTGTTGAACTTCTTTAACTGAGGTTTTAGGGAACTCCTCCTTTCCCC
TTATAAAGGGTCCCTTTACTTCATTTTTCATCATGCTTCATGTCACGTTTATAATTTTTTAAGTCAAACAAGAGTTTAAGGTAAACACTTCAATGATAAT
GATGAGCAAGCATTGTATCCAAACTGGATATTTCTCCAAAATACAATCCTTATATTTGTCTCAACCCAAAAAATCGACGTTGCTTCCAGTAGATTAATAA
AATAGCAACTTAGCCGATTGTGCCATGCACAAGCCTCAAAAAACATTTAATTATCCACAGCCTTAGCCACATTCTAAGTCTAATACTTGGCTAGGTACAG
CCTTAAAGAGATTTGTTAGGAGGTTACGACACATATCTTTACCTGAACTCCAGATGAAATAAAATTAACCCAAATTCCCAAAAACAAGAGACAGATAAGA
AGGCAAGAAATTCTGCTTCGCAATCACATGATTCAAGCATTTAAAGTAAATTATAGTAAGATGAGATGAGAGCGACTTAGTAATTAGTGATTGTCATACC
TGAACATACCGGCGATTAAGTTGCTCCAACCAATCTGTTTTCACACAAACTTTGTCATCAGAGAAGATGTGGCTGCTCCTTTTCAAAATGGTTGCAATTG
AATATCCTAATGCCATCAACCCACCAAGAAGCCGTACACTGACCTCAAAGGTGATTCTTGGTGATATTATAAAGGGACTATCTGTAACCCATTCCTGAAA
GAAATACATGAAAGAAACATCAGAAGATGCACGATTATCAGTGTCAAGATTACTATTTCTTGACATTTCTCACAATAAAGCTTTTAGAAATTCAATAGAT
ACCAAAATTGTACCCAAACTAGGAAAGAGAGACATGGTGCAGGAATGCTTTTCCAGGGGAAGACCAGAATGCTAATAGATCAAGATATAGAGAAATGTGA
TTATGATCAGTCATTTAGAAAGTTCTCAAAAATGAAGTTAGTCACATGATAGAATGTTCTATGGTTTAGTGTCCAGATATCTATGACAGAACAGCAGAGT
TCTATTAAAAAAAGAGTTAATCTGTATTATATTGATTGCTACATATCTTCTGTTGTATCATATGGGACACCTTAAGGCCATATTTCTTGAAGCTGTTCCA
GCAAGCTCTATACGCAGAAGATCCTAGAATTTTAGAAGTTGGTTCATTCAGACTACGACAGTGACCGGCATACATGCTGGCAGCATTCTTGGTACTCATT
AACGGTATAGATGCATCACAATCAAACAGAAGATATGACGGATATCAGTAGCTAAACCAATATCAAGCAAATTTACCATCTGAAAATGATAAAACTAGGT
TAAAATTAGCCTGATTATTACTGACTGATATGCTCAACATGTAGAAAAGGAACTTATTGGTCACCTCAAACATAAGAGTGTATTTTCCATCCTTGTTCCT
CATCCTCAAATATGATTGGCAAGCTTCGGGATCTTCACTGGGAGGTAGGAGATAAATATCATAAGTTTCCTCTGTAATTTCCTTGTATTCGTCTGGAAAC
ACAGCCTTGATCTGGTCTACATCCACAGCTTTTGCTGACTATAAAACATATTTAGACTCATCAGTCCCAAAACTTGTGCTTGCATAAGCACAATATACAT
GGAATGTAGACAGAAAGGTCAAAAATGTTAAGACCTTTAGTACATATGTGGGGTTCTGAAATCCAGCGAATGGGTTAAACTTATTAATAATTTTGATTTG
AGCCGTCTTCAGATCGGGCTCAATAAAGGCTTTGTACATAGGATACACCTGTTAGAAGAATGCCACAAAGATCATTGTACTTGGCCGTCGAGAATGTGCA
AAAAAATTTGAATTAGATATATTTGAAAATAACAGAGACGAAACCGTTTCTGAGATTTGTTGGATTATCTCCTCGGGCTCTTGTCCAGCACGGTGGATGT
CCCTAAGAACCCGTTTCACTAAGTCAAAGTGCACTCCACCAGTGACAGATACACGGAGATCTAGCAATGGCCTCAACTTTTCACTCAAAGCATATATCCC
TTCAATTATAACAATTCGAGAGCTTGGAGCTTCAAGGGTCCTGTGAAATCGATGATCAAAAGTGTTATGGGATCGGATAGAAGTAGACGTGCATTTTACA
TTGACAAGTAAGGGAACAAAATATTTTATCTAAACCAGTTCTGATAATAAAATTCAGATTTTCTTCTGTCTACTAGGTAAAGCCTATACACCAGCTCTGT
ATAAATCAGGTCGTGAATGTGCTAGGCACCAAATGGGCCGGGGCGCCGGTGATGTGGAATGTTGGGTTACCACAACTGTCTTCTCCAGTCTCCACTAAAA
TAAATTACACAAATGCTTCGCAGAACTTCGCATAAGAAGATATTGCATATCGGTTAGATTAAGAATGATATGCAACATCATTCTTGGGCTTCAATCAAAT
GTTACACACATACCATTGAAAGAAAACTGAGGTCTTAGTGTCTTTTGAATATCAAAAGTAGTTAATGAGCAGTACAAGAAAATTTTAAGAATATGGTGAG
ACCCACCACAGAGAAACCCCCCAACTCACCCCACCCCCTTGCACAACAAATATTTTTTCTTCTGTAAACTCCAAGGAACATGAAAGAAAAAAGAAGAAAC
AATCCTTAGCACCATGGAACAAAAAGGCAGTGTTCTCAGGAAAAGTAAACAATGAGACAACAGAAATAAAAATAAGAAGAATGAGAACTGACCTATAACC
CACACGAGAGCTAGATTTAAAATCATATATAGGAACTTGAACAGGCTTCCCCGCTTTCAGCCCATGTATATTCTCGAGCAGAGTCTCATAGTCCGTCAAT
CGCGGATCTGTTTCAAAAATACCAGGACATGGAAGTTACTGTAAATCTTCATCTTAATTGCATTAGTCACAGAATAGCATAAAGTGAACATAATTAGAAA
CTAAAGCAGGAAAAATTCGACTATGCTGACATGATCCAAAACAATTAAATATGGCCTAACCATTTCCACAAGATCACATACTGAGATTAACATCTCAAAA
TATAAGAATATTCAATCAAATTCAGAAGTGCATTGTTTTCTTTTTGATACTTTGTGGCTTTCTACAGTAACACCCTACGCACAGGGCCTCCAGTGAGCCT
GATATAGAGACAGCTATACATCAAGATTTTTTCAAAAGTTGTTTAAAATCGAGGATTTCAAAAGTTGATTGCTTAACCTTTCATCAGCTGAAACAGTTAC
ACCAAGAAACTCATCTGTTTATTTTACTTCAAAAGCATCGAAGTTGCATACACTGACACAATTTCACTTATGGGACACATTCTAAAATTTTGCAAAATAT
ATTTGAGAATTGGTTCCCAAATTCAGTATTCATAGAGTTCAGAGAGATTTAGACTCTTGAACAGTCATCACCTAAACGAGTATTATCTGAAAAAACAAAA
CTAAGGAGAGGCCACAGCTGTACAAATCTATTAGAATTCCTGAAAGAAAGGAGCAATGGGATCTGCACCCAATATTTATTCATTACTTCAAGAAAGGAGC
AATGAGATACTATTGCATTTTTGTTTTTTTTTTGTCATTTACTAAAAGTGGTCATGCTTTAACTGTGGAAGTAGTAGTCATTGTTAGTATTTCACTCTTA
TCATTCATTATCACATTAACCAACTACAGGTAACCGACACAAAATACTATACCATTAGTTTATCACTGATTAGCAACATGGCCTATAAACAACCTGCATA
TTCTTATGATTCGACTTTTAATAGATTAATAAATAAAAGTTCAATCTAGAGTCAGGAGATATCCATCAAGACTGCAGACCAAAAATAAATAAATAACTAA
ATACTGTTGGGAATCATATGAAGTGTTGGTCCAATGATGTCTTCGTATTTCATATGCATATACAGACGTATTTAGATTAAGGACGAAGTTTGAGAAGTGT
TTAAACTACTAGTTCTGAATTTGTTTATTTTTGATAACCCGAGAGATCTCCACAGGGTCAGTAGTGTATTGGAACGCGGTACATAAAAGGTCCATCACTG
TATCTTCTTCACTTAAATACCGCATGAGGCAGAATTTGAACCCGTGATATGTGTATAACCCACACATCACGTGTTGCATTCTCACCACTGGACAAAGCCT
TGGAGCAACTACAAGAATAATAAAAGATATCTCATGTAATTAAAAAATTGCTACATAAGGTCACTACAAGAATAACTCATCAACATCAACAAAATTATGT
ATGTAACAAACAATTAGAATCAAGAAAGAATGAAAGCAAGACTACCGTCGAAATTTCCATCAACGATACGACTGGGCTCATTGTAGTTGTCCATGTTTAT
GATAGCAATACTAGGCATAACATTCAGGATCTTCTCTGTGAACACGGACTTCCCGGCCCCTGAAGGACCAGCGACACCCACCAGAACAATTCCTTCATTC
TTCTGAACCAACAACTGGCATGCACGGAGTACTATAAAGAAACCCTTCTCAAATGATAGCTGATCTTGAATTGGGGCTATCTCATAACGAGCAGAAGTAC
TTCTTTTTACCAGTTGAACTTGATCTCTTAATAGACCAGACCTTCTTCGCGGTGAATCGGCATTGGAAAGAGTATCCTGGGCCATTAAAATACCTGGAAA
ATTCTGCAAATTAAGATGCAAATAAGGAATTTAAAACTGCAATCCAAGTATTACCAGTAATCTATGGTCCCCAGAACATCTTTTAGGGGAACTACACATT
CATACGCAAAGAAAAAGTTCCAATTTTTGTTCTTGTTTGGATAGATCTAAACAAAAAAAATAATAATCTGCAGATATCAGATAAAAGTACCATTCCTTGA
AAAGATACTGAACATGAGCAAATGAGGTCTCAAAGCAGCTTTTGACGAAATCAAAGCAAAAGAGGAAACAAATATTTGTGTGCACGCACATGTAGGAAGA
GCATTGCATTTTACAAGATAGAGCAACAACGCACTTCACATCTCACTATTCAAGGAGATACTCTAGAAGCACATACAAACTAACTGGGATACTCCAAAAG
TGTATTCGACAACACTAACTGGGTTACTCCAGAAGCGCATACAGGACAACACTAACTAGGTTACTCCAGAAGCACATACGACAACACCAATTGGCTACTT
ACTCTGTCCAACACTTCTGCCCAAAACTGGTCACCACATTTTTCTTCCCAATAGTAAGATAAAATGATCCTTGAGTTAGTATTTTAAAACTAAACTTTGT
CATTTTAAATCCACTATGTCACAAAGTATAGCAGGTCTGGAACTAGTTAAGGAAAGTTGTAGTAGCATAACGGTGTAACAATAGTTTTACATGATGAATC
TTTGAAAATGGATACAAGTCAATCTCACTAATTTGGGGATTGACATGGAACTAACAGATTCATTAATATTCTAATGCTTTTTTTATATGAAAAGAATCCC
AATCTAGAATACTTTTTATAGCTCATAAATATCTACAATTAATTTCAAATGATTTATATATTAAAAAAAAAAGCACTCAAAATTGGTCAAATTAAAGTAA
GAAGTGAAATTGAGAAACAAATTGAATCAAGATATAAAATTCCCATATCCCAAGGAACTCTGAATGAGAGAAACAACAATTTTCCCCTAATAGATTTTAA
GAAATATTTTAAGCGAACTAACAAGAACACAATTGAAGAATAATTGAAGAGTTTAAGCGAACTACCAAGAACACAATTGAAGAATTCTTGAAGAGTTTAA
GCGAATTACCAAGAACACAATTGAAGAATTCTTGAAGAGTTTAAGCGAACTAACAAGAACACAATTGAAAAATTCTTGAAGAGTTCGAGCGAGCTACCAA
GAACACAGTTGAAGAATTCTTGAAGAGTTTAAGCGAGCTACCAAGAACACAATTGAAGAATTCTTGAAGAGTTTAAGAGAACTAACAAGAACACAATTGA
AGAATTCTTGAAGAGTTTAAGCAAATTACCAAGAACACAATTGAAGAATTCTTGAAGAGTTTAAGCGAACTAACACGAACACAATTGAAGAATTCTTGAA
GACTTTAAGCGAATTACCAAGAACACAATTGAAGAATTCTTGAAGAGTTCAAGCGAACTAACAAGAACACAATTGAAAAATTCTTGAAGAGTTCGAGCGA
GCTACCAAGAACACAATTGAAAAATTCTTGAAGAGTTTAAGCGAGCTACCAAGAACACAATTGAAGAATTCTTGAAGAGTTTAAGCCAGCTACCAAGAAC
ACAATTGAAGAATTCTTGAAGAGTTTAAGCGAGCTACCAAGAACACAATTAAAGAATTCTTGAAGAGTTTAAGCGAGCTACCAAGAACACAATTGAAGAA
TTCTTTAAAAGGAAAATGGAACTAAACTAAAAAATTTGATCCACTAACCACTATAAAAGTTCTAGTCAACCGCCGGCAAATCTCAACATTCAATAGGGCA
CGATCAAATTCCTCATTCCTGATGTAAATAGATAAAGTGAACTACTAATTTGAAAGATCAACAAGAAAGTACACAAGTTTGCTGAATCACAAATTCAATC
AAAACCCAGATAATTTCCAAGTATTTACATGCAAAACCAAAAATTGCTACGAAAATCGTGAAATAAAAAAGCTTGAGAGTTCAACATACTCGGCAAATCA
TCATACCTGTAATCAAGTAAAGAGGCAAGTAATAGAGCAAAAAAAAAATTGCAAGAAACTTGATTTTTGATCTAAGTGAACCGAACGGGAAGAAGAAGAC
AAAGAGAATATATATTTATAGCAAAGAGGAGAATACAAATTGGGTGGAATTTAATTGAGAGAAGTTACTGAGTTTGTTAGATATTTTGTTTTCGCCAGTC
GCTGTAGAACAAGAGGAAAGGAACATGTGGACTCGAGAAGAAAAAGGAGGGAAATAAAAGGAAAGAACCCTGTAGCGTTGTGTAGAAATCCTATTAGGGC
TTGTTTGGTTTATTTGCTACGTACTATATATGAATTCACACTAGTAATACATAAAAAGATATTTCAAATTAAGTTCAACAGACAAATTAAATATTTTAAT
TTTGTGAAATTACACTAAAATAATATATTTATCTATACAAATTGAAATTTAATGAAAAAATAGTATACGCAAATCTTATTAAAATCTCATAAAAATAGAA
AAAATTGATTATGAAAATTCCGACACAAATGCAAATATTTGGGTCACATTCTTTAATAATTATGATAAGGGTAACCAAATAAAATACCTTATTTAATAAG
AATAATTATGGATAAGGGTAACTAAAGAAAAATACATTATTTAATAAACATGGATTAAGGATAACTAATAGTTGACTAATTGTTGTGGAGGTCAAAACTG
CTAGAAGTATTTCTAAAGAACTATAAACAAAAAACTAAAAAGGTAGCTAGCTTTTCTAAAATTGCATTTGATAAAAGTGCATTTTGAAGTACTTACTTCA
AAAATATTTGTCCAAACACTAGTTTTTTTTTTTAAAAAAAAAGATATTTTTAAAATTTATTGGTCTAACACCAATTTATTTTTTTCTAAAACAGAAAATA
ATTCCACTTAAAACAAGTGATTCATACATTATTATGCATTCCTTAATTGTTCTCACATTATTATTCAATGTATAAACAATTAATGCATTATAGTTTTTGT
GTAATAGAAATTCGTTTGCAATGTACCGAGCGTGAAATTTGAAGTTTAACGTTTAAAATTAAAAATTCAAATGACATAATTATTTCAAATTAAAATATTA
TTTTTTATGTAAAATTTATCCAAACGAGTAGATTAGTTGATCATTTTAAGTTTTCAATTTCACAAATTATTGTTTAAACTAATTATACTTTGACACAATT
TTTAATTTTTTCCGTGCAGTTGATAATACTCTCACGTGAAAATACCCAAACACAACCAAATTATAATTTTAAAAATTTTATTGAACAAATATTTCCCAAT
TTGACAAGGCTCTTTTCGGTTTTTTTTTTCTTTCACTTCTCTTTCTTTGTGTAAACTCAAAAAAATGTAAAGAAGAAAAAGCGAAAAAATAATATGAAAG
AGACGCATTTTTTTAAACGTATTTTTTTTTTCGAAAGATGTTCACCATTTGAAAGGTTGAAGAATGACTTATCAGACGTTTGTCCATGTTCTATTGGGAA
ATTTGAAAGAATATTTTTGGTTAAAATATGAAAAATAAATCATTTGAAAGTTGGACCAGTTTTGTTTGCCCATAAATACAAATTAGACTTACATTTTACT
TTTTTTCTATTTTTCGGAGTGAAAAATATTTTTTCAATTTTTCAAAATTCATAAAAATTCATATTGGATTACAAAATTTTATGGCTAACATATTTTCAAA
GTTTAATTCTCGAAAATATAAAAAAAATTATGATCAAACATCTCTTTTAAGTTTCTTATTTTCTTAAAAAAATGGTTTATATAAAAAATTTATATCACCA
AAATTAAACGGAATAATCACATTAAACGATTTAGTTATTTTATAGATGAAATGTCAACCGTAAAATAACTTTCGAGTTACTTATAAAAGAAGAAAAACAA
CTTTTTGAGTTAACTGAATTAACTCCACTTATTTGGTGCAAGGTTTTAAGTTTTTGTTTATAGGAGTTGGGAAATATCGCGAAGTTAAAAATTAAATCGA
TATATAAATTTTTATCTTTGTTCAGCTGGATTGGGTAAAATTTTTTGAGTCAAGATCAAGTTGATTGATTTTTTGAAAGAGATTTTTATAATTAACATTC
AATTATATAAACGTATGTTCAACATTCATGTTTATAATTGAAACAGTTTTGCATATGGCACTTAGCTACTTAGAGCTTTGCATATAACACTTGGGGCTTA
TTTGATCACGAGATATCATAATAATATGATATCATAATATGAAATTATAAAATGAAATTAAAGTTTTATTTGGATATACGATATGAATTTGTGTGTGGTA
TTTTCTCTCATAAACATAAGAATTTCATAAGTTGTAAAACTATTAAAATAATTCAATTGTTTGTATAATCTTACTAAATAAATAAAAATTTATAAAATCG
CATAATAAATTATTACAAAACTATTTGTTCTCCACCTATGTAAGTGTTTCATCTAACTTTAATTCAATAAAAAAAAAACTGAACATAAATTTTAATGTAC
TGATTTTTAATATAATCCTCCCACATAGTGCATGCAATTTCCTCGCATTGAACCTGCATTTTTCGATCATGTGATCGAGAAAACGAACCAACTTATTACT
TTGAGTTGTAATAATTACAAAGCGGTAGAAGTAATAAATTAGGCGTTAGAGTAAATGAAACAATTTTATTACTCAGCAATCGAATGGTGTTAGGTAAAGT
AACTATATGTTGGTGAGAATAATAAATTTTATGTCGGTGAGAATAATAAATTTTATAAAGTAATGATATGATTATAAATTTTATTTATAAATGAAATAAA
TGGTTAGTAGCTATAAATGTGAGATTTTTTAATAAAATATAAATTTGTGAATCAATTTTTTTATAAAAAATACCTCAAATAATAATAGGTTTTCAGAGAA
TATGGAACCATGAGATAGAATCACATGTCCAAACATAATTTCATCTTAAAATTTTATATCGTGATAGAATATCACATTACTAAACATCTATTTATCTAAT
TTTCCATCATGGATGTCAATAGGGCGGGGCAGGTTGATTCAATTACTGATACGAAAGTTCACCGAGACTTGACATCTTTACCCTCGCCGAAAGTCCACCG
ACATTGCGTGTTGCAAGGAGAAAACAGACAAGTGAATTTATTAGTCTGTAGTATTAACGTAAAAGGGGATTCACATTTCACCTTTTGCAAGTCAACCGGG
GGTTTGATAAGTAAAGTAAAGTGATTTGAACTCAATCCATAGGCACACATGAGACGGATCCGAGAGTGAGAAAGAAGAAAAACGGGAATATATCAAAAGA
GAGTGTGTAAGATCTAAGACTGAAGAGTAAAGAGGGAGCTGACCATTTGATCAGAAGATGGGCTGCTCGTTCTCCGGCTTGAATGCTCTATACGACGCCG
TTAATGGTGGTGGCGATGTTTGGATCAATGAGAATCGATTCAAAATTGTCAGGCAGCTTGGCGAGGGTGGTTTCGCTTACGTTTTCCTCGTCAAGGAGGT
GATATCTGACCCTTCTAATCCTGGCGTTTCCAAGAAATTTAAGGATTCTTCTCATATATCTGGTAATTTTTTCTCTCTCTTCTAATCATGACTGAGTTGC
TTCAGCTTTGTGCATAATGAATTTTGTTCATTTTATCCAATTGTATGCATTTGTTTTGTTTTTTGTGACTAATAATTAGAGTCGTTCTTAATTGCTTATA
TGATCTTTCAATTGTGAGGAGTTGCTGGGATTGGGATGTTTGTTTCTTAATTGCTGTGCGTTCCTACCCTCCAATGCTATTCTAGTTTTGTTTTTATTGG
ATCGGAGTATTATTTGTATATGTAAGGTTAATCATCTTCAAATTTCGGATTTTGATGATTCTCTGAGTTTAGAATTGGCAAAGATTGCTCAAGTTTACTA
TTTACGGGAAGGGTGTTGTTCTCTAGAATGTGCTTCTTTATTGTACAATTATTTAGTTTGCTGTCCTGACCTTGCCTAAACTTTTTGATGAAGTAAATAA
TTTCATTGCTGGCATCAGGTGGATGCATAATAGTTACAGAAGTAGAATAGCAAGAAGAACTTATCAGCTCCAATACATATCTAGTTAAGAGCTAATGAGC
TGATAAAATTCAAGAGTATAACAGGGACACTATTGGGGACATATAGACCCAACTATACAACAACATAAAGAAAACTAGCTTTTAGAGATTTATAGGTACT
TCATATTGCATCAAAGTATTTCCTATTTCTTCCATTCCAAATACTCCAAAAAAATAGCTGCAGGTATTATCTTCCAAATTCTCTTAATGGTGCTATCAAC
TTTCCAACAACTCCAACTCTCAAAACCATCCCTGATACTCTGTGGCATGACCTAGTTGAGTCCAAAGTGTGATAAACATACTCGCTGCTACTGAGAAAGT
GTATAAAGAGGAGGCTATGCGACCTTGCCTAAACTTAGGAGCTCTTGGAATTCTTTTTTATTTTTTTTCCCGCTTGGTTTTCCTACCATTGCTAATGACA
TTTCCACTGAAATAGATTTTGGTGGTTTATTAGCCCATTCTAGATTATTGGAATCTTTTTCTTTGGGGAGGTGCAAAGAATAAGTTGTCTTTGAACTTCG
GTGTACAATTATTGTAGTCATTTCATTTATTATGTAAAAGATTTATTGAAAACTTTATGTATGTGCAGATGATGGAACTTATGCCATGAAGAAGGTTCTT
ATTCAGAACAGCGAACAGTTGGCGTTGGTTAAAGAGGAGATCCGTGTTTCATCTTTATTTACTCATCCCAATCTGCTTCCTCTCCTTGATCATGCTATCA
TTGCAGTCAAGGTAATTGCTGCAGTCACTTTGGACCCCCCACCCCCATCAGCTCTGTGGTCTGATCTCTTTTTTTAGTAGTACACTGATGAGTGATGTCC
ATGTCTAGGTTTTTGTGTTATGTGTGAACAAGAGTGCTTTGCACAATTAGGTGGTGGAAAATTAAATTGAGACTGGCGATATCATCCATGATAGGTTATC
TTATCCGTTACCGTTCCAGGAGCTCTTAGATGTACTTTGAGGATCTGAATCATTTCTTAACAGATGTTGCACACTGTTCAGTTAAAATGATGTGAGAATT
CTGAAAATACCAAAGTTTGGACGATCATGTGGAGTGTCAAACGATTTTTTCTGTAATACTTCTCTTCTTGAGAAACCAACTCTTCTTCTTTTGTGTTTTT
TTTTGGGTGGGGGTGGGTGGAGTGTGGTGGAGGATAATGGAAAACAATCACAGGAAGTGAGGAGGTATTGCTCTTCCAACACTCTCTGCTTATTGAACAT
GGAGTTTGAGCAACTCTCATTTGTCATTTATGAAAGGGCTATTTATGATGATGTTATGGAATTATAGCTGTACTGCACACTATATGCCTGCATATTTACA
TCTTCCTTGTACCCTATTCTCTTCGATTTCCATTACATTCTATCTAAATATCTTACTCTGTTGGATAGGCCGGTCCAGATCAGTCCTGGAAGCATGAAGC
TTACTTGTTGTTTCCGGTACATTTGGATGGGACATTACTAGATAATGCCACAGGCATGAAAGCTAAGAAAGAATTCTTTTCCACTTCAGATGTTCTTCAA
ATATTTCGTCAGGTGAATTAAGGACCAATATTTTTGCAACAGTACATTTTCTTGGATTTTTGATTAAATACAAGGGGAGGACATAATCATCTCTAGAGCC
TAGAAATGTATTTTAAGGAACTATGTTATGCAGCTTTGTGCAGGACTCAAGCATATGCATAGCTTTGATCCTCCTTATGCACATAATGATGTCAAACCTG
GTAATGTCCTGCTAACTCATAGAAGAGAACAACCACCTCTTGCAGTATTAATGGACTTTGGAAGTACACGTCCTGCAAGAAAGCAAATCCGCTCTCGTCA
AGAGGCATTGCAGCTGCAGGTACTTGTATTACTTTTTTAAATGTATGCATACTTTCTGCTCTAATTATATGCCTGTAATTTTCATTTAAGTTCCTTCTTG
TGAACATGTCTGGGCTGAATGTTTTCACCTATGCTATTGCTTTTACAGGAATGGGCAGCTGAGCATGTTTCCGCACCCTTCCGAGCACCTGAATTATGGG
ATTGCCCAAGCCAATGTGATATTGATGAAAGAACTGATATCTGGTCATTAGGTTGTACATTATATGCAATAATGTAAGAATACTCTTACTTCTTCTTAAT
ATTTGAAGCTAGCTCTCTGTAGAAGCGAACGAAAATCCTTTGTCCATACGCAGCTGATGGTTGCATCAAGATTTGGTTCAACTATCCTATTTCTTGCACC
TGTTGTGAATGTACGTAGCATTAGTATTTAGGTGCTTGTACTATGCTGTAGTACTCGGAGCTGATATTCCAAAGTATAAATAGATGAGAAAATCAGGTTG
TGAATAACAAGTTTTGTTTAGTAAAACTTAAAAGTGGTTGGTCTTACACTGCAAATAGAACTCCCTACTTTTTCCACTGAGACTACTTAATCAAGGCAGT
ACTTTTTATCTTGATTCTACCAAGTTTAATTTTCATCATTTTTCATGTCTTTTTTTTTTGTCAATTGAGTTGTCTCCTACCATTGACATTTCAAAGGTGG
AGATATCTCGTGACCATGGAAGTGATTTTCATGGTGTATATCAATAAGAAGTTACTGAATATATATATCATCTCTATTGCAGGTATGGAGTATCTCCCTT
TGAATACGCACTTGGGGAATCTGGTGGAAGTCTGCAGCTGGCTATTGTAAATGCACAGATAAAGTGGCCAGCCGGGCCTAAACCTCCATATCCAGAAGCC
CTTCACCAATTCGTGACATGGATGCTTCAGCCTCAGGGGACAGTTCGACCTCGCATAGATGATATCATAATTCATGTTGACAAATTGATCTCAAAATTCT
CCCGTTGAAAAGATAGGACAAGATTTGTGGGGTTAGTTTACAGATGAATCATCTTATAGCATCACTTAGCTTTTGTTACATAATTTACTGCAAAGTTACT
ATTCATTCTTGACTTTTCCCTGTTGAAATGTGAGAGAAGCAGCAATATTTTGCTCTTGTTTAGGTTATATTTGTGGCAAGAGGCTTTGCTAATCATATGT
TCTTTCTTCAAAATTATTGTTTATAGTTGGTCAATGGCGAAATATTCTGTCAATTTAGCTGTTTAGACTTCAGAGATGAAGAAATTTAAACGAATTAAAT
TGACAGTTCATCCAAATAGCATATCAGGATATACATAATTCCAACAGTGCAACTTTTTTCTTATACATACAGGCAAAACTCATGAATGGAACCCAGAATA
AAGATTTTCACTATAATTCCCTATGTTCAATTTGTTCATCGACATCAAGTAGTGCTGCCTCTACAAGAAATACAAAATATTTAAATGCTTCAAACATCAG
CCTGGACCATGAATTGTACTTTTGGTCTTAGCTACTGAAGGATCAGTCTTTGTGGTCATCATCAGATTCAGAATCTGCAGATCATAAACAAAAATGCAGT
GTAAGATCAAAAGCTATCATGCTGGAAGTTTATATGATCAATGAAGCAGATGATTCTTTTACCTTCTCGAACATCATCAGTAATGTGGCCTCTTGATAGG
ATTTGGTTCTTGACCATCCGCAGTATGATTTTGAACCAAAAGAGGTGAAGAACCAGCAAGCATATCAGCAATGCATTGAAAACAAAGTAAAGTATGATCC
CAGTAGTCCGTTCCTTCTGTATATCCAATACATAAAGAAGTTCGTAGCTGCACAAAGTTGAAAGAAATAACGAATCTTAGAGACGATGAACTAACAGAAA
ACAAGCTTACTGTAAATGCAGTTGGTAGTGAACTCACCATGTGCTTCGGATTATCCAGAAGGGATAGCAGATTATACGAAGTGATGTAAAAACCAACGCG
AAAAGAGAGAAGAAAATATCAGCAATCAAATCAAAGCCACTGTATTTCGACATCTTTGCAATTTCCATGAATACATCACTTCCGTCATGAAGTGCTAGAA
CCACTGATCCAATACGCGCAAACCTGCAAAACAGAATGTTCACATTCTTCAAAACTCAACTCACACCAACACTTTTATAACAGCTGAGCAAATGGCTGTA
CCCGTATACGTAAGACAACACAATGAGTGACACTGTTGTTACATGATGAATTATCTGCGCAGCAAAATCATAGCGTCTTGTTTCCCAATAAAGTGTTGCG
AATATGGAGTAAAAGTAGAATCCTCCAGCATACATGTACAATAATTTTAGCTTTAATCTGCCAAATTCGAATCAACCAGGTTATAAACACTCCTTTTCTG
ATTCAGATATCAATACAAAATCTTCAAAAATGAGAAGAGCTTTACTTCATTTTCAAATTAGGCCAAACCACATCTCCAGGTCCTGCCCAGAAATACCGAC
TATCTGTGAACCAAGGCTCATTACAAGTCACAGAAAGTGCAAGTAGCTCAGTAGATAGAAAATATACAAATTTCCATGCTGACTCTTTGAATTTGTTGAT
CTTCTTCCTCTCTTCACGACCGTTAATATTTACAACCGTCTTCTTTCCAAAAATCATACGCTTAGCCAATGCCTAGCATCAGAGTAAACAATATAAGCAC
GCGTCCAAATCAATCTCAAATTTCAAACAGAAAAGAAAAAAAAAACAGAGGAGGGAAGAAAACTGGGAAAAAAACTAATCAAAATTAGTTGAGATAGCCA
ACCAACCGAGCTACTACCTCGAAAACAAATCTGTCGAGTATGAATCGAAGAACGGGGAAGAAGAGAGCAAAAAATAAGAGAAATATCAAATCCTGGTACT
CAGGGAGAGACTCTTTCTCCCAATCAACCGAAGCAGCGATGTGATCCAGGTTTTTCATCTGTTGACTTTTTTTTTCAAAAATCTGTTGAATTGAACTTTT
TTTTTCTTCTTCTATTGTTGTAGTTTCAAATGAATTGCAGAACAAGTTTTCGAATTGTTAGGTTGTAAAGAGCGAGGTGATGATTTTGTAGCAAAAGCCA
TGATTCTGTTTGGAGATATGTCCCGGAAGTTTCGATTGAATAATTCTTTTTTTAGTAGAAAAATCATATTTGGCGGATCGACTGCTTTGAATAAAAAAAA
TTAAGTCAAACATTTAACATCTGTCAAACATTTCTTTCTAAGCTAAGACACAATAATACATATTATTCTCTAACACGTTTGATCGTTTCGATTTTATATA
AATATATTTCTAACTTTTGTTAAAGAATGATAAAAATTCCACATCGGTGATTAATGATATGAGTTGACTCTTTACAAGGCTTAGGCAATCCTCCTCCCTT
TGAGCTAGCTTTTAGGGTGTGAGTTAGGCCTAAGACCTAATTTCACATGGTATCAGAGCACTGGGCGTGAGGTGAGGTGTTAAAGAATGACAAAAATCCC
ACATCAGTGATTAATGAGATGGGTGGACTCTTTATAAGGCTTAGGCAATCCTCCTCCCTTTGAGCTAGCTTTAAGGGTGTGAGTTAAGTCTAAGACCTAA
TTTCACAACTTTTTCGATGAGATTCTTAAATTATCTAGATACTTTCTCAAACTCAATTTTACATGATATTAAGGGTACCACTTTGAATTATGTACTTCCT
TTAATTATTGATAATATAAAGTGGTAATTTTCAATGAAAAAATTAATAATTAAGTTTTTCTTTTATCTAAATTTAAATACAAAGTAAAAAAAGTGAACAA
AGTTACTAATTTAATTGAATTGTTAAAGATCCTTTTGAACTTTATGAAATTGCTGTCATAATAAAAAATAAAAAATATTTGACCGAGTATTTATGTAAAG
ATTTTAAATCTTTTAAGTGTGGTTCGTATAATTTCACCTTCAATCTCCTCTAGACATGTCAAATTAAATTGACTTGACTTTACTTTACTAAAATGAATAT
TTTCATTTGTTGAAAGTTTAGGTGTGATTTTCGTTTTCAAAGTGAATTTGACCTAGAGTTGTTAAATTTATTTGAGCTAAATAGGCTAAAAGCAGAACAA
TTTAACAAGTTAATTTGCGATTCAATATTTAAGGGCAACTGAAAGTATTTTATATAATTCTCAATATTGTAAATAAAAAAACAGAACCAGAGAAAAGAAA
AATAGAAATAGCTAGGAATTAAAAAATAATGCTCACTGTAGCAAAAAGTTGCATTTAAAATAGACTTGAGTTGGCTAAATTGAACTACAATTCAATTTTA
TTTGTCCACGACATTAATTTAGAATTCGTACTAATTTTGTGTATTATTTCTAAAAAAACTAGCTAATAAACCTTAATTAATTCATTTTCATTTTGTCCAT
AGCTTCTTGCTTCTTCAACTTAAATTGCAAATTAACCTCTTAGCATTGAGCTTGCTTCTTCATAGTTCTTTCTACCAAACGACATCTAATCTGGACACCT
AATCTAAAGCAACTACGCCAACTAAATTACTTGATGAAGTTGAAGCATAAATGGTTTTAAATTAGTCAATTTGATGATATAATCGATAGAAAATCTACGT
AACAAGAATTTAAAAATTTATAATATTTCAACTCGACTTATCTAAATAAATTCATATTGAAGTTTGACTTTAAACTTGTTAAACTTCAATATAGACACCA
AATGAAAAAAAAATTAAAGAAAAAAGAATTTACTCGTGCAATAATCTACTAGTATACTTGCCCACATTCTCAAGACACATAAAAAATTCAGTTTGCAGTT
CGTTAATTCTAACTTTTTTAAAATTCAAATTTAGCCTCATTTCATCATTTATAGATTACATTACATTCTTAATATATGAAAATTAATAAATAAATATGTA
TATATGAAATAGTGGAAAAATATAGTTTGGAATTATAGGGAAAAAAAAGTGAGTCCGTTAAAAATAAGAAAACAAGTCACACACGTAGCGGTTAATTAGT
ACACATGTTGACATGTTTGAAGGCACGTGGAACGACTCACTAATTCCCCAACTAAATTTTTTTTAAGTTTTGATCTTTACCATTTAATAGTTTAGTTTCT
TGCATTTTCAAACTTCACTATAAATCCCCAAAGTTTCAAGATTGAGTTGAAAGGTTGCCACCATCATCATGTTTTGTAGCTTTTCAAAAACGTTGAAGGC
ATAATAAAGGTAGATTTCTACTACAATGATTTAAGTTATTTCAAATAGAAATTTATGTGTTTTACTTCTTCTTTTTTTTAACTTCTTGTGGTATGAATAT
CAATTTTTATAATGTACCACCGGGGGCGGAGCCAGGTGGGTGAATTCTTAAACTTTTAATTCTGGCTTCACCTTCACGTACAGTAATACCAAAAATGAGA
AATTTCTTGACCAGATATGTCTCTTTAACAGAGGTTAGGCCAAAATTAGTGTTAGAGGTAAAGTTGGAAAAAAGATAATTAATTCTCTCTTAATTATTTT
AAATAGGAAAAATGCATATGTATTCTCGATCTCTATGTGTGAAATTTAAATACTTTTTACTCCTTTACTTCTAGACTTATTTTATTAATATTTTTTTACC
TTTTCTTAACCTACGAAGACACTATCTTTTGGTTGCTGTTGATATTTTTTACGAAGCTTGTGGTACTCATGCATTTTTTCTTTTAGAACAAAAATGAAAT
GATTTTTTAAATGTTACTTTCTCCGTCCGAAATTATTTGTCATGTTGCACTTAATGAAAGTTAATTTTATCAATTTCTAAAGGTAAATTGGATCACATTA
ATTTGATATTTTAAAAAAATAAATAGATATTCTTAAGTATTATAAAAAAATTAATATGATGGAAAAATACATTTTAAAATTATGTCAAAATTTTTATAGT
TTGACTCTAAAAATAGAAATTATAATAAATAATATCGGACGGAGAAAATATTAAGAGTGTTTAGCTTAACTTATAATCATTTCGAGTGTTTACAGTTAGA
TGAGTCAAAAATTATTCAGCTTATAAGCACTTAAAATTTTATTTTGGTAATAATAATTATTGTTCTATCATTAATATTTTTTTTACTCTCAACCACAATT
GTATATTTGCTAATTTATTTGCTTTTGGTATTTACAAACAGGATTTCAAAGTGATAATAATATATATATATATATCCAAATTCATCTAAGAAGCACAAAC
GGCCAAAAAGACCTCTTAGAGTTCCCCTGTTTTTGTTTCCCCACATGAATTAACTCTGCCAAACAACAAATTCAACGCCCTTTAAAACAGTCCCATTTTT
CACCCTCTCCAAGTAACTCAATTATTTTGACATTTCTTAATTTAGCTACCAAATTTTTAATAGCATATGGACTATTACAATGAAGAAGTCACTCCAAGCT
CTGCATCAAATTCTACAATAGCTCACATCGTCGACGGTTGGGTCGCGATGATATTTGGGATTTTTGCTCTGTTTTGCCTGTTCAAATGTTGCTGCTACAC
TGAACGGGTACTTTCATCAGAAAAGATTGAAATGTTATCAATTGCACCAGTTGGTGATCAACATGATCATAGTAGGCTTGTTATCATGCCCGGGGATCAA
AATCCTACCTGCATAGCAATGCCTGTTTCTTCTCCTTGTCTTCATCATACTCAGGATGGTTGATTTATGTTTAGATCTTAGTTTATTGGTCTCAAATGGG
TACATTTAGCGTAAATCTAGTCAAATTATCATGAGTCTTGATAATATATTGAATATGGAGCGACATGTATAGTGAGAATTCATATATTCAATCCTAACTA
GCTCGGAATTGAAGCGTTATTATTGTAGTTCTCAAACTTTGAATTAGTAATTCGGTTCTTTACTTGAAATTTGGGGAGAGATTTTGACGAGTTTATGGCA
AGATGCATGAGGGTCGGGTGTATACAGATCGGGGTTACGTTGGTATCAGTTATAACTTTTAACATGATGATAAGTGTTTCAGGCTGACGGGTGGAAAATC
GAACTATTGAGCTTTCTCTATAGGCACTAAATTCATTTGTCTTTGATTCTTATTGCTCTTTATAATTCTAATCTGATCATTACTGGATTAACATTACTAG
TACATAATTAATGTGAAAGTAAGATGTTAATTATTATCCATCTAGCTCCTTTACCTTTTTTTCCAGAGCAGACTCTATTATTTAGTTTGCTTTATAAATG
AGATTTTAAATTAGGGATTCTATTCCTCATTAGTGAGCATACTGTTAATTGGAATTTAAATACACATTCTAATGGATAAGTTCAACAAAAGTATGAAGGA
CAACAACATAAGTACAGTATTTGATTAGATTAAAGTAGGCAATAAAGAGAATAAATTAAAGGGTTAGGCACCATAATTGACATGTTAATGACCAGAGGCC
TAACCAAAAGTCATACAAGATTCATCCTTAGTTTCCATATAATAGAATATTTCCTCCCCTTTATAGGTGATGCTTCTTTTTCCCTATAGCTATGCTGGAA
TAGGAACATAATCCGTTAACTTTGTATTTGTTACGAACAAAACATGTTTTCTAAATGTGGTGGATCCAGGATTTTTATTTGTGGCCTCCGTGAAAATAAG
TGGTTTAAAAATTTATTTTCTGTGTTTGACCACTAAGTTATTAGCAAAAGATAGTCTAAAGAGCAATATGTAATCCAGAAAAATACTATAGAAATGGAAC
GCGGAGTACTAAACTATTGAATAAAGGAGTGATCGAGGGGGACTGATTTAAGGGAACTATAATGGGGATTGGGAGACGATGAGTTTGGAATGCCACTTAT
GAAACTATTTTTTCATACTTTCACTAGGTAGTCATTTTCCTATTATTTCTTTTTAAGAAACTTTTTTTTCGCAAGAAAAATATTTTAATCAATCAAACAT
GAAAAATTGAATTATTTGTTCTTCCTAACCAAACAAACCATTTACCATAAAAGTCAAGAACGACTTGAAGGTTGATAACAGAATCATTTGAGCCGCAAAT
GCAACTTCCCAACTATGTTATTTGGATTCGGACAGGTTCGTGTTTGATTCTTTAAATGTATTGTATTTTTGGAGAATCGGGCACAGGTGCAACAATATTT
TTGAATAGCATAGCTTCCCAATAACGTATCTGCCCTTTCATATTTCCAAAAGAAGTATTTTTCAACTTGATATTAATAATTATAAACTTAAATGTTCGAT
GGGCCAAGTTAAATCTTGTGTGAGATTGAGAGAATATATATATATCAGGTAGAATCATATCATCCAAATATGTGCAATATCCACAATTAGTTAATTCTTC
TAGTGTCTATAAAAAGCCAGTCACTTAGCTGATTTCATGCAGAACACAAGCAAAAATACTTTTAAAAAAAAGGCAACTAACATACAAAGTGGGAAGCAAA
AAATGAATTCAACAGGCACTTCACCTGAATTTTGGCAATGGAGCTCACCAATTCCATACATTTATTTTGGTCTAGCAGTCATTGTCTCTACCATTGCTTT
TGCATTAATTTTTCTCATTTTCTGTGGCCAAAATTCTGCTTCAACAGAGTATTTGGTTGAGACTGATGAGGAAATTAAGAAAAGACATCAAATAAATGTC
CTAGATCCTGAGCCTAAAATTGTGGTAGTTTTTGCTGGAAATTATAATAAGCCTTTGTATATAGCAAAGCCTCTTACTTATTCTCCAAATGCTGCACAAA
AAGTCTAGTCCACCAGTTGATCCTCTTTTTTGTTTGACATATTCGAAATTCACTGGCTCAACTAATTCATATTGGATAGGGGTAAATTGCGAACTCATAT
GAAGTACTTCCTACCAAAATGCTCTCTAATTCTATCCAAACTATACCACTGCAACCAGTGATAGAGCCAGGATTTTCTATCCAAACTATACCACTGCAAC
CAGTGATAGAGCCAGGATTTTCGCTATGGAACTACACTCTCAATAGTTTTATTTTCTCTTTGTAACATGTTTATTCCTGTCTGGGAATTAGCTAATTAGG
TGTATAGTTATTATTGTTTTAAAAAAATATGACAATATTTTAGTGGACTTTACAACTACGCACATGCTCAATGAAATGCCTTAAAGAGTTCAAGAAACTA
GCAGGAAGGTGTTGTTGAGACACTTTTCAGGGTGGTCGAACCTAAAACCAGGACAGTAAATAAAGTACAATAATTAGGATAACAACATGATAAAAAAAAA
AAAAAGAGAGAGTAAATTAAGGAATTTTATATGTTTAAACAAATTTAAAACCTTTCTAGTGTGAACGACAAAGATTTGTCATATCTATGTTTGACTTGAA
TACATAAAAAGCATTATCTTATTGCTAAAAAATTATACACCGGCACTCTAACACCCACAGGCCGAGTTAGAGGCACTAGAGGTTCATTCAAACAAACTTC
ACTAAAAAATTACACACTCTATATTTTTATATATAAATAACAAATGTTGAATCTCCTCGTGTATATTGATTTTTTAGTGAAAATTCTGACTCTGTCGCGA
TAAAAAGAAGGGAGGGGGAGGGAGCTAAGTGTTTAATTAGATTGGATCTTTCCAGCCTTGGGATATTTGTCCTATTGTCAAAAAGAATTTGGAAAAGAAC
ATCACATGGAGCCCAAGACAAGTGCAATACAAGATATGATCTCTCAAAAGGACAAACAGCAAGAATAATAGATGGGCCTTGCCTGTCTAGCATTTCTTTA
TAATAAGCCATGCCTTTGGATTACAATGTGAGAAACAACTAAAAAGTCATTAAGAGGCATTGGACATGCCCCATTTCAATATATCCTCAACTGGTTAATT
AATACTCTTATTTGCACCTTCCATGAGGGAAAAAAGAAATGACTTCTTTGGCTTTAATAAGCTTATAGAAACTAACATGAATGCTTACAAATACTTTCAT
AATTAATACAATCCTAAATTCTAGATCTAACCACATTCCAGATCACTATTTGACAATGACAGTACTATCAAGCTAAGAACAATAAGTTGGTACCACCCAG
TTTCAATTAATGTGACATATATAGTTTGACTCAGTAAAATTTAAGAGAAAAAATGAAAACTCGTGATCTTAAATATATCATACATATATTTGTGTGACGA
TAAAAAAAAATCTCATTAAAGGAAAACTAGAAAATTTATTGTTAGATGTTTCATTCTTTTCAAAATGAACTAATAAGAACATAGTGTCTAATAAACAGGA
CACATTTTGATTTTTGAGATTCAAACGAATATTTCAAATGTTGTTTACCTAATTTCTAAATATATAAATTTTATTTCTAAAAATTTACATGTCTAAATTC
ACAAACAAAATAAACAAATTTGACTCTCGAAATAAATAAAAAAGAATATAGCTACTGTATAACAAAATGGAAAGTAAGAGTTTTTAGCTGCAGAATGACT
CATCATGAGTGAAAGATTGTACCACCAAGTGGTGCGGTAAAATGGATATAATTCATTCATAGTTGATCTGAGCTCTCGTCCATCGTTGACTAGAGGCCTA
ATATTAAGAAGCACGAATTTAAATTAATTTATCAAGAAATATCGAATATCAAATAATTAAACGAAAACAGAGGAAAAAGTAATGGAATTACGAATGAATC
ATATAGTATACTTGTATGTACTAGCAAGGAAAAAAACATTAGTAAAAATATAAAATAAAAGCTATGTCTCCTTGTAAAGTCACAGAACTTACTACAAGAC
AACTCCAGTTGGCTTACCTTCAATATTTTTTTTTTCTAGTAGAAGAAAAAGCTGCATAATTTATTTACTCCCAACCTCTTGTTTTTATTTGACATGACAT
AGAAATAAGTATTGACACTCAGAGAGAGGTCCTTTTTTCTAGCTTTATTAACAACAAAAAAACAAAATAAAATAATTTTTTTTTAGTATATATATTTTTC
TTCAGAGTAGCATATAGGCTTGCACTCTCCCCCTGCATTTTGCATTCAAAGCAGAGCTTCTTATTAAATGAGTCCACGTTCAGAATTCAGAGAAGTAAAG
ATATATGTACCATTTATTTTTTTTACAACCTAAGTAATTAGCCCAATTTTCTGTCCTTTTATATTTACTCGATAGGTCGTTTTTTGTGCCTTTTGTTATT
GTAAAAAAAAAAAAAAAACAGGTGTTTTCTCTATCATCTTTGACACCTTCTACCTGTCCCTCTGTACATGTAAATAATGGCGATGTAGTTGTACATGTAC
ATATATATCCAAGTGGTGAAAATTTAATAAAATTCAAAAAAAAATCGTTTTTTTTTTTAAGGGTTGCTTTCAGAAGTAGTATAAGATTGGGGCATGTTTG
TTCTATACAGGTGTTTTGATTCAGCTTTCTTTTGCCTTTTTAACATGTACCAATAAACTCTACTTTTTTTGTTCTGTTTCTGTTTTACTTCTTTCTAAGA
TACTCTGTTTTTTTTGTTTTTTAAATTATGGACCCTAAGTCTCATATTTTTAATGAGGGTGAAGAATGTCACAGTAGTGAATCTGGATGGACAATGTACA
TTGGCTCACCTACGAATGATGAAGACGATGAGATGAATTGTGAAGGCGATTTTGATGATGAAGATGGTGTTTTAGGACAAGGTCGTCGCAAGAAGATAAT
GAATGTTGTCGTTGATGACGATGATGATGATGATGATACTGATGATTCAATGGCGTCTGATGCATCTTCAGGACCAAGTCATCATATTGTTAGAAATGCG
AATAAGAGTATAATTATTCCAAAGGAAAAAGGTAATGGAAACAACAAAGCCAGCTTGAAGAAAGGTAGTGGGAAGAATCAAGACAAAGGAAGATACTCTG
TTTTTTCAGCAAAAGTTCCATCAAGTAGTGAAAAGGTAAAGAAAAGTATTTGGAAGGGTAAAGGAAAATAAAACTTACTATAACTAGTGGGTACTATATT
ATATATCTTCTCTTTTTGTTATATTACTGTACTTAATTTGTATCTCTTGTGTTAGTACTTAGTGCAAAGTGGAATGTCAAGGATGTTTTGGGATTAGAAA
TGAATCAATTTTTTTTGGTTCCCTTTTGGTTGTCGATGAATATATGTAGAGTTAATTTTTTATATGGTTAGTCAAGTAATAAATATTATTATCTGATTTT
GAGTTTTTTCATTCGAAAAATCAACTCATTACCATGTAAAACAGTCAATTATCAATTACATATAGAGCTAAACGTTTTTCAATGCCTAGAACTGATGTAT
AAAGATTTAGTCACGGTATTGTTAGTTTCTTGTGCAACTCTACTAACTAACAGTGTCTAGTAATGCCGGTTAAGTTTAAAGAGTTAAAATTTCAATTTTA
TAAGTTTGAATTTTAGAATGATATATCAAATTCAGTATACATAATATTTAATAGAAATTTTGATACAAATACATAATTTGGACATACATTCTGCGAGTAG
AAACAATTTTATCGGGTGCGGGGTGACTTCTAGGCCAAATGCTTCAGAGTTATTATGGCTTCGCAGGAAATATATATACGTTTATTTTATAACTTAATAC
AAATATAGAGTCTATTGAAAGTCAGTGGGTTTGATCGAACCCCCTTGGCTACTGTAGCTCTGCCCCTGACACTTCCAAACCACAACCGGCTTCTGCCTCA
GCCACCGTGTTTATCTACTATGCGGTACACCGTTCTTTGATCAACTATGATTATTATACTTCGAACAAATGATCAAGTAGGACACTTGAATTTAAATAGA
TTATTAATTCGTTCAAAAGTTATTTGGATTGAGATAAGTTAAATTAAAAAAATTCTTTATTATAACTAAATATAACATATCAAATACTAAAAAAATATTA
TATTATAAATATTTTGACAAGATTTTGTCTTAGTCAACTTATTCAATCCAACATATATATGAGCTAAGTTTTACAGGTCAAAATGAACGGAGCAAAATAA
ACAGGCAAGTCCAAATTTCAACTAATCAAGTGAATCACAATGCTAATCAAAATTCAAACACCTGCTAAAGCAAAATGACGAGCACTTTGGAACACATTGA
ATAAGCGAGTTCACTTATAGGCCATAAGGGACATTAACTATTATCACGATCATAAAATTTTACTAGCTCAAGATATTTACATTAAATCAATTAATATGAC
ACACTTATTATTTTATAAATCCTTTAATATATTTATGTTCTCAGTTCTCATTTTTAACTGCTAAATGATCACATTGGTCGATTTGACTTTGTCAGAATTT
TTATCACACGTACATAAATCGAAAACTTTTAGCCGTGTAACAAACAAGATCTGTTAAAGGTCTTCCTCCTAAACTAAAGTAAATGGAATAAAATAAAAAT
CTAGTCACTGCGCGCATGCAAAATAAAAGGAGGAGCAAGTCAATGAAAATGAAATATACTGTGTAATTATTCTTGTTCAGTAGGAAGCAAAAACAATATA
TTTTGTTTTCGGTAAACAAGATAATATAATATACTAGTTCGTTCCACTTTATTTGATTACGCCATAAAATTTAAAAAGAAATCTTCTTTTTTATAAGAAA
ATTGAAGTACAGAGATTTTAAAAAGAATTGTAACATTAACCACGTCATAATATTTGTTTGGTTATTTAGCTTCTAGAAGATACTCAAATGTGTAAAAAAA
AATTGAATGTCAAAGTGTTGGGAGCTTTGGGTGGACGAAGAGGAAATAATGTGGTAATTTTCTTTTAGATAGATAATTTTTCTCATTTTTATGGAAATTA
TTTTCTATATTTTTTCAAAATATTTTGATTAACTGAACATGAAAATCAAAATATATTTTTCTTTCGTACTAAACACACTCAACAAGAAGAAAGTGTTGGG
GAAGTTTTGATCAGAGTAATTTTTTCTCGTGAATTTGACTAGAAATTTAATTTTGTAACATTTTATAAACTTTTTTTCACGATAAATCTTCGATAGTATA
TATACTTTTCTTGTATTTGAATTACAAGTGGACAAGAAATCTTATTTCCTCGACTATGACCTCCACGTGGAGGATTACACATGGGGTACGATGGAACATC
CTGCATGCATCTGATTTGAAATTTAACTGTGAAGGGTGCGGGGGCTTTTTAATTGAACGTTGCAAAACGATTCCAAAACGGACCCCCAACCTGTCAACAG
ACTGGATAACGTGTGTGTCCAAATTAAAAGAAGGAACAATTAACGTAACTTCAGTGTTTTCCAAACATGATGTTTTCTCTCTGCTGCCTTTGGCTCTATA
CCATACTTTTGTATACATTGTATGTAGGTAGATGTAGAGCTGTTCCGTTACCGATCAGAGTTATGGTGGAGTCATAAATACTCTTTCATAATCGTTTTTA
TTAAAAAACGAACTTTTCAATATGATATTTTTTATACAAATTTAAATTTAATTAGACTTTAAATATAAACAATAAACGCCAATTGAAAAACAAAAAAGTT
ATTGTGTTTATTTGTTTTATATCCTCTTTTAAACACTTTCTTTTTTATTTATATAAATAAAATAAGTCCAAAGGAACCTTACCTAATCTTTATGCATGCG
TGTCACGATGATTATATTTGTATATAAAATCAATTTATTAAGCCGCCGATATATTATATAATTCCTCTCACATGTTATAAGAAGTGAGTAGTTTAAATCA
TCTAGAATGAGTAAATATATTGAATTTTATAGTTAAATACTACTATACACACAATCTTTGATGAGCATATTAGGTAACTCTTCATACTAAGCTTAATTAG
TTGGCATAATAATTTTGTAAAATAGAGTAAGAACATGCTATAATCGGTTAAACTATATTTTTCTTTTATCATTGAAATATCAATAATTCAGTGTATATAT
TTTTATGCATGAATAAATGGAAAAATCTTCCTAACTTCACATCCTCATGTCGGGTAGGGTGATAAGATTAGCTTATAGTATAATTTATCCATTTATTAAG
AATTCAATTCATTTGGACTTACTTTTACATGTAAAAATATAATTGAGTTGATTTTAGCTAAATATGTACCTAAAATAGATTTTTGACAAAATTGGCAAAA
AGAATTATTTTTTTCCGTTTAACATTTATGAAGCCATAATAAAGAAAAAAAATTAATTTTGTTTGGTGGTGTAATTAAATAAGTTGGCAAGAGTTGGATG
AGTAATACGACTCAGTCATTAGTTAATCATCTTGACTCACACCCGGATATACCAAATTAACTCAATTAAATTTGACCCACTCCAATTTAATTTCATTCAT
CCAATATTTGACAATTCTAAATAGAAATAAAGATAAATAAAATAGATAAATTCAGAATTTAAGTTTTATTCGTTTAACCTTTAAATTTTTTACATCTACA
ACCCCTGGCAGGCATGACCTCTTTAACCCTGCAGATGGCCTAGCGACGGAAGTAGAGACGGATGACTTTCAATTAGAATTTTGTATATATCTTAAAAAAT
TATTCATATAAAAATATTCACTAGTTCTCAAAGTAGGAACAACTGCATACATGGTTCTCAAAGATACCGGCAACAATAAAACATTTGGCATAATCCTATA
AAATGTACTTTTTGCTTTTCACCCTATGCGGCAGGTTCATTGCTTAGCATCTGGTGTATGGTCAATTTTGGGTTCTAATATTGAAAGAGATGAGTCCTTA
TCAGGTCTTGGACATAACTCAGACTATAAAAGCTAGCTCAAACGGATGTGAATTGTCCAAGCCTAATAAGGAGCCTGCTCATCTCATTAACTATCAATGT
GAGACCTTTTGCTTTAACCGTATTCATAGACCTTTGATGATGGAAGCAATTAGATTTTCATCAAGAAGATTGAAAATATAACGAAATAAACATATGAGTA
AGTCAAAACGGGTATAATAGAGTTCTCAAAGTAGGAAAAAGTACCCGCGTGGTTCTCAAAGATAGGTAACAATAACATATCTGATGTAATCCTATAAAAT
GGGATTCGATGAGAGGATAGAGTTTACACAAAACTACAGTGATGAAAGTAGGATTTTCACTAAGAGGATTTAAAATATAAAAAAAGTAAAACATGCGAGT
AAGTCAAAACATGTTCCAATATCTACTATATATACAAAAATAATGTAATTTTTCTGATACCCTAGGGTACCTCCGCTCATGTCTTATACCTTGTAGAGAT
AGATAAGTTATCATTGTCAAGTAGCGTGTAGTACGTGTATTATCATCAAAAGATGTATAGTCAAAAGTAGATAATATAGGAGCTGATTGAATACAATATA
ACGTATTCATTACTAGTTTGTAATTAATATATAGTGTGTTGTGACGTATATAAAGTATGAAAATATTAAAGTGAGAAAACGACGAAGAATAGAATATAAT
GAAGGGATGAGCAGTAACAATCAAACCAGCGGAGAAGAGGAGTTGCGCACTAATGCAGGTGTGGAGAGTACTTATTAATAAATGTGAGCTCAGAAGAACC
TGGAAGGCCAGACTCCATGTCATTGGGACACATCTTCACTGTATTGGACAAAAATCAAAAGGCCCAAAAGTACCTTTAATTTTGGCTACTTGCATGTGAG
TATCATATCAATGATGCTGGCTGGCCTTTTTTTTTGCATCGATCACATTATTTATATTCATAATTGGCTCAAACTTGGCTACCTAGTGGGTGTAGCGGGG
GGACATAGATTGTGAAACCCCGTTTGGGTTTTAGGGGCTTATGTTCCCTGTTGAGAATGACTTCACTTATGCCTAACAACATCCCTTGTGTCTACTGTGC
CCACTTCTGGACCCGTTCCAACGGTGAAATGCTTCTTCTCAAACGGAGTTGGAACCTCATCTTCATTTAATTCTTTTAAATATCTCTTTCAAACCTTAAT
TTTAGTTTCTTGTTTTGGACCTACTTCTTATTAGGTACACCTAAATATTTTTGTCCTAATTAATTAACTAATGGCATTTTTATAGCTTTAGCTCTAGCCT
AGACATTTATCTACAACATGACAGAATCAAAGTAAACACAAAAATATGCGTATACTTTATATATTTAAAAAAAATAAATTTAATCATGTATAAATATTGT
TATTTTCCGATAAAGGGAAAATCCAAGAGTGTAACAACGTTGCGGTGAAGGGGTATGGAATACGGATAAAAAAAAATTAATAAAGTTTCTTCCGAGCAGC
TAGAGTTATCACATAATTATATACAATATATGGTTTATTTGTTCCATATAGTATATGTATTTCTTCTTACTTGTTTTTTTCTTTGGGTGCAGCAATTTGT
TCCATGATTTTTTTTATAAATTTGGCCTTAAAAAATTATCCGACAGGATTAATAGACTCAAAAAGCCAAAAATATATATTATAATTTTAGAGATATGAAG
GGGACAAAAAATATTCACGTGATAACTAGTGCATCACATATTTTTGTGTTGAAATCGTTTAGGGGGTGAAAGCTTCCAAGCTAGCTAAATATACGAGGAT
AATTAGGAGATAAATTAAATATGAAGGGAATAAAAGATGTCAAAGTCTAAGAGGTCCCAAAGGAGTATGCCTTCATTTTTAAAAATATCATAGTAGCTAG
TAATATTAGTGTGCTATTTTTAAAACGCTACATCTTTTCTTATTATACAAGTTATTTGATAAATATTTATTTATATTTATATAAAGAAGAGATCAGAGTT
AAGACCTCGTTGAATGTAAGTTGTGTTATGCAATTACTCATTTTGGCTTTAATTTGAACACTTTTCGTGAATTTTCTAGCTACGTCAGTGTCATTGATTA
TGTTTTGCAATTAGTCAATTATTCCTGTCCTCACTATCGTTTACATTTTATAGATAAGATAAATGTACTATGATATCTTTTATTTGATTTACAGAAACTT
AAGGAAAAAGCAGCATTTCGAAAATCCAGATGAGTTCTACTTCTACTTCAAGATGGTTAATGCATAAATTGGAGTAAGTTACTAATATTCATATATGTTA
ATTGAGCTAATTTCTGCCTCATTCGTGGTTGATCTGACTTGTAAGACATTGTTTCGATATTTCAAGTACACAATCAGTTTGGAGATATCTACTTGAGTGT
CATTGACCTGACCAATTGCATTAGATATTAAGCTTTCTTTGGCCATGGTTTGAAATAACCTTATTATTCAGAAAAGTAAATGAATTATTTGGAGATATCT
ATTTAATGACCATTTATCGAGTTTAGCTTTCTTCGTGAGTTGAAATCTTATCACTTGATCTAGATCGAACGATTGAGCCATGTCTATGGAGGATTAACGA
TTTCGTCCTGTTTGTAGTGCCATGTCTGATGGATGGATGCGTACAAGCTTTATTCACAAATAATATATAGTTGTTCTATTGTACACTCACTGCCTTGTTT
TTTATGTTAAAATTGGAGGAATTCATTTTTTGAAGCTGAGGGTAGTTTCTACTCCTTTACCCATCGGTGGATGAGAAATCGCCACCATAGTACGTAATTT
CTGGTTAACCATGTTCCAAGAAAAAAAAGTTAAAAAGTATCTTCATATCAAGAGTTCAGGTGAACAGCTGCCTATTTGGTTTCTTTGTGTATTGAAACTC
TTAACACTTCTGTTGTATGAGTGAAATCTTTAGATCTATTGGAATCACATGATTAAAGTGTACAAAAAGTAGTTATGGCAGTAATTAGCAATCTGTCAAA
GAAAGAGGTGAGACTGATTGTTAGTTAGTTATAACCAATTATTGTTTCAAATGTGTGATTTCTATAAATAGGATGTGTAATTAATCCATAATATTTTTTC
CTCTTCTTCTATCTTCCACTGATTTTCTCTCCAAGTAGAGTTGCATAGATTCTATGATTCCATGAAATCTAATAAAACCGATCGAATTCATACATCATCC
CGTTTGTGCCTTTATGAAACCAAACGTGAATGATTGGCAATCATGAATCGTATAATTGTAAATGTGGAAAAGACTATATTAAAGAATTAAGTAGCTACTC
CATTTTATTAGATCAAAGAATTACGTAAAACTATATAAATCTTAAAACTTTAAAACAACATATAGTTACAATTATGTATTTATATAATAATACTAGCTAG
AGATATGCCATTTATGTGGCATGTCTTAAAATATTTTGACACTTCCATTTATAAATTATGATTTTCTCATTCGGCTAGATTACGAGAATGTAGAAATTTG
ATACTTTCATAAATCATGGTTCTTTCATGTTTAGTCATTGAGATTCAAATAAAAGTACTTCGAATAAAACTTCAATTTCAAATTAAGCTTATTTCAAATT
GGTAAGTTTTTTTTAAAAAAAAACTAAATAATATCTCATACGGTTACTTAATTCTGTATTCTTCATTCATAAAGTCACTCAACTTTAAATTTTAATTCAA
AAGTCATTTAACTATTCACTATTTTTTTTCAAAAAATTACTTAACTATCCACTATTTTCTTTGAAAATCATAAACTTTGAATTTCTAACTCAAAGTCATT
CAATAATCCATTTTTTCTCATTAAGTCACTAAACCATCAAACGAATTCAATGCAATCTTCTTATTTGGATTTGTATAATTTCATAACCTAAATGCATATA
TTTGGATCTTGTTATATGCTTTTACTAAAGTGCTTTAGAAGGGTAAAAAGTAATCTTCGGTTGATAATAGTAAAAAATAATAATTCTTTTTTTGATAATG
GTGAAAAAAGTACAAAAAAATAAATTTCGTAGTTTAAATTTGTACAATTGAATTTCCTTAATGAAGAAATCCTTTATAGATAGGAATGTTGTTTCCCGTA
AAAAGAACAAGAAAAGATTGAAGAGAAAGAATTACTAACTAGAGTTCATATAATTATGGTTTAAAGGTTACTTTATTTAAATAAATATGGACCATTAGAT
TTTAAAATTGATAAATATATTTAAATTAAATGTGTACTGAATCAATTGAAGAGATTAGTGTACCCAAGAAAATCCCCTTGCTAGAAGAATGAGGTAAAAT
AAAATTGGCAAACATTGTATTATTAATGGGTCTGTTTAAATGGACGGGTCATTAAATGATTCAAATAAATATAATTTATACATAAAAAATATTAATTAAA
TAAATTGCGTATTTTTTCGAATAAACACTGAATAATTAAGTATTTTTTTTTAGGAATAAATAGAATGTTGAATAACTTTTGAGTTAATTTAAAGTCAAGT
GACTTTTTGAATAAAGAAAAGAGGAGATATTTGAAAAAAAAATTAAAAGTGGATGAATTTTTGAGTGAATAAAGAATATTTGAGGGAGTATCAGAGATAT
TGGTTCAAAAAATCTGCAAACCCTCTTGTGCAAAGAATTTAAAATTCAGGACTACGTGGCGCTTAGGGAACCGCGTTCAAATACTGGGGAAGTCTGATTT
CTCCATATCATCCCGACGGAGTCCAAAAGAGCAGAAAAATAGTGTAAGAGAGAATGGCGAAGCTTTTATCCACACCTCGTCTGACCTCCATTCACAAACT
CACAGTCGCTTCCAGTCTCTCCAAGTCTTCTTCTTCTTCTTCTGCAATTCACTCTTCTCCCACCGTTTTCCCCATTTCTCTGCACTCAAATTCCCTCTTT
TTCTCCCTCTACACTACTCCTCTCCTCACCCTTCGCTCTATCGATAACCCTTCCCATATTCATCGAAATTTCTCCGTTTCAGCCTTCGACACTAAGAATG
AGGACGTATCACCGTCTTCCAAAGGTGACACTAAGGATGAGGACGTATCATCGACTAAGGATGAGCCTGTTGCTGAAATCAAAGCCGATGATATTGCGAA
AGAAGATCAGTATCCAACCGGGGAATTCGAATTTGAGGAGTATGGTGTTTGGAAGAGCTTAGTTGTGAAGTTTAGAATGCTCTTTACGCTTCCTTGGGAG
CGAGTCCGCAAGGGAAGTGTTCTCACCATGAAATTGCGCAATGAGGTCAGTACTGAGAGCTATTTGATATTTAAATATAGATCGAAAATTTTAGTAATCA
TGTTAGCAATGTCGAATTCCTGCGAGTTCCTATGTGTATAAAAATAGTGTAGTGATTTTTTTCGAATAGAATTATAACTCGTGCCTGTGACAACCTTTGT
CCAATGCATCACAGAGTTAATGATGAGCTGCAGTATTTGTTATCCAATTGAATTTGCAATATGCAAGTATATACATGCTTTAGAACGAAGAGTGTCATTA
ACTTTAATTCTGGTGCATCTGATCATTATTTTGGTAAGGTAGTTTTTGTGATGAAGCATAGTACTAAACATGTTTTATTTCTTTCATTTGGTATGTTCTT
GTATTTGGCTGGGGTCTTCGAAACAACCTCTCTACCTACATAAGTTAGGGGTATGGTCTACGTACATCCTAAACTCCCCAAACTCCACCTAATGGAGCTA
CACTAGGTATTTATTGTTGAAACATAGTACTAGAATATTACGGTGCAGATACAAAATGCAGAAAAGCTGGCCATGGATCCTTTTATATCTGAAAGGGGTC
GTTTGGTAGAGTGTATAAAAATATTGCTCAATAGAGTGTATTAGTAATGTTTGTATTAGTTATGCTCGCGTTAGTTATGCATGTATTTTTTCCTATTCAT
TGTTTGGTTTGGTGTATTAAAAATAATATGCATTGTATAAAAATATTTATTTATAATATAGGGAAAATGGTCTGATATACCCCTCAACTTTGTCATTTAG
AGCTGATATACCCCTCGTTATAAAAGTGGCTCATATATGCCTCTACCGTTCTACAAACGGCTCACATTACCCTTGCCGTTACAAAATGGCTCACATATAC
CCTTTATTTAACGGAAGTTAAAAAATTAGTTTTAAATTTATATTTATTACTTGTAATTTTTTAAAAAAAATTATTTAGGGTTATATATGATTCTTCTATC
AAAGTTAAAGGTATATTTAATTTTTTTCATATTTTTTTTGACTTCTTTTATTATAATTATTTGAGTTTCTTATTTTTATTTTGTTTTTTTCTTTCATTCC
TTAGTTTAAAGAAAAAAAAATTAACTATTTTTTTTGTGTGTATTGTAATTTAATTTCGTATTCGAAGAAAAAATTTGGTCATTTGCAATAAGTTTTACAA
GAATATTAGTGAAACATAAATAAATTTGATTATCAAAATAATGATTATAAATTAGTCATTGAAACAAAAAAAAGACAAAAAAAAATATGTTTGACGAGGA
TTAAATTTACTCATATGAGATTATATTTTTTAGAAAAAAATAATAAAAATTTAGATTAATTTTTTTTTTCATTTCCGTTAGAGAAAAAGGGTATATGTGA
GCCATTTGTTTACAAGTAGGGGTATATATGAACCACTTTCATAACAAGGGCTATATCAGCTATAAATGACAAAGTTGAAGAGTATATCAGACCCTTTTCC
CTATAATATATCTTCTACAATTGTGGTGGAAAAGATGTACAAGTGGCTTTTGAGGGTAATTGAGTCTTTAACCATGCTAATGCATGTATTAAATCCCTTT
ACATTACTTATACCTAGAAAAAGTGTACCAAAAAAGGGGAGGTTTTAACCAAACTAAGCCATTATATAAAGTCATTTACCAAAATAATATGTTTTTCTAA
AATTTTACAAAACTAGTATAAACGTATTCCACAGTAACGTTTTAGCATATATTTTATTTTTTAAAAGTTGATGGCGTCAGATTGATATATGTTACTCACA
TTAACGTTTTACTCCTAAAACGTTACTCACAGTAACGTTTTAGGAGTAAAACGTTACTGAAAATAACGTTTTAAAAGTAAAACGTTACTTACAGTGACGT
ATATCAACCTAATGCTGTTAGTTTTTAAAAAATAAAATATACCCTAAAACGTTACCATGAAATACGTTTATACTAGTTTTGTAAAATTTTAGAAAAATGT
ATTACTTTGGTAAATTGTTTTATATAATGACTTAGTTTGGTTAAAAATTCAAAAAAGGGACTACTAATATTTAAAGCTAATGCAAGTTGCAAATATTATT
TTTGCTAATGCACTCTACTAAACGACCCCTAATGAAGTGAAAAATCAGCATTAACCAAAATCTTAAGTTCTGAATGCATCTATTGTTAAGTATTACAACA
TTTCCCTTGCTTCCTTTCCAACCAAACAGTCTACATAATGCAAAGAAGGATGGTCTTCCAAATCTTCTTCTGCTCCTTCCTTGTCCTCTGGTTTTGCATC
TGATCATTAAAAGGGTAAAATTATGATCAAATTACTAAGTGTAGCTAAATAGAGAGGCAGAGAATGGGAAGTTACACATTTATCGGCACATAATACTTTT
AATTTGCTAATTCTTGTTCAGATATTTCTTCTCTGTTTAGTTGAGGTAATTGAACTCTTGCACTGTTTTTTGTCCTCTCAGATATCTGATCAGTTACAGA
GCCGTTTCTCTTCAGGATTATCCCTACCTCAAATTTGTGAGAACCTCATGAAGGCCGCTTATGATCCTCGAATCTCTGGTGTTTATCTCCACATTGAACC
TTTAGGTTGTGGCTGGGGCAAAGTTGAAGAAATTCGGAGGCATATACTGGACTTCAGGAAATCAGGCAAGAATTCGTCTTTGTACTTTTATGAAATGGTG
AGATCCGAAAAGGTTCATGGGCTTGTCACTTGATTATAAGTATCATACTTTGGAAAGAGGAAAAGGATGACATTTGGTTATGTCTGTCTGCATAAAGCTT
GTAGGGTTGAATTTGAACCAGGGAAGAAAGATATTTTGATCCATGAAGGATTTGGAAAAACAAGGACGTAGTGAATAGATGAAAAGTATCCTTATATATA
AGCCTTTTTGTACTTTGGGAACTTTTAGCCTGAGGGACTGGAGGGGAGATCATATTCTTAGCCCTATATGATGAGGATATTTAAATAAGATAAATGAGTA
TTTGAGATCAATGCCGAAAACTGTCATGAACTAATTTGAGAGGTGAAGGGAATTTTAAGGTCCTTGGGAGTTGTTTAATCTGGATGCTGTCAGAACTATG
CAAGATCAACATACTAGAATCTAGTACTCCTTTCTGTTTTGGCTCATTTCTTTGAGGAACAATAAAATTACACCCTTCCCATTCCTGTATGATTTAATGG
AAAACTAACCATGTGTCTAGTAGTCCTGATTCCCCATCTTATCCTGTGCCAACTAGTCCCAATTCTTAAATGCATATGAATGACAATTTTTTGGCCCTTT
CTATACATCTCACACAACATGTGTGATAAGTCTTCAAGTATGTCGAGCATCTTGGAGTATGCGCCTATTTCAGGACCTCCTAAGTCATGAGACTGGGATA
ATGCAATATCTCAGTTAAGATGAATATTAGACTAAAAAACCATCTTATAAGAAACCTAAACTTTAAAGACACTAGGAGAAAATATTACGCAATGCTAAAA
AAAATTATCTTCCTTACCTTCTCATTGTAAAATGCTAAATAAAATGATCAATGTCACTACCTTATCATGTCTTGGATTATGAGGCCATCTCTCTATTATG
GATCATCATGTTATGGTATTTTCCTTTGCAGTTGCAGCTGAGGTATCTAATCACACAACAAATCTAAGTTTCAAATGAGTATATGTTGTATAGACTGAAA
GTTACTTGGATTAATTAAGCTTCTTATGTTTAAGGAGTGCCATATGAGATCCATTTTGTTTTAAAATCTAGAATTGGGAAATATAAAAGTAAAGAAGAGC
GTTAATCTTTGTCATTTTTCAGGTAAATTCATAGTTGGCTATGCACCTGCTTGTGGTGAAAAGGAGTACTACATTGGCTGCGCTTGTCAAGAGCTTTATG
TCCCTCCAAGTGCTTACTTTGCGTTGTATGGTTTAACAGTTCAAGCATCATTTTTGGGAGGTTAGTTCTTTAGCCTCCCAGCTGAAACAAAATATTTTTT
GGAGAGATAAGTTCCTCTTAAATATCAGATGTGCTAAGTTCTGTTCGTTCTTGAATGTATGGATTAATTACCTCTTTGGAATATTGAGTTGGTCATCATT
GCAGTAATGGTTATTTTTCATCAATTTAAGTGAAAGTGCAAAAAGCAAAACCTATTTAAATTTGAAGTTGCTGGAATTTGCTAGCCAGTGTTACTAGGGT
TTCAGAGTATGCGTGAATGCAGCCTGAAATTGTTGAACAATGCTTCTTAATTGTATATAGCTAGTTCCAGAGCATATGTGATCTCAATTGCTTATGATCA
GCCCTTAGCTGCAGCAAATTTATTGCTCTGCAGGTGTCTTTGAGAAAGTTGGAATTGAGCCACAAGTGCAAAGAATTGGTAAATATAAAAGTGCTGGAGA
TCAACTAATGCGTAAAAGTATATCTGATGAAAATCGGGAGATGCTAACTGCATTACTTGATAATATATATGGAAATTGGCTTGAAAAAGTTGCTCTTACT
AAAGGTGACTTCAGATTTGAACTTCATACTGGAGATTTGAAGTCCAGTGGGGATTTTCATGATCTGTTTTCTTACTCAGGGAAGAAAATAGAAGACATTG
AGCAGTTCGTTAATGATGGAGTCTACCAAGTTGAAAGGCTAAAGGAAGAAAGCTGGATAACAGACATAAAGTACGATGATGAGGTATAGTAAGTTGCTAG
GTATCTTGAGGTATTACTTGAGAAACAGTTCTTTGATTATTTGTAAGTTCAACTGATTTATTAGGTGAATTCTTTTTTTTTTCTGGTGTGAGGGAGGGGA
GGGGTTACTTTTCAAATGAATTAGGATTGGTAATGGATTTACTTCTTTTCCAGGGAAAATCAATTCTTAAAAATCATAAAGGAAAAGGATGTAGACAACT
ACTTGTATGTGCCATTTCATGTGACCATTCTGTTTGAGTTCTAGGATGATTTTACCTCTTTCTCTTTATTAGAATTTAAATGAAGAATTTTGCATTTGTA
TGTATGATATTATTCTTTTGTTCATGGAATGTTGATTATATGACACTATTATTTTTGTTATGTAGTCAAAGATCTTTTTCTTTGACCACAATTTTTAGAT
ATATTTTTTGGATTTTTTTGTCTATAAAAATTTGTACTCCCCCTGTACCAATTTATGTGACACCCTTTCCTTTTTAATCTATCCCAAAAATAATGTCACA
TTTTTTATATTTAGAAACAATTTAACTTAATGAGATGATTGACAATCACACAAGTATCTAATTTCTTAAACTCCGAGCCTAGTCAAATGGTGCCACATAA
ATTGGGATGAAGGGAGTATATAATATGTTTTATCTAGTTCCCAAGTGTTGCAAATCTAGATTAAAATGTTCAAAAAAACAACGTCCAAATTGGAACCTTG
CCAAATTAGGTTTCCTGAACTGTTACTGGGAACGATGAAAGTGTGGGATATAGCGAACTCTATATATAAGAAAGTGATAGCTGCACAGGTTATCACAATC
TATGCACCCTCTTACAGCCTTATGATGATATACCCTTTGTATCCAGTGTTTTCACCTTTTCTCTTATCTTGATTTTAGTTTATGGATGAAATCTTGGAAA
TCAGCTGAAGTTAAAAGATCCTTTTAATGATTAGACAGTCAGTATTTGTCAGACATCTGTATTGCAGGTCCTTATGTGATTATATCGAGAGCAACTAAGT
TGTATACTAGTATCTTTGCCTTGAAAACAAGATTGGCATGCACTGTTAATCTCTGGATTATCTTGTATGTATTAAGCTTAAATAGTTTGTTTCATTTGTG
TATCTGGCCATCTGGATTTTATGACTTCCGCCATAAAAATGCTTAAATTATTTCTTGAACTTGACATAAGAACTTAACACCTTTTCTCCCATGGTTATCA
AGGAATCACTAATTTATGCATATCCTCAGGTAATGTCAATGTTGAAAGAGCGTTTGGGAATTTCCAAGGATGAAAATCTCCCTGAAGTTGATTACAGGTC
TTGTCTTTTTGAATTTCAAGTCACCTGGATAATTTTTCTCAGGGTTTATTTTTTTTATTTTGCAGCAATAGTTTTGTACAATTATTATGTACATTGCTTT
TCATGACACTTCTTTCTTATGCTTGGACTAATTAATGGCCCTGGAATTTTCAGAGAACATCAATACTTTAAAATAATATATTTTATGTAATTTTACGGAA
AAAACATCCCAGGCGGCTAAAGGAAAGTGTAATAACTTGTATCAGTTCGATTTTGAGATTTTGCCAACTATCAATTGTCATGTATTCTAGTATTGTCTCT
CCACATATTCTTTGTCTCAGCTGTTATGCACTATTTTCCCTTTGGAACTTTTAACATTTTGTGATTATTATATTCTGATACAGGAAGTATTCAAAAGTTA
GGAGATGGACTCTCGGTCTAACAGGTTATAAAGACCAGATAGCTGTCATTCGAGCCTCCGGAAGTATTAGTCGCACACGCGGTCCATTTAGTTCATCTAG
TTCAGGAATAATAGCAGAGAAGTTGATTGAAAAAATTCGTAGTGTACGAGGTATGAAGTGTCCTTATATGTGCACTTTGTCAAGCTGTCAAAATATGTGA
AAACAGGTCATTACAAATCCTGATTAGCCATATATCGTGAATACCAAGTTTTTTAGTCTCAGAAAGACACTTCGCAGACACAAGGCATTATCTGCTCTGC
GCAGTTCTGGATACTTTCTTTCTTGCTTTGTTCTCTTTGGCTTTGTTTCCAACTCATATTGTGGAAAGACTTGTATTGTTGATAGGCTTTTGCTTAGTAT
GAAGGAGAAAGACTCTTGTGAGGAATTTGTCACTGTTATGTTGCTAGAGATTTGATTGAATAAGCAAAGTGCTACACTTCATATTCAATTTTTCTTCTTT
TTCAGACTTAATAGTAAAACTTAGAGATGGGAAGGCCAGTTTGGTTAGTGGTAGTTGCAGGTTTATTTTTGCCGTCTAATGCATGAACTGGCTATAAGCT
ACATAAGTTATGCTAGAAGAACAGTATGTAAATTTTTCAGGTAACTAATGGGAGTCAGTGAACAGTTCAATAAGACTCGTGCATGTGCTGTTTCATTAGA
GATATTAGGGTGCAAGATTTCCCATATTCGTCTCATCCCTTTCTCTCTCCTGTTTGAGAGGAGGGGACTATTCATTGGTGAACTCTCAAATCACAGCAGA
TTTGGATGCTTCTGTGTGTAGATTTTAAAAATGAAAGGAGGAAAAAGCTTTTGATAGGTTTAGGTGGTCTCCGTGCTTTTAGGTTATTCCTTTTGGTTGC
CAATTTTCTTCTTTATATTGTTTTTCATGTGTGTCTCTATGTTGTGCAGAGTCGAAAAGGTTTAAAGCTGTCGTCCTTCGAATTGATAGCCCTGGAGGAG
ACGCTCTTGCTTCTGATTTGTAAGTCCTGTTATGTTATGGATCTTTCCTTTTTATGCACTATGTAAGGAGTCACTTTGCCGTCTAAATTTTCTCTCTGTA
ACTTGTATGATTGTTGCATTTATATCTCTTCTTTCAGATATATAGAGTCCTAACTATTTTTTAGGTAAACTATTAACATAAGATCCTAACTGTTTTAATT
GATTGTCTTGTACAATGGAAATCTTAACTTATCTGCTGTTTGTGTGCTCCCATGATACTTTAGTTAAATCAGCTTGTAAAATAGGAACGTGATGTTTTCC
TGTCTTCAAAGCAGTCAATCTATTTTCCACATGTAAAAGCTTCTGTAGTGTAGACTCTGACAAACATTATTTTTATTTTTCGGACCAAATTCTATGTTGA
TTTATTAGGATGCTTTTTACTACAGAATGTGGAGAGAAATTAGATTGCTGGCAGAATCTAAACCTGTTATAGCATCTATGGCTGATGTGGCAGCCAGTGG
AGGATATTATATGGCAATGGCTGCACAAGCTATTGTGGCAGAGAACCTTACATTGACAGGCTCAATAGGTGTGGTGACAGGTAAATCTAAATACTACAAC
GAATTTTTGTCTTCTATAAACTGTGGTTGAGTGGTACCCAATTAAGGTGCTAATTTCAGATCTGGAATCATTTTCCAAAGAACCTTATGTTTCATATATG
TGGTGTACTGTGCTTTAGTTCTTGTATTTTTGCACTAGCAAGATGACTTCTGCACAGATATATCAGCTCCCAAAAGTTTGTACCTGATAAAGAGATACGT
TTGTATAACTTGAACCCAAACATAATTCAGGAACTGAAATGTAGTTTAAATTTACCATCCATTTTTAAGAATTAGAAACAGCTCTCAACCACATGAAAGC
ATCACCTTGCTTTTCAGGAATGACCTGTGCTCTTCAGGAACTCCATTAATCCTAGTTGTTTTAGAAGAAAAATTGTAGAACTCAATTGGTTGTGTGTAAT
TGATGCTTCTTTCATCGTCCATATCTCTTTGGCTTCACAATTCAATTTTTATTGGATTATTCATCATTAGTTGGTCGGATTGCTTTTTTTCGTCTGAGGG
TTTCGGGATAAAATTTTATTTTAGCAAAAGAACAAAAAGAAAAAAGTTAAATGTTTCACGTGTGGGCTGAGGATACATTTTATAAAGTGCAGAAGTGTGG
ATTGGAAATCAATTGATCAGATTTGTTTGTTATCTCCAAATTGGCGAAGGTTTCTACTCATGTTAGACCACCAGTTGAACTATCCACAATTTCCTATCTT
TCAAAGGAAGATTTTAAGGAAAAAACATTTGTATCTTGAATGGCAGGTGTTTTTCCTTGTGTGGTATAAATTTTTTGAAAACTTTGTGCTTGCTTTACTG
GGATCCATAATGTGGTCAATGATCCCTTGCATAAATGAATCTTATCTGATTCCAAAATCCTATACTATCTTCACCTGAGAATTAATCAAAATGTTCTCCT
TTTGAGTGCCATTCAATAAGGTATCACTCCCAAGTACAAAAATTCAGAACACATGCTTCAACTATATGCTCTTGTATCAGTTTTGGTGCTCTTTGTAAGG
CTGATTGTACTGATATTTATTTTACACACTTCAGGTTATGCCATAGAACTGTATCATGAGGGTGCAAGATTCTTCTAATTTTCCAAATAGTCAGTCCTTC
TCAATGTATACCATATTTAGATCCACTTAGTACCAGCTCAAAATATATTGAAGTGTAACTAGATAGTTCTATATTGAATGGAATAACAGAATTTGTCTCA
AGCTCTGGAACTGAAGAAGGTATTAGGAGGTAATTCCAACTATCGAATGATATAATCATTTCAGGAAGAGGCTATATTAATGCTTTGTCCATGTAATTAG
CCTGATGTGGGAATTGAAGAACTGTTTCACAAGATAACATGTCATGTCAAAAATAAAAACAAAAATATGACTAACAATTTAAGACAGAGGACTAACTGTT
TCTTACAGGTAGGTTATATAATTAGAAAAAGGTAGCTCAGAGGTTGATTCCTTGTTTGTATCTCTTCACTAGGACCTTTCCCTACTCCCAACGTTGCCAT
TCACCCACCCACTTCCTGATGCCGCCAATTTCATCTTAACACGTCATTCTCAGATTTTTTTTTTTGAACCAGATTTGTCTTCACAGTTCTAGATCCGAAG
AGCTTGGACTGATATCTGTAAAATTGGGATGACAACTCTCTTTGGTGTGTGTGTAAGAGTGTATGCCTTTCTGTCTTCCTGCAAATAGGGTGATTGAGTT
GATCTGGTATCTTGATGAACTCTTTAAGATTTTGGTTTGTGGGAGAGGCAACTCTTTGGTTTACTCCATATTTATGTTGGTTCATGTATTTGCTTTAATA
CGAGTGTCAATCCTTTATAGTTGCAGTTTATCCGTTTCTTGGTTCCTCTGGGTTTTCTGTTCCTTTCTGCACTGCCTGGAAGTCCTCTATTCTGCCGCTG
CATGCCCCTTACATTTAGTTGTTTTGGTCCTTAATCTTCACAAAATTTACTTGTAATGAGGTCTTCAAAGTTGGAATTGACCTTATGAGCTAGCTATGCT
ATTTCACATGTATGCCCAAGCAAACTTCTAAATCAGATTCAATGTTTAAAAATTACAACAGGGAAATTCAACTTGGGAAAATTATATGAAAAAATTGGCT
TCAATAAGGAGACAATATCAAGGGGAAGATATGCAGAGCTTACTGCGGCTGAACAACGACCATTCAGGTGAACTTTTTTCGTCTTCCTTGGGTTATACAT
GTTACACCTAGAAGGCTTGAACCCCATTATAAGAACATAAACTTCTATCATGAATTTTATGTTACATCCTTCTGTTGTTACTGCTCTTTATAACAAGCTG
AATTTTGATCTTAGAGACTAGCATAACTTCTTATGCCTAACACCAAAATCAGAACTTTTCCACTTCTACTAATGCATCCAGTTGGTTCTCGCTTTGTGGC
TTTCGAGTTTAGTTGTTTTAAGCCTACAAATGAAAATCCAAATCTTGGATTTTAGATTGTCTTTTGATTTAGTATTTTCTAAGATAGAACTTCATCTGTA
GGCCTGAGGAAGCAGAACTGTTTGCCAAATCTGCACAGCATGCATATACCCAATTCCGAGACAAGGCTGCCCTTTCAAGATCAATGACGGTATGATACTT
GGTAAAGAAGACAGCTTAGAAGAAAGCAGTCGTTACTTTATTTATCAGTTGATTGAAAATACCAAGCACTCCATTTAGGTGGATAAAATGGAGGAGGTTG
CACAAGGGAGAGTTTGGACTGGAAAGGATGCTCTTTCACGAGGTCTAGTTGATGCTGTCGGTGGTCTCTCTCGTGCTGTAGCAATTGCAAAACAGAAGGC
CAATATACCTCAGGATAGACAGGTGTGTCATAAGTAAATCTATTTTTGCTGTTAAAACAGCCATTTCAGTCTGAGCACATAGATTGTAGTGCTCTGCAGC
CTGAAGCATGATTTTCAAGTCTGTATATCAGTTTATGCATTGGATCTTTGTCAACTGTCATTCTAGTGAAATTTTGGAGCTCTGTTGGGAACCTAAGGAT
CCGAATCTCTTGATCTTCTAAGAGAGCTGGTGAATTTTCCTGCCAAAACCAAGTTATAGAAAATCTCAGCTGCATCTGTCATCAATAAAAAAGTAGAAAG
ATGAGGAAGTTGCCACAACTTTTGAGATAACATGAAGTGAGATATGTAGTCAAAGGAGAATTCCTGAGAAAATTACATCATAGAAATAGTCTTCTCTCAA
CTTCCTTTTTTACGAATTATCAAAAAAGAAGAAGTTGAGAATGGACCACTCACGACTTTACCTGCAAGATACTTCAGTATGTGCTGTGGTCAAACAGCAG
ATTTAGCTTTGTTTTTGTGCCACATTTTGGAAATCTGAATAATAGTTTTTGTCTTCATAGTCAGATGTGAACCATTATGGTACTCATCCCAGGGTCTTCT
GTTCAGAAAAATGAAATGCATGATGAATTGATGATGTTTGATGCCCAACTAGTTTAGTGGTAATAATACCTAACAAATCTTGGAAGCTGCTTTCTATCAT
TGGTTACTGAAAAAGTAGTCAGAGGCGATAAAGTTTGATTTGATAAGAAAAATACCGTTGAAACAATATATCGGGTTAGTTCCTCCTTTTTTTTGTTTGT
ATGTTCATCTCAGTCTCTATATTTTTTGAAGGGATTTGTAGAGGAGATAACTTTCTCGGTCTTCCTAATAAATTGTTAAAACTGCAGGTTTCTGTTGTTG
AGCTGTCAAGGCCATCCACGTCCTTACCAGAAGTTTTAAGCGGCATAGGAAGCTCTTTGGCCGGAGCAGATAGAACTTTAAAAGAGTTGCTAAATGATGT
GGCATCATCTGATGGGATCCAAGCCCGTATGGACGGCGTCATGTTTGAGAAATTAGGAGCAGCTGCTTATACCAATCCCCTGTTTTTGTTGATAAAAGAT
TGCCTCAGTTCCTTCTAAGTCAAAGGCTGTCTGCTGCTGTTGTATCAGAAATATCTCATTTTGTTATTTGCTCAAGCACAACGTTCATACAAGGATCTTA
CATTTTGTTGAGGATGCAGAATTCGGTATGTCTACTTAAGGACAAAAGCAAAAAATCAGGTACTTACTTCCTTTCCTTGTTTTCAGTATAGAACTTCCGA
TATGTTTTTGTTTCAAATCTTGGGTCGGTGAGTAAGTGAAACAAATAGATAGGTGGTAAACAAAAGATTGAATTTCCTTACTTCCTTAAAGTTGATAGTG
CTAAAAATATATTTGGCACTACCAATACTTGTAAAAATTATTTGAGTAATTAAATTAAGTTACAGTGGTTGCAGGGTGGTATATATGAGCTCTTGCTGAT
TTTAATTCAGGATGGGTGGTTCTCAACAAGGGTATGGAGGTACTACACGAATTAGTATCATGACATTCTGTTATATACAACTACTGTAACTTCGAAACAA
TTCCACTTTGCACTTCCGTATGAGTCATTCTGTTTGAACAGATAGATCCATTGTGACAACGGCCATGTAAAAAATACAGATTTACAATTTAGAAGTGGAA
CATTCTCATTATCTGTTTCTCCAACTCCTTTCTTTTTGTAAATGCAGTAGAACTATTGTTGCTTCAAGGCTCAAGCTTTGTGCATAGAGGTAGAGCACGG
TTTTAATTTTTTTAGGATTCCCACCTGGCGTTCTTCGGGGCCCAACCAAATCCGAATTCGCGTCCTGGAGCTCCACATTGGGTGATAAATTGCTCCTTAT
AAAAGGTGACTCTTTATCGAGGGCTCGGTACCCGAGACCTTTGGTTGAGAATGAAGGAACACTTATCACTCCACTACGCCTATATGGATTAAGAGAAACT
AGAAAGCTTTCATAACATGACGAAAGAGAACTATCCTCATGTTATGTGTTTTCAGTAGTTGTCAACTGCTTTCAAGGAGTGTGGTGTAGATAACTTTCAT
GTATTCTTTTGGTCATGGTATATGGTTATTAGAGGAAAATATAGGAGAGGTAGTTTGATATTTAGAACAGGTATATAGCTATAGCTTCATCAGTTCATTT
CGCAGAAGAATATGGGTAATCAATTGCGGTTGCTTTCTCCACCTGATATTACTTCAGGCTAATGAAGTCTGCACACCATATCCGGAAGTCACATGGTTAA
TGTGCTCATATCACATTGTGACTTCAATCCAGATCCTTGACTTTAAAATGCAGTTTCTTATGAATCGTGAGGAAGGAGAGACGGAAGATAAGCGATAGTA
TTTGGTTGAATTGGGAGTACAACTTACTTTATCCTTGTTAAATCACTTCTTAGACAGTAAGAGAGTTTTTTGTTTAATTGGAGTTCAGTTTATTTGAATC
CTTCTCTCCTCCACTAAGATTTGCCGAGTAGAGTTAATTGCTGCTATACTAGTAAGAGGCAGTAGGAATTGGTTGGTTGTCAAGATGCACACAAGTTGAT
CAAACATTGTAATAAAAGGAAGTGGGTGTGGTTTATCATCTAGTATTCAGCTCTTTGAAGGTTAAAAGGGGAAAAAGATGATTATTAATGAGTTTCTTTT
TAATTTAAAGATTGAAATTTGTGAATCAGAGTTATTGCTTGCGATAACCCTAGACTGGAGGGTGCATAGCAGTTTAGATTGTGGTAGTATTGACCACTAA
ACTAAACTTGAGAGAAGAAGAAGAATTGAAAAATAGGGCTTATGTCACAGTTGTTAGCTTGTGAGCTCAACAATACGCACAAGAAGACAGGCTGCAGATA
TTCATTTGGAATATCTCGCTAGGTTCCAGATTTCAGTCTCAACAGTCACTAGGTTCTAAGCGTCTCTATACTTGGGCATTGGACGTTAAAAAAAAACTAT
AAAGAAAAGTTAAAAAACGTTTTAGGAATTAAATTGTGTTTGATTTAATTAATGGTTTTACCGTTGAAGAATGGCAAAAGTCCACATCGGTGGTTAATGA
GATGTTTGGAGTGTGAGTTAGGCCTAAGACCTAATTTCACATGGTATTAGAGTAGGATCAGATGTTAGCTACCTTAACTTTTGAGGTGTGAGTTAGGTTT
AAGACCTAATTTTACACTTACATGGTGTTAGTTACAAATTATATATAATATAAATAATAAAAAAATAATCTTTTCTATTTTATTCTCCAAATATAAAAAA
AAAAAAGTCTATTTTATTCTCCAAATATAAAAAAAAATAGAGAGTAAGATAAAAGATAAACATGTAATGTATTATCAGAAGTTGTTCATACATGTAATGA
CTACTTTTTTACTCCATAGTTAAAAGTAATAAATTGAGTGTCTGCCACCATTACATTGTAGCTTAAGATCATCATATTCGCATCAATTTTTTTTGATTCT
TGGAAAAAAAAAGGTTTCATTCTTTTTGACATTGTTAACTATGATGACATATACTGTATTTCTTTACGCAATTAGCTAAATAACGAATGTATTTGATACG
GAAGGGAAGCATTGTTTTATCAGCCCAGTAGTTTGTCCTATACAACAGCTAAGCGGCTAATAAATTATGTTGTAATACATCGATGATGGCCACGCCATCA
TTTTTGGAGTTTTGTTGACCGGAGTTTCTCTGGGGAAGTTGGATTTGTACCTTTGCTGCTTCAGTGCTGACTGGATTTCTCTATAAATAATAAGCCCCAT
CCATTTGTGAACCACATCTAGCCAATGGAGTTCCCAAACTTTGTCAAAAAGTATGTATTTTGGTTTAGAGAGAGAAGTAGTACTACAGGAGTGTCACCCA
ACTCCCCTACTACTACTGTAGGTTTATCCCTTGAAACTGTTAACACGGTGACACAACCAGCTGAGCTACAGCTGGATGTGGAAGAGAGTAGCCCTGTAGT
TGCTGCTGCTGCTGAAACCAATAATATCGATAAGTCGATGCTATTCATGGCATTCTGTTTAACATCAGGGGTTGAGATAACTCTTAATTTTGTACAGGTT
GGAAACGGGAGCCGTGATCATGATTCGCTTCCTTTGTGTTTCCAGTTGTTGTCATTTGCTATTTTACTTGCTTTCACTTTACTCTTCGTGGGAAGATTTA
TAAAGAGCAATTACCCAGCTGAATCTGAATTGCTAGAGCGGGCAGGTATTTTATTTGCGACTACAGCTTTCTACCATTTCATGACAATGCCCTTTTCTCT
GTTTCTCAAAGGTTGCTCTTGGGGCGTCTATCTATTCTCCTTGCTTGCTATAGCTATATGCAACCATTACTAATACACTCTCGCTCTACTCAATCCTTCC
TCTAAATTTTTCTTATTTGGAAGGGAAGAGAAACGAATCGTGGTCATAGTTTTTTTTTTTTTTTTTATAATAATGAGGAAGGTTTACTTTGGGTTAATAA
GATTGTATAGTTAAAACTATGAGCTAGTGGTTTTCTTGTTATTTCTTACCTTTAATTACGATGTTAACAAATATATATCATCTCTCTCGTGTTTTATAAA
ATTTTAGTTTATTTTTCTTTGCTTTTCGGTTATTAATTGTATCAACAGTGTACACTCCTTAAAACTAAAAGTGGATGTGATTCATCTCTTTTTGTATTTA
TATTTATTATAACTAAAAAATATTCAGTCCAAGTTGGTTGGCCTCTCGGTGGGATATTCTTTAATGGTTCAAAAAGCACAGTTTAACATGAAGCGTGGAG
TTTTTTTTTTTAATGTTTGTTGAATTTAATATAATAATCCCACCAGTAAAGTGAAAAGGCAATGTTATTTTATCTTACAAGGACAAAAATGATAATTTAA
AAAAAAAAATTCTAGTCAAGTAAAATTCATCAATAGCAATAAAAATGAATATGAAAATCGATATAAAGGTTAGACGAGTCTCCCGAAAAATCCATTGATA
CTTGCACATGATTTCTTGTTAAATACAGTGAAATAAAATCATAGAAGGCACCACGAAAACTAGCCGTACTAGTTAGCCCATTGAATAGAAAGGCATTGCA
AAATGCCTTAAAATAGCATGTGAAATGCACTTGCTACAAGACAAAATTAATTCGGTCGGTGTGCAGGAAAATGTTACTTGTTCATTTGCAACAAAATAGC
TACAAGGTTGAATAAATTGAACGAAGAAAAAAATATTTTAAAAGCGTTCAAATATATGATGTTTTTTTTTGACAACAAACAATGACATAAAACTTGAGAA
TAATTTTATAAAAGCTAAATACGACGCACTATTTCACTTTGAGATTGACGTTTGCAAAATTAAATTCAAAATAGGATAAGGGATCTAAAGGCCACCACCA
TATACTTCTTCGCCGCGGGTATCCGTAGGTAGCTTTGCTATGTATGTTTAATGTTCACGCTGGCGAGCTTCCCCACGGCTGCGCCGTCGCCTGCGTCGAA
CTCATGCTGCCGCCACCAGCCCCAATTTCAAACCGTCAAAGTTAGTCCAAGACCCAACAAATTACGCTCGTTTGCAACTACCTCCGTTTCAAAATCGGCA
GGTTCAATTTGCACCCCAACACCTGAGGAAGATTCTATAACTGCAAAATCAACTTTGAAGAATCAGCTCAAGAACCCATTAACGCTATCCGAAGAGATCA
CGCAACTATGCGAAACCAAAAGTTTGTCGGAAGTTTTCCGTACATTTCAAGAATACCTCGAAAACGCCTTCTACCACTCGTCGGAAAAATCCGAGGCCTT
AGGCGTACTCTTACAAGCATGTGGTAAACAGAAGGACATTGAAACGGGTCGTAAAGTCCATGAAATGGTTACTTCGTTGACCCGATCGAAAGATGACGTT
ATACTCTGTACGCGGCTCATCACGATGTACTCCATGTGTGGGTATCCTTCTGATTCTCGCTCTGTTTTCCATCAATTACGAAGCAAGAAACTGTACCAAT
GGAATGTTCTTATGAGTGGGTACACAAAGAATGAACTTTGGGTTGCTGTTATTTGTTTGTTTATTGAGTTGATGACTTCAACCCAGGAAAAGCCAGACAA
TTTTACCTTTCCTTTGGTTATCAAGGCTTGTGGAGGGGTTCTTGATGTGGGTATGGGGAAAGCTATTCATGGGATGGCATCAAAGATGGGTTTGGTTGGC
GATGTCTTTGTAAGCAATGCGTTAATTTCCATGTATGGGAAGTTTGGTCTTGCTGAGGAAGCTATGAAAGTGTTTGAGTATATGCCTGAGAGGAATCTGG
TTTCGTGGAACTCCATGATTTCTGTGTTCTCAGCGAATGGATATATTGAACAAAGTTTTGATCTTTTCAGAAATATATTTACAGGGGATGAAGTTCTTGT
TCCAGACACGACTACCATGGTTATTATGCTGCCAATTTGTGCAGCAGCAGAAGAAGTGGAATTTGGGAAGATTATTCATGATTTAGCTGTAAAGCTAGGA
TTATCTGACGAGTTAACAGTGAATAATTCTTTAGTGGATATGTATTGCAAAGTTGGATACCTTTCTGATGCACAAATTCTGTTTGAGAAAAATGAGAGCA
AAAGTGCGGTCTCTTGGAACTCCATTATCGGGGGTTATTCAAGAGAAGGAGATGATAGAGGAACATTTCATCTTATGAGAAGGATGCAAAGTACTGAGGA
GTACATGAAGGCGAATGAGGTTACTCTACTGAATGTTTTGTCCGTTTGCCTAGAGGAGTCAGAGCAGTTGATAGTGAAAGAACTGCATGGCTACTCGCTT
AGAAATGGTCTTGAATACCATGAGTTGTTAACAAATGCTTTTATAGCTGCCTATGCGAACTGTGGATTGCTCAGATATGCGGAGCTTGTATTCCACGGAG
TGGCGAACAAGACAGTAAGCTCTTGGAATGCACTGATAAGAGGCTATGCTCAGAATGAGGATCCATCTAAGGCTTTGACTCTGTCCTCTAAAATGATGAA
GTCTGGCTTGCGTCCTGACTGGTTCACTATTGGTAGCCTTCTGTTTGCTTGTTCCCACTTAAAACTGCTACATTGTGGTACACTAGTTCACGGTTTTGTA
CTTAGAAATAGTCTAGAAACAGATATGTCTACACTAGTTTCCCTAGTTTCATTCTACATGACTTGTGGAAAACCAGAGCTAGCACAACGTCTGTTTGACA
GGATAGAAGATAAAAATGTGGTATCCTGGAACGTAATGATAGCTGGTTATTTGCAGAATGCACTACCAGATAAAGCCTTTTGTCTGCTTCGTGATATGGT
ATCTCATAGATTTCAACCTGATGAAATTTCTGTGACAAGTGTTTTAGGGGCTTGTTCAACATTGTCTGCTGTCAGGCTGGGGAAAGAAGTTCATTGCTTT
GCACTGAAATCCAACCTTATAGAGGATAGTTTTGTCCATTGCTCAATCATAGACATGTATGCAAAATCTGGATTCTTAGGAATGTCCAAGTATGTTTTTG
ACTATATTCCACTCAAAGATATAGCATCATGGACAGCTATGATTACTGGATATGCAGTTCATGGACTTGGAATGGAGGCCATCGAGCTATTTCAGGAAAT
GCAGAAATCGGGCTTCATCCCAGCCAGCTTGACATATGTCTCTATTTTAATGGCATGTAACCATGCGGGGCTCATTGAAGAAGGTCGGCAATATGTTAAA
GAGATGCAGACATTGCATGGTCTCAAACCTGAATTGGAGCATTATGCATGTGTGATTGACATGCTGGCTCGTGCTGGACAGTTTGATGATGCCCTAAATC
TCATGGCTGAGATGCCTATGCAGCCAGATTCTCAAATTTGGTGTTCGTTGCTCAATTCATGTATAGTTCACGCCCAGTCAAATCTTGGGATGAAATGCGC
TAACAAGTTACTGGAATTGGAACCAAAGAGAGCAGAAATCTATGTTTTAGTATCCAATTTTTTTGCTAGATATGGGGACTGGGACTCTGTTAGACAGGTG
AGGGACAAGATGAAGGAATTAGGCTTGCAAAAAGAAATTGGTTGCAGTCAGATTGAAATAGGAGGAAAAAACTATAACTTTGCTGTTGGCAATATGTTTT
CCAAGCCATAAAAGCTCTAGTGAAGTTTGATGTGACCAAACGGAAACAAATGAATTGGTTAGTACCTGAGATGATTTGGTGCTTCAGCATTTAAGTGTAG
AGGATAAAGAACAAAATCGAGGCAGCTACAACAAACTGTTTAGAATCACTTATGACTTGACTCACGTTCTTCTCGTTGATGACTCGAAATCTTTCCTCGG
GGAAAGAAGTTCACAAATTACGTCAATGTGCTTTAAGTTAGTGATGGCAGTGATCGTTAAGGAGATTATCACAAGGAGTTGGAATGAGAGGCACTCTCTC
ACATTTTTCTAAGATGGTTTCTCTGGGTACATAAATGAGTCGATTTCACCTGTTTTTGTTAGCCACCCTAATCGTTAGGATGTATATATCTAGTGATATC
ATATTACTTATACTCTAGTTTGGCTTGTGTTTTGATATTCCTTCTTAGCAATGGGTGCTTTATTTCAAGAATGATTCTTCCATGATGATATTTAAGTTTT
CAAAGAATCATCTGAAACTCAAGTCATTTCTCAAAATAAGATGAGAATGACGAGGTTGATATACCAAGAACCAAGAGTTCCATGGAAGTCTTATTCACTC
TTCTCTCGTGATACTACTTTATCTGTCAGCCGAAGTATTATCGGTTTAATCATTATAATTTCACACAAAAAAAGTTATAGAAAATCACTTACAAACAAGA
TAACAAATCAAATAAAATGAGTTGATAGATTGCATCTTGCTCAAAAATACTATGAATGCCTAGTAGAATTTCAAAACCTCTAAAGGATTGAGAAATAAAA
GTATGAAATTAAATTTAAGTCAAGGACTTTATATGTCAAATAATGTAATATAATTATGTTCTTACATCTGGTTATAGTTAACCCATTAAAGAAAACTCAA
CCAAACAAGATAATCTCATATAAAAAAGAATGAATCAAGATCATTATAGAAATCGTTATAAATAAAAGGAAAAGGATAAATATATTTCTAAATTATCATA
AATAATATACATTCAAATGAAAGACTCAATAGGGCACGTGTGCAATCTTATTTTTATTTTTAATTAATTTTGAACTATTTTTATTTATAATTAATACTTC
TTGTCGTCAAAAAAAAATCTTGCGGTGCCTTTCACTCGATCGTCTTGCTAGTTGCTACTTGGTAACTGCTATTATTTTGAGGTTTTTCCTATCCATGCTT
TCTGAATTTAAGAACGCAAAGTGCCTCTAAGCTCTACGCATCTGAAATGCCACTATATAACTCAACCTTAATTCTGGCTTAGCTGCATTTGAAAATTGGC
GGAGCTTTCATAGGTAAAATGGATTCTTCGGCGGCAAATTCTGTGTCGAACTCCCCTATATCCTCTGCTCCTCAATCTCCCCGGCCTCCGCCTCCGTCGC
AACCGCATCAGGTTTCTCTCGCTTATCTAATTTAACCGTTCATTCATTTTTTCCCTCTTTTTTATGGGTTACCTTTTTTTTTTTCTGTAGGAGGTCTCAA
ACCTCACTGTTCTTGAAGCTGTGAAGAAGGAGGAAGTGATTGAAGATCCTCTTGAGTAAGTATATGTCTAGGCTTTCTTGTATAACTGCTTTGTGATTTA
TTTTTATTTGAAAAATAATAATTGGGGTTGAAGTGTCTGCTCGGCCTTCTGTTTGATTTTTAAATTTATTGTATAATTGGTGATTTTATGGTTCTAAATG
CAATTGGCAGGATTTAAGAGATTTCTTGTTGTTAATTCCTTCATATAAGGATGAATAGACTCACAAAGAATTGTTTAACAGCCTCTCTTGCTTCACTAGG
TAGGGGTAAGACTATGTATCCTTCACGAACCCCACAAGTGGGATTACATTGGGTATTTATTGTTGTTGTAAAATGGGAAATAAGATATACTCATGGCTGA
TAGTCATGTGGCATTTATATACTCATGGCTGATAATAATGTGGCATTCTTTTGTGAGTTACTTATCACCTATAAACATTGCCCAATGATGGTAAGATACA
GAGATGGGGCACAACAAGAATATTATTGACGTGAAAGTTTGGATTCAGCTGGTAGGTATGATGATAAAGGGTATGTATCATAACAGGCTTTCAATAATGA
TTAGTTTTTATGGAAGGTGTTGGATAAATTTGATTGATTTGGAGCCCAACTGAAGTTATGTTGGTCTTCTTGTAAAGATAGCATAGAGCTTATCTGGCAT
CATGTGCGACAGCCAGATTCGAAAAAGTAAGATGCTTAATTGATTCTCTTGTAAGGTAGTAGTTGAAAAACAAAATCTGTTGGCTACTCTATTATCTGCT
CCCAAGTTAATGTCCTACGTGCAACGTGAATTCGATGTTAAAAACTACAATTTTTTGGTGAATCCTCAGAATACATGCTCAATATTTAATGGCAGTAGAT
TAGTACTTCAGCATTTAACTGAAATAGCAACAGCTTTCTGTAATGGCATCTGTTAAGTGCATGCTTATTAGAGAATATCTTGAATTATCCACTTTAGCTA
AATTAGTAAGCTCAAAAATATTTCTATTTTTTATGAATCAAATAATGAATAACTATGCATTATTATTTCCACATGCCTAGATTTGCAGGGCCTACCAGTT
TGTTAGTAGTACAGGGATAAAGAGGTAAAAATAGTCGCACTAATCCTGTACGTTAGTGGTATCATCTTATGTTAAATTTGTATAGCATATTTGAAATGTT
TACAGGACTTTAGGCTCTCCACTACTTGAAAAGTTATGCTAAAGCTTTCTGAAAGTTAAATTATACCTAACAAGGTGTCTTGACCAATCGATGGATTCAG
GTGTCACGTTGAGGGTCTCAACATGCTTACCAAAAAGTATAGATTCAAGTGCTCGAGAATATTATGGATTAGGCAGGGCAAAGAAATAAAAGCTTTGATA
GGAGAAGAATGTGAAACCCCTCCCACGTGGGATTTTTTATGGAATTGTTGATTGCTTTATATTGCTTTGAGTCTTCTGCTATTTAAAAACTTAACCGAAA
CTGTTAATGGGAGCAATGATGGAAATTAGCACATGGTTTGGAGTTTGGACTACTAACTAGCCAAGGTTGTTACAAAAGTCTGCTTTTGAATTAAATTGAT
ACAAAATGCTTTTCTATCTCCTAGTTCATAATCTTTCACTATGTATGGAGAAAGATTATCTTACTTCCATTATTGTTGTATCATTAGAGGTAATAAAATT
TCCTTTGATTGAAATATACTTTATACAGTATTCATTATTTCTATAATATTGATACTACTTCAAGGTCAAAATCTTAATCCCATCAAAAACCAGATCTACC
TTTATTTTATACCCCAGTTTTCTCGTAACCATAGTAATATCAATTTTGTCTTTCATGTCTATGGCTAATCAAACTAAAATATTTTATTTGTGAGGAGTTC
CTGAGAACAACTTGTTGTGTCTCCATTATTGTATAGAAATTATAAGTTTTCATGTTAGGCCATCCCTAGCTGGACATCCTTTTAACAATAAAAACATTAT
CTTTTTCATGATCTGGTAGCATATCTAAGGGATTTTTTGGTATGCTTTTATCAAGTTATTAGCTGGCCGTGATGGTTAATCTTAAGTCTATAGGGCAAAT
AAATGGGAAAAAAAAAGAAAAAACTTAAGTCTATGGTACTGATAAAGGGAAAAAAGACAAAAGCAAGTCTATTTATCCTGCTACAGCACTTCTTTTAAGT
TCTGCTCAAGTTCTCTATCTATATGAATGTAATCTGAACATGATGGAGGTCCTAACTCTCTATTTTCTTTCCATGCTGTGATGTAGTGATATGGAGACTG
AACAGGATGAGAAGTTCAAGAGGTATGAAGTTGAGGCTAGGAGATACTTAATGTCCAAGTACTTTTCAGACAAGACTATTTTTGGAGGTAAATAGTCCGA
GAAAGCACTATAATAAGGTCAATTTTTCTGATTATTAAATCAGCATGGTTGTTTTCTCTTCTTGTTGCAAGTGAATTTTTATGATTATTACATTGAATTG
CATTTATTTGAGCGATATTACTTTGAACATTAACATGTTTTAGAGATATATCGGTCTATTGGTTCCCCCACCATCCATTGCCTAATCTAAGTATCACTTT
TAAGTTTATGTGATATGGAGATTCGCATGTTTATTGCAGTGCTTCACAATTATGTCCTTGTGTCCTTTGATGCATGTGATTTTGAGAAGCAACTAGTGTA
AACTCACCTAAACAAAATTTAAGGGCTTTTAACAATGACAGGTTTTTTTCCTTTAAAATATAAAGCGAAATCATTGGAAGAGTCTAGTGGTTTACCAGGA
CATCTTTTGATTACTTTAGTTGTGCCATTCCCTATCATCTGCTATTTAGCATAGCCGAGCTACAAGTTACTGGGACACTGATTAGACTGTGTACACAATC
AACGAGTGGGAGTAGAAAAGTAAAAGTCGGCATATTTGAATTACCAATAAGCAGATTAACTGAGAGGTAGTAATCTTTGTTCGAGATATCATGTTTCCAC
AATTAAGGCAGACCAAATGCTTATCTCTCACTTGATTACTGAATCAATCTCTTCTTTTTGATTAGCTAACTCTAACCTATCTGTGACATCTATAAATGTG
TTATTGCAAACTCAGAACTGGCATGTCTGGATAACCTTTTTCCTATAGGTATGAGTCGTGAATGTGCTACATCGTTTGAGTTAGAAGAGGCTATTATCAC
TCCGCATGCATCAGGAAAAGGTTATTACTATGTCGTATATTGTTGGGTTGCAATTGTATCCCTATGAATTTCTTAGGTCAATTGCAGTTGTGGCATTGAT
TGCTATGAATTGTTTCTGTTGAAACCATTGAATAGTTTTCCATCCCGGAAGTAGCAACATGATTTACTTTTTGACATGAATCAACTTCAATGAAAATTGT
TTGCAGGAAACATCTTTGATGTTAAAATGGGTATAAATGGAGAGCAAGTAAAAGTAAGTAGGTGCGTAAATTTTTTTTTACCACATAAATGAAGTATATA
TACAGCATGTTAATTGAAATGTTATGTATTGTGTTGTTGCCTCAAAATCTCCTTTTCTGGTCAGGTTTCCTGGGTACCAGTCTTACGCAGATCCTGCTAA
TTTTGATGACGATAACAGTAGCGACTCAGTCTCTACAATGGAAACTCCATCCCAGAGTACTGCTAATGGGCATCAACCTTCCCAATCTTGAAATTTCTTT
CAATCGATACCGTCCTCTTGATCAGTAGAAATCTCCTGGACTAGGGTTAAATCTGAAAATTTTCAAGTAAATCAACTAGCGACTTGTATAATTTCTAGAA
CTATATGTGAAAAAAAGGTAAGTAACTTACTTTGGATTGGGCATGGTTGTAGGTGTTATTATTGTTGTTGTATGCAAGGACAAAGATAGCATTCGGAGCT
CTGGTTTTTCATGATACAAGTGAGGTTTGGAAACATTGGAGAATGTTTTTCGGGAAAATAAGTGAGCTTTTTACTTAATTTTGTGTTACTTCAAAAGCTT
TTGTGTATAACTTAACAAAAATAGTAACCTAAAGCTAACTTGATCATTTTGAAAGAATTTGTGTTTCTAGAGAAAAATGTTCTTACAAATATAAGGGGAC
CATCTTACATACGTAGGAAATAAAGGAAATGAGCTTTTTGTTGATCTTCATATTTTTCAAAAAAAAAACAAGCTAAACAACCAATTTGAACATGTATTAT
TCCATATCATTGATTTTCAACAATCAAACTACAAATTCAAGAACAATTTACAAGTTGCCAAACTTATATTAATAAAATACATCTCACTGGACGAGACAGA
TTCTGCACTTATGGACGTTTTAGCCAACAACAAGCAAGCTCCATTTAAAATTTGCCCATGATCTGTAATTTAACGAATTCACTCTCTTACAAATATAAAC
AAATTGAGAGTTCCTGGTTGTGTATCATAACAGTGATATGGGATATGATGTACCATTGGCTCCAGAACAAAACTTATCCAAGCAAATGCCATAGAGCTTC
TCTCCAACCTCCCTGGCATTTGGGTGGTGGTGGTGGTCTATTTGCAAGCATTCCAGTGCCAGCAAGAACTCTGATTTTGCCCTGCCAAGTTGTGAAGCAA
CTGAAACTATAACGATGAACAAAACCTACAATGTGCCGAAAAGGGAAAGAGTTAAATTCCATGCACCAATGAGGACATACAATCTTTAGATCACATTCAA
AAAATCATTGATTTGCAGCAAATAGTAATGTGGTAATAAAAGCATAGTATAGTACATGGAACTGAATAAACGAAATAGGCGTGATATCCCGATATCTACA
AAATACAAACACAGCTTTAAATAGAAACACAGCAAAAATACATGCATAAATTGAACTAGTGCAAGACTTATTCTTATGTAGCCATCCACAGCCTCATTAA
TTGACATGCTCAGATCAGAAACTATCATGATATATTCACAAGCTTGCTCATACATGCTCTCAGGTCCAACACACTTAGCTTCTATTAAGACTTCTCAAAT
ATTTGGAAAAATCTGAATTTCCTAACAAGTATCCGATTTTAGTCTTCCAAATCGATTGCTATTTTACTCGTGCTCAATTTTAAGCAGGGATTTTCACCAC
CAATGACTCATTGGTCCTCAATTTCCAACTATTCCTGTCTTGAGAGACAACTGAGAATCCATCATCAAAACAAGCAAGAATATCCCATCTTAAACATCTG
TAGAAAGAGAGAACAGAGCCAATACCCTTGATAGCCCCTCAAACTTGGGACAATTTACATGTTAAACAATCCAACTTAACAAGTGACCAAGCAGATACTT
CAAATCAACAAAACTATCTCTTAAACACATAGGTCAGCAAAAACAGACGCATGAAAACTACTTCCTGATGAGGTGTCAAAGAACGAAATCCTTTCTATCC
CACCATCTTGATGGTATCTAAAAAGATAAGGTGCTTGTTTTGGATTTCCTTAATTGAGGGTTCTTAGTTCCATTTTGTGTCAATCTATCTATCTTTTATT
GGTGTTTGTTTTTTTTGGAATTTGGTAGCTTATTTATTGGTGTTCTTAGATTTAGAGTTTATTTACATTTCTACATTGTAACATTTATATACATTCTAAA
TAGATGGTAGTATAGGAAGTATTTAATTCAATCCATTTAGAATCATTTGGATAGCGAATTTGTATGTGACCGCTATTACCCAAACGGATCTGGGTGAAAA
TTCTCCGCGCAGAAAAAAATACTCACCCTTTGCATCTTATCTCTTTTTCCTTTTGTTTCCAGACAGTGTACTATCACCTTCACCATCACCGAAAAAGAGT
TTCCTTGAGACGCATCTAATGGCGCTAGCCTATCACTTCTTAGTTTTTTCTCTTCTATTCTTTTTGTCACAAGAAAATTTTAGAGAAATGGAGGAAGATT
TTTTAGAAGAGAAATCAAAAGTATAGCTTTTCACACGCTCAAATGTAAGTTTAAACACTATTTTCTATGTCAACATGAGGTATGAGGTGCTCATCTGACA
TACTCTTGTCAAAGAGGGGTGGGTGTCTATCAGGTCATTAGTTAAGTTGGATCATCAAGCAGACAAAATGTTTTTTAGGGGCTATTTCCCTCCGAAGAAA
GTATTTCTTCATGGTTCAAACATAAGAGCTACAGAGACTGATTGATGCATATCAATGAGTCTTAATACCTATGAGCTTTATACAATCTATAAGGTGTAAA
GCTAATCTTACAACGAAAAATCAAATTACAAAGACAATTCCTTCTTTCCCTGAACTTGCTTCATATGTAAAGTTAATATCTATGAGCTTTATACAATCTA
TAAGGTGTAAAGTTAATCTTCAAATTAATAACAATGCCTTCTTTTTCGGAACTTGCATCATATGTAGAGTTTCAAAGGCAATAAGACATCCACATAGGTC
TGACATCAAAATCATCTAGTATATTAACAATCTTAATTCAAGAAAACCAAAACCAAAAAGAACTTCCAACATCATATCAACAAAGAGCAGGTCGAGTGCT
CCCAGGCTTGATATACCTTCTACATAAATGCAAAAAATATACCTTCAATCAACTTGATCAAGTTCAAGTGTGTGAATTGTCTGGACCCTTCTCCTCCTCT
CATAGCCATGATCATCTGTGGGCAACTCGTACCGACAAACTGGGCAGGTATTCCTAATCCCAAGCCAAGGCAGAATACAGTCACCATGATACCTATGAGC
ACATGGTAACTGTCTAACCTTTTCTCCTAAATTCAACTCATCCTTGCAGATAGCACAAGTAGCATTGTTATTTTCTAAATCACCTTTACTCACAGCCACA
GTTGGAAGGTCTCTAACAACAGTCATGGAAGCTGGTGGTCTTCCAAGAAAACCATGATCGCCCTCTGCAAACTGTCCAAACAATAGCTCATACTCAGTAG
TGTAATTGTAATCGTCTCGATCCACATGACGACCGAAATCGAATTCATCATTTGTAATTTCCGGGTCTGGCTCCAAATTCTGAACATTCAACAGAAACTC
CCACTCCAAATTTTCCAACTCTCTTGCTCTATCCTCTGGAGCAGGAGATTCAGATACCTCCTCAACATCTAAGAACATGCTTAGAATCTCTCTCTCATCA
ACTCTTCCATCAATTTCTTCCCACTCAAAGTCCTCATTCACATCCCTATGATCCTCCAACTGAAAGGAACCCCAACACAGCCGAAGACTCGGGTCATCAC
TCTCATTGTCGCAAATATTCTCATTTTCGTCTTCGCCATCAACTTCTTCCAGATTGAACAATCTGCCTGAAACGCAGTTATCATCAGGGTCCCAGTCAGA
TTCATAATCCACAACCCTCAACCCACTGACAAACTGTTCAGGGCCATCACAATCTTCAATATGGAACCCAGAATTATCAGAATCCCCACGAAAACCTAAC
CCTAGCCCAAAATCAACGTCTAAGCTACTCATTCCCGTAAACTCATTCCCTCCAATCAAACCAAAATCGGTCTCCAATACCGGGTCCGCATGCAGCAAAT
CAGGGTTGGAAACCACACGGATCAAAGATTGAGATTGCTCAACCCGTTGCTGAAACATATCCATAACAAAGTTTACTTGGTTCTCGCGGTCCATGACGGT
GACAACCGAATCAGTTTCTGAAACATCGTCGCTTAATGCCAAACCAGTCCTCCCACGAGAATACGAAGAGATTTGGGAACGGGAAGGGAAATCGGAGAGA
TCTGAGGGATCGTAAACATCGAAGTCACCGAAACTGAGAGGCCAGTAAGGAGAAGAGTCGAGGTCCTCTACGACGCCGTTTTCATGTTCGATAACATCGT
CTTCGCCGTCGTTGAGGAAATTAAGCAGCGAAATGGAAACCTGAGCCATCGGTGAAGCGGAGAAAATACGTTTTTTTTTGTGTGTGTGAAGAAGTGCGTT
TTGTGGCTTTTGGTTTCCTTGTATTGATGGTTTTCTGGTTAGGTGTGTGCGTGTATTGAGTAAGCAGTTGATTTTCTTGGCGTGTGAAATTACTCTATTA
AACACATCAAAAATACCCGTCCTTTCCACTCTGTTTGAAAATTGGAGTGTTTGGTTTTAAATGGTTTGGGAAAAATTACAAATAGTACTAGTTGTTATAA
AATCAAACTCATAAGAATATAATCATAAAGAGAAGAAGACAAGAGAAGTAGATAGTAGAAGAGGAATTTTCTTCTTATTCAAGTGTCTCATCTGTATCTG
TTACAATAGTGAATGAACAACCCTATTTATAGAGTGAGAAATCACTCCAAAGCTCACCATATTAAGTATCATAATAAATAGATACATTCTTATCCAAAAA
GGTTCATGTAACCTAGTGAATATGAATGGTTGTTCATGTACCAACCTTATGGACTATCCACTTAATTCAATGTATTTATAACACTAGTGACATTTAATAT
CTTAACTATTTTGGAAAACAAAGTAAAATTAGATAAATTTAATAATTTAAAATTATAAATTAAATATTCATAAACTACTCAAAAAATCAAAATGTAGATC
ATAGTTATTACTCAATAGATATTTGCATTTAATCATGTAAGCAATTATATAGTTATTTCATCATAAAAGAATTTAAATATGTATATTAACTATCTGAGAA
TTGCACTATTCAAATCATTAAAAAATGCCCTTTTGAAAAATAATCCCTTTATTATAAATTAACCCACAGTGCCAGCTCAATGATACAATGGCGTGAAACC
TTAATATTTTTAAGGCTTAATTTTTTAATTAATATAAATTACGAAAGACATAATATCACATACCATCTCAAAAATAGCCATCCACACCTTTTGATATTTT
TAAGGCTAACTTTCTCGCACTAATAATAATTGTTGAACATAATAACGGGGCAATGGGTTGTTGTTGCATTGGACAATTTTTATTATTATTTTTTTAATAA
AAAAATATTGGACAATTACTACCAAGATTGTAGCAACTTTACGGTGTAAGTGCATACTTATTTGCATATTAGTGAGGATTATCAGATTCAACTCTCAAGT
CTTGTCAATTGTTTCCACATTGTTTTTGCTTAAATAGATACAAGAACTACCACAAACCTAATATTATACATCAAAAAACCTCTCTATAATAAGCAAGTTG
CCCAGTCATTTCAGTCACAAAGGCATCATCGGTCAGCTTTCACCTTTTTCTTTAAGGAATCAAACAAGGATGTATTTGGTTTGTTATTTGATGACTTTGC
AAATGGATTAGAGGGGCGTTGTGCTGTCACCTTGATGGCTTCTTCATTCTGATCTTGTGCATCTTCCACTCCATTTGCATTTTTCACTTCGTCTTCTTTT
CTTGCATTATTCACTTCATCCACCTTGTCCTTTTCATCCCTCACTTTCTTAGCATTCTTCATATCAAATGCATTTTTGAATTCCCTTGCCATTTCCAATT
TTCTGGCTTTAGCATTTTCTGCCTCTACATTTACATCCTTGATTGGCTCCTCTAGAGGCCGTTTTTTCGTCTGACAAGGAGCTAAGGAATTTAGGGATGG
AGAATCCTGTGATTCCAATCTTTTGCTGCTTTCAACCATAACATGGGACTTGGTTAATGCAGCATGTGCATTAAAGGAGTTATCACCTTTCAACTCAGTA
GATGCAGAAATTTTGCCAACAGTTGTTTCTCTATTCATTCTTTCCTGTAGAAATACAATGGAACATGAATAACACGTGAAGTAAATAATATGACAGTCAT
ATGCTTCCATGGAGGTCACAGTCCCTACCTCCAATAGGGCATTAAAGCGCTCTGCCAAATTTGGCAGTTTCAGTGCTGTGACAAGCTTTATAGCACCTTT
GACTGATTTTTCCAAAGACAGAAGCTTTACGAGCTCAGTAGCTCTCACTAGCTTATCTCCTGATAAGAGAGGGGAAAGAAACCAATATCAAAATTTAAGA
AAACAGAAAAGAGAAGTAGGAAACTGAAGCATTCCAAACTTGCTGCATCCAACTTTGCAGAAAACTGACCATTGCAGCAGGACGCAATGAGCCTCAGGAT
GCAACGGTCAAGAGCAGCTTCAGTATTAAAAGCCTCATCATCAAGCAAACTGGTGTCCTCACCAGCAGCTTCCATTTCTTCAATTGTGCTCTGAATCTGA
ATATAAATCCAGCAAACAGCATATCAACATGAATTTTCACTGCTTTTTGAAGCTGCAATGAAATCTTAGTATACACATACCCGGTGGAGATGCGTGTTAT
TCATTATAAATTCATTCTCCAGGATTTCTGATCCAAGGTCAGATGAAGCAAGAGGGAATGAAAGATCCAACAGTGAGAGAATAGGTTTAGGAGTAGCCTG
AAAATACAACCAGAGGATTAGAAAGGTGTGGTCATATATATGCAAGAAACACAACAAGAAAGCATCATACCTCTGGAAAGGAGTCGGGAGATTTGCAAAT
GACACAGAACAGCTTGCTTGTGTTTAACCCAACAACCCAATAGTTTTCTTCTGACTTCTTCAATTTGCTGGCACTGAAATTTCTAATTTGTAAATGAACA
AGATCTATTACTCCAAAGCAGTTAGTGGAAAAATAGGGAGGTTATTATACCTGAAAAGTGGAAGCCAACTCCCACCATATTGATTATTAAAGACCCTTAG
CACACCCTACATTTGCAATTAAACAACTGACATTGATGAAGCAATCTTAACAAAAATAATGGCCTCAGAATTAATGCTCAATGCTTTTCTCACCGTTGAG
TCGAAAGAACTGAGATATCCCTCTTCACTAAAACCAAACCATGACAAACAGGAACCAGGAGTCAATGGAAGTCTTCCTCGGCGAGGTTGTGTTCCAGTAC
GAATGTTGAAGACTCTAAATTCAAGAATCTGTATGGATTTTTAAAAAGTTCTATCATCAATAAACCAGCTCACCTCTTCTCCAATCGTCATCAATAGATC
AGTCCAAATAATACTTGCATATATTAAGTTCAACTAGAAAATCCAAGTTCAATGGAAGTGAAGACAAACAGGCACTATATAGCCTTGTTGAAATAACATC
AAACAAAAGATATTAACAACATGACATGATGATGGACTATACCTGTTCGTTCGAGGGAAGAGGGGGAGATGCATGTGTGACAACAGCAAGTTCATCCTTA
AAGCCTGCTGCAGTAACCACTGGTCCATCAAGGGAAAGAATATGCCTCTTGTATTTCAATCCAAATAAAGAAACAGAACTGTCTCAGATATCATTTCCAG
AATAATCAAAAGATCTGTTACGACATTTGATATACTTCATCTATATCAAGATGATTGTCTTAAGTCTATTTCAGGTAATGCTAAAATAATGACCATTTTT
CATAACTTATATAAATAATCAAATGGTATTAACAAATCAAAACCAATCCATTATACAAACTGCAAAAAACTTTCAAGAAGTAATACAAATTCAAGCTGAA
CCTCCATTAACTCTATTACAAACAAATGTTACTTTCTTAAAATTGCATGAAATCAAACAAAACAGTTAATTTGAAGCAAAGGGAGATTATTATTGACACA
AATGGAAGCAACTTAAAAAAAATCTCCAGGAAACAATATCTGAATATATATACCTGCAGGCCACCCTCTGTGAAGATGCGAAGAAAATTGCAACTAGTTA
TGGCAGCTACCCAGCCAGTTCCTAGTGCAACTGCTCTTACTTCTTCCTCTTCAAATCGCATTGACCACTAATGTTGCATAAGGAAATCAGGGTAAGTCAC
TGAAGTTATAAGTTTCATAACATTTCCAAAACATTTTGGCATACACATACTCCTGATATACACATACGGAATGATAGTAAATCACTAACCTCACTGTTAT
TTGCCCAGGTACCGAAAGGTCGATACATGAGTGTACTCATATTCTTTTCACCTTTGCATGGATTTGCAAATACACTTCCATTTTCATTTAACGAAGCCAT
CGTGAAGCCAAAATAATCAGTCATTGCAGGGACTCGGGGACCACTGCTTGTGTCATGAAAATCAATCTGCATTGAAGTTGTCATGTTAGCTGAATAACTA
ATTCATATATAGATCTATAAAAGATTGGATAAATTCTCCTCTCAACATAGTATGCACCAAAATTTACTAGCTGTTTTCCCCTTATTAGTTTTGTTGACGA
ATTGATGATTACAGATTCTAGCCGTGACAATTAAAGGACAACACTTGTGATTGAAGATGGTTGTGGAAACAAACACAAAGTTCAATTTTGTATAATAAGA
ACAAAAATAAATAATGAGGGTATAGTTTTAGGATAGAAAAACAGACAGACAGACACAAAAAACAAAACAAGCAAACAAGCCACAATACCTCTATGTGAGA
GTATCCTTCATGCTCCATCGTGGTTATACTGCCAAGCATGCTGTAACATAGAAAACGCCTTTTTCCTGGCAGCTGCGGAGTTGCACCTGGCTGAATAGCT
TCTTGCATTTTTGGCCCTGTAGAAAGTGGCACATCCTTGAGCTTATTTCTTTTATTATCTGAACCATCCCTGTGACCATGAGGAGCCTTCTTACGAGGTT
CAACTTTTGGAAGTAACTCCAACTCTTCATTAGTGTCCTCTTCCCAATCATCAGTATAACTATGGTGTTTGTGTAATCTTTTTCTGCTAAATGGTTCAGA
TTCATCTTGACTATCTTCTCCAAGATCACTTAAACTACCAGATACACTTGGGTTTTCTTCCTCTTCATCATAGAAAAGAAGACCATGACCACTTTTAGAA
CTTAAACCAGGAATATCTTCTGTGGGAGATCTCATTGAAGAAGGTACAGCTGATTCCCAAACACCATACTTTCCCATGATGTCAATTACTGCCAATGCGT
TGCCAGTTGGTTTCCACGCCATACAAGTTATCCTGTTATCAAATTTCTGCCGATCAATATCTTGTTTCTTATCAACATCCCATATCAAAACCTGTCTATC
TAGTCCAGAAGTAGCCATGTACTTTCCATTTGGTGACCAAGACAAAAAGCAAATGGGTTGTACATGATCACCTCTAAGAGAAAACAGTTTTTCTGCAGTG
TCTCTGTCGTACATCACCACATCATTTTTCAAGCCAGGAACAGCTAATAGTTCCCCATCAGGACTCCAGCTAACTATATTTGTAGAAGAAAAATCAGAAC
CAATGACAGGAGCTATTCCTTTTAAGACATGAATTGTGTTCCCAGACTGGAGTTCCCAGAGCATAACAGTCCCTATTGAATCAACTGAAGCCAGGTATTC
ACTTTTGGGATCAAAAGCTATGCCAGTGATGGATCCTCGATGTCCTTTAAGAACTCTTGCAATCGAGCCATCAATGGTATTTATAAGTTTGATGCCTTCA
TCATCACCACCAGCTGCCAGCATAGTTCCGGATTTATTGAATGCAAGCGCCCGTATTGGCAATGTAAATCTAGTAATGTTTGTATCGAACTCCCAAGCTG
ATGCAAGATCAAGACAAAAAACAAATCAAATGATGATCACAATCAGCAAATCGATGAGCAGCTGGACTAGAAAAAACAAATATTCCAAATTTCTACAACT
ATTCATGTATATGCCTCCATTTCGATCAATATGAGTCTTCCTGATTCGAGACATTTTGAACTGTTTGATATTATTTCATATATAATCCTATTTCAGAACT
TCCAAGAATTCAAATTCATTCAACTTTTAAACCTTGATGTGATGTATTCCCAATCAAACTAAGTTTTCAACCATTACTTTTTTGTATTTTCTTCCACTAA
CACTAATATTTTATTTTATTATTTTTTCACTAACACTAATATGATAATTAAGTCAAATCGACATCTTAAACTCCATGCCATTTCAGAGATTATGATATAA
AATAACAAGGCGATAATTTAAGGCATTGAAAGAAGTACATCTCCAGATCATTTCTCCCGAACATTCTTGTTTTGAAAATAGTATGATATGAATAACATAA
CAAGTTGCAACAAATTTCAGAAATAGTACATATGGCACTCAAATTGTCAACTCTAATGGCTCATTTGGTAAGGGAACAAGTTATCCCAGGATTCATGATC
CAGGTATTGTTATCCACTCCCAATGTGGGATAAAAATAATACTATCACGGGATAACTAATATTGGGATAAGTCATCACGTGATTTTATCACAACCAAACA
CGGATAAACTCAGCCTAAAATTCATCATTATCCCTTATAACTCTTACTAAATTAGCCCTAAGTCAGATAAATTTCCTTTTTTGGTCCGCGGCTAATGTGT
CACAATGCTTTCATCGGTCAACTTAAGGATTAACTATTCATTTTGCCTACAACAGGAACACAACAAGCAAAAACTAAATGAACTAAAACGAACTCCTTGT
TCCTAAACTGAAATCACTCTACTTTCCATTTCCATTGTGGACATAAATTACCTGTTATGAGAGAGAAAAAAAGTGAGAGAAAATACCAGGAAATTTGTAG
AGTTTGACGGAATGGTCAATAGATCCAGAAGCTAGACAGGTGTAATTAGGGCTGAGAGACAAAGCGGTGACGCCATCTCTGTGCTGTCGAAGAACTTTAG
GGGGATTAGCTGGCAAAATAGCATCGTGAATGCAAATTGAAGAATCAGAAGAAGACGCAGTGACGATGTGTTCGCCCTGCTGATCCCATAAAACCGAGCA
GAATGACCCAACACCGTTGCTGTTCTTGTGAGCTTCTCTAAGCTT