BAC Sequence – LE_HBa0024G05

>C04HBa0024G05.1
AAGCTTACATACCTCTAAGGGATTAAAACCATGATTAAATTCCGCAAGAATCTCGACGAACGCTTGGTCCTCTCCTCTTTTCTCTACTTGAACTTTCAAC
CAAAATCATAGGTGTATATTAGGATTATAAAACTGAACCTATAGGATTACACCCCTAAAATATTAATAAAAATTAATTAAATCTGATTTGGTAAGGAAGC
AAAGTACCTTTACTATTTTCGGCTAACTTTTCTTAACTGGACAACCTAATTTCAGTAGGTCATATCTCCCTCATCCGAACTCGAAGCTTAGCAAACTCTG
TGACGTTGAAAAGACAAGTCAAAGAGATTTCCTAAGGTATCTTGTAGCACATATAAATCATCCTTTTCTAGGAGTTATAGTAGTTTGAAGTTGACCCAAA
ACTTATACTTGAGCATAACTTCAGATTTCGCTCTTTCTTATTTCTTCCAAAAATCTCACTCACTACGAAGAACGGTTCCAGTCTTGGTTCAAAAAATTTC
TGGGGTGTTACACTAATGAGTTGGAAAATCTCATGTATATTCACACAATTTTTTATTTTTCATTTTCGCATTTATAAGTCCTATTTAAAAAATTGCCCAA
ATTTCCAAATTTTCGTATGGATTAATTGATCCGACGCGTGGAGCACCAATTATTTTCTTTGAAAAACTTTATTAGGAGCTCTGTAATGAGTTATGGAACC
TTGACGTAGACTCACACAATATTTGAATGTCTATTTCATCATTTACAAGCCTTTTTTAAGAATCGCCTAAATTTCACGTTTTTTTCGTGTGTATTAGCCC
ATGGATCTGATGCCCGGAGCACCCAAAAAATTTCCAAAAAAACGTATTATGAAGATCACCATAAGAATTGAGAACCTTCATGTATTTACACACATTTTTT
TTAACACCATTTCAGCATTTACAAGTCCCTTTTTAAGAATCACCCAAATTCTCAATTTTTCATGTGTACTGCCCATTGATTCAATGCCCAAAGAACTCAA
AATTTTTTTTCTTAAAAAACTTTATGAGGACCTCTGTAGTGAGTTGGGTAACTTTAAGTATACTCACACCATTTTTAATGCCCAATTCCGTATTTACAAG
CATTTTTTAATCACACAAATTTCCTGATTTTTTATATGGCCCATGGATCTAGCGCCCAGAGAACCCAATTTTTTTTAATCAAAAACCTTTATGAGGACCT
CCGTAATGAGTTGGGGAACCTCCACGTATATCACTCCATTTTTTGATCACCCACTTCCACATTTTCAAGCCCTCTTTTAATAATCACCCAAATTCTCTCA
TTTTTCATGTGTAGCCCATGAATTAGGCGTCCGGAACACTCAAATTTTTTCTCGAAAATCGTCATGAGTACCTTTGTAATGAATTGGGGAACCTTCATAT
ATACACGCATATTTTTTTTAACGCCCATTTTATGAGCCCTTCTTTTTAATTGACCAAATTCCTGGGATTTTCGTGTTCATTTTCCCATAAATCTTGTGCA
TTGAGAACCCAAAGATTGTTTTTAGAAAAACATTAAGGGGACCTATGTAATGAGTTGGGGAACCTTCATGTGTATTCACATCATATTTTAACGCTCTTTC
CGCATTTACAAGCCCTTTTTATGAATAGCCTATGTTTCTTCGACTTTTTGTGTATATTATTAGCCCATGGATCTGGCGCTTATAGCACTCAAAAAACCTT
TCTCAAAAATTTTTATGAGGACCTCCGTAATGAGTTGGGGAACCTTCATATATATCCATATCATTTTAACGTCCATTTCTGAATTTACAAACCCGCTGTT
AAGAATCGCTCAATTTTCTCAATTTTTGTATGTATTAGCCCATGGATCTAGCGCCCGAAGCACCCAAAAGAAATTCAAAAGAATTTATGAGGACCTCCTT
ATAAGTTGAGAAACCTTCACGTGAGCTATCACCATCTTTTAACACCCATTTGTGCATTTACAAGCCTTTTTTCCAAGAATTGCCTAAATTTCCCAATTTT
TCATATTGATTTTCATGTGTATAAGCCCATGGATTTGGCACCCCGAGATTGCACATTTTATTTTTCAATAAACAGTATGAGGACCACGTAATGAGCTGAG
AAACCTTTATCTATACTCGTACCAATTTTTAAAACCCATTTTTGCGTTTACAAGCCTTTTTTTAAGAATCACCAAAATTCCTAATTTTTCATATACCCAT
GGATTTGTCGCCCAAAAAACCCATAATTTCTCTCAAAAACTTTATGATGTCCTCCGTAATGAGTTGGGGAACCCTCACATATAATCATACTATTTCTTAA
CTCTAATTTTTGCATTTACAAGATCTTTTTAAATAAACACCCAAATTTCTCGATATTTCGTGTGTATTAGCTGATGCATTTGGCGGCCAGAGCTTCCAAT
TTTTTTTTAAAAAATTATGAGGAGCATCGTAATGAGCCTTTATTTAATAATCTCCAAAATTTCCCAATTTTTCGTGTGTATTAGCCCATGAATCTGGCGC
CTAGAGAACCCTAAATGTTTTTCTAAAAATACTTTACGAGTCTTTATGAGTGGGGGAACATTCATGTATACTCATACCATTTTTTTAGCCGTCATATCTG
TATTTACAAGTCTTTTTTTAAGAACATCCAAATTTCTCAATTTTTCGTGTGTATTAGCCTATTGAATAGGTGTTCGGAGCACCCAAAACATCTTATCTCA
AAAATCTTTACGAGGACCTCTGTAATGAGTTGGGGAACTAACATGTATACTCACACCATTTTTAACGTCTATTTCCGCATTTACAAATCCTTTCTAGAAT
TGTTCGAATTCCCCAATTTTTCATGTGTATAAGCCCATAGATGTGGTGCGGAAACCGCCTAAATTTTTTCTCAAAATTTTTAATGCGGATCACCAAAATA
AATTGGGAAACCTGCACATATACTCACACTATTTTTTAACGCTCATTTCTGTATTTACAAGTCTTTTTCTTAAGAATCGTTCAAATTCACTGATTTTTTG
TGTGTTTTAACCCATTGATCTAGGGCTCAGAATATCCAAAAAAATTTCTCAAAAAACTTTATGAGGATCTCTATTATGAGTAGGGAAACCTTCACGTATA
TTCACACAACTTTTAATGCTCATTATCGTATTTATGAGCCCTTTTTAAAAATCACCCAAATTTCTCATTTTTTCGCATGTATTAGCCCATGGACTTGGTG
ACGGAGTATCAAAATAAATTTTAAAAAAATTTATGAGGACCTATGGAATTAGTTGAGGAAATTTCAAGTATACTTAATCCATTTTCTTAACGCTCCTTTC
TGCATTTACAAGCCCTCTTTTAAGAATCGGCCAAATTTTCTTATTTTTCGTGTGTATTAGGCCATTAATTTGGCACCTAGAGAACCCAAAAAAATTCTCA
AAAATCTATATGATGACCTTTTTAATGAGTTAGAGAGCCTTTACATGTACTCGCACCAATTATTTAACGCCCATTTCATTATTTACATATCTTTTTAAGA
ATCGCTCAAAGTTCCTGAATTTTATTTAATGGATCTAGTGTCGGCAACACTCAGAAGAAAATATCTTAAAAAATTTATGAGGACCTCCATAATGAGTTAT
AAAACCTTCACATATACTCACACCATTTTTTAAATTCTCATATCCACAATTACAATCCCTATTTTAAGAATCATCTAAATTCCCTAATTTTTCGTGTAGA
AGCCTATTAATCAGGCTCATGGATCACCCAAAAAAAGTTTCCTAAATTTTTTTGATATGAAACTTCAAATGAATTGGGGAACCTTTATGTATATTCACAC
TATTTTTAAAGCCCTTTTCTGCATTTACATTTCTTTTTAAGGAATCGCATGAATTTCTCGATTTTTGTTAGCCCATGGATTGGCGCCCAAAGAACCTTGT
AAATTATTTTTCAAGAACTTCATGAGGACCTCTATAATATGTTGGGGAACCTTCATGTATACTCTCACCATATTTATTACTCATTTCCACATTTTCAAAC
CTTTTTTTAAGAATCGTCCAAATTTTTCAATTTTTTTTGTGTGTTATTGGATATGGTGCCTGGAGCATCCAAAATATTTTTCTAAAAGAACTTTATGAGG
ACCTCCAAATGATCATTTGTGGAACATTCACGTATACTTACGCCATTTTACACCTATTTTCATATTTATAAGCCCACTTTTAGGAATTACCTAAATTCCC
AAATTTTTCCTATTTATTAGCCCATTGTTCTTTATTAACTACTGCCCATGTTACAGGGTACATCTGATTTTTTCCATCCTTGGAAATGCAAGACAACAAT
TCACCTCTACACACACCTTTCATAAATGCACCATCGAAACCAATTATCCTTCTTCACCCCTCCATCTTACCACTTTAAAATGCTCAAGGACAAAATAAAT
CCCTTGGAATACCTCTTTTCCAGGAACTGTATTCTTGGATGTCATAACAACCACAATAGTTCCTGGATTTGTAGACTTCAACTCCTCAACATAGTCATAC
AATCTAGCAAATTCCTATATGAAATCATCAATATGCTCATTAATGACTTTCATTTTTCTCTTCTACAACTTATTTTAGTAACATACAATCCATGATTCTT
TTCTACCAAACCTTGAATCTGATGGAGTTTGATGCTAGGCTCACTCATGATTCTATCTTATCAAGTCTTACAAATCCAGTTTGGAGTATGCAACTTATTT
CTTGTTATTTTAAAACACTGATGGACAGGAAAATATATCTTCACAGCAAAATTTCCTGTTTTACCCTTTCAAGAATATGCCAAGGACAACCCTTCTTAAG
ACACTTTGCCTCGATCCTCTCCTTTTCATTAGGTTTAAGTTTAATGTTCACACCCTTCTAAATGGAGTAAGCATGTAGTTCTTCTCTAAACTGAACATTA
TTCACAAAAATCATATACAATTGGAAAAAAAAACTTTTTTGGCATTTGGGTCAAAATAGACCTTTGTACTTGAATTCCTAGGTGGTGGATCTACAATCTC
ATCAGAATCAAAAGGATCCCCTTTATTTTCACTAATATCACTGCCAAGATTTGAGTTATCAAAATATAGGTCATCCGTTCCGATTTTCCTTCATATCTTC
CCCTATTATTCTTATGAATATCTTCAAAAAATCTATACCTACAGGACCAGAAGGTATCTCATCTACATTTACTCTAGCAACCTTCTTTTTATTAACTTGT
TTTTGAAGATTTGACATTTTAGCTTCAACAAACTCAGTATCCAAGTCACTTAAGTCATCAATGTTCTCATAAACATTATAAAGTGACTCAGAATCATATT
GTTCAGCATCTACATGTACATCAAATTCATCATATGTTTGAAGGTGGTAGGAAGAAAAGTCATTACCTTGACCTTGACTTTCATCTTCATGTAAGTCCTC
TAAAGAAACCTCAGGAGCAGCAGTTTCCTTATTCTTACAATTCTCTACCCTAGGTTGCTGATCTTTTAAATTTATATCATTTTTATCAAATGGTTGATGG
GAAGACTGTTAGGATCGAATTCACGCACACACACTAGATGAATGGAGAACACAAGAACTTTCAAGAGAAAGAGATGAGAGATCTAGAGAGAGAAAGAGAA
AACCTAATATTTCGTGGTAACACCCCGTGAGTAAACTTCCACGGCGGTGAGGTATATTTATATTAATAAATCAGAGTATTTTTTGTTACAGAGAATAAAT
AGGAAAACCTAAAATAGAGAATAAATAGGAAAACCTAAAATTAATCAGGCTCCACTTCCTAACAATTCTCCCACTTGGAGACTGACTCAGTCATCCAAAA
AATACATTCTCCAAAAAAATCTTCATTATTGTCAAAAAGGTTACTGCTAGAACTACACCGCCAATATGAACACATCTTTCTAACCTGGTTGAATCATCGA
TTATCGAACCACTGAACCTGACTCCGTCATTGAATCTGGCTCTGATACCACTTGTTAGGACTGTAAATAAGCAGGTGTATACGTGGAAGCTAGCAAAGCA
AATCTCAAAAGACCACGAGTAAGAAGACAACGAGAAATATACCAAAAGACACAAAGATTTAACGTGGTTCGGTCAATCGACCTACGTCCACGAAGAAGAT
AAGCAATCCACAATAAATATGAGAGTACAAAATACAGAGGGAAACAAACTCAACCTTCCTGCTGAAATCATCAATGAAGGTAACATAGAATCTGGATCCT
CCAAGTGATGATACTGGAGATGGTCCCCAAACATCTGTATGGACCATTTCGAACCGCACTTTCTTTGGTTCTCTAGGAGTCTTTGTGAAGCGTACTCTTT
TCTATTTACCGATAACACAGCTCTCGCAAAGACCCATATCAACAGAATTCAGACCCTCTAATGCTCCTTTTGCAACCAGCATCTTCATTCCTTTAGTACT
CATGTGTCCAAATCTGTTATGCCACAGACATGAACCAGAAGCACTTTCAGCAACAACGACCATGTTTATGCACCCTGCAGTGGTGTACAAGATTCCAGGT
TTGGTGCCATGAGCTACTACCATAGCACCTTTCACGATCTTCCACGAACCTTTCCCAAACTCTATTGCATATCCCGTGCTATCCAACTGACCAACAGAGA
TCAGATTTTTCTTGATCCTAGGAATATATCTGACATCCTCCAATGTCCACTGGTTTCCTGAGGTGGTCTTTATGCAAACATCCCCCTTTCCTTCAATCTC
TAAGGCTTTATTGTCAGCAAGATATACTTTTCCAAAATTTCCAGATTTGAAGTTTTGGAGCAACTCCTTGCTTGGAGACAAATGGAAAGATGCACCAGAA
TCCAAAATCCATGATTCAACCGGGCTTTTCACACTAAGTATTAGAGAATCCCCAATGTCCTCTGCTGAATTTACAGAATCATTGTCATCTTCAAATTTTT
GATTCTGTTTTTTCTTTGGCTTTGTACACTTCGTCCAGAAGTGCCCTTTTTCTCCACAGTTCCAACAAGTCACGTTTGATCTGTTTAGTTATTTTCCTCG
ATTCTTTGATTTTGATCGACCATGTTGATTTTGGCCTTTCGTCTTACTTCTCCCCCTTCGATCATCGCTGAGAGCACTGCCCGATGAATCTCCCACTTCT
CATTTGCGAATACTTTCGCTAAGAACAACATCATGGATTTCATCAAACTTCAATTTCTCTGATCCACGGGAACTGCTAATCGCAGCAACAACAGTATCCC
AAGACTCGGGCAGAGATGACATCAAAATCAACGCCTTAATTTCATCTTCAAAATTAATATCCACAAAATTGAGTTGACTCACAATCATATTGAACTTGTT
TATATGATCAGAAACGGATCCAGTTTCATACATCTCTAAATTGATAATCTACTCATCAAATATACCTTTTTCATAGCCGATGGTTTTTCATACATGTTTG
ACAGTGCCTTCAACAGATCGGACGTAGTTTTCTCCTTCACGATGTTGAATGCCACGTTTCTTGACAAAGTCAAGTGGATCAACCCTCGATCCTGGCGATC
CTTGAGTTTCCGCTTCTCCTCCGTCATGAATTCCGGCTTCACCCCGGTCAACGGTTTCGTGAAGATCTTTTGGGTATAGATAATCTTCGATCTGCATCTT
CCAGAAACTGAAATCGGATCCATCAAACTTTTCGATTCCAAGCTTCGAACTATCCATCTTTTGTGATCGTGTTGAATCTCCTTAGCTCTGATACCAGTTG
TTAGGATCGAATTCATGCACACACACTAGATGAATGGAGAACACAAGAACTTTCAATAGAAAGAGATGAGAGATCTAGAGAGAGAAAGAGAAAACCCAAT
ATTTTGTGGTAATATCCCGTGAGTAAAATTCCACGGCGGTGAGGTATATTTATATTAATAAATCAGAGTATTTTTGGTTACAGACCTAAAATAGAGAATA
AATAGGAAAACCTAAAATAGAGAATAAATAGGAAAACCTAAAATTAATCAGGCTCCACTTCCTAACATAGACACATCAACCCTAACATTTATAACAATTG
GTGGGGGCAGTAGTGTGGGTGTTTTTGGGAGTAAGCAATCTGGCTATTTGCACCTCAATAGGATCCTCAACAATTATAGGATTACTAATTTGATGTATTA
CATACACATCAACTAAGTCCCCACCCTTTAAGTTGTTAATAGATCTCAAAACATTGGCATCACTTTTCAACATATAAAAACCACCTCTTTTGTTAGCTTT
ACATCCAAATATTTCAACTTTTCCAACTTCCAATTCTCTAGCTAATTTATGAAAAAAAGATAATTTGAAGCTCATCCATATCGATTCTATTTTTTTCAGG
AACAGAAATTCCATTAGCATACGTGAATTCAGGATCAGATAAAAAATAGCCACCATAATGCAATTGAAGTGTAATAATTATTGAATTTATATTCCTACCA
TTCCTCCAAAGTCACGAGAATACATTCAGATGATTGACAAAAAAAACTAATTCATAAAAATCCCTAATCGACAAAAAAACCTAATTAAAAACTAATTCTT
TATAGAATACAACAAAATCCTCTATAAAAATATGATATAATACACTAACAAGAAAGAAATCCAATGCAATTAATAAAAGTAAAAACAAATGGAGGATACG
AAAAAACCCTAGATTCAATTGATATTCATGAGAAATGCCATTGAATGTATAATACTTCTAAAAATAGTTATTAAGCTTGTTATTAGGCATGTAAAAAACC
AATATCCTCCCTAATATCACACCACGACCTCTGCAACAGTACTAAACCCTAACACGAACTCAAAACATAATTAAAGTGAAACATCAAAAACACAATCGCA
AAACAAAGAGAAAGAAAATCAGTCAACAAACTTACAACTATGTAGTGAAAGCGAACTCAAACACTTTACAAAATCGAAAAAATCGCGGTGATAAACGATG
TAAATTGGGAGTAGAGAGTTCAAAGGTGTAATTGAAAAGGAAAAAAAAGAAATGTGTTAAAGAGAAAGGAATAACCTATTTTTAACATGTCATTTCCTAC
GTTGCATTTTTAAATGACATGGAAAGCTACGTGTGGCGTTTGTCATTCACACACAACTGAGTGGTCAAAAAAGGGTTTCAAATATTGGGTTTCAATGGGT
TCGAGGGTTCGGTTGGAAAAGTCGGGAGAAGGAGAGGTGAGGTGACAAAAAATGACAAGTACAAGGGTCTTCCAGGACATTTGCCTTTTTCATACGAGGA
ACCTTCACGTATATTATCACCATTTTTAACTCCGATTTTTGCATTTACAAGCTCTATTTTGAAGATCAAAATTTTTTTCTGATTTTTCATATATAATAGC
TCATTAATTTGGGACCAGTACGCCTAAAACTTTTTTAGTCAAAAAACACTACGAGGACCTTCGTTATGAGCTGAGGGGTCTTCAAGTATACTCACATCAT
TTTTTTAACAACCATTTCTGTATTTATAAGCCCTTTTTTAAGAATCACCCAAATTTTGTGATTTTTTGTATGTTAGCCCATTAATCAGGCTACCGATACA
CACAAAAAAATTTCTCAAAAAACTTTATGAGGATCTTCGTAATGAATTGGGAAACTTTCATGTATACTCACACTATTTTTTAAACTCTCCTTTCTGCATT
TACAAGTTCTTTTTAAGTATCCCTCACATTTCTCGATTTTTCGTGTCTATTAGTCCACTGATCTGTCCAAATTATTTTTCTGAAAAACCTTTATGAAGAC
ATCTGTAATGAGATGGAAAACCTTCACGTATACTTACACCATTTTTATAAGGCTCATTTTTGTATTTACAAGCCCTTTTTTTAAAGTTGCCCTATTTCCC
TAATTTTTTCGTAGCCATTGATCCAATGCCTGTGAACCCCAAGTATTTTTCTCAAATAAATTTATGAGGACCTCTATAATGAGGTGGGAAACTTTCACAT
ATATTCACGTCATTTTCTTAACACCCTGTATTTACAATCCCTATTTTAAAAATCACCCAAATATAATATTTTTTGTGTATGAGCCCATGAATCTTGCTCC
CGGAGCACTAAATTTTTCTCAAAAAATTTATTAAGACCTCTGTATAAGTTGGTGAATCTTCATGTGTACTCAAACCATTTTTTAACACCCATTGCTACAT
GTACACGACCTTTTTTTAAGGATTCCCCGAATTCCCTTATTTTTGTGTGTATTAGCCCATTGATCGAGGCGTACAACGCACCCAAAATTTCTTTCTAAAA
TATCTTTATGAGGACCGACATAATGAGTTGGGAACCTTCATGTGTACTCACTCCATTTAACGCTCATTACTACATTTATAAGCCTTTTTTTAAGAATCGC
CTAACTTTCACATTTTTTCTTGTGTATTAGCCCATGAATCTGGTGACCAAAGTACGAAAAAAAATTTAAAAAATTATGAGGACCTCCGTAATGAGTTTTG
GAACCTTCATGTATACTGACGCTATTTTCTTAACGCTCATTTTAACATTTACAAGTCATTTTTTAAGAATCACCCATATTACCTGATTTTTTGTGTGTAT
CCCATGAATATGGTCCCTAGAGAATCCCAAATATATTTCTTAAAAAACTATATAATGACTTTCTTAATGAGTTGGAGAACCTTGACATATACTCACACCA
ATTTTAACGCATATTTCATCATTTAGAAACCTTTTTTTGAGAATCGCTCAGATTTCCTGAATTTTCGGGTGTATTCGTAAGACTCGCAAAATGATAGGTT
GATCAAGCAACCTAACTTATATGAACCTTATAAGTTTATGTATAAATTGAAGAAATAAAAATGTCCAAAAATTTGGCCAAGTATAAGTTTAAGGGAGTGT
TCAATGCTAGCGGACCACTTCAAGTACCTTAAACGCTTCTTTAAACATTTCCTTAGATTTTTTTGGTTAAGTCCATATGTGGAAGGACGTTTTCGTAAAT
ATTATTTTTAAGTTAAATTAGAAAGTGGGTATATTTTATATTATTTCTAAATAACTATATAAGTGATTTTACATTAAAATATCCCCAAAATAAATCACTT
TCACATAGACCCACTTCATATAAAAAATTTCATCTTGCTCCAATATTTCTCTCTCTAAACTCAAGGAAGAAGAAAAAGCCATAGAAGTTTGGGTTTGGGG
ATTTCAAAATAATTTCTTCATAAATTTTCTTCAAGGTTTCTTAATATAGGTATGGTGATCCTTCATCCTTGATCAATATTTCTTTCAAGGAGTCCAATCT
AAAAGAATTTCAAAGTCTTTCAAAGATCCAAACCCTATTTTCTAATCTAAGCATGAGTTCAATGCTAAAAACTTTCAAAAGCATTTATATTGATGAATAA
TGGTTGGATTGATGATTATAAGTTAATTTTACACTGAATTTCTTCAAGAACCCATGGTTTCCCGAACTCTTTAATTTTGGAAATTGGTTAATTATGAAAG
TATAATGAATAGTAACTATTTATATGAAGTTAGTTTATAAAGTTATGGCTTTAGTATTTTATTGTGGTGAATTATTGATGTATTGGTTAGATGAGGACCA
TGACCTAAAAAGGGAAGCTATGAATGAGTTTATGTTGAATTGCTTATGTGGATTATGGAGGATATCAATTGTCTTACCTCTTGTAGTATCTTGAATCTAT
GGGTTGAGATTGATGCTTAATGATATAGAATTGTGATAGATTGAGTTGTGACCTACTTAGGTGGAGGTGTTTAATTATTGAGTATGAAATGGATATATCC
ACTTATGGAAGAGGTTCTTACATTATAGTATATGTTGAAATTGTATGTAGTATTATTGTGGAAGGGTTATACCCACATGAATTGCAATATGATTATATGA
GTATACACATGCAATGAATGAATAAATTAATTGAATTACAATTATGTACATGTCTAGTATAATGAATATGGATGTGTTGAGTTCATGGTCTATAAATCCT
TGAATGCAATAAATGAAGATTATGCATGATTATGATAGTATGTACATGCTTATGAACACTTTGATAGGGAAGTGTCTATGATGATAATGTTGCTGTTATT
TTGTCATAGTAAGGACAATTAAACACACACTCCATGCATAAATATGATTACGATGTATCTATGGTGTCAATGGAAAGTATAGTTCTCATATGCACCTTTA
CACATTATGAAATATGAAATTTACATGTCTATGATGATCCTATTGTGTTAATTGAAAGATAGATTTCATGAAAACACTATGAATGTATGTAAAAGGATTT
GTCACATGTATATTGATATTCTAAAGGTGAAAGGTATTTCTCACCTTATTGAATCAAGGAGCTATGTTATAAATTGTATTGAATGAAGCTAAAGTATTTC
TTCACACATGTAATACAATCTAAATACTATTAATGTATAAGTTTGAAAATAATGCTTAGCACCGAGCGAATATGGAAAATGTGGTGGAGACTCTCCCGCT
AGTTAGATCGGCTATTCTACATATGCTCTCATGAGATGGAAACTCTCCCGCTAGTTATGCCGGGTTTCTAGAAGATCTCCCTATCCCATATCTATCTGTC
CGAATAGGTATTATCTAGTGGATCCACACTAAAGCTAAATATGTTAGTTTTACCTTAGGCAAGTAGGACGTGTTTTTATTGGTATGGGGTCATATGACAC
GGATTTCACGTAGCTCGCATGGTCTATGTCGGTTAAGGCTATATTCCCTCTAATGATTAAGAATATAAATTATGAATATGCAAGTGAGTTATATGCTATG
TTTCCTCAAAGGGGTTTACTTAGTATGAGTGGTAATATAAATTCCATTCATACTTTGCACAAGTAGACTTTGAGATTAGTCATGGTGTGTTCCTCTTATG
TTTATGTACTATGTAGGTTTTTTAACACAAGTGTAGGTTTCAGCAGGACATAGAGTTCTCTAGATTCAAGGGCTTGGGAAGAGTCCTCCAAGACCAAGTG
TATGTCCTCATGATTCGGGGACAAGTATTTAGAAGTTTCTTGTATTTAATTTGTAATAGGTTAGGTATAGTTTTGTTTAAGTCTTTAGATTGTGAAGGGT
CGTGACCTTATCTTTAGGTTCCATGTCTTGGTTAGAAGGCCATGTGAGATGTAGGCTTCACTATGATTTTAAAAATCGTGTTCTCGAAGTGAAGGGTTTT
TAAATGAAAATTTTTAATTGCTTGTCATTTCTCCTTATGATCGAATGTTATGAATGTTATGAGGCTTGAATAAGACCTTTTCGAGGTCGAGTAAGCCATG
TTACGACTAGGGGGTCTAATTGAGTCATGACATTAATAACCAATGGATCTAGTGTCGGCAGCCCCCAAAAATATTTTCTTAAAAAACATCATGAGGACCT
CCATAATGAGTTGGGGAACCTTCACGTATACTCACACCATTTTTATAACGCTCATTGCCGCATTTACGAGTCCTTTGTTTTAAATTTCTCAATTTCCCTT
ATTTTTCTATGCATTAGCCCATTGATCTGGCTCTAGAGCATCCTGAATTCTTTTCTCAAAAAAAATTATGAGTACCTCTGTTATGAGTTTGGGAACCTCA
TATATAATCACATTATTTTTAACAACACTTTTTGCATGTACAAGCCCATTTTTAAGAATCGCCCAAAATTACCTATTTTTCATGCGTATCAGTCCATGGA
TCTGGAGCCCGGAGAATGCAATTTTTTTCTCAAAATCTTTATGAGGACGTATGTATGTGTTGGAGAATCTTCATGTATACTCACATAATTTTTTAATGCT
CATTTCTACATGTACATGGACTTTTTGTAAGAATTGCTCAAATTCCCTGATTTTTCGTATGTATTAACCCATTGAACTGGCGTCCGGAGCACCCAAAATT
TTTTTCGAATATAACTTTATGAGGATTCTGTAATGATTAGGGAAACCTGCACGTGTACCTACTCTATTTTTAAATCCATTTTCACGTTTACATGTCTTTT
TAAAAAAATTACCCCCAAATTTCCCAATTTTTGGTGTGTATTATTAGCCCATCGATCTGACATCTTAAGCACCAAAAAAAATTTTCTCAAAAAACTTTAT
TGGGACCTATGTAATGACTTAGGAAACCTTCACATATACTTACACCATTTTTAACGGCCATTTTCGCATTTACAAGAATTTTAAAGATTTGTCCATATTT
CCCGATTGTTTATTTGCCCATGGATGTGTCCAAATCACTCAATTTTTTTTTTGATTTTTTTATGAGAAACTCAATAATGAATTGGTAAAACTTCATGTAT
GCTCACACCATTTTTAACGTTTATTTCCGCATTTACAAACCCTTTTCTAAGAATCGCTCCAGTTCCCTAATTAATTTTGTTTGTATTAGTCTATGGATCT
GGTGCCTAAACCATCCAAATTGTTTTTCTAAATTTTTTTATGAAGATCTTTGTAATGAGTTGGGGAACTTTGATGTATACTCACTCAATTTTGAACGCGC
ATTTCTACATTTACAAGTCCTTCTTTAAGAATCACCCAAATTCTCTGATTTTTTATGTGTATTAGCCCATGGATCTTGTGCCTAGATAAATCAAAATTTT
GTTCTTGAACAACTTTTTGAGGACCTCCGTAATAATTTGGGAAACCTTAAAGTTTACTCACATCATTTTTAACTCCCATTCCGCATTTACAATCCTTTTT
CCCTAAGAATTTCACAAAATTTTCAATTATTTGTGTGTATAGAGATGCCTATGGATTCGGCGCCGTGAGCACCATAAAATTTTCTCAAAAACTTTATGAG
GACCTCTGTTATGAGTTGGAAAACCTTCATGTATAATCACACCATTTCGTAACGCCCATTTTTGTATTTACAAGCCTTTTTTAAAAAAGAATTTTCCAAA
TTCCATAACTTTTTGTGTGTATTAGCCCATTGATTTAGGGCCAAAGCACCCAAAACAAATTATAAAATAAATTTATAAGGTTCTCACTTTTTAACATCCA
TTTCTGCATTTACAAGTCTTTTTTAAAAGTTTCCAATTTTTCCCATTTTTTGAGTGTATTAGACCATGGATCTGATGGTGGGGTTTTCAGGATTGGGCCT
TAGAATCAGGGCTGACCTGAGGGCCTTGGAGGCTGGTTCGACCTTGAGGACCTCAGAGGCAAGGTCTGCCTCGGTGTCCTCAGAAGCAGGACCGGCATCG
GGGGCCACGGAGGTGAGGTTGTCCTCGAGGGACTTGGAGGAAAGGATGACCTCGTGGGTAGGGATGGACATGGGGTGGACTTGAAGGCGTGCTGAACTCA
GAATATACAAAATATTCAACTAGCCAAAAAGAGACAACTCAAATCTTTAAAACATTCACCAGAATAAAATGACATGACTTCTTAAACTCTACTATTTATT
TATGAAGCCTCTAATTAACAAAGATGGAAGTAGGGACAAGATCCACAATATCCTTACAAAACTTAAAAGTAAATGGAATACTCTATAATAGAGGAGGCTC
ACCATAGCTAATTTTAATTGTAAGTGATGTCAACGAAGCTTCTATAGATGACCCTAAATACATGTATCTGCATCATAAAAGAAGCAGGTCAAATGGTATC
AGTACATGGAATGTACGAGCATGTAAGGGAAATTCTAAAGCATAAACATAAGCTTGAACTGATAGAAAAGAAATATACTTACCTCCTCTCAAACTCACTC
AACTCAACATGAACTCCCTCGGGAATAGGATATTCAACTCAATGAAACATAGTTCAACTCAACTCAATGAAATAGGACTCAACTCAACAATAAGGTACTT
AACTTAGAGGTAAGATACTCAACTCAAAGATACTAGGCTCAAGATAATCAAGTCAAGATACTTAACTCAATATACTGAAGAATAGAACAATAATAAAAGA
TGCAATATACAGATAGGTTTTAAAACATTAGTACTCAATTGTATGTAAAGATACAATAAAAACCCAATTGTATGTAAAGTCCAATAATAACTCAATTGTA
TGAAAAAATACAATAATAAATCTTATTTTGGAGATACTCTAATTGACAACCAGGAATATGAGCTATGTGATGATACATTGTCTCGCCTATGCTGCCAGAA
TTGTCCTATACTTTGTGGGTTATAGGACTACTCACTAAGTAGATCTACTAAGCTATGCTTAAAAAGTAATAAGGAATCATCTAAAAAGTATGACCCTTTC
TACTCTCAAAATATAACATAGCTCATATGCTTAAAAACATTTCCACTTTCTCAACTTTAAGATTATTACTCAAAAGATTTCTTTTAAAAGAGATAGTTAG
TACTCAAAATTGCTCATGAAATCTTTTGGAAATTGGTGTTTTGTGTCATCTTAAATGTAAAAAGCATCCACTCTTTAGAATACTTAGTTTCCACATATTC
ATTTTGAAAAATGAAACTTAACCCTCCCCGTCATCAAACTTAACTACTTAAGTCTTAAAATAAATTATAAATAATTATAAAAGACTTTTCAAAAATAGAG
TTCATGCCAAATTGTGAACGAGAACGACTCAATTCAAGGTTTTCCATAACCATATATATAACTTAATACTCCAAACTCAAGAACTCAATGATACTACTCA
TCTCAAGAATGTTCAACTCACAGGGTTCATACGGCATTATGGGCATGAACAACTCAATTCGAGGACTTCATGGGTAACATACAATAGTCCTATAAGTAGA
AATGTAATGTCAAAGTTTTAAAAAAAATCAAAATTCTGAAGAACTTAGAACTTGGATATACTACTCCTCTCAATGATACTCAACGCATGAAATTCAGGTT
GAATTTATGGGTATGAACAACTCGACTCAAGGGTATAATTAATAATATAGAACTCATGTGTGCGAATCTTCTCATTCTCATATTTATTTCCTCAATACAT
AGCTCAAACCGATAGTCGATCTCAAAAGATTCACAATTTAACTCAAAGAGTTTTTCAAACTCTTCTCTTAACTCTTTCTTGAATTGAATTATGAATTCAA
GATTTATGATCCATGATATGATATATCTCGTGAGTTTTAAATATATTTTAGAGTAGTTAGAATCAGATAAGAGTAAAGGTACACTTTAAAAGAACACGGA
CGGAGCAAACGACTCAAAATGGGAGGGGGTAGGTGACCCTGGCGCACTGAGTGGCACAGGGAGCTAGCCCCTGAACTTGATAGGGAAGTTTTTGGTGCAC
TGCTGGGGCGGCATGCCAGCCCCCAGCCTAAAAAAATGTGACGAATTCTTATTCTCATTTTCAAACCCTAATTCGCCTATAATCGAATGATTTCTTCCCA
ACTCACTTAGATTCAAATACTCAACATAAGTACACGATGATCTACTCTAAAAAAACCCCTTAAATTACTAATACTGATCTCAAGAATTCATCAAACATCA
TTAATCAAAGAACGAAGCTCAAACTTCAAGAAACTCATCAAAAACTTAATATACCCAAACATATACATGAAATTCGTAAAAGAAACTCATGATTGGTGTG
TGGGTGAACGAACTCAACACCATGAACATTTAAATACTCATAGGTATCAAATCCTCGGCAATATTTCACAAAAAAACTTAAGAAGCTCGCCGAACGCCTT
GAACCCTTTCTCTTTTCTCCTCTTTTCTCTCCTTGAACTCTCTTCTAAAACCCTATGCGTACTTTGGATGAATGAAATTGATTCAAATAAGTTTATACTC
CTAAATTATTACTAAAGATGTTTTAATCTAAAGGGGTAAGGAAAATACCAAAATACCCCTAATTAATTTGGGTAACTTTCCTTTATTAGGAAGGCTGACT
TCAAACAAGCATATCTCCTCCAAACTCTAAACTTAGAAAATTTGGTGGTGTTCGGAAAATAATCAAAATACCTTTCATTTGATATCTTATGGGACACGTA
ACTCATCGTGTACTAAAAATTATGGTAATTTGAAGTTGACCCAAAACTTAAAAAAACTTACAAATGACTTGAATAAATTATGTTTAGTTATTTTTGGACT
CAAGGTGCTACATCTAATGACCTTAAAACTTACAAAATTTTAAATTCCTCGGTAAAATTCTATTCACAATTAAGGATGGTTCGAGTCTTAGCAAAAAAAA
ATTGTGTTATTACGTGCATGATCACTAAATTTTCCAAGAATAAGTGTAGGCTTTTCGAATGCAACCAAGGAACTACAAAATCATGTTCAAGTAAAAAAAA
ATCTAGTGGAAGATGAAAAGGGCAATTCTCATAAAAATGAAAAAGAAGCGAAGGATTGCTCGTAAGGATAGAGAATGAAAGAGATGGTCTTCAATATGAC
TTCAGTTATGTCGTTATGTTACATCGGGCGCTACTCAGAAGTCAATCAATGATTGTAATTGTTTATGACATAAAAAAATATACAAAAAAGAGTCATGCCA
TGACCAAAACTAGGATTCTCGTTAGGATGCCGAAACCCATCTTTTTGACAATTTTTTCTTTAAAATGTAGGAGGAAGAAATGACGAGTCGAGATTTTATG
ACTCAATTGGCCTAACTTCAATATTGAATCAATATACTCGATGCCATTTTGAACCATCTACAATGTTAATTTGTTTATGATTGGAGTCAGAAGTGCACTT
AAGTAGTAAACATGGAAAAATAAATAAAAAATTGAAAGAAAGAAGCAAAATTGAAAGGCCGTATCGTTTGAGAAGTTTGGTGTGTCTGTTGTGACGGAAA
AATGAAAATGAAAATCTAACAATAAAGAACACCAAGTTTAACATGGAAAACCCTTCAAACCAAAGGTAACCACCACGGGATCGACAAGATTCGAATCGAT
TCACTATAACAATAAGAGGGTTACAAATATTCTTCCAATGGCTACACAACAAGTGCCAAAAGCAACAAACAATAGCTACACCAACAAAAGATAAATAGAA
AGAAACACCACCCAAACCGGGCTGCTTTTCGGGACCTAAAACAAAATCTTGTTTACCTCCGAATCCAATCTCCACCATTCAAATCACCACCAAGATGTCA
GGAACACTTAGTCCAAATTTCAGCCCGATACAACAGTTAGTTAATCGGGAAACACGATCTGAAGGTTTCTGGTCGGAGAAAAAGTCTGCAACAAAAGAAC
CCTTTTTCTTCTCTCTTTTCTCTTGTTGAAATTTTTCTCACAAAACCTCACTTATGTCCTAATATCTTTCAAAGATAATAATAATGAACAATTTTATTAT
TCTCTCAAGACCATCCTCTATTTATAGAGTTGTGTTTTTCCTTACAAAATCAAAACCAACTACAAATAGAATTACAATAGAATTGGAAATCAAATAAAGG
GAATAATTCCAATCCTTTTCCAAGTAGGATTAGTCCATTGGGACTTTGGCTGGAACATGGGCAATATACCAACAGTGTCACCAAATTGCCTGACAATAAT
GACACCCAAACTACACCCTAAGTTGGGATTAAAGTGGTTTATGTCAAAATATCGTAATATAACAAGGTTGGAGGCGATACTCGCAGAGACTGTGGAGGGA
GATATTTGTAATTTGTTGTTGAAAATTCATATTAGTAACTACTATTGTAGTTGAGGGTTTTAAAAAGTGAATATTAACTAATTTATAATGTTAAAGTTGT
AATGAATAATTAAAGATGAACTAGGGTTACAATTCTTAGATATCATAGTTCAAATAAATAATTTAATTTCATCACATTTAGGTTTGTCCATTGTGCAGAA
ATGAAAAATATATGTCTCCTGAAGCCTCTCCGCTCAATTAAAAAAATATCACCCTAAGTCCATGTCGGCACTTGTATGACGAAGTAATTATTTCATTCAT
CAAATGTATCAGGTTGTTTATTCTATCTCTAGCTAACTCTATTAGATAGAGGTTGGTAGCTCCAAATCCTTTGTAATGACCCTTTATCATAATCTTAACC
TTTTTGTCAAGCGAGCCAGAATACAAGCGAGTTCTTAATGTTTTTAATCATTAAAAAGTAATCTTTATGAAAGAAACTTAATACACACTAATCACCCCTT
CATTAGAACTTAAGAAAATTTTAATGTAATGAATCTATTATCAACATTCCTACTCTAAGTTCCATAACCCCAATTATGATTTTTAACTATCTGCAAATAA
TAACTAAAGTAATATATAAGAAATTAACAAACATAAATAGAAAGAAAGTAAGCAAACCTTTTCTAATTAATGCAGCTCTTGCAAAGAATTTTATTCATTC
CACAATAATCTTCTAAAAACAAGAATTAGCCCTAATAAGGTAAGAATATTGGAAACTATTAAAGAATGAAAAAAATCCCACATCGATGGTTAATGAGATG
AGTGGACTCATTATAAGGCTTGAGCAATCCTCGTCCCTTTGAGCTATTTTTTGGGTGTGAGTTAGGCCTGAGACCTTACTTAACACCCTTTGAGTTAGCT
TTTAGAATGTGAGTTAGGCCTAAGACCTAATTTAACAGAAACCTTATGCTAGTAGTAATCCCTAACTTCTATGACTAACGATAATCCCTATTATTAATTT
CTAACCCTTAAAAATGTTGTCATAATTACATAATTATAATAGAAGAAACATAGTAGTAATTCCAATTGACTCTGCTTTGACTTGGTTAACATCATATCAA
TAAACAAGGGTTTGCAGCGAGATCATCACATGAGTTTATTTATTTTAGAATATATATTTTCAACATGAAAGGCGTGGGATCCATCATGTGAAAGGTACCC
TCGCATTGCAAAGTCCATTATTATAATTTCTTTGTTTGTATTTCAGTTTGGCGCAATTTATTTTACATTCCAATCCACTTTTTTGGATCCTTTCTTGTTG
TTTTGTTGTCTAAAATCAACCTAATCATATCTACTGGCTCATAATAACAAATGTACGATAAACATATAAGATTATACTCAGAATTTAGCTAATTATGGAT
AAAATATGGTGATTAGATGTGTAAATACACCCCAGATCGCCACTCCATACTAATAGCTTTTGTTCAATCTCGAACAACTCATTTGATCCAATACAAACAA
AACATCTCATAGACAAGGTTACTTACAAATATGATTTGCACAAAAAGATTAATTGTGATCTAAAATTTTCTCATTCAAACACACTCTATCAAATTTAAGA
TTGTTCAAGCAAACAGTAACATCCAACCTTAAAATAAGAAATTTCACATCAGTAAAAAAAAACAATGTTGAATGCCTTGAATCGGACCCGCTACAAACAG
AATGGACGGGGGTCTCGCTGCCCGGTCAGCGAGTCGGGGGTCCAGGGGGGCGACGCGCCCCCTGGCCTGGGGGTCCGGGGGGGCGGAGACGCCCCCGGCC
CGACGGTATACAATGTTGTTGTATTGGGCCCTTTAATTTTCTGTTGATTCTGTATGTTGGGCCCAAGCCTGTTAGGGCGTAGCTTAGCACTATATATAGA
CGCTATGGGAAACCCTATTCTGTAATTCGGTTTTTGCCTCTCCATAATAAAACTGCTCCCTCTCTTTCCGTGGACGTAGCCAATTTATTGGTGAACCACG
TAAATCTGTTGTCTTGTTTTTCGCGTTTATATTTTCTCATATTATCTCAAATTCCGCACAACAAACAAGATATATGTTGGGTATACTTAAGCAGTTATTA
CACATTAGTGACACATTTTAAAGTTTTGCATGCCTAGTATATGTTGAGTTTTAAAAGGTGTGAATGGAAAATGAAGAGTTGCGACTTTTATGAAAGATTG
CGACTATTCTGAAAATTTATGACTTTAATGAAAAGTTGTGACTATTATGAAAAGTTGTGACTTTTATGAAAGGTGACGACCTTTCTAAAAAAATATGATT
TTTTCAAAGGTTTGTGACCTTTTCAGTAAGGTACAATAAGAACTTTTTCACACTACCCTTTGTTTTCTATAAATTGAGGAATCTCCTCTCAGTTTAAAGA
TATAAAACTTGTTGGAGTTCTCTTAGTGTACTTTATTGCCATTGAGTGGCTCGCTGCCAGCGTTTTGGGTATCAATACACTGGTGATTGAGATATTCTAT
CCTTGGAGGACATATTACAAATCAAACCTCGGATACTAGAGGGAATAATTTCCTTAAGGGGACAATGTGCATTCAGTGGACTTGATCTTCTTTCTATTTT
TCTAGATTTAGGTATTTGTTACACTTTTTAAATTTGTAAATTAATTTATTATGTTCTTCTGTAATTCACTGGTTCATTAAACTTTGATTACTTCGTGTTT
CTTCAAAGTTCTTTGGAAACATTAAGATTCTTTAAACACAGATTGACAACAATTCTTATGTAAGAAAAAAATCTTGTATTTTTCTAATCTATTTCTGATT
CTAGTTTATCTACTAGTTTTAATTTTCTAGTCGTGAAAATGTTCTTAAACTTTGTGGTGTCTTAACAAGTTCTTCAAAGTTTTATTCTAAGTATCTTAGG
AATACAAGATGAACAACAATCTTACGGAAATTATTATACTGTTAGTATTTTTTGTATTCTACTGATTCTGAGAATCTGATCATAGAAGTACAAGATAAAT
GCATTACTTCTATCATAATTCGTTGTTTTTTTTTTAGCAAGGTCGAAGTGAGAATATAATTGAAAAAAATTGTGGTGTTCCGACTAGGTAACCTTCTTAT
TATTTAGCTAAGGAGGAAAATAGTTTCTAAGAGTTAACAATTTTGATTTTTTATCTTATGTATCTTTGGAAAAATATCTACAAACTATATGTTGTGGAAT
TAATTTTTCTTGGCAAGTAGTGTTGCCTCAAAATTCTTTAGCTTGCAAAATGAGAGATGCACAATTTTGTTTGATAAAATAGTATGTCAAAATGTTATGT
TGGAAGACTATTTGAAAAGAAAAATATTTTTAAGTGATAAAGAATATGTTTAATTCCGTTTGGAGACTAAAAAACTTTTGTAGTTTGGTACTCCTTGTGA
ATTTGATTATGTCTGATTGTTGTGGATTAAAACCTTTTGTAGTTTTCTACTCAATTAACTTTCAATATTGTTTATTGACACCATCTTTCCAAAGGATGAG
TCTACAGAAGACACAGAAAATGTTACAAAATCATATTCGAAGGAAGTAAATGTCCTTTAACATTTTACTAAGCCTCTGAATCTCTTTATTATGTACATTA
TCCTTTTCACTTCCTAGGCCTTTTAGACCCTTCTCTAGACTAACTCAAGTCTAATTTTACAGTCCACAGTCATAGGTCCTATTTTAATTCTTTTAGGAAT
AGGATCTTGAACTTTGACTAGATACCCCCACACTTTGAAATATTTCAAGTTGTATTTCCTTTCTTTCCATTTCTCATATGGAAAAAATCATATTCTGATC
AAACAAAATCGCTTTCTTTCTAAAAGGACAAAGTTTTTATTGATCCCTTTTGCAGTAAGAATAGTTCCTCCACACAAGTTTTGTATAAAATCGAACTTAT
AAATTATGCATCCATAATTTCTTTTAACGTTCGGTTTTTCATTAGATTGAGGTGAATATGCCAGTAGTTTGATATTTCACTTTCCAAATATATTTCTGCA
CAATGAGATTTATACTCTCCATTCTTATCACTTCTTATATAATTTTTTCACACTGATTTTCAACTTCGATATTACATTGTCTAGACATTTCTATTGCTTC
ATCCTTACCATTTAGCAAATATACATAGTCATTTCTAATGCAATTCTCAATAAAAGTAACAAATACTTTTTCCCACCATGAGATGGTGTTAACTTCATAT
CATAAATTTCAGTGTAAATCAATTCTAAGGGATTAAAATTCCTTTCAACAGATTTATAAGAATGCTCAACATACTTATATTCCACAAAAACTTGACATTT
TTATTTATTGCACTCAAAGTTAAGCAAAACTTCTAAGTTGATCAGTTTTTCTTACAAGGTTTTGTAATTGACATGCCCCAAGTGTTCATGTCACAAACAT
TGACTCAAGCAAGTAAGAACAAATAAAAACATTGAGTTTGAAAAGCTCTTCGCGAGGTAGCTTTTTCGTCACTAATATTTTGTTCCTATTTCTTACAATT
TTGTGTGATATAAACATTGTTTAGATTGTCAAATATCCTTTTCAGAAGGACATTTTCCATAACTTTCAATTTGATTGTTAAAGAACTACCTATGAACAAA
GTTTCATTGGGTTCAATAAAGACAATATAGTCCAACTGTTATTTTTACAAAAAACATAACAAATGACTATTCACCAATATTCATGTCTATGCAAATACTT
TTATTATAATAGACATATCTTTTCAAGAAAAATCACAACATTTTAAGTGAATTATTTTTTCATAAAAGAACACAATTATTTTGAACAAGTATATATATAA
TTTGGATGTTTCATACTAGTCACACTATATACTAGTAATAGAGAAACTCAACAACCACAATATCAAATATACTCCAAGAATTTTGAGTCTAATCATAAGC
AAATAACCCCCACATTTCAAATGTGATCTCAAAAATATTTTTCAAGTATTTGAAAATAGTTTTTTCACATATTTTAATGTTGGAAACATTATTCTACGAA
AGAATTATAGTGCTGCAATTCTCTTTGGCAATGTTTACACAATGTCAAAGTTCATTCCGTAGAAATACAAAATCACAAATTGTAATTCACTGGTATTTTT
TCTCTATCATAAATAGACATACCACTTAGTATTTTAAATACTAACAATAAGGACAAAAAGAAATTGTACAATTTATTTCTATATTACATTGAAGTTTATA
GAAAATCAAAAGTACAACATTGACTTATTATGTGAAGTTTTTATATTCTTCAAACCAATTGCATAGTCCAATTTATCCAGAGTATAAAACCACAAAAGTT
TTTAGTCTACAAAATGAGACACATTAACATTTCTCATAGAGTACAAAACTACAAAAAAAAAAATCTCCAAACAGAATAACACATATTCTTTATCACATAG
AAATGTTTTTCTTATCAAATAGTCTTCCAACTATAACATTTTGACATACTATTTTATCAAATGAAAAATATGCATCGCTCATTTTTGCAAACTAAAGAAT
TTTAAAAGCCACAATATTTGCGAAGTAAAATTCATACCACAGCATATGGTTTGCAGATCTTTTTCCCAAGATACACATAAAAAAAATTAAAAACCAAAAA
TGATAACTCTTAGAAACTATTTTCCTCCTTAGATAATTTAATAAGAAGGTTACCTCGTAATCTTTAAACAGAATACCATAAAAAAATTTTGTTACATTCT
CACTTCGACCTTGCTAAACAAAACAACGAATTATGGAGAAGTAATGCATTTATCTTCTACTTCCATGATCAGATTCTCTCAATCATTAGAATACAAAAAA
TAGTAACAGTATAATAATTTCCTTAAGATTGTTGTTCATCTTGTATTCCAAACATACTTAGAACAAAACTTTGAACATTTTTGTAAGAAAACAAAGTTTA
AGAACATTTTCACAACTAGAAAATTAAAACTAGTAGCGAAACTAGAATCAGAAACAGATTTTTTAAAAAAAATTATATATACAAAATATTTTTCTTAAAG
AGAAATTGTTGTTAATATGTGTCTAAAGAATCTTACTGATTCCAACAAACTTTGCAGAAACACGAAGTTACCAAGTTTAATGAACCAGTGAAGAACAGAA
GAATAGAAGAACTGAAATTAATTCACAAATCTAAAATTTGTAAAACACGTACCAGAATCTGAAAATTTTAATAATAGAAAAAAGATCAAGTCCACTGAAT
TCACAGTGTCCCCTTAAGGAAATTATTCCCCTCTAGTATCCGAGGTTTGATTTGGAATATGACCTCCCAGGGTAAAATGATCTCAATCACCAGAGTATAG
ATACCAAAAACTCCGGTGTCAGCGAACCACTCAACGGCAGTAAAGTACACTTAGAATACTAAATTTAGTAGTTGAAGAAGAAGTCCATAAAGTATATTTA
AAATAAGAGGAAATCCCTCAATTTATAGACAACAAAGGATAGTGCGAAAAGGTTCTTATTGTGCCTTACCAGAATGGTCACAAACCTTTGAAAAGTCACA
ATCTTTCAGAAAGGTCGTCACCTTTCATAAAAGTCACAACTTTCCATAAAAGTCACAACTTTTCATAAAATTCGCGACTTTTCATAAAAGTCACAACTTT
TCATAAAAGTCGCAACATTTCATAAAAGTCACAACTCTTCATAAAAGTCGCAACTCTTCATTTTCCATTCACACCTTTTTAAAATCCAACACTCATTAGA
TATGATGAGTTATTTGAGGTCGAACAAAAGCTTTAAGTATGAAGTGATGATCTGATGTGTATTTACGCATCCAATCACTATATTTTACCCATAATTTAGC
TAAGTTCTGCGTGTAAGATTACGAACATCCATATGTTTATTGTATATTTGATTTAATGAGCTAAAGATATGGTTTCGTTGATTTCAGACAACAATAAAAA
GAAGAAATGACCCAAAAATGGATCAGAATGTAATTGAGTAAAATACAATAATTAATGTCACTTGACCTTATTGAGGACCAATAATAGCTGATCATATTCT
AGACTTCTACAAAGCCTTAATCTTAATATCGTGTTAGAGACTTTTACTCTATATTCTTTTCCGCCCCACGTCACCACATGGGAGGAACATGAAAACATAA
AAAACAGAGTCCTATCAACTTTTTTCGACCTAGGATAATAAGTTTGGACTTACTTCATCTCGACAAATGAAAGAAGATCATGGTATCCTAAATCATTATC
TCTTTGATGCACAATGAATGATCTTTTTTGGAGAGTTTGTAGACAATCTATTGATGTTGTCAATAGTCCTTTTTTAAAGGGGTTTTCCTTTTGTGAGAAG
CAAGTGAATCTAAAATAAATCAAGTTTTGTTTTTTTCTTATATTGCTCTAGATTTTCCTTATCAATGGCTTTAAAGAAACATGATCTTATGAAGTAAGTT
TTTCTTCGATGTTTTTTTATTTTTGCCTTTTGTCTTCTTTTTGTAACAATCTCCGTGATGTTTTCATGGTTCTTCTGTTTTTAGTGAGAAGATTGAGAAG
CTTGAAAGATTACTTGACCTCGAACGGAAATTACTCGCCTTCTTATATGAATTGGAGAGTAGTATGGAAACCTACGCTGTGGAAAAATAACATATAAAGC
TTTTTATTAAGTTTTGAAATGATTGTGACCATATGGAAGCAGAGGTTGATTTTCATTTTATCAAATATTCATTTATGAAATTCTCTAGTAAGTTGATAAC
TAACTTTATGTGATCATTTATTTTGCAGCATGATAAGTATCTGAGTTCGATCAAACATTTGAGGACAACAATCAGTGAAAAGTAGTGTTGGCTATCGAAA
TTTCTAATCAAAATGCATTTTTACATGCTTATTACTTCAGTAACAGGGGGTGATCATATGAATTATTAAAACTAAATTTTAGCTTTCTCTTTGAAAATTC
TAGTTGTACTGCAATTTTAATTTCATGAAATATATTACAGCTTTTTTCATAATTCAGTTTGTATATTCTATGATATAAGAAGTTAATAATCAACAAAAAA
AACACGTAGTAATAGAAAAAAAACAAATGAAACAATCATTTGAAAGGGTTGATGTTTGATTAAGTTGTTTCGCTATAAATTTATGTGAACCAATATTTCT
CATTCTAATAGTTAATATTGAGGTGAAATTTAACAAAAATTCAACAATTATTATTTTTGAACTCATAATTTGCAAAAACAAAAAACAAATTCATTCAGTG
CTAAAAGGATTACATTTTAAACTCATCAAGTTGATAATTTAGTTCCACCTATAATAATAATAATAATAATAATAATAATAATAATAATAAACACAACACA
TAAAAACTAAAAATAAATAAATAAAAAATTTTAACAGTGAAAAATTTAGTCCTCCTAACTATTATAATTTTTTTTTAATATGTTGAGAAATACAATTGAA
AATTTGTTCATGGGAGAGTTTAATTTTGAGTAGATTCAAAAAAATTTCCTTTAAATATATTAATGAGCAGTTTTAGGCTATTAAATTTGATGAAAGTGAG
CGTTTATGTTCTTCAAATATTTAACAAATTAAATAATATTTGACCAAACCAAAAAAGTCTCATCAAATTTCATAATCCACAACAACTCAAACCTATTTGG
AACAGACATACTAATCAATTCATCTTTATTTTACGAATTAAGTATTTTAATATATAAACCAAGAAAAGTTTTAAGGATTTTTATCTTTATACCTAACTTT
GGATGATTTTCTCTTCACCCCTCCCTCCCTAACCCCGTTTACTATCTTGTGGTACTTCTTGGGGTCCTTTTTTGGTTCAAAACTCTCTTAATCAGTAGTT
GTTGAAGGGTGAGAAGTTTTTTAGATGACATAAATCTTAATACGTTTTAATCTTTAAAAGGTGAATTTCACCGCTTTTTACATTGGAAATTGACTTTATT
CATTAGTCATTTATTCTTCTCTTGTTTGATTTACTCCAAACCATGAATTCATATAATAATAGAAGTCTTATATTTTTGTCAAGTAATTGGAAAAGAGTTA
TATTAATGACTTTTATTGTCTTCATTTAGCTACTTTAGATACTTAAAGAGTACTAGTTTATTGATTAAAGAAATTTATTTCTCTTCTCTGTATTTTTTTT
TTATCACTAATTGGTGTCTATTTTACCTCTTGTGCATCCAATGGTTTGAGATATATGTAATCTTCTTATTCTTACATCACTTTTTTGGCTTTTAAATTTA
TAAAAATGCTCTTTAAGATTTGATTTTGAACAAATCATGGATGTAATTTATTTTTCTTATGATGTATTTATTTGTTTTTGTTTATTTGTACGTTACTAAA
TCATCTTATTTTCTTCATCTTTTTACCGATAATAATCGACTTAAAAAATTTACATATTTTACATTTTTTAAGTTTAAGAAAATTAAAAAGAAAGTTTAAT
ACAATTAAATAAAGCTTGAAGAATAAAGATTTCTTACGAATTATAGATTTTAATTTATGCACCATTCTCAGCACAATTTTTTTGTTGCATTCTTTCTTTG
TTACGTTCAATTTTTATGAGGAAGATCCTGATACTGACCATTTATAATTCCTATTTTTTATTTCGAAGGTCAAAATTAGATTTTGGAAGCTTGGGATCAC
GATTTGGGGTGATTAAAAACAAATTTTTAGAAGATTTATTCATTAGCTATGATTCTAACCAAGAGTTGGAAGTACGGAGTGGTGTGTATTGATTGGTTTG
ATTTTGTTGAATTTATTAGTGTTTCAATATGCTAAAGCAATAATCAAATCAACAAGATATTTTGTACCAATTTTTTATGTATCGATTTTTGGTCTTTAAC
GATTTTTGATTGTCAGTTTAACCAATAAAAGAATGCTTTTAAAACATTTATATAACTTGTCAAACAATTTGGCCGGAAAATTAAAAAGAGAGAAATCAAA
TAACTCATTGAGTGCAAAAATTATGCTTAGTTTAGTAAAAGTATAATAAATACTTGCAATCCACAACCCTAGTCGTTGCCTAACCCTTGTCGTTGCAAAC
CCTACCCCTCATTGTTCTTATTTCTTTAGGTTTGATGTTATGAACCTAAAGACTAAGGTAATACTAAAATATAAAAGGTAAATGCAGAGAGCAGAGTTTA
TTAGTGTTAATTGTGTGAGATCTTTATTGTTATAAGGTGTGTTTGATATGAAGGTGTAACACCCCAGAATTTTTTTCGAACTAAGACTTGTGTCGTTCTT
CATAGTGAGTGAGATTTTATCAAGGAATTAAAAATTTCTTAAGTATTAAGGTCAGTTCACTAGATTTAGCACTTTGAATTCCAAAAAGAATTCAATTGGG
AATAACAAAATCTGAAATTTTGCAAGTTAAGCTAAGTATGAGTTTGGATCAACTTCAAACAACCATAATTCCTAGCACAAGATGAGATTGGTTTGCTACA
AGGTACCATAGGAAACATCTTTGAATAATCTTTCCAAATCCACCGATTTTGTTAAGTTCTAGTTCGGATGAGTGAGCTATGACCTTTTGAAGTTAGGTTG
TCCAGTTAAGGAAAGTTAGCCGAAAATAGTGAGGGGTATATTGGTTTTTTCCTTACTTAATCAGAATTGATACATGTTTAGTAATATTTCAGGGGTATAA
TCCTTTTAGGTTCAGTTTTATAATCCAAATATATGCCTAGGGTTTAAGTTGAGAGTTCAAGAAAAGGCAAGAAGAGAAAAGAGGAGAAAACAGGAAAGGA
TGAAGGCGTTCGTCGAATTTCTTGAGTTTAGTTGAGGGTTTTCGCCATTGATTTAATCCCTAAGAAGTCTGTAAGCTCACAAAGTGTTGGGTTTGTTCAC
CCATATGCCAAACGTGTTATTTTTCAGTGTAATTTCATTCTCAAAGAGTTGAAAGATTTAAGTTCTTGATAAGTGTTCTTGAGGATCATTGTAGATCTTG
TCTTGTTGGCATTTTTATGATTTCTTGAGATGAAAGTGATTGTTTGGAGTGTTGTTTTGAGTGTATTAGTGTTTACTTAGGTTAGGTAATTGAATATAAG
GAAAACATGAGAAAAGAAATCGTTTAAAAGCGATTTAGGGTCAAAACCAAGAGCAAAGTTCGCCGAAAGCATGCCTGGGGGATGCTGGCACGGCGCGCAG
AGATGCGCCGTGAGGGTTGGGTTGGCGCGCCTTAAGTGAGCCCAAAGTCAATCTCTGATGTTAGGGGCTTTTGCCACGCGACCGAAATGCGCCAGGGTCA
CCTGCCCCCACTTATTTTGTGTCGGTTGTCCCGTTTGAGCTCATTTAAAGTGTATCTTCACTCCTTTTAATTTTAAACACTTAAAAATCATTCATAACAT
GAATCATAACCTTGAAATAATAATTCAAATTCAATTTAAAGTTAAGATTAATTTTTGAGAGTTCTTCTGAACCTTTTGAGAGAGTCCCTTCGAGTCCTTT
TGAGGAGTCTTCTACACTTCTACTAACTTGTTTCAAGACTCAAGTAAGTGAGCATGACAGTAAGGAGAATGTTCTCATGAGTCTATAATATCTCCTAGAT
CATTTATATCATGAACCATAGCTGTTGAATTCATAATTCACATTGAAGAGATCTAAATCTCATGAGACCGGCCCACTATTACTACGAAAAAGTCCTGCCC
TCTCCTTCGCTACTAGGAAAGTAAGCAACTCTTTAAGTTCAATTGTGAAGTCTTTGAGATCCACGATTGACTTTAACATGTTTGTAGGAAGTAAGTAAGA
GAATGAGAAGATTTTCATACATGAGTCTATAATATCTCCTAGATCATTTATATCATGAACCATAGCTGTTGAATTCATAATTCACATTGAAGAGATCTAA
ATCTCATGAGACCGGCCCACTATTACTACGAAAAAGTCCTGCCCTCTCCTTCGCTACTAGGAAAGTAAGCAACTCTTTAAGTTCAATTGTGAAGTCTTTG
AGATCCACGATTGACTTTAACATGTTTGTAGGAAGTAAGTAAGAGAATGAGAAGATTTTCATACATGAGTCTATAATATCTCCTAGATCATTTATATCAT
GAACCATAGCTGTTGAATTCATAATTCACATTGAAGAGATCTAAATCTCATGAGACCGGCCCACTATTACTACGAAAAAGTCCTGCCCTCTCCTTCGCTA
CTAGGAAAGTAAGCAACTCTTTAAGTTCAATTGTGAAGTCTTTGAGATCCACGATTGACTTTAACATGTTTGTAGGAAGTAAGTAAGAGAATGAGAAGAT
TTTCATACATGAGTCTATAATATCTCCTAGATCATTTATATCATGAACCATAGCTGTTGAATTCATAATTCACATTGAAGAGATCTAAATCTCATGAGAC
CGGCCCACTATTACTATGAAAAAGTCCTGCCCTCTCCTTCGCTACTAGGAAAGTAAGCAACTCTTTAAGTTCAATTGTGAAGTCTTTGAGATCCACGATT
GACTTTAACATGTTTGTAGGAAGTAAGTAAGAGAATGAGAAGATTTTCATACATGACTTCCATATACTTACTTCGACCTTTGAGTCGATTCGAGTCGAGT
TGTTCATGACCATAATTCCGCATGAACCCTATAAGTCGAACAATCTTGAGTTGAGAAGAATCTTTGAGTTCTCGAGGAGTAGTTCATGCTCATAATTCCG
CATGAACTCCTCCAAGATGAATGTCCTGAAATCATCCACATGAGATAATGAACCTTGAATTCATACTTCAATTCAAGGAAGTTAAGAGTTAAGTTTAGAA
GTTAAGAAGTAAGTCAAAACAAAGTTCTTTTAAAGTGTCTAGAGTCTTTATTAAACGTTTTAAATTGTTTTTGAGGCTCAAGTTTTAAGTCAAGTAAAAA
GTAGAGAGTTGAAGATCTTCCTTCAAAGTAATATAAGGGAACTAAGTATTCATTAAGAGTTGAATTTATTTATCAAAAGATATAAGGGAACTAAGTATTC
CCTAGAAAGTTTATAAATGTTTTTACATTTAAGAGGGAACTAAGACTTAACAAAAGAGTTCTGAGAAAGAAAGGGGAACATTTATTTCAAAAGGGCTTTT
TAAAGCTAAAAAAAAGTTGAGTAAATTATCTCAACCCAAAGGAAAGAGGTTATTTTAAAAGCATGAGCTAAAGTATATTTTGGGAGTAGTATTGAGCACT
GATGTGGGGGTGAGAGTTCATATTAACTCAAGTCTCCATGTAAACCATGTAGCCATAATGGGTATTAACGGGTTATACTTTTTAGATGATCAAGTAAGTT
TAGATAGTGGATCCACTAGGTTAAGGATGTTTTATGTGACGGCAAAGTATACAAAAGTTATGGCAGCGTGGGCGAGATGTTGTTTCACCACATAGGCTCA
TAGTGGTGGTTGCAGTTAGAGAAACTCCCGCAGAAACTATATAACTTTCTTATATATATAAAGTTGAGTTTGTTATTCCATGTTCTATAACAAACTAAGT
TGATTTTACTGTTTTATAAAGATTTTTATATATATAGCATGTGAGTTGATTTTACTGTTTATAAAGCTTTTTATATATAGCATGTGTATTATCGCTTTAT
ATTGAGTTGAATATCCATAGTTAAGTATCATATCTTTGAGTTCAGTATTTAATTTCTGAGTTGAGTATCTTATTCTTGAGTATTCCTTGAGTTTCAAGTT
TGAGAAGAGGTAAGTATGTTTCCATCTTTTTATACAAGTTTCAAGCTTATGTTATACTTTAGAATTCTCATTACATGCTCGTACATTCCACGTACTGAGC
CAATTGGCCTGCATCTTCTCATGATGCAGACACAGGTATTCTGGATCATCAACAAGAGCTTTGTTGATACATCCGAGAGTTTGAATTAGTTATGGTGAGC
CTTCTTGCTTCCGGAGGATTCCATTTCCTTCCAGTTTAGTTAGGAGGTTGAGGGTCTTGTCCCGACTTCCATTATTATCAGATAGAGGCTTCATAGGTAG
TCAATATAGTTGAGGAGTCTGTATTAATCATTTATTTTAGTAAATGTTTAAAAGACTAAAGTTGCCTATATTATGACTAGTTGAATATATTATTTTATTC
AAAGTTGTTCATTTAAGTTAATGCTTTATCTGTTGATTTTATTGAATCTTATTCAATTTTTAATCGTTTGTATGCTGAAGTTAGTCTTCCTCTTGTAGTC
ATCCAGGATGAAGGTTCGCTTGGGGACAAACAATGGTCTTCTTGTGCCGGCCACTTCCATGTTGTAGACTCGCATCGTGAGAGAAGGAAAATGTTCCATT
GAAAATCTTTTCCTGGAAAACAAGTAGATTTTTTACTTATTTTCTCATATTTGGTTGGTGAGTAGAATATATTTTTCGAAAAGACTTTTTAGTGTATCAT
TTATGAATGAAAAATAATTTTGAAAAAATATCTTTTATATTTACTAGAGAGTAGCAAATTATTTTTTAAATTGAATTTTAAAAAAAAACTTAAATGATTA
TGGGGCTGGGGTGGGGGCCAGATGGGAGGTTGAGGAAAGGTGTGAAAAATAAAATTTTGATGTTGAAGATATTTTTTAGAAACAAACTTAATTTTTATTA
GTGGTCGGGGTGGGGAGGAGGCTGGTATGCGGGGTCAAGGGTAGGTAAAAAAAATTAAAGTTAAAAATATTTTTCAAAAACAAACTTAAATTTTATTTTG
GGGGTGGGGTGGGGGGAGAGTCGAGTGAAGGGGTGAAAAAATAAAAATTTGAAGTACTCCCTCCGTTTCAAAAATAATGACCCTATTTCCTTTTTAATCT
GTTTCAAAAAGAATGATCTCTTTCCTTTTTTGGCAACACTTCAATTTTAACTTTCTACGTGGCATATTTAAGACCACAAGATCAAAGGGCAATTAAGTAC
ATTTGACATAACTTTAATTTATAATCACAAGATTAAAAAGTCTTCTTTCTTTTCTTAAACTCCGTTCCAAGTCAAACTAAGTCATTCTTTTTTAAACAGA
GGGAGTATAAAATATTTTTTACAAACAAACTTTTCTTTTAGGGAGGTGGGGGCTGATGGGGCGTTGAGGTAGGGGGTAAATAAATAAATAAATAATGAAA
ATAAAAATATCTTTTAAAAACAACTTTTAATTTATTTTTTTTTGGGGGGGGGGGGAAACGGTGGTAGGTGTTTGAGGGGTAGGGATGAGGGTGGGTTGAA
AAAATACAAAATTGAAATTAAAAATATTTTTAAAAAACAAGCTTTAAAAGTTCCTTTTTTATTTTGGATTTAGAGACAAATAAATTATTCAACTAAAAAA
TTGTAATTTGAAGTTGGAGGAGAGCTTTGGAAAAATTTTTCCTTAAATTTGAGGAAAGAGTTCATTTGGAAAACATTTTCCAAAACATTTAGCCCAACCA
AATATGAGAAAATTGGAAAACATCTTTCAAAAAATATTTCCTTCATATCAAACACACCATAGTCTAATGTAGTGATTATATTAATGTTTTTGTTTGATAA
TTGTATGAATTATAACTTAAATAGAAAATTATTATATTCTTGGGTTCTTCTTTAACCAATTAACCCAACCCAATAATTTTATTTATAAAATCATTAAATA
AGTGTTAGCCCAATAATAATAAGCCAATAACCATTGCTGGCATTGAGCGGATCCTTGGTCTGGCTTACTTAACTCAATAGACTTAATTATATATAGGAGT
CATTCTCATAAAAATAACTTCAAATAGATATCTGGGCCAAAATGGCACTTAAGTCTCACAATAGAATATTTGATATGCAATTAAAGAGAGACTTCAAACT
AAACTATATGATTGTCTATCTGTCTATGAAGATTCTATAATTCTAAGATGGATGTTGGTACAGAGCACGCAACATTCTATAAGTAAAGATTGGAAAGCAA
GAAAAGAGTCCTCCGAAATGCGAGGAGGCTCACCACTGACTCTAAGTGCTCAAACTGGATAAACTATGCACTAGATGTTGATCCTGGTAACCTGCGTCTG
CATCATAAGACGATGCAGGCCAACTGACATAAGTACATTGAATGTACGAGTATGCGAGTTGGAATACTAAACGAGTATGCGAGTTTGGAATACTGACTCT
AAGTGCTCATAAAGCTTATAAAACAATTTAAACAACTTAATTCGTCAAATAAAATGCAATAACAAACTCAATTTTACTTATATATGAAACGAATTAGTTT
TTGTGGGAGATTCTATAACCGACAACCACCATTATGAGCCTAAGTCATGATACAACATCTTATACATGTTGCCAGAAGTGTCCTATACTTTGTCGTCGGA
TAGAACTCCATAACTTAGTGGATCCAGTAGCTTAACTTATGTGATCGTCTAAAAAGTATGACTCGCTAATACCCATGATGCCTACATAGTTTTCATGAAG
ACTTGAGTTAATTTAAACTTTTATCCACCATTGGTGCTCAATAGTACTCCCAAAACATATTTTAGGTCATGGTTTTAAAATAACTTCCTTTCTTTGAGTT
GAGATTATTGTTAAACACTTAGCTTTAAAAAGCTCTCTTGGAATCAATGTTCCATTTTCTTGTTAAAATTTTTTTTTTGGGAAATCTTAGTTTCCTCTTA
ACTTAAATGTGAAAACATTTATGAACTTTTAGGGAATACTTAGTTCCCTTATAAGCTTTGAGAAATGAACTCAACTCTTCACTCTTTGCTTAACATGAAA
CTTTTGATCTTAAGTCAACTATTAGGGAATACTTAGTCCCCTTATATTTCTTTAAGAAAAGACTTCTAATTTTGCTCATCACTTGAACTTGAACTTGAGC
CTCCAAACGTAATTAAAACATTTACTAAAGACTCTTGAAAACCTTTAAGAACTTTGCTTTCACTTTCTTATAAACTTTAGACTTGACTCTTTAATTTCTT
CAACTTTGATCTTAACTTTCCTTGAATTGGATTATGGATTCAAAGTTCTGATTCGGGTTATTTGGTGATTTCTAGGTGTTTAGAAATCATTTGAAGTAAT
TAGAATCATTGGTAAGTGTTAATGTACCTTAGAAGGACTTAAAAATGCTAAACTATGAAAACTAGTGAAAAACGCCAATTTGGGTGCATTCGGGGGGCGC
CGCGCCACACTAGTTGGTCTAAGGCACCTTTCTGCCGCACTACAGGCGCGCCGCCCCAGGACTCCAAGTGCAAATGGGGTGCGCCGCGCTTGGTTCTACC
CGAATGCGTCTGAACGTCTCTCTTCTCTCGTTTTCTAATGCTAAATCGCTTAAACCTCCATAGTTCTATTCCCAAACTCTTGGTATCATCAATACCTTCA
ATACCCAGTAGATCTAACTTGAAAAACAACTTGGAAATTATGAATCAACATCAATGGGCATTCAAATAACTCAACCAATAGGGATTCGACAAGATCATCA
AGAATTCACTCTTAATCATGTATACAATACAAAATCCACTTAATTGAAACAAGTTTGGTGTGTGGATGAATTACCCAATACAAAAGAACATACCTTGATA
GAGATCACCCGCGATGAATTCCATTCAAAATTACATGGCGTTCTTGGCGAAACCTTGATCTTTCTCCCTTTTTCCTTCTTCTCTTCTCTTTTCTCCAAGC
TCTAAGCGTAAAGTTAATTTTCTAATCTCAACTAAAGCTGGTTTTTACCCTAAATAAGTATCTAAAACCAAATAGGAAATAAATGGGTGAAAGACTAGTT
TTCCCTTCCTTAACTCCGAATTGGGACCTTTCTTAATCCGACAGTGCAACTTCCGATAAGCATATCTCCCTCATACGATATCGAAAATGTGCAAACTCGA
CGGCGATGGAAATATCTCTCCAAGGGATTTCCAACCATATCATGAACTACCACTAACTCATCCTAAGCTAGATGTTATGACCGTTTGAAATTGACCAAAA
CTCACTTCTTAAATTAAAAAAAAAATCCATATTTCTCCTTTTCTTTCCAAAATGAATATTTTTAGTTTCTTAGCTTATTCCTAGCTAATTCAAATTTCTG
ATATTTTTTTATTTGGTTTATCAATTCTATTTTTCTACACCCCTAAGAATACCTAATTGTTTTATAAGTTGGTTAAGATGAAGCTTAATACCTCTGTGGT
CCTTAAATCGGATGATGCCTACAAGTAATTTATCATCGACTATTGTAAATACATGCTAATCAAAAATAAATTAGACATATGTTAAAGGGTGCGAAATATA
ACATGCCCCTCATAATATCTACATGGGCATTCTTATTTAGGTAAACAACCATTATATCTTAAATTTGTAATTTAGCATTGAAATAATTTAATCATCTATT
ATTTAAGACCAAATGTATCTTAATACTTTAGGATAAATTCAAATTCAATTCATCTCATTAAATTTAACAACAATACTAATTTCTTACAACTTTTAACCTA
TATAAAATCTCAAAAAAAAATCTAACTTTTTATAACCATGTGAACATTATTATTATATTTTGTAAGAATATTGTGAAGACATCTATTTAAAGAGAGTTTT
CTTTTTGTGAGAAGAAAGTGATAGCAATCTAAAATAAATCAAGTTTCTTTATTCTTACATTGCTCTAGATTTTCTTTATCAATGGCTTCAATGAAACAAG
ATCTAATCAAGTAAGTTTTTCTTCGATATTTTTTAATTTCTTCCTTTTTTTTCTTCTTTTATTAACAATCTTCATGATGTTCTGATGTTTCTTCCCTTTC
TTAGTGAGAAGATCAAGAAGCTCAAAAAATCACTTGACTCGAACAGAAATTACTCGCCCTCCCTTATGAATTGGTGATTAGTATGGAACCGACACTATTG
AAGAAGAACAAATAAGCTTTTTAACAAGTTTTGTAATGATTGTGACCATATGAAAGAAGAGCTTGATTTCGTTTTATCAAATATTCATTTATAAAATTCT
CTAGTGAATTGATTACTAAATTTATGTGGCATTTATTTTGCGACAAAATAAGTATTTCAGTTCTATCAAACATTTGAGGACAGCAGCTGGTGAAAAGTAG
TGTTGGCCATAGAAATTTCTAATCAAATTGCATTTTTAAATGCTTATTACTTCAATGGCAAGGGGGTATAATAGGTATTATCAAAATTAACTTTTAGCTT
TCTCTTTGGAAATTCTAGTTGTAGTGCAATTTTCATTTCATGATATATATTACTGCTTTTCTCATAATTCAATTTGTATATTCTAAGGAATAAGAAGTTA
ATTAATCAGCACCAGAAAACACACAGTAATAGAAAAAAACAAATGAAAATATCATTGGAAGGGTTGATGCCTGATTAAGTTGTTTCGGTGTAAATTCATG
TGAACCCAATATCTTTTATTCTAATGATTGATTTTTTGGTGAAATTTAATAAAAATTATACAATTATTAGTAAATTCATCTTAACCCAATATCTTTTATT
CTAATGATTGATTTTTAGGTGAAATTTTAAAAAAAATCTACAATTATTATTTTTTTGCAAAAGAAAAATAATTCATTCCGTGCTAAAAGAATTACATTTT
GAACTCATCAAGTTGATAATTCAGATCCACCTATAATAATAAATACAACACAAAAAATAAAAATAAATAAATAGAAAATTCATCATTGAAAATTTTATGT
AATTTACCAATTGGATGTTTTCTCATATTGGATACGATGTCCTTGTCAAAGGACCAAGCCACTCGAACAAAGTTAGGTTAGTGAAATGCAACTTCTAGAC
CGATGAACTTCAATATGATCTTTGAGAAAAGCATGCAAAACAGGCAAACTAAACTCAATGAAGGCGACTGCCAGCACTGACTCAGACACACATTAGCGGC
TGGGTAGTGGGTTAATTTGATTGGAAAAGTAGAATATCTTCCTCTGAATCAAACAAAATATGGTCCTCCTAATTATAATAATAGTTTTCAATTCAGAGTA
ATTTCAGGTTGACTTTATGAATCCTCAATGTCCGTAACACTTTGTTTAGCTGTAAAACCCTGTATCCAAGACAGACGAAAAAATAGCTTTTCTGGAAAAT
TTGCAGGTGCAACCAACGGGGTCATCGACGGAATATAGACTAACATACGGACCATCCTGCACATTGGTCAATGGGGTAAGAAACCCCAAAAATCTCAGCC
CGGGAAAATTTGGTTAAGTCATGATCGACGGTCCGTGACCATCGATCGACACCCCATTAAACCCACTCTCCGACAAGAGCCACGGATGAACAGCATGGTC
CGTAGATGGACTTGTGGTCCATAGGTCTGACCTTTGGTGAGAAATAGTAGACAATTAAGGGGGAAATGCAGTTGGGTCAACTTCAAATTGTCATAACTCT
TATCACAAAATTAATTAAGTGTCCCATGACCTGCCAAAAGATAGATAATTGAATTAAGTTTCAATATCCACCATCTTATATAAAACCTGACCTTCGAGTA
AAAACTTATGCCCCTTTTAGTAAGGGCCTGTTGAACAGGCCCAACCTACGGACCAAACAACAGACCGTCGATAAAACGACGGACCGTCTGTCCAGGTTGT
CGTTTTGTCCAATAGCAACTTACCCAAGGGTCTTTTGGTCTTTTTCCACTTTGTTTAAACTCTAAGATATGTATTTTTTACCCTAAATCATCAGATTTTA
GTTAGTTTAAGCCTAGAAACATAATTAAAACTTATCCTAAGTCAAATCATTAATCAAAACATAAAAAATAAAAAGCAAGAAAGGAGAAAAACGTCAAGAA
CCCTAGTTCAAGAACGCATCAAGGTTCCAGCAATTCCAGTCTCAAAATCCAAGTGTTTATCCGTGGATTTCATCACCAGATATGTGGGATTTCACTAGTG
GGTTCCTTTCACCCATTGGGTCCCTAGTTTTCAGGCAGATTCTTGATTATCTTATCATGAATAAACCTAAGGTTTCTAGAACTTTGATAGAACTTCATGA
ATTTACTAAATAATTTTCCAAATCAGATTGTAAAGTTATTATTCAATTTATGGCATGAATTTCAGAACCCTAGCTTTATATTTCTTTAGTGCTTGAATTA
CACATGCTAGGTTAGATATTTCAGTTATTCAGTTTAATATGCCTCAATTATTATTGCATCATTATCAAATTAAATGTTGCATTCTCAGTTTGCATGTTCA
GTTTTGACATATCTAATTATTACAAAAATTCAGACATAATCAGTTAGTTACATAATTCATGGGAGTAGCATAATACCGAGTTGGACAAGGGTTCAGCGTG
CCCAATTAGTCCAAGAACTACTAGCCAAGTAGGTTGTAAGTCCTCTCTGTGGGCAATCAGTTTTGTGATCACGCCAGCATGCCTTTTATACCTTTGGCAG
GGTATATTGGGTCGTCTAGATGGGGCGTAGATATCGGACTCCATATTTAGCTCATATAGTTTTATTATTGGTTATTAGTAGCTCCCATAGTTCAGTCAGA
TTCTCTTGCATTGACCATTTATCAGTATACTCAGTATTCAGTTTCAGCATGTTATAAATTGGTCATTACATTCAGTTAGCCTAAAATTTTCTATATCATG
TTCAGATTACTATACTTTCTTTTATGCTTGTTCAGTTATGTTTTATTTCAGCTTTATTTTATCCTACATGTTCAATACATTTCAAGTACTTATGCATACG
TGTGCTACATCTTCTCGTGATGTAGGTTCAGGTTCTCAGCATCCAAATCACGCATAGATCGATTTCTGATCTTCAGTTCAGCAAATTCAGTGGTGAATCC
TCATTCTCCGAGGGCAATAGTCATTAGTTTCTTTTTAGTATTTAGTCTTTAAGTTTCAATTTTTGCTAGACTTGACTGGGGCTTGTTCCACTATTCTAGT
CCAGTTTAGAGTCTATTTTCAGACATAGTTAGTTTCAGCTTAGTATTGAGTTAATATTTTCATTGTATCAAACTAATTGTTTTCAAATATCTCAGTTATA
AAATATAGGTATTCCCCATCTTTTGACTTTAAATTATGATTTAGCTTCTGCATCAGTTTCTATTCTTTAGTATGCTCATGATCATGCCAATAGAGTTATC
TTGGGATCACTTGTGGTCCTAGGTTCTATGTCTGCGTCTCGGGGGTAGCTCAGGGTGTGACAAAACTTGGTATCAGAGCACTAGGTTCAAGAGTCCTAGG
ATGTTTGAAAAGAAGCACTAAGTAAAGTCCTTTTTCATGGTTGTGAAGTGCACCACATCTAAGGTGAGGGAGGCTACAAAGTATTTTTATAAAAACTTCA
CTTTCTTGTTTCTCTTAATGTGTGTAAGGTATGATCTGATTCCATTCTAACTCGACGTTGTGCGCTTAAAATCATTCCTTCTCTTAGAGTTTAGGCATGG
ATTGCTAATGCACGCGATGCTAATGCAGTTCCTCTAATACCCTATAAGGAAGTTCAAATGTAGAGTTTCAGAATGTCAATTTAGCTTTTGGCTCAGAGTA
TGATCAACCAAAACAATTAGTAGGTTTGAGTTCCTACTAATAGAACTGATCGATTAGTGGCAGCCAAAGTTTGTGATTTATTTAGGATGAATCCGCCTAA
GTTTTTAGGGTCACAAGTTGGTAAGGACCCATGAAGTTCATTGATGAGGTTAAGAAAATATTTGGTGTGATGCAAGTAACTGGTCACTATAGGTGAAATT
GGCATCCTACCAGCTTAAGGATGTCACTCACATATGGTTGAATTTACTAAGTGGAAATACAACAAAGATGACTTTGTATTTTGTAACTCAGTATAGCAGT
CTAAAAGTGTTAGTCCAGAAACTCTCTCAGAACCTTTCTCAATCTCTACTCCAGTTGGTGAACCAGTTATAGCTAGAAGAGTATACAGAAATTGCCCTAT
CAAAATCTCTCAAAAAGTTACCTCAGCAAATCTTTTAGAGTTAGAAATGGTAGACCTCGATGTCATTCTAGGCATGTATTGGTTACAATCCTGTTATGCC
TTTATCGATTTTAGAACTAGGATTGTTCATTTTCAGTTCCCAGATGAACCAATCCTAGAATGGAAGGGTAGTAGCTTAGCTCCTATGGGTCGATTCATTT
CATACCATAAGGTTAGAATGATGATCTCTAAGGGTTATCTCTATCATCTAGTTCGGGTTAAGGATTCTAGATCTGAAACCCCAACTCTAAAGTCAGTTCC
TGTAGTTTGTGATTTTCTATAATTACTTCAAGAAGATCTTCCCGGAGTCCCTCCCGAAAGGGAAATTGACTTTGGAGTTGATCTACTTCCAAATACCCAG
CCTATTTGTATTCCTCCATACATAAGGCCCAGCAGATCTTAAGGAATTGAAAGAACAGTTGAAAGACCTTCTATATAAGGGCTTCACCAGACCTAGTATT
TCACCATGGGGTGCACCAGTGTTGTTCGTAAGGAAGAAAGATGGTTCTCTTAGAATATGCATTGACTATAGATATTTGAACAAGGTCACAATCAAGAATA
AGTATCCAATCCCCAGGATTGATGTCTTGTTTTACCAACTTCAAGGTGCTAGTCATTTCTCAAAGACAGACCTTAGATCGGGTTATTATCATCTCAGAGT
CAAAGATACATTCTGAAAACAACCTTCAGAACTTGGTATGCTCATTACAAATTTGTAGTTATGTCATTTGTACTAACTAATGCTTCTGCAGCTTTCATGG
ATTTGATGAACAGAGTGTTCAAACAATACTTGGACTTGTTCGTTATCGTCTTCATTAATGATATCATCATTTACTCTAGGAATGAGGAAGAACATGCGAG
TCATTTGAGAATTTTTTTACAGACTCTCAAGGAACGCCAGTCATTCACTAAGTTCAGCAAATACGTGTTCTGGTTGTAATGTATTGCTTTCCTTGGTCAC
ATTGTATTTAGCGAAGGGATCCAGTGGATTCACAAAAGATAGAAGTAGTGAAACAATAGCCCATACCTACTTCTGCTGCAGATATCAGAAGTTTCTTAGG
TCTAGCGGGTTATTATAGAAGGTTCGTGGAAAGATTCTCCTCTATAGACTAACCATTTACTAGGCTGACTCAGAAGATAGTCAAGTTTCAATGGTCAAAT
GATTGTGACAAAAGCTTTGCAGAATCGAAAACAAGATTGACTACAACTCCTCTCTTGACTCTACCAAAGGGTTCAGATGGTTATGTGATCTATTTTGATG
CATCTAGAGTTCGCCTAGGTTGTGTGTTAATGCGGCGAGATAAGGTTATAGTGTATGCTTTTAGACAACTTAAGGTGCATGAGAAGAACTATCCAACTCA
TGACCTCGAGCTTGCAGCAGTGGTGTTTCCACTCAAGATATGGAGACACTACTTATATGGTGTTCATGTAGATATGTTCACTAACCATAAAATCCTTCAG
TATGTGTTCATCCAGAAAGAGTTGAATCTTTTTCCAGAGAAAATGGCTTCAGTTCCTTAAGGATTATGATATGAGTATGCATTATCATCCTTGTAAGGCG
AATGTAGTAGCAGATGCTCTTAGCAGATTATCTATGGGTACTGTAGCCCACGTTGAGGAAGAAAGGAAGGATCTAGTGAAGGATGTTTATAGGCTTGCTC
GTTTAGGAATTCGCCTTATGAGCATATCAGATAGTGGTGTAACAGTTCAGAATGGGGCAGAATCTTCTTTGGTAGTAAAGGTTAAAAAAAGCAAGACAAT
GATCCAATTTTGCTTGAACTTAAGAATGCAGTCCACAATCAGAGAGTGGAGGTTTTCTCTCAAGGGGGAGATGGTGTACTTCGCTACCAGGATAGATTAT
GTGTTCCTGATGTGGGTGAGTTGAGAAAGCATATCCTTGTGGAAGCCCATTACTCCAGATATTCTATTCATCTAGGTGCCACTAAGATGTACCGCGATCT
GCGGGAAGTCTATTGGTGGAGTGGCATGAAGAGGGACATAGAAGATCTTGTGAGTAAGTACCCCAATTGCCAGCAAGTCAATATTGAACATCAAAAGCTA
GGAGGTATGACTCAAGAGATCGATATTCCTACTTGGAAGTAGGATGTGATCAATATGGATTTCATCACAGGGCTACCTTGTACTCGCAGAAAGCATGACT
AAATTTGGGTGATAGTTGATAAAATGAATAAGTCTTCTCGCTTTTTAGCGGTCAAGACTACACATTCTGCGAAGGTTTTTAGTTTAGCTCTCATTTCTGG
AAGTCATTTCAGAAAGGTCTTGGTACTCAAGTTAACCTTAGTACAGCTTTTCATCCATAGACGGATGGGCATGTAGAGCGTACCATTCATACCTTAGAGG
ATATGTTGAGAGCTTATGTGATCGATTTCAAGGATAGTTGGGATGATCACCTTCCTCTTATTGAGTTTGCCTACAACAATAGCTACCATTCCAGCATTCA
GATGGCCCCTTATGAAGCTTTGTATGGGTGTAGATGTAGATCTCATGTTGGTTGGTTTGAAGTAGGTGAAGAAGATTTAATAGGGCCAGATTTAGTCCTT
TATGCTATGGATAAAGTTCAACTCATTAGAGATAGAGTTAAGACAAACCAAAGTCGTCAGAAATCTTATGCAAATGTGAGAAGAAGGGAATTAAAGTTCC
AAGTGGATAATTAGGTTTTCGTGAAAGTATCACATATTAAAGGGGAAATGAGATTTGGAAAGAAAGGGAAGATCAGTCCGAGATATGTAGGCCCTTATGA
GATCTTAAAAAGGGTTGGCAAGGTGGCATATGAGTTAGAGTTGCCAGCAGAATTAGCAACAATGCATCCGGTCTTCCACGTCTCACTCTTGAAGAAATGT
GTGGATGATCCAGCTTCTATAGTGCCATTAAAGAGTATGGCGGTGAAAGATAATCTTTCTTATGATGATGTACCAGTTGAGATTCTTGAACGTAAGGTTA
GAAGGTTGAGGAACAAAGAAGTTGCTTAAGTCAAGGTTTTGTGGAGGAGTCAGTCCGTAGAGGGAGCTACTTGGGAAGCAGAAGCAGCCATGAAAGCCAA
GTATCCTCACCTCTTACCTTCCGATTCTGCTCTAGCTTGAGGTAATAGTTTCTCTTCAGTTTTCTAGTCATTCATGCATGAATTCAGTCCTAGAATCATG
TTCCCTCAGTTTGTACTTGCATTTTCAGCGTATTTGCATGTTCTCGGAACTCAATTCAGTCAGAAAGTTAGTTCTCAGTGTTTAGTAGTAGGGTTGCAGC
TCTCTCCCTCTATTCCAGCTAGTTTCATCTTCATTCGAGTACGATTTTTCCCAAGGGGGAGATAATGTAACACCCCATATCCAAAATAAACTAAAAACCA
ACTTTTCAAAAAAATCTGCAGGTGCAACCGATGGGTCGATCGATGGACCGTAGACTGACCCATGGTCCATCCTGCACATCCGTTAATGGGGTCAAAAAAA
CCCAAAATCTCAGTCCAGGAAAATTTGGTTAAGTCATGATTGATGAACGGACCTACGGTCCGTAGTTTGTCACCGTCGATTGACACCCCATTCACCCACT
CTCTGACTAGAGCCACGGATAACCAGCACAGTCCGTAGATGGACCTATGGTTCATAATTCTGACCGTTGGTGAGAAATAGCAGACAGTTAAGGGGGAAAT
GCAGTTTGGTTAATTTCAAATGGTCATAACTCTTTTCACAAAATTAATTAGGTGTTCCATGACCTACAAAAATATAGATAATTGAATTAGGTTTCCATAG
CCACCGACCTTGATAAAATCCCACCTCCGAGTAGAGAGTTATGCCCATTTTAGTAAAGTCCTACCGAACAGGCCCAACCTACGGACCAAACGACGGATCA
TCTGTACAGGTCATCGTTTGGTCCGACAACAATTTATCCAGGGGTCTTTTGGTCTTTTCCCACTTTGTTTAAGCCCTAAGATACGCTGTTTTGACCCTAA
ATCATAATATTTTGGTTAGTTTAAACCTGGAAACATAATTAAAACTTACCCTAAGTTAAATCATTATCAAAACTTAGAAAACTAAGAAGCAAGAAATGAG
AAAAAGGTCAAGAACCCTAGTTCAAGAACGCATCATTGTTCCAGCAGTTCCAGCCCCGAAATCTAAGTGTTTCTCTAGTTAATTTCATCACTAGGTATGT
GGGATTTCACTAGTGGGTTCCTTTCACCCATTGGATCCCTACATTTCAGGTAGATTCTTGATTCTCTTATCATAAATAAACCTAGGGCTTCTAGAACTTT
TGTAGAACTTCATGAATTTACTAAATAGATGTTCTAAATCAAGTGGTAAAGTTATTATTTAGTTTATCGCATAAATTTCCAAACCCTAGCTTTGTATTTC
TTTAGTTCTTGATCTACACATGCTAAGTCAGATATTTCAGTTATTCAGTTATATATGCCTTAAGTTTTAATGCATCATTATCAAATTAAATGTTGCGTGT
TCAGTTTTGAGCTATCCAGTTATTACAAAAATTCAGACATAATCAGTTAGTTACATTATTCATGGGAGTAGCATAATACCGAGTTGGACTAGGGTTCAGC
GTACCCAATTAGTCCCAGAACTACTAGCTAAGTAGGTTGTAAGTCCTCTCTGTGGGCAATCAGTTTAGTGATCACGCCAGCATACCTTTATACCTTTGAC
AGGGTATATTGGGTCTTCTTGATAGGGCATATACACCGGACTCCACATTTAGCTCATGTGGTTTTGTTATCGGTTATTAGTAGCTCCCACAGTTCAGTCG
GACTCTCTTGCATTGACCAATTATCAGTATTCAGTTTCATCATGTTATAAATTGGTCATTGTATTCAGTTAGCTTAGAATTCTCTATATCATTTTCAAGT
TATTATACTTGCTTTTGTGCTTTTTCATTTATTTTTTATTTCAGCTTTATTCTATCCTACATGCTCAATACCTTGTAAGGACTGACGCATACGTGCGCTA
CATCTTCTCGTGATGTAGGTTTAGGCTCTCAGCATCCATATCACGCATAGACCGATTTCTGATATTCAGTTTAGCAGATTCAGTGGTGAATCCTCAATCT
CCGAGGACAATAGTCATGAGTTTATTGTCAGTATTTAGTCTATTAGTTATAATTTTGGTTAGATTTAGCTGGGGCTTGTCCATGTATTTCTAGTCCAGTT
TAGAGGCTATTTTCAAACATACTTTCAGCTTGGTATTAAGTTAATATTTCCTTTGTATTAAACTCATTGTTTTCCAATATCTCAGTTATAGAATATGGGT
ATTCCCTATCTTTTGAGTTTAATTTATTATTTAGCTTCCGCATCAATTTATATTCTTTAGTATGCTCATGATCATGCTAACAGGGTTAGCTTGTGATTAC
TTGTGGTCCTAGGTTCCGTGTCCGCGTCTCGGGTGTAGCTTGGGGCATGAAATTAGCTATCAATTAACTCTATTACTATATTATCTAGAAAATAAATGGA
ACCCGGAGTTGCATTAGCTTTCAAGCGGAGGAGCAAAGCTAATGAAGATAGAACTTAGATTTAGGATGTTACTCGGTGAGTAACCTAATTTGTTGATACA
GCTTCTTTCTACTTTCGGATCTTGTAGTAAAGGAAGAAAAAAAGGACTATTGACAACATCAATAGATTTTCTACAAACTCTTCGAAAATGATAATTCATT
ATGCATCAAAGAGGTGATTATTTAGGGTACCATGATATTCTTTCCTTTCTCGAGATGAAATAAGACAAACCTTATTATCCTAGGTTGGAAAAAGCTGATA
GGACTCTGTTTTTTATGTTTCTGTGTCCTCATGTGTGGTGACGTAGGGCGGAAAAGAAAATAGAGTAAAAGTGTAATGACTCAGAAGGTCATTTTTCGAA
ATTTTAAATATTAGTGTAACTTGAGTTAATAAATCGATAGTTAATAGACTAAAGTATTCATGTAATAATACTCTATACATCATGGGTTAAAGTGAATAAA
ATTGTTTAGGGTTTGTCACATTTAGTACATAATCATTTTATTAATTAAATAAAAGAAAGAAAAAGACAAAAGAGTCAGAGAACTTTACCTGTAGACGCCG
AAGGCAGCCACAAGATCTTCATCAGGTAAACCACTAATATGTCTAAATCATATGGTGGCTTATGTGTATGTAAACAAGTATTACTACCTCGTTAGTTGTG
AAAGAAAATACAAAAATTGAACAGAAAATGTTGAAATAAAGTCACTGGTCTATGTATTGAAATTGGGGCTTGTTGGAGGTATAAAATTATATACTATTAT
TTTGATAATATTAATAATAGGTATAATAAATTGAAGTTGGGCATTCTGAAGCCATATGATGATGTTACAACATTTTGGCGGCTTTCAAAATTCAAGGGAA
TAAGAAAAGAAAAAAATGTTAATTTTCATTATAAGTTAGTAGGTGCAGTGTTGTTGAATTGGTGGCTGATAAATTTGAGAAGTAATGATTGGTGAAATAT
ATATGTATAAGTGGATGAAATATTTTTTTCATTAATTTGATAATTGGTCAGTCCCTATTTTGCATTAGTTTTAAGAATTGAGGGATAACTTTTAAAAATT
TAGATTTGACCTTAGACTTGGAACTTGAAAAATAAGATAGCTGAAATGTTAGTTGGTAACAAGATTACGTATTTGATCATAAATTTGGGTGAATTATTAG
GTCAAGATTAAACACATAATAATGTTGGTGTTGTTAGTTTCGAAACCTTATTGTGAATTTATATACTTGAATAGATTGCATCAATTTGGAAGATCAACGG
AAAGGGAAGACTCAAGTCCTAGAGTGATTATTCGAGTGGCTAAGGCAAGTGGATTTCTAAACTCTTGTTAAGCGTATGAAATTCGTGTATTTCCTTGTTT
GGTGTTGAGAATGATTTGGAGACTTGTTGCTTATTTGTTGGTGTTGTATTCCTTGTTGCAAATTGTGTTTTGTTATCAAAACGGTTATCTCCTCATTTTT
CTTTTGAGCATGTCACTTGCATTGTATCTGAGACATGGTTGTGATAAGAGTTAAGTGATATGAGGATGTACCATTTCGAGGTCGTATCGTACGCCGCGAT
GGATATTATATTTCGAGGAACGTATCATGTTTCCCGATAGTTACTATTATCAAGGGACGTGCAATGCGCCGCGATAGATGCATCGACAGAAATGTCCCCC
ATGGGTCCCAGACTGAGAGACAGCGGGTGTGTATCATTAAGGAAGACATGCATCACTATACTTGATATTGCATCTCATGGCATTAAACATTTTTATTATT
GATAAACTTGAACACTTGTTTTGCTGATCTTGTGAGTGTTCCTCTGAAACTTGTGACTGTTGAATATTGAGTTGTTATTGAGAATGTATAAGTTGATAGA
GTGTGGTTATTGAGTTGTGTGTTTGGTAAATATTAAACTGTTAGGCTGTAGCGTGGAGGTTTAGATAGGGTGTAAGGAGTCCCCGTATTTTGTTCACTTA
ACTTGTGTTTAGAGGTTTGCTTATTGGATACCGCGTGGTTTGGTACGCACCTCTTACTTCTACAAGTTTTTGGAGGTTATGAGCCCGGATCTTCATGATA
CCTTCCATTCTCTTTGTTTCCGAGATATCTTGTGGAGGATTGTGATAATTGGTCAGTCCCTATTTTGCATTAGTTTTAAGAATTGAGGGATAACTTTTAA
AAAATTAGATTTAACCTTAGACTTGGAACTTGAAAAATATGATAGCTGAAATGTTAGTTGGAAACAAGATTATGTATTTGATCATAAATTTGGGTGAATT
ATTAGGTCAAGATTAAACACATAATAATGTTGGTGGTGTTAGTTCCGAAACCTTATTGTGAATTTATATACTTGAATAGATTGCATCGATTTGGAAGCTC
AACGGAAAGGGAAGACTCAAGTCCTAGAGTGATTATTCGAGTGGCTAAGGCAACTGGATTTCTAAACTCTTGTTAAGCGTATGATATTCATGTATTTCCT
TGTGTGGTGTTGAGAATGATTTGGAGACTTGTTGCTTATTTATTGGTGTTGTATTCCTTATTGCAAATTGTGTTTTGTTATCAAAATGGTTATATCCTCA
TTTTTGTTTTGAGCATGTCACTTGCATTGTATCTGAGACATGGTTGTGATAAGAGTTAAGTGATATGAGGATGTACCATTTCGAGGTCGTATCGCACGCT
GCGATGGATATTATATTTTGAGGAACGTATCATGCTCCGCGATAATTACTATTATCAAGGGACGTGTCATGCGCCGCGATAGATGCATCGACAGATATGT
CCCCCATGGGTCCCAGACTGAGAGACAGCGGGTGTGTATCATTAGGGAAGACATGCATCACTATACTTGACATTGCATCTCATGGTATTACGCATTTTTA
TTATTGATAAACTTGAACACTTGTTTTGCTGATCTTGTGAGTGTTTCTCTGAAACTTGTGACTGTTTAATATTGAGTTGTTATTGAGAATGTGTAAGTTG
ATAGAGTTATTGAGTTGTGTGTTTGGTAAACTTTGAACTGTTAGGCTGTAGCGTGGAGGTTTAGATAGGGTGTAAGGAGTACCCGTATTTTGTTCACTTA
ACTTTTGTTTAGAGGTTTTCTTGTTGGATACCGCGTGGTTTGATACTCACCCCTTACTTCTACAAATTTTTGTAGGTTACGAGCCCGGATCTTCATGATA
CCTTTAATTCTCTTTGTTTCCAAGATATCTTGTGGAGGATTGTGAGGTAGTTGTTTTTCATCTCAGCGAACTTTTCTACTCTAGTTTATGACTTTGTTTT
TACTTGAATTTTTAGACTTGTATTTTTATTTCAATTCTAATATTTACATTTGAGGCTTGTAGACGTGACAATCTGATTATGGGGATTGAATTAAGTTGAC
TGTGTTTTCGTTATAGAAAATAGTATTGGACTTCTTTTTATTTCAGCACTTTGTTAGATGTTGTGTTTTAGGCTGACTTGTCTTGGTGGGATAAGACGAG
TGTCATCACACCCATTTTGGTTCGTGACAAAAAGTCTCTAACACGATATTAAGATTAAGACTTTGTAGAAGTCTAGTATATGACAGCTATTTTTGTCCTC
AATAAGCTCAAGAAACATTATTTATTGTATTTTAGTCCGGAACATTCAATTACATTCCGATCCATTTTTGGGGTCTTTTCTTGTTTTTTATTTTTTTTCT
TCGAAATCAACCAAATCATATCTTTAGCTCATTAAATTAAATACATGATAAACATATGGATGTTCAAAAGATTATACTCAGATCTTAGCTAAATTATGGG
TAAAATATAGTGATTGGATGCGTAAATACACACAAGATCACCTCTTCATACTTAAAGCTTTTGTTCGACCTCAAACAACTCATCCCCCACATCGGTGCTC
AATTCTACTCCCAGAACATACTTTAGCTCATGCTTTTAAAACAACTTTCTTTCTTTGGGTTGAGATAATTGCTCAACACTTAGCTTTAAAAAGCTCTCTT
GGAATCAATGTTCATTTTCTTGTTCAAAACTCTTTTGGGAAATCTTAGTTTCCTCTTAACTTAAATGTGGAAATATTTATGAACTTTTAGGAAATACTTG
GTTCTCTTATAATCTTTGATAAATGAATCCAACTATTTACTCTTCGCTTAACTTGAAACTTTTGATCTTAAGTCAACTCTTAGGTAATACTTAGTCCCCT
TATATTTCTTGAAAAAAAATACTTCAACTTTTTACTCTTCACTTTAACTTGAACTTGAGCCTTAAAACGTAATTAAGACGTTTAATAAAAACTGTTGAAA
ACCTTTAAGAACTTTGCTTTGACTTACTTCTTAACTTTTCCGACTTTGATCTTAACTTTTCTTGAATTAGATTATGCATTCAAGGTTATGATTCACATTC
TTTGGTGATTTCTAGGTGTTTAGAAATCATTTGATGTAATTAGAATAATTAGAAAGTGTTATTGTACCTTATAATGACTTAAAAAGAGTTATCTATGAAA
ACTGGGCAAAAAACACCGATTTGGGCGCATTTGGGGCGCGCTGCGCCAGACTTGCTGGTGTAAAGCACCTTTCTGGCGCACTGCAGGCGTGTCTCCCTAG
GCCTCCTAACGCATATGGGGCACGCCGCTCCTGGTTCTACCCGGATACCTCTAACTTCTTTCTTCTCTCGTTTTCTGATCCTAAATCGCCTAAAGGAAGA
AAAAAAGGACTATTGACATCATCAATATATAGTCTACAAAATCTCCAAAAATGATCATTCATGTGCATCAAATAGATGATTATTTAGGGTACCATGCGTT
AAGAATTCATCACCAACTTAATTATGTACTTAAGGAAAGTCAAGAAAAATCTAAAATATTCCAGAGTTATGGAGAATAGGCTAGAAATGTTCTACATGGG
AAGGTTCTAGAATTAAGTAGTTGAAGGAATATTCTAGAATAGAGTAGAAAAATATACTTAGTTAGATTGTTCCATCACCTCCTATAAATAGAGGTGGTCC
ATTTGAGTTGTATGCAAGCAACTAAGTAACCAAGAAAGAAAGTAAGCAAGAGATCGAACAAAAGTGAGTGCTCAAGTAAGGAGTGTTGTTGAAGCAAGCA
ACAAGTGTGATCAAGATTGTAATATCGAAGCGGGTCCTTACTTTGGTATAATAAAATTAAGGATTGTGAGAAATCGATAGTACCCATCATCTCCACGCCT
GAATAATATTCAATAACTGGTATCAGATCCTGGTGGATAAGAGCGAGGTAGGAACTTAAAGAAAATCCTACAAGCTATTGTCAGAGGCTACAAGTTGTGA
GGCACTTCTCAATGGCAGACTGCGCAAACACTCTCAATAGCGTTGAGAAGCTCAACGTAAGCAACTACGGATCATGGAGAACGAGAATGCAATATTACTT
TCTCGGTCAGGAATTATGGGATATCATCGGTGGATTAGACACCACACCACCAACAAATGTTGAAGCAGCAAAAAAGTGGAAGGCCAAAGCTGAAAGACCC
ATGTTTGTTCTCTCTTAAACAATTGATTATGAGTTATTACAACGAATTAAGAATGCCAAGACACCCAAAGAAGATTGGGACACCTTAACGATGATTTTTA
CAAAAAAGAATGATACGAGATTACAAAGGCTTGAAAATGAGCTTTTGTCGATCTCTCAATAGAATATGACAATCAGTCAATACTTCTCAAAGGTAAAATC
TTTATCTGATGAAATATCAAAATTAGATCCAGAGAATACTATAACAGAAAAAAGTATGAGGAGAATTATTGTTCATGGTCTAAGGACAGAATACAAAGGC
ATAATCACAAGCACACGAGGGTGGGCCACAGAACCAACTTTGTCTGAGTTGGAAAATCTGATGCAAATGAAAAAGATCTGCAGAAGCCATTATCAAGTCT
TACTATAAAAGACGAAGATAAGACGCTCTTAAACAAAAGGCGAGCCTATAAAAAAGAGAAGCGGAGAAAAGCTCACGGATAGGGGGAGACCAAGACAACC
AACAAAGGCTTCAACAATCGGCAAATGCAGAAATGCTACAATTGTGGAAAGAAAGGACATTATGTGAGAGACTGTTGGTACAAGAAAATTGAAGGTAATG
TACCAACTTCTACTCAAAATAAGAAAGATGAAGAAGAAGTTTGGGATTTTGAGACCTCTTATGCAGTTGAAGAAACTAATGAAGAAGAGGAGCTTGTCAT
CTGTCACTCTAACAAAGAAGAGAGAATTGCACTTGCAACTATGGGTGAAAAATTGGTCGATTTTGAACATGATTGAATCGTTGATTCAGGATGTTCAAAT
CACATGATTGGTGATGATAAAAATCTCATTAACATGAGCGAATATAAAGGTGGTCGAGTAGTGGAGACTACAAAATAATTCAAAAATATCAATAACTCAT
ATTGACAAGACGGTGTTCGTGCCTCATCATAATTCTAGACAAGTGGAACTTCAAAATGTCTAACATATTTCAGGTATGAAGAAGAACTTATTATATGTAT
CACAACTAACAGATTTTGGTCACTATGTCTTGTTTAGGCCAAATGACGTAAAAGTATATCGAAATTTAAAAGTTATAAGCATGCCAATAATGGAAAGGAG
AAGGTTAGAATAAATATACGTCATGCCAACCAAGAAAACTTATGTGACTTGATGAAGCACTAACTTGGTGGTACAACAAAGTCTCCTAGCCAGATTCAAG
GAAATTGGAGCAAGAGCTGTTAGGATCGAAAATAAGCAGGTGTAAACGCGGAAGGCTAGCAAAGCAAACCTCAAAAGATCACGAGTAAGAAGACAACGAG
AAATATACCAAAAGACACATAGATTTAACGTGGTTCGGTCAATCGACCTACGTCCACAGAGGAGATGAGCAATCCACTATAAATATGAGAGTACAAATAC
AGAGGGAAACAACCTCAACCAAATTCACTCAGAATACATGGGAGGTTCACACAAGTGATAACATATCAATCTTGTGACCCACAAATTCTCCCTCTAACCA
AAACTCTCAAAGCCCTTAAGACTACATTGTGAATGCTAATTAAATTAGAAGGAACATGTCTCTATTTATGGAATCCTAAACCTTTTCCTACAAGAAAAGG
ATTAGTCAATCCAAAACCTTTTTCCTACAAGGAAAACCTATTTATGGTAAGAAATTTAGGGCAAATAAAACCCAACAAGAGCTGCAATATAAACTTAAAG
AAGAAGGACAAAGAAGTAAGGCTGAACAAGAATACGAGGTATCTGAAAAATATAGCTATAATGATCCGGAAAATTATTTTTTTGGAGATTTTTGAGCTAT
TCAATAATTATGATAATTTAATTGAAAATATTTATTAAACAATTATTTTTGATTAATTGGTGAAGTTGATTTGAAAATTTTAAACTATTTATTTAGCTAT
GATTGTTTAATTGATGGGTATATATTAAATAATTTATTTAGTTAGTTGGTGGTTAATGGGCAATTTCATAATTTATTAATACTATTTGACCCATATTAAA
ATAAGTTACTAAGGTTTATTACTTTTAATATAATTAACTAAGAAAATAAGATAAGGAATGGAATAGAAAATTTTACCTCGGTTGAGAGGCGGCGGACGTG
GAAACCGAAAGGCATACATTCAGGTAATTAGTTGCTAAATTTTTAATAACTATGGAATGAGATAGAAACTATTTTGTGGTGTGTTTGTTGTTAGGAAAAG
AATGGTGCGAATGACGATGTTGTACGTGTTGGGGGGAGGTTTATAACTTTGCAACAAAAGGAAAATAATTATTATTATTATTATAAGAAGTTAATTGTTC
TGTTTCTTATTATCCTTTTCAAATCAATTTGATAATCCCTCCTTATATAATTAAGCATGGCTTTGTTACAATATTATATGTAATTAAATTGAGTGTATTA
TAGTATAGGAAAACTGTTAGGATGGTAATGTTTGGAAAAATTATGACTTAACTCTATATTTGAAACTAGAAAATATGAGATTTGACCTATTCATTGGAAT
CAAGATTTAGGAAATTTATTATATTTTTGAGTGAGTTTTTGGTCTAAGTTAGACATATGATTGTTGTTAGTTTCGAAATCTTATTGTGATTATATATTTG
AATACATTGTATTATTTGGAAGTCGGTTGAAAGAGAAAGACTCAAGTTTTGGAGTAATTGTTCGACTATTAGAGACAAGTGGATTTCTAAACTCTTGTTA
AGTGTATGAAATGCGTGTATTGCCTTGTGCTATATGTTTGGGAGTAATGGGACTTGGTGATGGATTGACTTATCCACATTGATTAATACTAATGATGAAA
ACAAAGGGTAAATGTGAATAATCGCTTGAGTGTGATATGTTGATAATGAAGAATGGTTTGAAAGGCTTGTTGAGTCATTGTTGATGTTGAAACTGGTCAT
ATCCTCTTTATTTGTGTGAGCATGTCATTTGCATTATTTTAAGACATGGTTGTGATTTGTTATGTGCATTGAGAAAAAAATGAGAACTTAAAGAGGATGT
ACCATTTCGAGGGATGTATCGAGCGCCGCGATGGTTACTATATTTTTAGGGACTTATCGCGTGCCGCAATGGTTACTATTACCAAGAGTTGTGTCGTGCA
CCGCGACAGATGCATGGACATATATGTGCCCCATGGGTCCCGTACTAAGAGACAGCGGGTGTGTTTCACTAGGTCAGACATGCATCATTATACCTGACAT
TGTATTCCATTGCATTGCACATACTTATCATTAGTGAACTTGATATGTTTCTTGCTGATCTTGTTATTGCCTTTCTGCGGAACTGGTGATTGTTGAATAC
TGAGCTTGTTATTGAGGATATGTAAAGTGTTGTTGTTGAGGATACGTAATATTTTTGAAGTGTTGTTATTGAGGATATGTAATTTGTTGAAGTGTTGTTG
TTGAGAATATGTAATTTTGTTGAAGTGTTGTTGTTGGGGTATGTAATTGGAAAAAGTGTTGTTGTGGAGGATATGTAATTTATCTAAGTGTTGTTGTTGA
GTTACATGCTATGTAAATTCTGAGCTGTTAGCTTGGGCTGATTTGTATGTAGGTTGTAGTTGTGCAGGTTCGGTTGGGGTGGTAGGAGTGCCCGCATTTT
ATCCCCTTAGCTTGTATTTAGGGATTTACTTGCTGAGTACCGTGTGATTTGGTACTCACCCCTTGCTTCTACAAATTTTTGTAGGTTATGAGCCTGAATT
TTTATGGTACTTGATATTCTCTTCTTTTTCGAGGCTTCTTGAAGATTTGTGAGGTAGTTGTTTGTCGTCTCAACAGGCTTTCTTTCTCCTTAATTATGAA
CTTGTTCTATTCTAGAAACAAGATCATTTGAGACTTGAGTTTTTCTTTTGAATCAATTGTAATACTTTAGAGGCTTGTACACGTGACAGCCAGATTTTGG
GGGTACTTTTTTGGATTTAATTATAAAATTTCCGCACTTTATTCTAAAAATTGAATTTTTGTCTGACTTGTCTTGATGGGATAAGAGAGTGTCATCACGT
CTAATATTGGGTCATGACAATAGCGCACATACAGAAGAGATATTTTCAAACGGAAAAAATAACAATTCATGGAAAAAAAGAGTATATGAAACTCAAGAAA
TGTTGCAAAAAAAAGACGAAAAAAATCTGCAACCTCAACTAGGAAGGAAGACACAATTGAAATGCTCAAAGACCAAGTATTAAAATGCAACACTAACAGA
GATGATTTACAATAAAGATGCTACTATATTTGAAGAAGCTTCAAAGAGTATGGATCAGAATAATCCGATGAAGGAGGAGTTTCTTAAACGGCATGGACGT
CATGATGCTTGCAGAGCAAGAATCGCTCACAATGGACGAAGGAAAAATTAAGTTGATGTCGAGGGGGAGTTTTAAGAATTCATCACCAACTTAATTATGT
ACTTAGGGCAAGTTAAGAAAAATCTAGAATATTCCAGAGTTATGGAGAACTGAAGGAAAATAGTCTAGAAATGTTCTAGATAGGATAGTTCTAGAATTAA
GTAATTGAAGAAATATTCTTCAATAGAGTAGAAAAATATACTTAGCAAGATTTTTCAATCACATCCTATAAATAGAGGTGGTCCATTTGAGTTCTATGCA
AGCGACTAAGTAACAAAGAAAGAAAGTAAGCAAGAGAGCAAACAAAAGGGAGTGCTCAAGTAAGGAGTGTTGCTGAAGCAAGCAACAAGTGTAATCAAGA
TTGTAAAACTGAAGCGAGTCCTTATTTTGATATAATAAAATTCAAGATTGTGAGAAATAGATAGTGCATCGTCCTCCACGCCCGAATAATATTCAACATC
ATGATCTTCTTTCCTTTCTCGAGATGAAGTAAGACCAATCTTATTATCCTAGGTCAGAACAAGTTAATAGGACCTTATTTTTTATGTTTCTTTGTTCCTC
CCATATGGTGACGAGGAGCGGAAAAGAAAAGAGAGTAAAAGTCTCTAACACGATAGTAAGATTACAACTTTGTAGAAGTCTAGTATATGATCAGCTATTT
TTGGTCCTCAATAAGCTCAAGTGACATTAATTATTGTATTTTAGTCCCGAACACTTAACTACACTCCGATCCAATTTTTAGATCATTTCTTATTTTTTAA
TTGTTGGAAATCAACCAAATCATATCTATTAGCTCATTAAATCAAATATACAATAAACATATAGATGTTCATAAGATTATACTCAGAACTTAGCTAAATT
ATGGGTAAAATAGAGTGAATGGATGTGTAAATACACACCAGATCATCACTTCATACTTAAAGCTTTTATTCAACCTCAAACAACTCATCCTATCCAATGA
GATATTCAGACAAGGTTACTTACAAATATGATTTGCACAGAAAGATTAATCATTAATCATGATCCAAAATTCACTCATTCAAACACACTCTATCAAATTT
AAGATAGTTCATGCAAACATTACAAATTCTATACTGACACTTCACATATATTATAACATCCCACCTTAAAATAAGAAGTCTTACATCAACAAAAATAATA
CAAGAGATATGTTGGATATATAAATAAGAAGGTGTTACACATTAGTAATACGATTTAAAGTTGTCGTAGCCTAGGATCTAAGTGGACAACATCACTAGTG
GGTTGGCCTATTATAAATAACATCATGATCAAGATGTGGAAGCCTTGTCGATGTGAAACAAAGTCCAACTAAGATTACGTAAATATGAGTAACGTGGGAT
GAACTTTGTGTTGAGTTTAGGCAAATCACATTAGGTGACGTTGAGTCCATAAGAAGGGGTGTATATGACAATCCAAGTTAACATAAGAAGTACACATCGG
CAAAATATAGGAGAGATATTGGATATGTATTGTAGGGGTGTACATAGGTCTTACACACTAGTGACGTGTTTTAAGTCGGCCTTAAGTGGACAATGTCATA
AGTTGGGATGCATATAGTAAGGGTGTACATAGGTTGGTTCGGTTTGGTTTTTTATTAAAAAAAATATAAATCAATCATGTCGATTTATTAAATCTAAAAA
ACAAAAATCAAACCATATAAAGTCGATTTTTTCGATTTCGGTTTTAGTCTGTTCATTCGGGGTTATTTCAGCTTTTTCAGTTTTTTATAACTATACGTTG
TTTGAAAGAGAGATCAAATATTTTTTCACTTACCTGTGTGATAAGCTAAACATAAAAATGATAAGTGAATAAAAATCTTCCAAAAGACGATAAAATGCAC
ATGAGTACAATTTTTTTAAAAAAAATATCAATGTTCAGTATGTTATATTAATAAGATCAAAGGCAACAATCAAACTGAATACAAAACGAATCATTTATAA
AGTAAATTGTTAACTTCAAATTTGAAAAACTATAATAATATTAATGTAACTTTTGATCTTAGTACAAAATGAAGTATTTACAAAACCTTACAAGCCCAAA
TTTGAAATAATATATGTATAAACATTAAAAATCATAAACTAACTAAAAATATATTAACAAAGTAGATTATAAATAGTATTTTTTATCTATAAATAAATAA
AATTATATATTTATATTATGTCGGTTTGATTTGGGTACGATATGACTTTTTTTCGTTGAATACCAAACCAAGCCAAGAGTGGTCGATTTTTTTTTCCAAC
GCCAAACCAACTAAACCAAATCACAAATCATTTTTTCGGTTTGATTTGATTCGTCGATTCGATTTGACTTTACGAGTTGACTTGTACACGCGAGTGTATA
GCTACTGAAGTCATCGAGTTACCAAATGTATCTATTGAAGTCATTGAGTTACCAGAAAATCAAATTAGCTCACTGTCCCAAGGAAAACTTAAGACATGCA
ATTTCAGTATGATCAGTCGCTCTCCCCTTGTCCTTTTATAATATTTTATAAAGAGTGATTTCATTATTTTACAAAAAAATGGCTTAGGGTGAACACACAC
ACACACATATATATATATATATACACGTTAAAGGGTGCAAAATCAAACATGTCGCTCATAATATCTACAAGGATATCCTTATTTAGGAAAACAACCATTA
TATCTTACATTTGTAATTTAGCATTCGAATAATTTAATTATTAATTATTTAAGACCAATTGCCTCTTTATACTTTCGGATAGATTCATATTCAATTCATC
TCATTAAATTTAACAATTAAACTAATTCCTTACCACTTTTGGACTTCTATAAAATCTCATAAAATTTGTTAACTTTCTATAACCACGTGAACATTAAATA
TTATATTTGGTAAAAATATTTTGAAGACATCTATTTAAAGGGGGTTTTCCTTTTGTGAGAAGCAAGTAAATCTAAAATAAATCAAGTTTCTTTATTCTTA
TATTGCTCTAGATTTTCCTTATCAATGACTTCAAAGATTCAAGATTTGATCAAGTTTTTCTTAGATGTTCTTATATTTCTTTGTCTTTTGTCTTCTTTTT
TAACAATCTTCTTGATGTTTTCATGGTTCTTCTGTTTCTTAATGAGAAGATCGAGAAGTTTGAAAAATTACTTGACCTCGAACGGAAATCAGTCACCTTC
TTATATGAATTGGAGAGTAGTATGGCAACCTATGCTGCGGAAGAAGAACAGATAAACTTTTTATTAAGTTTTGTAATGATTGTGACCATATGGAAACTGA
GGTTAATTTTCATTTTATCAAATATTCATTTATGAAATTTTCTAGTAAATTGATTACTAAGTTTATATGGTCTTTTATTTTGCAGCATGATAAGTATTTG
AGTTCTGTCAAAAACATGCGAGGACAACAACCGGCGAAAAGTAGTGTTGGTCATCAAAATTTCCAATCAAAATGCATTTTTACATGCTTATTCTTCAGTA
GCAAGGGGTGATGTTAGGCATTATTAAAACTAAATTTTAGCTTTCTCTTCAGAAATTCTAGTTGTACTGTAATTTTCATTTCATGGAATATATTACAACT
TTTCTCATAATTCAGTTTGTATATTCTACAATATAAGAAGTTAAGTAATCTACAACAAAAAACACGTAGTAATAGAAAAAAACAAATGAAAAAATTATTG
GAAAGGGTTGATGTCTGATTAAGTTGTTTCGCTATAAATTTATCTGAGCCCAATATTTTTTATTCTAATAATTAAATTTTAGATGAAATTTAACAAAAAT
TCAACAATTATTATTTTCGAACTCATAATTTGGAAAAAAAATAAATTCATTCAGTGTTAAAAGGATAACATTTTAAACTCATCGATTTGATAGTTTAATT
CCGCCTATAATAATTATAAGGCGTAATGACCTGGTAGACCCTCGTACTTGGCTCCGTTTGTAAGTTGGACCTTTGTACTTTTGATTTTGCCAACTGAACC
CTTAAACTCATTCAAACACAATATTTCAAATCCTTTTCTCAGCATTTGTGTGTGTGTATTACACTCAATTTACACATGATATTCCACGTCATATTTTAAT
GACACATTAGTATTATTATTATTTTTTAATGACACATCAGAAATTAATTATTTAAAAATAAATAATATTTTTTAAAAAGGTGCAAAATTCTCTCTCTATC
TCTCTCTCTCTCTATATATATATATACTCATTTTCCATATTTTCACTTCATCTTCTTCCTCCCCACCCTCTACCCTTCACCATAAAAAATAAAAATCACC
ATTTTTCGTCTTCCTCACGCTCAAAATTTTTCTTATTGACAAATGTGAAAGATTAGTTAGCTCTTACACATACTTTCAGTTTTATTTATTTAGATTTGGT
AAAAAATCTATCAAGAAAATTTTAAATTGAAAAAAAAATATATGCCTATAAGTAAATTCAAGCAATAGATTTTGAAAAATTAAGTTTTAAAAAGATGAAT
GAGATGTATTTTTAAAAAAAATTATTATGATTATGTTAATGGTGTATATGTCAAAAGAGAAGAAAAGAAAATGGATAGTGGCAGGGGGTGAGTGGGTGGG
TGGGGAATCTAGGGCTGAAAAGAAGAGGAAAAAGGTGGGACTGGGGTGAAGTAGAATATGAAGAGAGAAAGGGTTGTGGTGGCGATGGGTTGAGTTGGTT
GAATAAGGAGTTTTTGATTATTTTTTGGAAAAGTGGTGTGGGAAGAAGATAGATTCTTTTCTTTTTTTTCTTTTTTTTTATATAATTTTAATAATTCAAA
ACTTAAAATTTAAAGTTTAAAAAATGATGTTCACTCGCCTTAAATGCGTGTGCTTACTCTCTCTCTCCAAGTCAATTATTTTAATGTCACATAAGCATGA
TCAATGGTCAGAAGGATTTAATATATTGTGTTTTATTTAGTTTAGAGGTCTAGATGACAAAGAGGTAAGTAGAATGGTTCAAAATACAAACTGATACAAG
TATAAAGGTCCACCAAACCATTCCGACTAATAAATACAACACATAAAAAATAAAAATAATTATAAAAAAATTTAACAGTGAAAATTTTATGTAATTAACC
AATTTGATGCTTTCTCAGATTGGATACAACAAAATTTAGTCCTCCTAATCATTATAATATCTTTTTTATATCTTGAGAAATACAATTGAAAATTTGTTCA
TGGAGAGTTTAATTTTGAGTAGATTCAGAATTTGCCCTTTAAATATATTAATGAGCAGTTTTAGGCAATTAAACTTGATGAAAGTGAGTGTTTCTGTTTT
CCTTCAAATATTTAACAAATTAAATAATATTTGACAATACCATAAAAGTCTCATCAAATTTCATAAAGCACAACAACTCAACACTATATGGAATAGACAT
ACTAAGCAATTCATCTTTATTTTGCTAATAAAGTACTTAAATGTATAAATCAAAAAACGTTTGAAGATTTTTATCTATATGCCTAACTTTGGATGATTTT
AGTTGTTGATGGACGAGAAAATATTTTAGATTACGTAAACCTTAATACATTTAAATCTTTAAAAGGTGAATTTTACAGATTTTTATATTGGAAAATTGAC
TTTATTCATTACTCATGAATTTCTTATTCTCTTGTTTAATTTACTCTAAATCATGAATCGTATAAAAATAGAAGTCTTAGATTTTAGTCAAGTAATTGAA
AAAGAATTATATTATTGTCATTTATTGTCTTTGTTTAGCTACTTTAGATACTTAAAGAGTACTAGTTTATTGATTAATGAAATTTATTTCTCTTTTCTAT
AATTTTATTTTATCATTAATTGGGATATTACCTCTTGTGCATCCAAGGGTGTGAAATAAACCTTCAAGAAGAAAGATTTCTAATTGTAGATTTTAATTTA
TGCACCATTCTCAACACAATTTTAAAAAAAAAAAATGTTAGTTGCATTCTTTCTTTGTCACGTTCCAATTTTTATGAGGAAGAGTCTAGTACTGACATTT
ATAATATCTATTTTTTTATTCCGAAGGTCAAAATTAAATTTTGGAAGCTTGGGATTACGATTTGGGGTGATTAAAAATGAATTTTTAGAGATTTATTCAT
TCGGTATGATTCTAACCAAGAGTTGGAAGTACGAATAAGTGTGTATCTATTGGTTTGATTTGGTCTGATTTATTAGTTTTTAAATATGCTAAATCAATAA
TTAAATCAACAAGCTATTTGTTACCGATTTTTTATTTATCGGTGTTTGGTCTTTAAAAATTTGATTGTCAGTTTAACCAATAAAGAATGCTTTCAAAAAA
ATTATATGACTTGTCCAACAATTTGGTCGCAAGAGAAATCAAATTACTCATTGAGTGCAAAAATTATGCTTAGTTTAGTAAAATTATAATAAATACTCAC
AATTCACAACCCTAGCCGTTTTTTAACCCTTGTCGTTGTCATTGCATACCCTACCCATCATTGTTCTTAGTTCTTTTGGTTTTGATGTTAAGAACCTAAA
CACTAAGTTATGCCAAAATCTAAAAGGTAAATGCAGAGAGCAGAGTTTAACAGTGTTAATTGTGTAGGATCCTTATAGTTATAGGGTGTGAAAAGATTGT
TTAGTGTTTCATTTATGAATGAAAAATGCTTTTGAGAAAATATCTTTTAGTTTTACAAGAGTAGAAAATAATTTTTGAAATTGAAAATATTTTTTAAAAA
CAAACTAAAATTATTTTGGGGGTGGGGTGGGGGGCTAGATGGGGGTCGAGGAAGGTGTGAAAAAATAAAATATTGAAGTTAAAAATAATTTTTAAAATAA
ACTTAATTTTTTAGGGGTGGGGGTGGGGCTGGTAGAGGGGTCGAGGGTAGAGGTAAAAAAATAAAATTTGAAGTTGAAAATATTTTTTAAAAACAAACTT
ATTTTTTTGGGGGTGGAGTCGGGGGCAGGGTCGAGTGTAGGGGTGAAAAATAAAAATTTGAAGTAGAAAATACTTTTTACAAACAAACCTTTTTTTAGGG
AGGTGGGGGATGATAGGGCGTTGAGGGTATGGGGTAAAAAAAATAAAAAAAATTAAAAATATCTTTTAAAAATAACTTTTATTTTATTTTATTTTCTGGG
GAGGGGGGGGGAGGGATGGTAGGGGTCTGAGCGGTAGAGGTGAGGGTGGGGTGAAAAGATACATTGAAGTTAAAAATATTTTTGAAAAACAAGCTTTAAA
TTTTCTTTTTGTATTTTGGGGTAGAGACAAAATAAATTATTCAACAAAAAAATTGTAATTTGAAGTTGGAGGAGAGTTTTGGAAAATGTTTTCCTTAATT
TTTGAAGGCAAGTCATTTTCCTTAAATTTGAGTAAAAATGAGATGATTTGGTAAACATTTAACCCAACCAAACATGTGAAAATTAGAAAATATTTTTCAA
AAAATCTTTCCTTCATACCAAACACAACGTAGTCTAATATAGTGATTATATTAATATTTTTTGTTTGATAATTATGTATGACTAAAAATTAAAATAGAAA
ATTATTTTATTTTTGGGTTCTTGTTTAACCCATTAACCCAACCCAATAATTTTTTTTATAAAATCATCAAATAAGTGTTAACCCAATAATAATAAACCAA
TAACATTTTTTGTCACGTCCTGAGCCTACACCATGAACATGGCCGGCACACAATAATTATTGTTGTCTTTGAGCGAACCCTTGGTCTGGCCTACTTAACT
CAGCGACAGACTTAACTCAATATAAGAATCATTCTCATAAAAATAACTTCAAATAGATATCTGGACCAAAATGGCACTTAAGTCTCACAATAAAATATCG
AAATGCAATTAAAGAGAGACTTAATACTTAAATTGTCTACCTGACTATCAAGCCTCTATAATACTAAGAGGAAGTTCAGACAGACCCCCCGACATCCTAT
AAGTAAAGACTGGATCCAGAATGCAAGGAGGCTCACCATTGACTCTGAGTAATCAAACTGGATCAACGAGGCACTGGATGTTGATCCTGCTTACCTGCGT
CTGCATCATAAGAAGATGCAGACCAACTAGCACCAGTACATTGAATGTACGAGTATACGAATTGGAATGCTAAACAACACTTAAGCTCGAAAAGAATATG
AAAAAAACATTTACCCTGACTCTGCTCAACTCATGAAATATTAAACTTAATATAAAGCTATAATGACACATGCAATATATAAAATAGAAAAAAAAAACTG
TAAAACAGTGTAAACAACTTAGTTCGTTAAAGAAAATGCAATAACAAACTCGATTTTACTTATATATGAAAGTAATATAGTTTCTGTGGGAGATTGTTTA
ACCGACTACCACCACTATGTGCCTAAGTGATGATATAACATCTTGCCCACGCTGCAAAGGCATCGCATAGAACTCCTTAACTTCGCGGATCCACTATCTT
AACTTACGTAATTATTTAAAAAGTATGACCCGCTAATACTCATGGTTACATGGTTTTCATGAAGACTTGAGTTATTATGAACTCTCATCCCAGATTGGTG
CTCAATACTACTCTCAAAACATACTTTAGTTCATGCTTTTAAAATAACTTCCTTTCTTTGGGTTGAGATAATTGTTCAACACTTGGCTTTAAAAAGCTCT
CTTGGAATCAGTGTTCCATTTTCTTGTGGGAAATCTTAGTTTCCTCTTAACTTCAATATGAAAACATTTATGAACTTTTAGGGAATACTTAGTTCCCTTA
TAACCTTTGAGAAATGAACTCAACTTTTCTCTTTGCTTAACTTGAAACTTTTGATCTTAAGTCAACTCGTAGAGAATACTTAATCCCCTTATATTTCTTG
AAGAAAAGACTTCAACTTTTTACTCTGCACTTTAACTTGAACTTGAGCTTTAAAACGAAGTTGAAACGTTTAATAAAGACTCTTGAAAACTTTTAAAACT
TTGTTTTGACTTACTTCATAGCTTTAGACTTGACGCTTAACTTCTTTGACTTTAATCTTAACTTTCCTTGAATTTGATTATGTGTTCAAGGTTATGATTT
GTGTTCTTTGATTATTTCTAGGTATTTAGGATTCATTTGAAGTAATTAGAATCATTGGAAGGTGTTAATGTACCTTAGAAGGACTTAAAAAGACTAAATT
ACGAAAACTGGGCGAAAAACACCGATTTGGACGCGTTCGGGGCTAGACCAGTTGAATTGAGGCACATTTCTAGTGCACTGCGGGCGCGCCGCCCTAGGTC
TCCTGGCACATATGGGGCGCGTCGTGCCTGGTGCTACCTAGATGCGCCTGAACGTCTTTCTTCTCTCATTTTCTAATCCTAAATCCCCTAAACCTCCATA
GTCTTATTCCCAAATCCTTATGATAATCAATACCTTCAATACCCAGTAGATGTAACTTGAAAAACAACTTGGAATTTACGAATCAATATCAATGGGCATT
CAAACAACTCAACCAATAAGGATTCGACAAGATTCATCAAGAATCCACTTCTAATCATGTAACAATTCTAAAACCACTAAATTGAAACAAGTATGGTGTG
TGGATGAAATGACCCAACAAGGAAGATCTCAGATACCTCAATAGGGATCACTCCCAACGAGTCTACTCGAAATTCCTTGGCGTCTTGGCGAAACCTTGAT
CTTTCTCCTTCTCCTTCTCCTTCTCCTTCTCCTTCTTTTCTCTTCTCTTTTCTCCAAGCCCTAAGCATAAAGTTAATATTCTAATTTGAACTAAAACTGA
TTTTTTACCCCAAACAGATCCCTAAAACGAACAAAATAGGAAATAAATAGGTGACTAGTTTACCCTTCCTTAAATCCGGATTGGGACTTTCCTCAATCCG
ACGTCCTACTTCCAATAGGCATATCTCCCTCATACATATCGAAAATGCACAAACACAGCGGTGTTGAAAAGATCTCTCCAAGGGCTTTCTAACCGTATCA
AGAACTACCTCTAACTCATCCGAAGCTAGAATTTATGACCGTTTGAAAATGATCAAAACTCACTTCTTAAACTTAAAAAATTTTCTTTTCTTTCCAATAA
AATATTTTTAGTTTCTTAGCTTATTTCTAGCTAATTCAAATTTGTGAGATGTTACACTTTTTATATTCAATTTATCGATTCTATTTTGTACACCCCTAAA
AATACCCACTTATTCTATAAGTTGGTTAAGATGAAGCTCCATACCTCTTTGGTCCTTAAATCGGATGATGCTTACAAGTAATTTATCATCGACTGTTGTA
GATACATGCTAAACAAAAATAAATTTTTAATTTATAAAAAAAAATTGTCCATATTTACTAATATTTTTACATTCACCCATGTTGGGACAACATGATAACT
GGATATATCTGTTTGATTGCCTGAGATGGACATGAATTTAAACCTTCAACGAGAACTTTACTGTATCTTCAGAACAGAGACATAATACAACATATATCGG
ATCGATCCGAAAAATTACAGCAATGTATATATGATTTTTCTTTCCCTCCTTGACTAATTACAAACCGTCCTACATTGTCATGTTCATCACTATTTTTACT
TAATTCTGTTCAGTGGAATTCTTTCACTTTGTCGCGCAACTCTTGCCACATGAGAGATCCTTTGAGGCATGGTCATTCCTCCGGAAACAATGATCTCTGC
ATTTTTTTTGGCTTCACTGTTAGAAACACTTGAAAACAGTTCTGTAGACATGCCCGAAATTCATTTGATGCATTTGGAGATAGATCTTACCATGGATAAG
CTTATGTTGGTTAGTTTTAGAAAGTTGGATAACTCAGTAAACTAAAGACACCATCAACTAAGATGCATGCTTCAACCAGTCAACCGAGCTACTAGTACAA
AACAAGGAGTGACATATTAAAGACGAGTTACCAGAAAACCAGAGACATACCAATGCCTTCACGGATGGACATGTTTGGTTTTATGACATCATTGGCGTTA
ACCAGGAGTACATCACCAATGTACAAATGGTTTGTAGGGACAAAAACACTATACAATTCTTCATCCCCTTCTTCTGTCTGCCATCCAGAAATAATGTGTC
AATGTACATATATCAGCCAACAATATTATTAAATGCTCTTTTCTGTGTTCTATTATTGTTGTTCTTTCTACTTCTCGTCTTTCATCTCTATCAAGTCACC
GGAGAGAATATGAGGAGCTTATCTTTGAAAAATGTCAGTAGTTCAAGAAAGAACTTATGCACATCAAAAGAACATTCAGCACTGCACAGCAGCAAAAGAA
AATATGCATTTCTGAAAATAATAAGAAGGATGGTTTTTTCCCTATTGCAGTAATAAGGGAAAACTTGCTACAGCGAACAAATACCTGAAGGGTAACTGAT
GATGTTATAAAACCAAAAGCATATTCCCCCACACGGGGATGACGAATAATTGCCACTTCCTTAAAAGCGGTGGTGTTTTGATCTGTAGATTATATACGAA
TAAAAGTAAGTATCAAGAACAAGTAAAAAGAGAATACAGCAAAACCAAAATACTCCAGGTAGCAACCTCAACTCTCAAAATAAAGTACTTATTTCTTTAT
CTTCGAGACACAATTTTGATGTATTGTCTGTCTTATGGTCCTGATCCCCATGCTTTTTGACACCCTTTATTATTTAAATGGAAGTCCAGGACATCAATGA
AAGTTTATTTCAGATTTCACATGTTTACTTCACAGCTCTGAGATTTGTTACACTCCACTGCTAGAGATTATCCTTACTTTTTCTTTCTTTTGCTATCCAC
CCTTTTCTTGATGAAAGGAACAGGTGATAGTAACATAATATTCTGTAAACTATTATGAAATAACCCCATTCACCCCACCCCCCACCCCCACCCCATCCCA
CACACGGTCTCCTTGTTTCTTCTCCTTTCCCATTTCCATCTCAGGATGATAGTAGCAAGAAATGGATCCAGAAGTGAATTAGATAAGTGCACCACTCCTT
GCCTTGCCTTTCCCCTTAACAAATGGAAGGTAAGTCTCATTTCATCATTGTGCTCTTCAGAAGAAGAAAAATGTAACTTTACCTGGAGACACTGCAGAAC
TGATCTGCTTTGAAGCCGAATATAAGTGTCTGACAAATGGCATTCGTTTAATAATCCATTCCCCAATCCAAAAAACAGTAGCACCCAGCCAGGATGAAAC
AAAAACTCCAACTAAGAATACAAAAACAAGAGATGTGACAAATCCTAGTCCTGCACCAACAACAAATGTCCGAAAGATCAGGATATATGGGGAATATACA
ATAGATAACAACTTTTAATACAGATCGGAAGGTGGACAACACATAAATCATGCATGGAACATGAGATTTATCAATCATGCATGAAACATAGAAAGATAAC
ACAAAACATAATGGACAGTCAAAAACCAGCTGAAGTTCTACACTTAATGAATATTAGATATTTGATCATGTAGAATAGACATCAATGGCTTCCGCACACG
TGAGAGGCATTTACAACTCAGGAAAAGAGAAGTGTATTATTACATATACACTGATATCAACATCACATTTATAAGAGCAAAGCAATTCATACGAGTTAGT
CAGAGAAGGCTAAACCCTAAACACAATGTTAAAAGAAGCAAGCACAATTAATGGCTATTTTTCTAGTTATTTGTAGTTATGCCAGGTCAACCACGAGCAT
CTTAGACTTATATGGCTGGACATAGTTGGTTGTAATTTTGTATGCTGAAAGCAATATCCTTTTTGAAGCCCCTGACTGAAATCTTCAGATACCAGAAACA
AAATTGTACTTCCATCATGAAGACAAGACAAGAAAATATAATCACCAAAACTTATTCTTTCTCATAATGCTCCGACTCTTCACTACAGTAAGTAAAGAAA
GTTTATAATGCATTTCATTACTTTTCTCCTCAACATGTAAAGTAACTTTTTACATGTTCACAAAGAGATATATGCAGCTGATAAGCTCAATTTTAAAGAA
CAATTTGCAATATTATTTGGTGAAGTTGCAGTGATGCAGGATAATGAAATATCTGAAAATGAAAATACGAGGTGAGCCTTGAATATGCAGGGTATTGAAC
TACTAAGTATCAAGAAGCAGGATAAACCAATACAGGAAACTAACTGCAGCTATCAAAATGTAGGAAAATTGGACTTACCAAATATGTCAATGCCAAGTTG
TTCATATAGTGGACTGAAGAAACCATCAACAAACTGAATAAACCACCATGTCACAAAGAATGTAACCGCCACAGGGAAGAGAACCACACTGCAATTTCAA
ATTTTGGAGTTGTTACGGATTCAAAGTTAGCCAAAACCTATTAAAATTGGTAACGCAACATAGATATAAGAAATTACCATCCAGTCATAAACTTCTTAGA
TACCCAACTTTGAAGAAAATAACAGCAAGCCTGAAAAAGAGGTATGAAAAACAATTAAGATATATACAAGTAAACTGCCTACAGGAATATGTATAGAGAG
GAATGCTTAAATATAGAGGAGTGCTTAAATATGTCCTTTTCTCATAGGAGCTTCTCTATACATGCACAAAAAACAAAGTAAATTCCAGACTGAATATATT
GGAGTACAATTGGCATTAAAAGGACTCGAGATTGAATATACAGCTCAGGTGTCTATCAAACAGTTCCCCTCTAGAGAACCTGGATTTTCTAAATTATTTG
TTCTCATGTGTCAACTTGTTTTCCAATTTGAAGATTCTTTTCGTATAAGTATATGTAGAATATATATTAGTACATTGGGTCGGAAAAGGACAAGTAAATA
TACTGTTTTACTCCCCAAAGAACCTGGATTTTCTTAAATCATTTATTCTGACTTGGACCACTTCTTTACTAGTTTGAACTTCTTTTTCGGATTCAAGTTT
TGTTGAACGGTCTTTAAAACTCTTCATCTCTTTTTAAAAACTTGTTCAAATAACTTTCTTCCAATATAAAATCAAACAGATTTAGGTAGCTTATTTTGCT
TAGACTCTCCAAAAATGTTGCGCAACCGTGTCGGATCCTCAAAAAAAGCACTGAAATTTGAAGGATTTGAAAAGTTCGAGCAACATAGTTAATCACAATA
ATATCTCTCTATCACATCAATTTGAAAACCAAAACGCAAGAATGTATGTTAGCATAGGCTGATGCTAAATTAATAAGTTTGACCCCAACCCAAATTACCA
ACTACATCCCATAAGTAGATAAGATGCACAAAATCTATTGACCTTTTTCTTTTACAAGGATACACAAAATCTATGACCTTTTTTTTCTTATAAGGATGCA
CAAAATCTGTGACTTTGATCATATCAAAATTAACCCATCATTCAGATTATTAGAATGTACCTTCTTTTTTGTGCATAAATTGACTCTAACTATTTGATAA
CTCCCAACCCAAGTGAAAGAAATACAAACCACATTGTACATGAGCAGGTATATAAGACGAAAAAACATCAAAACCTCATTTTAAGAATCAATTGTGTCTA
CTTCAAAACCAATATTCTCCGCACACTTAGCATAGATTTTGGATCAGATTTTGACAATTTATCCCCAAATATCTATTTGGCCATGAAATTCTTATCTTTC
AAATATTTGCAATTGGTAGAAATTAAGAAATTTCACTTCCACTCACAAAAATCCTATTTTTTCCCAAGTAAAATGCAAGTCCAAACACAACTTTAACAAC
TCAATTTTTCAAGCTTCAACTTCAAAAACTATGGAAACGAGAAATGCATTTATTCGAATTGGTAATTCATAAATTGTAAATATATACACTACCCTTTGAA
CCCAAAAAAGAAAATATCGAAAACTCAATACTTTTCAACAAGTTTGTCCATGTCCTGCGGCAAACACAACTATCCATTTCCCCATTTTCGCCATTCTTTC
CAATCCCTTCTCCATTTCCCATATTTTCAAAATCAAGAAAATACACTTCCTGTACCAAACACAAAAACCCATCTCCCCTTTTCTTCATAATCTCTGTTAG
CTTCAAGGATAAGAGTAAATTTCCTCTAAAACCTCAAAAAATCAGACAGCTTTTAGAAAGAAAAACTGACCTTGCGGGTAGAAGAATTGGGTGAAGCAGG
AGTAGATTTGATGGGGTCTTCAGGATCTTCAGAAGCTTGACTTAGTGGTATAGAAGTGGGATCCTTCTCTTCCGCCATTTTTGCTTTTTAGTTTTAGGGC
TTTGTCTCTAGATCTCAGCAAGAAATAGAGAAGACTTGCAAAAACAACACAGAGACAGCTGAGATGATATTATTGTGAAGAAGAGACTTGTAAGGTAAGG
TGCCCACCTATTTTTCCCCTTCGTAAACTTAGAAATGAAGTGAGAAAAAAAAAACGCTTTCGTTTCGTTATAAATTTTGAAAATTTTTTGAATCGAAATT
GTACTTAAACATAGAATTTATCAAAAAAAATATAATGAATCTTAAAAAACTAAAAATTGAACTAATCTATTTAAACAAATTTAAAATTTATAATCAACAA
ATATTTATGAATAAATTTTTTAAAATTAATTTATAATCAATGATCAAAAGCTAGTCAAATATACTCTATTTATTTGGATTGAACTAGTATCGATTTTTAA
AACTTAAAATGTGAAGAAATATTTTAAAATTTTTAACTAAAATGTATAATCAAAACGATATTATGACTTATTCTTTAATATTGATTCCAACTCTATGATT
AAAGCTAGTTAAGTGCACTACACTTCATTTATTTATAGAGTTCTGGTAGTTTGAACATGCAAAGTCAATTTCAATAATAAATATAATGTTGAGAGAGTTT
TAAATTTTATTTATTTAAGAAAAAAAATAGAAATTAGGCTGTAAATTTCAGCCAAAAAAAACCAATAATTGGCATAGGGGGGCAAAGGGAATTTAGGTAG
CTTGTGGGGAATATGGGACACAAAAAAAAAAAATCAAACACCTTATTATTCAACATCAAATAAGTAATAGTAATTGATTATCATTTTTTTTAATCTTTAA
TTACTCATTTAATTATAATAAATTTAATATAAATATTAAAGATGAATAAGCTTTTATTTAAAATAATGATACGCAATAATATGATGAGGGGCTATCAAGG
TAGTGAGGAGGGCAAGGGAATATCGCCACCTTGAATGTATAAGACTTTGAGTAATGCAAAATTTGATGTGTACCTTTTATAACATATGAAAATGATCTTG
TGATATAAAAAAATATTCATACAAGCTAATATGACTATATTATCTAAATTTCTTGATAATAAATGTATCACTTTTGTTGTGTTTCTCCAAAGAGAGAAAT
GATCTTGTAGTATGTAAGATGATAAGGTAAAAAGCCATGATTGAAAAAAATAATTTATCCAAGAATATATATTACTTTCCTATAAATTTTGAACGATGAC
ACTAATTAGTAGGAGAAAATATAGATTATGCAAGTTGATGGCATCGTAAAATTTGAACACATTCCAATTTTACAAATTCCATTCTATTTTGACTAAGTTC
TTTTTTAAGTAAAAAAAATTCATGTATTTATGTTCTTATCACATAGCAAAAAAAAAAATTGTACTTTGAGTCGTATCATCTCAAATTTATGATCCTCAAA
TTGTTGGCTTTTACATATTTCATTGTGCTACATCACTTGAGGTGTCTAAAATTATTAGGCTACATTTGCTTGTTATATAAAGAGTGTCTAAAATATGTAA
TTCAAACTCTTCTTATATCATTTTACTTGTATATTCGGTATTTGTTTTCAACAAAGGGTGTCCAATTGGATACCTTGAGTAGCTCCGCCACTAAGCTCAT
ACTGGTTGATTTTCAACTCAAAACATTTGCTACCATATTTCATTAGGACAATTTCAAATATATACGACAAACTAATTAGTTTACAATAAATATAGCAAAT
TTTATTTGTATAAGATAAAAAAAATGGGTTAATTACATGGGTGGATTCCTTTTTAAAAATAATTACTTATTTTAAATTTATTTTTTAATTATTACCATTT
ATAACAGCTTTTAAATTTCTTTCTTTTCTCTGACTCGCACTTTCTCCTTTCTTTCTTTCTTTCTCTTTTTCTCCGTCTCTTTCTATCTTTCTCTTCCTTT
AATCCTTTTTCCTTTCTTTCAGTTGTCCTATTTTTCTTGCTTTCTTTTTTGTTGCTCTTTCTCTCTCTTTTTCTATTGCTCTGTTTTCCTTTGTTTTCAT
AGTATAGTCAACGATTTCATACAAACTTATATCAATAGTGAATTAGATAAGTAATATAATCGTAACAAATTAAGAGGCATAAAAAATTACAAAATGAATT
AAATTTTAATTAAAAATGTATTACAAATATATTAAAGTTGAATTATTAGAAGAGAAGTAATATAGTCGTAGCAAATGAAGAGACATGAATTAAACTTGAA
TTAAAAATGTATTTCAAACATATTAGAGTTGAATTATTAAAACATAATTAGATATGAATGTAGAATGTTGAAAACAAAAGAGCATTCTTTGATCTGCATG
TAACTGAATAAAACGTCTATCAATAATGAATTAAACAAGTAACTCAATTGTAACAAATCAATTACTTAGTTGCAAAATGAATTAAATTTGTATTTAAAAG
TGTACTACACAAATATTAAAGTTGAGACAAAAGAGAAAATTAAACATAAATAAAGAAAATGTAACAAATGAAATATCAGACAATGATTTATGTGAATTAA
ACTTGTATCAATAATGAATTAAACAAATATCCAATAATAACAATAAATAAATAAAAACTGCAAAATGATTAAATTTGCATTAAAATTGTATTACTTTTGA
ATAAGAAGAGAGAATTACGAATGAATGGAAAGACTAACAAGACAATGATCTTTAAAGTGAATTAAACTTGTATCAATAATGAATTAAACAAGTATCCAAT
AGTAACAAATAAATCAAAAAACTATAAAATGAATTAAATTTGCATTAAAATTATATTACACAGTATTAAAGTTGAATTAGAAGAGAGAATTAAGAACGAA
TAGAAAACGTCACTAACGAAAGACATGACAATGATCTATAGAATGATAAGTTATATCAATGATGAATTAAACAAGTTAAGTATCCAATAGTAACAAATAA
ATCAAAAACTTCAAAATGAATTAAATTTGCATTGATATTATATTATCTAATTCAACTTTAGTACAATTTTAATATTATATTTAATTTATTTCAATCTAAT
ATTTCACCTAAAATCAATTATAAACTTAACCGAACTCTCTTAAAATTGATACATAAACTCCAAACGACATTTTCAATTATTTGTAGGAACTACCTATTCA
AACTTATCACAAATTCGTAAAATTCATATAATAAGTTTAAATTTTGAAGCTTTATAATGACCATCAATGGTGAACTCTTACTTCTATAATTTTAAAGATT
TGAATTTTTTGCTCAAAAACGTGATTTTATATAATTTCAATTACTTTTTCCTCTTTTCATCTTGTTTTTAGATAAAAATAGTGACATGGGCAAAAACTAA
TTAGAAGAATATAGTTATTTAGATGAAAAGTTCAAAGAAGAAGAACAAGAACAAGAATTAAAAAAAAAGAAGAAGAAGAGGAAGATATCAAAATAAATAG
AAGAGTAAAAACAACAGAAAGAGATGAAGGTGCGGAGAGTAAAAAGAAAGAAAGACGAAGTCGAAGAAGTAGAAGAATTAAAAGAAGAAAAGGCAAAAGG
GTTGCGAAAGAAGCGAATATTGTATAATTTTCTTAATTAAAAAAATATTATATTTAGTCAGAAAAATTATGTTGTTATAAATGGTAAATATTTTTATAAT
ATAACATACTTTTGTGATTTACCCATTAAAAATAGCTCTCAGTCATAAAAAGTATCTAATTATATTTTATGGCTTGTCAAAAGTCATAGAAAATATACAC
TTACTATATAAAATAGCATACATATACATCATGAGCTATACACTGACTAATATTGGTACACTCAAAAAAACTAAGATATGGTTTAACTATACATAAAACA
TACATTTAGTATACATGAAAACACACATTGACTATTTAACCTCAATCAACTTGAAATCACCTATAAACATTCTTAAATGTTAGATATGAAATTCTCTCGA
TGTATCGAGTCTTTTAATGTTTAATTCGTTTTAAACTATTCACATTTTTGTTAATTCAATTTTTATTATTTTTATTTTTCAAAAAAAAGACAAATAAGAC
TCATAAAGACGAAGAAGATAATTTGATCAAAATCACCTCTAAACGGTTTCATATTTTAGATATGAAAATCTTCTCAATATTTTAAATTGATATATAATTT
TCTCAAAACAATGCATGTTTTAGATACATCAATTTTTATTGTATTTTATTTTTTTAAAAAAAGAAGAGAAGACGGAGATGAAAAGAAAATGACAAAGGAA
GCCGTTAATACTGAAGGAGGAAGAAAAAAGAAAGTATTTAAGCCAATTTCATTATTTTTTTAGTAATTGGTTCAATTTTTTGTAAAAGTAAAAGTCTCAA
ATCTGAATGACCAGTTTGCGTAATTGTCTTATTTTAATGGGAAAATAGTCAAAAATATCCTTCAACTTTGTTTAATTGATTGATTATACCCTTGTCGTTA
AAAAGAAGTTATTTTCACCCCTGCCGTTACTAATCTCATCATTTATATCCCTCAATTGGATGAAAATCTTAAATTTGACTTAAATAACCCAATTTCAGTT
GAAATTACCTAATTTTATATTTTAACCCTAATCTCTTTCTCTTTCCCTCTCACATATGATAAAAAACTTAGAGTAGCATCAATTGCAAGTCATGTAGAAT
AAGAATATATTCTTTCAAGTCTGATGTTTTTTATCTCGAATGTCGTTGAAGAGTTGCACTTCATGAATGTGGATTTGGTTGAGTATAAACGTTGAAAGGA
ATAGAACAAATTTTGAAGATCCATCAATGCCATTGATGTAATCTTGGGTTTATATTATTCAATATATCAAAATTGTTGAGGATGAATTAATATGTTTATT
TAGTCTTATAAACAGTAATCTCTTGAAAAATATTTTGGCCGAATGTTTCAAAATATTTTTCAATTAAATAAATATGTCTTTATGAGCTGGATTGAATCTG
ATGAAATTTATGCACTTTATCTCATCATGGTTTACCATAAATATCTCTATTTATTTAATTTATTATATACTCATTTATAAAAAAAATATATAATTTTTTC
GTTTTATATTAGTTGATCATTTTTCTTTTTACGTACATATATTAAGAAATCATAGATTTTTATTTCTTTATTTTTATTACGAAAAAGGGCCTAAAATGCC
CTTAAAATATTGAAAATAGTACAAAATTACCCTTCATCCACCTATTGACTCCAAAATGCCCTTTTCATCCACTTATTGGCTCCAAAATACCATTGTCATC
TACCTTTAAGTTCAAAATTGACCACTTATTTAATGATTTTAAATTTAAACTATTTAAATATTTTTTAAAATACTTGATGCTCAACTATTTGTTATAATTT
ATTTGTATCATTTATAAACCAACTCACTACCCACTCATTACTAACTAAACCCTACCTAATTAATAATCGAGCTATTATATCAAAATCGTCATAAACACTA
CTAAAACACGATGAAATTATAGATTTCTGAAAATGACATCCAAAATTATTCAAGTCCGAATCAAAGCCCCAATTAAATTTATGTTGAGCCGCTTATTTAG
GAGCACACTTTCAATAGGATTCTCTTTCAAGATTAAATTTAAAATTTATGATTAAATGTAAAGAGTTAATATATCCCGAATCAATTCATGCACTTTTTTA
AAATATACTTTTATAAATATTTATGATTAAAGGTAAAGAGTTAATATATCCCGAATCAATTCATGCACTTTTTTAAAATATACTTTTATAAATATTTATG
ATTTGTTTTAAAACCTTTAATATATTATTTTGGAAAAAAAATTACCTATAAAGTAACATCACATAATTGAGACGTAAGAATAATAAAGATGAACATAGTC
AAACTTTTTAAATTTGTCATTAATTTTTATTTAGACACTTGAATGTATGATAATTTACTTCTATAGATATTTTCGTCTCAAATTTGTAAGAACAATCAAT
TGACAGTAGCTTTTCTGTTGTTGCATTAATAATGTGAAGGATTTATTAATTTGGTGGGTTTAATTAGTAATGGGTGGATAGTGTATTGATTTATAAATTA
TACTAATAAGTTAAATTATAACAATAGTTGAGCGCCACGTATTTAAAAAATTATTTAAATAGTTTAAATATAAAACCGTTAAATAAGTGGTTAATGGTAT
TTTGGACCCAATAGGTGGGTGAGAAGGGTATTTTGGAGCCAATAGGTGGATGGAGGATAATTTTGTACCATTTCTAATACTTTGAGGGTATTTTAGGCCC
TTTTTCATTTTTACTATTTAGTGATTTATACAAATAAAAAATCATTACTCTCTCCATTCTCACATGTGTGATCACTTCTGTTTTTACGCGTATATATTAA
GAAATCATAAATAAATGGATAGTTTTACCAATTCACCCTTTAAGAACTTTTTTGAAATTTCACAACAAGGGTGAATACTTTAAAAATGAATAAAGATGAT
TGAGGTAATATTAATTAATGTTTTTTTATTTTAGTAAGATGATCCATTAATATGTGATAATTATTTTTTGTATAGTGATCAAATTATACGAGACAATAGG
AATAATTTATGATTATATAGTGCTGATTATACCAATAAAAATTGCTATAACATTGTGATGATTTGATTATCAATAAATTGGAGTTTTTCATATCAACTTT
TATGTTTCATCTTTTTAATCATCAATTTGTAGCATAATTTCTTTTAGCAATTTCTTTGAATAGGTCTTAGGATCGTAACCTATTTTCCTCTCTTTTGTTG
CATTATTCATTATAAGAATATTTACCAAGTAATGCCACTATTATTTTATAATATATTTAATTTTTTAGTTTAATCACGCGAATGCGGACAAGTACACTAG
TTATCCAATATATACAAACTATTCACATGGTTTTTGTGGTTGTTTGGTACGAGAGATTAAGAATAATTAGTTTTAAGATTGATTTTAGAGTTAAATTATT
TTAGTTTAGTTGTGATAAAATTAAAAAACAACTTTATCACTTAGTTAGTAGGATAATTAATTTCAAAATAACTGGTTAAGCAGGTGGGTCCCACGTTCAG
CTTTTCCTATACGCTTTCCTCCCTCCATATTATCTTCACCCCTCACTCTTCCTAATTGGCGGGAATTTTTCGAAAATCCCAAAAATTGAAACCCTAATTT
GCGCCAAACATATTGAAATTCTTAATTATTCTATATAATCACTTCACTACGAGGCCAAAAAAGCATATCAACGAAATTCCTCAAAAGAAATTTCGTTGAA
AAGATGTATGTGGTGAAGAGAGATGGGCGTCAGGAAACTGTTCACTTTGATAAGATTACTGCTAGGCTTAAGAAATTGAGTTATGGGCTTAGTACGGATC
ATTGTGATCCAGTTCTTGTTTCTCAGAAGGTTTGTGCTGGTGTTTACAAGGGTGTAACTACTAGTCAGCTTGATGAATTGGCTGCGGAAACTGCTGCTGC
TATGACTGCTAATCATCCTGATTATGCATGTGTAAGTTGCTCCATTTTGAATTATTTGGTTTGACATGCTTATCATGTTTTTGTTTGGAGGTTGGATTTT
GGATTTGAACTATGTGGGTTCAATATTAAGGTTTTTAGCATTGTATTTTTTGAAGTTATGGGTTCATATTACTGTACTTTTAATGAGTTCTACGCATAAA
TTTGTGATCTGTGGAAAGTATGGGTCTGGTTTTATATGTGGTTTTTTTTCATAATTGCATCTAGGTTGGTTTTGATTGTATTGATGTTCAGAAATGCTGC
TGAAATTAGCATTTTTTACACGTAGATTTATGCTCTGTGTCGCAAGTTATGGGTCTGGCCTTATCTGTTTTTTTTAGTTGTAATTGCTTCTGGGTTCGTT
TTGATTGTGTTGATCTTTAGTAATGCTGCTGAATTGTAGCATTTGTTCAAGTTTGTGAAATTTTGTGTGTCTGGATTTATTTGTTTTTTTAATTGTTTTC
AAGTCAAACGTCTTTAGTGGTTGTGCTTATATTTGAAAACGGAATGTTGGTTTGGAAATTGAAATTTTGGGTTCAGTTTTTGCTTGTGTTTTGATAAAGC
TGATTGTTACATCTCTTTTAATTTTGTTGGAATTTGTGTTCTTAAGTTCAGATTTTGGCATTCATTTCAGTCACGACATGTTGAATTTAAACATTGTTGT
GGATTGCTATTATTGTCCTGTTTTGCTCTTCGCATATTTTTTTTGTTCATTTTTTCAGTTTGATCTCCCATTGGTTTCCTTTCTGTTTCAGTGTTCCCCA
CAATTTTTGTAATGGTCAACCATGCTATTGTATGTGTATGCTTTCTTATTATAGGTTGGTATGGAATGTATCATATTTGAATTATTGAGCTAGACTAAAA
TCTTGATTTGATTTATGTAATCAAACAACAAAAACGCAGTAATTAGTTCTAAGAAGAATTTGTTTTTTTTTTTAAAAAATGGTACACATTAAAAAGGAGA
ATGAAGATATGAGATGACTTGACTGAAAATGAGAAACAGGCAGACAAAAACAGTTTATATCAACTCCTCTACTGTTATAAGGTAGATATATTGAAGCTTC
TATAATGCATAGTAGGAAAAGTATCTTTTTAATGATTAATGTGTTAATTAATCTGTGATTTATCGAATCTCTTGGTGCAGCTGGCTGCAAGGATTGCTGT
GTCCAACCTGCACAAGAACACCAAGAAATCATTTTCTGAGACGTAAGTGATTTGAATCAACATTGGTCATTAGTCTTTCATGTTCTTTCATTTTTCATAT
AAATAAAATGTCGGTGTATTGATCAACAATGACAGTGCTGGTTGTAATAATGGAATATCACAGGATTAAGGACATGTACTACCATGTCAGTGAGAGATCT
GGATTGAAGGCACCACTTGTTTCTGATGAAGTTTATGAGATAATCATGAAGGTATCATTGCCATTTGGAATATTCCTTTAATTGTTATGTGTCAGATCTT
ATCTATGTTTTTCTTAATCAAGATCATGTTTAAAGTTCTTGGCCTCTGGGTAAATCAAGAGCTTGTTTATAATTTCCTGTAGAAATACTTATTAACAGCT
TGCCTTTTTTCTCTCAGAATGCTGCTCGTCTGGACAGTGAGATCATATACGACAGAGACTTTGACTATGATTACTTTGGTTTCAAAACCCTTGAAAGGTC
TTACCTTTTAAAGATTCAGGGAAAGATTGTGGAAAGGCCACAACATATGCTGATGAGAGTATCTGTTGGAATCCACAAAGAGGATATTGAATCTGTCATC
AAGACATATCATTTGATGTCTCAACGCTGGTTCACTCATGCATCTCCAACACTATTTAATGCTGGCACTCCAAGGCCTCAAGTAGGTCAACATTCTTTTA
ATGCTGTGATTTTTTCTTGATTTGATGATTCAACTAAGTCATCATTGATTTGGTCCTGTTTTGAAAATATTTGTTTATTACCCAACAATGTCCTCCTGTT
CATTGGCATCTTTTGGTAAAATGTTTCCTGATTTTACATCGTATTCTTTTGGGACTTGCAGTTAAGTAGCTGCTTCCTGATATGCATGAAAGATGATAGC
ATTGAGGGCATATATGATACTCTTACGGAATGTGCTGTTATTAGCAAATCAGCTGGGGGAATTGGCGTATCTGTGCACAACATACGTGCTACTGGGAGTT
ATATTCGTGGAACAAACGGAACATCAAATGGGATTGTTCCTATGCTGCGTGTGTTTAATGATACTGCCAGATATGTTGATCAAGGGGGTGGCAAAAGAAA
GGGTGTGTCCTCATTTTTGTGCTTGTTTAGATAATTCTAGAAGTTTAGGGTGTAGAGACTACCTTCACTTTTCTCACTCTGTAATGCTGTGTTTAGGCGC
TTTTGCTGTCTACCTTGAGCCTTGGCATGCTGATGTATTTGAATTTCTGGATTTAAGAAAAAACCATGGGAAGGTATGGTACTCTTTTTTATCATCAATT
GTTTAATATATTGTCTATTGGGCCTGCACCTGCTCTCTGTCACTGCACTAGATTGCTGTACTCCTTTCATATGGCAAAGCTTGTCTGTACTCAGCAATTT
GACAAGACATGATGTTTCCTTTTCTTCAGGAAGAGAATCGGGCACGAGATCTTTTCTATGCTCTTTGGGTGCCAGATCTATTTATGCAAAGAGTCCAAAG
CAATGGGATATGGTCTTTGTTTTGTCCAAATGAGGCTCCTGGATTGGCAGATTGCTGGGGTGAAGATTTTGAGAAGCTGTACACAAAATATGAAAAAGAG
GTAAAAATAAGTGTTCTACTGAGGTTAATTGCACACCATTTATTTGATATATTAAAGATCATTCAGCATTGATCGTTAACAATATTCTTTTGTCAACTCA
GGGAAAGGCAAAGAAGGTCGTTCAAGCACAAAATCTCTGGTTTGAGATCTTAAAGTCCCAGATAGAAACTGGGACCCCTTACATGTTGTACAAGGTGATT
TTCATGCATTCTGTTATGCTTCTCATTGTTTGTTGTGATGCAGTTAATTTTACTCTACCTTTATCTGTTTGTTATTGTAGGATTCTTGCAATAGAAAAAG
CAACCAGCAGAATCTTGGCACTATCAAGTCTTCTAACTTGTGTACAGAGATTATTGAGTACACTAGTCCAACTGAAACTGCTGTTTGCAATCTTGCTTCA
ATTGCTCTACCTAGATATGTTAGAGAGAAGGTAGTTAACATTGGTATATACTTAAAACTTACTTGTCCTACTTTCTCCTTGCCTCTTAGTGTAGTGTTGC
CTTTATATCTTTCAGGGGGTCCCAGGTGAATCACAGCCATCTAAGCTTGTGGGGAGTAGGGGTTCAAAAAATCGATACTTTGATTTTGACAAATTGGCAG
AGGTTTGTTTTGTTCTAAATACCAACTTTCTTGAACATGTTTCTCTTGACATTATTCTTAATTTTGCTCTGTTTGCCATGTGAGACAGGTCACTGCATTA
GTCACTTCTAACCTGAACAAAATTATTGACGTCAATTACTACCCTGTTGAAACTGCAAAAAGGTCTAACTTACGACATAGGCCTATTGGACTTGGAGTCC
AGGGACTTGCAGACACATTCATTTTGCTTGGCATGGCATTTGATTCCCAGGAGGTAAGTTTTGTCTATCATCTTTTCTAGCTGTACATTTGTGCAGATTG
TTCTGATCTTATACTTTGTCTATGTATAGGCTCAGCAGCTAAACAAGGACATATTTGAGACAATATACTACCATGCATTAAAAGCTTCTTCTGAATTAGC
TGCCAAGGAAGGCCCATACGAGACATATGCAGGAAGTCCTGTAAGCAAGGTATAAATCCTTTCATTCCTAGATTTTACAAATGGGTAATATGTTAATGGG
ATGTTTGATTTTCCAGTGCATATTGACGATCATCCATGATTTAGTCGAAATGGTTGTTATACTTCTAAGTGTCTAACATAAATAAAATAGCATCTTCTTA
CTGGTTTGACTTTGAAGATATGATTGCAAGTTTAAAGAGAATTTGAAAATGTTGAGACACAAATTATACACACTACAGTAGAACATGAAATGACTGTCAG
ATTTTATTTTGATTCACATTGTATTTCCACTAAATACATATTATGCTGCCCAGGGTATTCTCCAGCCAGACATGTGGGGAATTACACCATCTGATAAATG
GGATTGGCATGCTCTTCGTGAAATGATTGCAAATAATGGTGTAAGAAATTCACTTCTTGTAGCTCCAATGCCAACTGCTTCAACCAGCCAAATTCTTGGA
AATAATGAATGCTTTGAGCCATATACATCTAATATCTACAGCAGAAGGGTTCTGAGGTAACACCTGCTAGCAGATCCTGCAGCTGCTGCTTTTTTTTTTT
TTTTTATTATTATCATACTTGCTGCATATGATTTATACATGGTTTATTTTTTATCTCCAGTGGTGAATTTGTTGTGGTGAACAAACATCTTCTGCATGAC
CTAACCGAGACAGGGCTCTGGTCACCTGCTGTTAAGAATAGGATAATACATGATGATGGTTCTGTGCAGAAAATCCCTGAAATTCCAGATGATCTTAAAG
TTATTTATAAGTATGAACTTTCACTAATTACTTGTTCAGTTTTTATATACACTTCATTTCCACTTACATTCTAATACTGTTCACTGACTTCAGGACTGTC
TGGGAGATCAAGCAACGGACCCTGGTTGACATGGCTGTAGACCGTGGTTGCTACATAGATCAGAGTCAAAGCCTCAACATCCATATGGATCAACCCAACT
TTGGAAAGCTCACTTCCCTTCATTTTCATGCTTGGTCCAGGGTACACTTCAATTTTCACATTATAAGTTTTGTTGATCTTTTGAAGAGTGCATAAGCACT
AAGAAATGGTCTGGTATATTGTTACTCAATAGTTTAGTACAAACATCCATTTAAAGAGATCTTTTAGCGACTAGTGAATGTAGTTGTCAGACTACAACAG
CATGAACAGATCTTTGTAGGTTCCATCTTCACAGGTCAATTTTGAGTCTGAGTTTCATCTTTCTTGTTATTGTAGGGTTTGAAAACTGGAATGTACTATC
TACGATCACGTGCTGCAGCTGATGCAATCAAGTTCACAGTTGACACTTCCATGCTGAAGGTAGTAAGTAGTAACGTTATAATGCTGAGTAACTTATCGTC
AATATTATTTTGTTCTTACAAACTGCGCACTGGTATCAATTTGCAGGAAAAACCAAAGACTGCTGTTGACGAAGAAACTAAATTGGCTCAGATGGTGTGC
TCTTTTACAAACCGCGAGGACTGTTTATCCTGTGGAAGTTAG