Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

BAC Sequence – LE_HBa0009K06

>C02HBa0009K06.2
ATATACTATATGAAGAAGAAATTTCGGTATTATTTTATTGTGTCTCGATTTATATTATGGAATTCCTGGCCTGCTACATGTTTGCCTGAAAGCTTTAGTT
GATTTTTCTGATGTTAATTCAACTTTTTTGGCAGGACTCCAAAGCACAGGTGACTGCAATACACTTGATAATAGGAACTCTTCAGAGAATGCACATCTTT
GGTGTTGAGAACAGGGACACGTTAACGCACAAGGCTACAGGGGTAATTATCTTAGCATCTCCTATTTCCTTTTGCTGAAGTTAATCTATTACAAATTAAT
TATAATCACTGTTGCCCTTTTCACCCTCCAGTACTCTGCAAAGCTCTTGAAGAAACCTGATCAATGTAGAGCTGTGTATGCTTGTTCGCATCTTTTCTGG
GTTGACGATCAGGACAATATCAAGGATGGAGAAAGGTTCATAGCTGTGCCTTGCGTGTTTAGGGGATAAAATATACATTCAAATATGCTATGTCTCTTTG
GAGTTCCTTTTAGTTTCATGCTTTTCTGTAGCCATCTTCTTATGTGTTACTTATTTCCCCTATTGATTCAGGGTTTTGCTTTGCTTAAAGCGGGCCTTAA
GAATTGCAAATGCTGCTCAACAAATGTCCAATGCAACCCGAGGCAGCAGTGGATCTGTCTTGCTCTTTATAGAAATTCTAAACAAGTAAAACCAACTCTT
CATTCCTGTTCTTTTTACCTTCTCAACTACTGTTCTTTTGGAAGTCAATTTTACAAGAGATTCGTTTGTATAACAGGTATCTGTATTTCTTTGAGAAGGG
GGTCTCACAAATTAATGTTGCCTCCGTCCAGAGCCTGATTGAGCTAATCACAACTGAAATGCAAAGTGAAAATACAACAGCAGATCCTGCAGCAGATGCC
TTCTTTGCAAGCACCTTGCGATACATCCAGTTCCAGAAGGATAAAGGTGGTGCAGTTGGGGAGAAATTCGAGTCCATCAACTCATAATCAAATAGCATTT
CTCAAAGGAATTACGTTCTTGGTGTCACAGAAGCAGCACATTTTTCTTACAAAGTACAAAATTGATTCCTTTTCAACTTGCTCTAGAGAAAAATGCATTT
GACAACGGACTAGCAGAAGCAGCTGAAAAGATGCATATATACTGACCACACCCCTACGCAGTAATATCCTAATAAAGATTGTTATTGTTGTAACAATTTG
CTCTCCAGCTATGACTTCCGAGTGCCTGCCACTGTTACTTTTTTTTTTTTTTTTGGTGGAGAGTAGGTTTTCTTTTGAGGTGGAAGAGACAAGGAGTGGA
GAAGTAGTTCATTAATTTGTAGTTCAGAAATGTGATTATGACGAGTACTAGAATAATTTGTCCCTCAGTTTTGTATAACATGTTCTGTCCCATTTAACAC
ATTTCGCAGACCACCAAAAACTTTTAAACAGATATTGCTCTAATGGTTATTGGAGCAATCTTTTGGTGGAAAATATGATATCATAAGGAACCAAGGAAGT
CATTCATTTGAACCAATCAGTTCTGTTTACATATTTTTCTATATGAACATTTTCGTCTAGAAAAACATCACACACATTTCTCTCTATAAGACCTTAAGAT
TATTCAGTGGTCAACAAGAAATTATTTAAAGCAGAAAGAAGAAACAGTGTAGTTTAACAACTATAAGAAGGAATTCTCGAGAGAGAATCCTACTTCCAAA
CTCAATCATGTACATATGACTTGAAGGAAAGGATTATATGCATCATCAAGTTGAGAACAATTCTCTTGTTGAATAACAGAAAAAATAAAATCACCCTTTT
TATTTAAAACGAATCCCGATAATATAAATACATCCAACCGTCACTGAATTCTCATTTTCATAGAGCAAAAGTTCTCCTGAACATATTATATATTGCTTGT
AGCAATAATTTTGTGTTTGTTGAGACTCAGTTCATGGCATACTTTTGAGTCCAACTACGAGCCATTGACTCGTACTTGGTTTTATCAGTCTTGCACATAT
GAGCAATTTCTGGAACCAGTGGATCATCTGGATTTGGATCTGTTAGCAGTGAACATATGGACAGCAAAACCTTCATCCACAAAACCAACAGCAAATTGTA
GAAGTTTATACTATATTGTTTTTGCAAGTTACTGGTCTTATTTTCAGGTAACTAGTTCCGTTTATATATGAACATTTAATTACAGTTATCCTTTATGCGA
CTTGGATTTTATTTTTATGTTAGCCAGCAACCAAACACTAACTAATGTGTATCCCTTTTGATTTATGAAATAGTAAATCATTGAGGAAAAGGAAGAGCTA
GAAAGCAGTAGCACCTTGGATATGGTGAGGGCAGGACTCCATTGATCCTTCAGTATGTCCAAACAAATATTTCCATTATTGTTTATATTTGGATGAAAAA
CTCTGGTCCTGAAAGCCACCTGTCAATATATATATGAAAACTTAATATCAGCAGTCCCTTTGTGGAGAGTGATCAATTGAAAACATACCTTGGGAGGTTT
GAAAGGGTAATCAGGAGGAAAATGGATGGTGACTTGGAAAACACCACCAGCATAAGGGCTATCATTTGGACCAATAATAGTTGCTTGCCAATGAAACATA
TCCTGAGCTACTGGACCTGAAAAATATTAGTATAACAAATCTTCAAAACTATCTTCTACTTTAAATTTGGGAAAATTACTAGTTGTAATATTGGTGTGTA
CCTGCACTGCATGAAGTGGGAGGGTCTCTTTGCAAGTCTTTTAGCTCCTTTTGAATTCTCCTGGATGCCATTAATAATGAGAAGACTTTAAAAGTTAAAA
GGAGAGAAAAGATGTTGGTTTTATGAGTTATAGATATCCTCAATAAGTGGTAAAATGGAAGGGTATATATAAAGAAGGGAAGCTAAGAGAAAGAAAAAGA
ACTTTGTTAAGTGGTCACAAACATTGACATTGTGGTATTAGATTCTGTAGCAGAAAACAGTCTACTCTACAACTTTAAAAAAGAAGAATAGATGATTTTT
AGCCTAGTGAAAAAACACAAAAAGATTATTCTTCAGCATAACTTTTTTAGGTTTTCCAAACAGACGAAATCCAATTTCAAAAGAATTTAAATTTTCCTTT
CTAGTTTCCACTTTCCTCATTTTGCATCATTATTATATATAATATATCTTCCTATTTAGTCATCCATTTCTCAAGAAATACTCCGTGCCCACTAATTTTA
ACCTAGATTTTTATATTATTTTCAAATCAAGAAAATTTTAAGTGAAGAAAATCAAATTTAATTGTCTGGTTTTTTTTTCTAGAATCCCATGATAACCTGC
GTTGTCACAGTTTCTGCCCTTTGGGTGAACATTCTTAGTGAGAACTGGATGAACTCCCAGTATATAATAGCCTGTAAATCACACATGGGATCAGTCAGTC
CAAGTTATTGATGGATATTTACAAGATTTGTCCGCTTATTGTTGATTGGATGCTTAAAATCGTTATATAAAATATACTCTAGATAAGAGATTTTAATTGA
TATTTGTTTTTAGAAAGGGGGAGTGGGTGGGGGAGGCATAATTTTATTTAATGGACGGCATACATTATTCAAATATTGTGAGGCTACAGAATTTCACTCC
ATTTTTTTGAGTGAATATACACTTTATCCCCACCTCTCTGTACCATTTGCCTAATTTGAAAAAAAAAATATTAAAAAAAGACCATACAAGTGCCTGAATC
AAACAACTTTAGCTTTATCATTTGGCACCATTACTAGTTACAGGATTACAGCACCCAATATATTCCACTATTATTTGCTGTTACCATATATATGATTTGC
ACTACATAAATGGACATAGAAAATCACTTGTAATTACTTTACGAGATTTATGTGTGTAACAGTTTTTTACGCTGCCAATGCCTAAACAAGTTATATTCTT
TATCATAATACATTAGCAGAATCTCGTAATCCATTATAAAATATTACTACTACTAAGTCACAGGATTGACACATTTTATTCTCGATTAAAATAGGAATTG
TACCTCGCCAGCTAAGAAGAATCTAATCAAACTGTATAATTTGGTATCTGGCAATCAAGTTGCCATGTTTGTAGAGTCAACATTCCCTATTTCATTTAAA
TTATGTAATGACAATATCATAGGATTTTGGTCAACTAACGTATTTGTTGTCCACGACCATATTATGCAAGTAGTGGATCACCTCGAATTAATTCTGGTAT
CGTATCCTTTTGGAATTTTTACAACTTCACAAACTTATATTCCTTTGCCCTTCTAACATAGAAAAATAGAAAATCAAATGAAAGGCAGAAAGGTAGCTTC
ATGATCAGGCCAAGAAAATAAACAGAATCTACTTCAACCGATATGTCCTTAGGCACACTGCCATACATAACATAGCAAACGATCTTTTTTCCCTTTCTCG
TACCATTTACAATAAGAACTTAAGGAAGAAACTGAAAAATTTAAGGAGAAGCAAGAGCAGAATGATACTTGAAAGAAAATAGTAATATATTTGAATGCAA
TATCTAAAAAGAAACGTTTAATATGTTCAGAGAAATATGTTGTCAACATTGCCGGGAAAATTTCCTTTTTTTTTTTTTCTAACTGGATCATCAGGTCATT
AAAATACATATAAAGCAAATCAGAACAGAGAGGGCACAATAGAGTGGCCTACGACAAAGGTGCTGTGTGACTAAACAATTAGAGATCACAGCCATTACAC
AGAAAACCGAGCCACCTGACAATTCAAGAGATCACTAGTAATTTTAAATGAGACATACAACATGGACCTCCTACTTCCTCCGAGACAAATGACAAAGGAA
TACGAGAGAGAGGTTACAAGGAGAAGTGTGACCAGTAATAACATTGGACCTACTGTTGATCACAAAATAGAACATGCCTTTTGGGACTTCCCCTTCTTTT
TCTTCTGCTTGGGTGGCTGGAGCACGACCTTGATAGCGGCATCAAAGACTGCTTTCACGTTCTGCAGCAAGGACATTCCAACCACACAGGCACACACTTA
ACAAGATGCATCTAAAAAGTTACTTCAACACAAAAAATAAGATGCTGCCATAGAAAACATACCTGCTGTGTTTTTGAACTACATTCAATGTAAGCAGGTG
CACCAATTGTTTTCCTCAGCTCTTCACCCTAAAAATTGAAACAGGGCTGAGTCAAAATAATAGGGGAAAAAAAGCAAGGTAAAAAAAAATCCAGCAAAGC
ATCAAAATGAGGAAGAGTAGGTGATCCTTACCTGAGCAGTGGTAATTGGCACAGCACCAGGATGGTCTACGAAGAATTGCTTATCATCCCGAAGATCTGC
ATCCAAAACAGGTAGAAAGTAGGATAATTAGGCTTTGAGATGCTTGAAAATCATCAGCAGATAAAAAGAGAAACAAAATAACAAAAAAATGAAATAAAAG
TTAGACACAAGTCACACAACACAAGTCGTATCTTTCCAGTTCACGCTTGCCCAGTATAGTGAGCAGAGATTGCACTACTCCACACAAGGCGGTGGTTGCA
TTCAGATTCAAATTCAACTGCCATCTCCTCCTTGATTTAACTTTATCTTTAAAAAGAGAGATTAATTCCTATATATCAATTAAGCATTGCATTGATACCT
ATAGGAAGAGTTAATTCCTTCAACTCAATTATAAATGAGTACATTGAGCAAAAGCAAAAAGATTACCACATCTACTACCCACAAACCATTCACCAGCTAT
ACCAGATAGAAAGCCCGCCATTCTCTTTATTCTCTCTTCAGCAGTTACCATAAATTTTGTATGAATTACTAAAACCACTTAGATCAATCAATCAATCAAT
GAACTACACCTTAATCCCAAATCGGTTGGGATCGGGCTATATGAGCCATTTAATTTCCATTCTATTTACGCTCACACAACTATAGGTTTCAAAGTTCACT
CAACCAAGCAAGTTAGGTCATATGTGCTGAAACATCCTTATATTTCTATCGGAATTTGTTCTTTTTACCACTCAGAATTGAAGAACCAAGAGAAAAGCTT
ATAGAGACCAATTTGATCATCATCACACGCAGATATATGAAACAAAATAAGATCAGATCATGCTTAACGGAATTCTCACCTAGTTTTGTTCCAACAAGCA
CTATTGGAACACCGGGGGCATAATGCTTCAATTCAGGAATCCACTGGAAATATATAAACAAAACAAGCTTAGTATAGGAAATAAAAAACTCATCAACGCA
ATTGAAACAGAATGAGAAGCTCACCTTCTTGGCAACGTTTTCATAGCTGGCTTTACTAATGAGAGAGAATGCCAAAATGAAAACATCAGCTCCACGGTAA
CTCAGAGGTCTTAACCTATTGTAATCCTCCTGTCCTGCAATCCATATAAAACTCATCAGGCTCAATAAAATGTGGGAACAGAACTTTTAACATTAGATAT
ATGTATCAAATCAGAAGCTCAGGAGCAAACAAAATGGTGTCTAAAATAGTTACCAGCAGTATCCCACAACCCTAGGTTGACAGTGCTCCCATTGACGACC
ACATTTGCACTGAAATTGTCGAACACGGTGGGCACATAATCCTGTCAAACATTTCAATTAAGAAGAGGAAAACAATTGATGTCGAGTCTTAAAGAACATG
ACCGAAAACCTTCTCACAGTAAACAAACATATGAAATACTCGAATGATAACACCACAACTTTCTCCAAATCCACAATGAAGTATAGGCACCAACCAAAGA
GGAAAATTAATTTAATGTTCCAAAAATCATCAATTTAACGTAAGAGAGAATTATAATCCTTGGTTTCCTCATACATAGCACAAATTATCACAGATAGGTT
GAAAAAAGGCATGTAATAACTTCGCAATAATGGAATAACTCAGCATATAATTACAAAAGGTGGCATAAAGCAGAAAAATTTTGAGAACTAAGAAACTTTC
TCCAAGAGAACAAAGAAGATGCATTTTTTATCACCTAATAAATTTATAATAAGACATAAATTATGCATAGGTTAAAAAGTTGTCTGAAGCAAACAAACTT
GTGAACCTATAAATTTCTCCACGATACCTTCTTTATACCCCATATAGAACTTGAATAACAAAAGAACAAAACCCCACAACCTTGCAAATAAACAAACAAC
AATTAACTCCCAATGCTCCACTTGGGCTCGTTTCAATTCCATTACTCAATAGTTGAAAAAAAGAAACAAGAGGCACCAATTTCTTTACAATGAATACCGT
CAGAATATATATGCTGTTTTCGATCAATCAATTATTTAATCAAGAACCACATTAACTAAAAAAGATGCACAAGGGAATAAACTGGGTAAAGAAAAAACAC
AAACCGTGGGGAAGGTATTGCTGGTGTAAGAAATCAAGAGACACGTCTTTCCAACGGCACCATCGCCGACGGTAACACATTTGATAAACCTTGAAGCACT
CATTTTTCCCGGCTATTCAGAAAACCAACAATAACCCTCCTCTTTTCAGATCTTCTTTAGAAGACCTGATCCCAGAAAAAATTTAAAAAGAAAAAAAGAG
ATTAAATGTGGTATCTTGGAGCTTCTTGTTTCCGTTTCTTTTAACCTCTCCAATTCCTTTCAATGTCGTTTCTTCAGAATGGCTTGAAAACCCAGCAGAG
AAGAAAATCGAGACATGCCAATGGTGTTTTCTTTGGTTCTCTTGGTGAAACCCTAACCCTAATTCTACGAAAGGGAAAGTTCAGAGAGAATTGTAGAAGA
GGGGAAAGGGAATAAGGTGAATGAAAATGAGAATAGAGAAATGGTAAAGAGAAAATGAGGAGAAATTTAGGGATCCCAGATCTAGAAAGAGAAAGTTTGA
GGTAGAGAGAGAAAGGATGAAAATAAATGGGTGTTCATCTCTGTATTTTTTTCCATTCTGAGTCAGTATTATAAGTAACCCTTTGTTTTAGCCGGGAAAT
AATGCCGTTGAAGTTTTCATTCAATTATGTTTCTTTTTGTGGCTATTATTTTCGCTTATTCAAATTCAATTATTTTTTAAATGCCTCCACCATTAAATTT
AGCTTTATATGTTAATTAAATGTGGATTTTAGCATCTCATGTAAAAATAATTTTTATACCATTATTATAATATTGAATTTTCGTATAATCAAATATAAAT
TTACTGTCTTTTCTATTATATATGTATATATTGTCTTACCATCGCTATGATAAATGAAAAAATATTTATCAATTATGATCAACATACTAGGGACATAATT
TAAATTCAATAGTCTTTTATGTGAATAAAGAAAATAGTCAAAATACTTTTGTGTCTAATCTTGCCAAGGCCATGTTCATCATGTTCACATTTGCCTCTTT
TAGTTTTCAAATTAAGGCTCGTTCACACTTTAAACAGAAATCATAATTTTTGTGAGAAAATACAATTTTTAGTCTTTTTTCAAAAAAATATATATACATA
TTTAATTTATCGTATTAGAATCTAACTTTACGTCAGATAAAATCTTATATGAAATAAGACTTTTTATTAAAAAAAAATTCATATAATTTAAATTTAAAAT
CTACTAATATCGTAAATTCAATCTCATACACTACACTATATCCTATCAATCAGTAATTCTTGTCTTTTCATTGCGAAAGGTCCCACAATAATATCTTTTC
TAAAAGCAAAAGTAATGGTGAGAGTGTTGTAATTAATTCCCACCAAACTAGTTAGTGCCTTGTATCAAAGTAAAAGTAGCTGAAATTCCAAATAATCATT
TAAACATTATGAAATTGATTTGCGCTACCTAATCATAGTACTGCTACAAATTGGAGCTTAGTGGGTAGCATTTCAATGAAAGATGTGCACCTACCCTTTT
CTTTTTCATTTTTTTTTCCTCACATGCCATTCTTCCATTGAAAATCGAAAATAAAGTAATATTATCTATTTTAAAAATTTAAACTATAAAATGACAGAGC
TTTAAATACGAGTGTGACCACCGCAATAATATACAAATTTGATACTACAAGTTTTATCGTTTTTTGTTAGGTACAAACTATATTAGAATGAAAATTTGGT
GCAACAACTACATCCATGTTCTCGTGGATTTGTTTGCTTAATTTAGTGGCTAAATTCCAGCTGTTTAAAGTGGGGTTACGTAATGGTTCACAAGAATTCC
CAACATAGAGTTATTAATTGAAAAGAGTGAGTCATTAAATTCAAGTCAAGTTAGTTTTTACGAAAGAATATTAATAATAGTTATCTAAACTCTCACTTTA
CTGGTGCACGTTTAATTTTCCAATGGTAATCTCTCTTCCATATCCCCTTCCCCTCCCAATTTTTTTTAATAAAAAAGTAAAGTCAATTGTCTAATTGAAG
TGGCCAAGTAGCAAATTCCTGCACAAACAATTTTATTTCCATGTGTCCAGCTGACTGACCCCCTTTCCTCTATAAGTAGCTGTGTTAGCTGTATGAGCAA
TAAGTAAACATTTTTGACCAAACATACAAGTACATGTGGTTTTATCACATTTGTGGAATAAACAGTTATAGAAGATGCATCAGCAAGTATATTAGTTGAA
GAGACAACTCATCCATTATGAATATTATTAGCAGATGATGGGGCTCCACTGTTAGGCTACAAGTATAAAGAAGATTTGACAGCGGAAAAATACACACAGA
AATGCTGTATACAAATATTTGAAAGCTCAAGAAATATTACACTAACCAAAGGGTAAGAACTAGCAAAAAGGCATCTTGTATTTCACAGAGGGCATAAGCA
TACCTCCAAGCGCTAACAGAGCTGCCTACAACCTTGACCAACCTTTTCAGAATTGGACTAATGGTTTTAGCAGATCATAAAACTTGTATTTTTGTCGAAC
AATTGCTTCTATGTAACAACTCCAATTGCTTAAGATTTGGAAAATGCACGGAGTGTTTCATCGAGGGCCTTCTGGTCATAATCACCGGTAAAAACACAGT
TACCAAGTGAACCTTTTAGAAGGATAAGTCTTAGTTTCCCATCTGCCACTTTTTTATCAACCTGACACCCAAAAACAACAGAATCAATGATTGAAACAAT
GACTTCTAGCTATTAGGAGCTTAGAAAAACTATTGACTCTTACAGCCATGATAGACTTGAACATCTCCACAGTCATAGTTTCAGGAGGTGAAGTCGGCAG
CTTTGCCTGTTGTAAGATCTTCTGCACCCGCTGTACCAGTGAGTCATCAATCCAACCAAGACGGCGTGACATGTCAACAGCCATGACCTGAAAAAAAATT
ATACCTAGTTTATGCATCACGTATACAAATATGAATTTATCCTCTTTACTTTCTCATGTTTTCTTCTTTCACGTTTCTCTGAAGAACTATCCAGTAGGGG
GGGAGAGAACAGTTGGATAGGAGGTGATGAAAGTATGAAAGCTATACCGTTCCAGCAGCAACTGCTTCTCCATGAAGCCACTGCCCATAGCCAACGCCAG
TCTCAACTGCCTGCAAATAATAGCTATTCTAGTGAGAGGACATTATCTCAGAAATGACCTTGACAAGGCTATGTAACAGTCAATATTTTCTTAAGATGCA
ATTTGACTGTCACACCATAAAAAAAAGCATTCTTTTTCAGACAAGGAAGTAGAGACTTCCAGACAAGCATCAAATCCCTTGAGAATTTTAAGATAAAGAG
AAATAGAACAACAATAGAAACTTATGAACTTCGCATAAAGCTGTAGTGACAAAATCTAGTTTCCCTGACCTACGACAGTTTTTATTTTTTTGAAACTGGT
AACTTCTTAACTAATATAGTCTTCGCAGGCAAACAAACTATTAAATGATGAGAGCATGAGATGGTCATCGAGCTCATGTAAAGTATCAGCAACAGGAATG
CACAACAACTGTTTAACGCTTACATGACCAAAGGTATGACCCAAGTTCAAAGTTGCCCTCACTCCGCTTTCCTTCTCATCTTGAGAAACAACATCTGCTT
TGTTTTCACAGGAACGCTTGATAGCATAGGTAAATGCAGTGGGGTCCCTGGAAAAGGATAACCACTTTCAGTAACATGTGAAATCACATCAGATAGCCAG
GAAACATTAATCTTAGCAAGTCTGAAAGCTTCAGGTTATGATACGAATGATTCAGTTCGAGTCATACAAACATTGCTGTATATACTTGTGATACCAGCTT
GATCTTTAGAATGACAGTTACAACTTATCCATAAAAGGTTATGATACTTCAAATTGAAGCCCAACATAAAGGTCAAAAGACTTGACAAACTCCTAAAAAT
GGGTGGGGGTGCGGAGGACACATAACTCCTCCACTTGGATACCTTATTTCTCATCAAGATATTCTTACATTCTTAATGGGTCATATAAGATTGTAGAAAA
ATTGAATTTTGTGCCTATGTAAGTCTCTTTCTAGAGATGAAAGCTGGACAAACTAAAAGTTGGCAATTCAACTACTCAATGACATACAAATGATTGTTTA
CCTTGCTAATAATAATGGCATATTCTGTTCTTGCCACTCGAAAAACTCAGCATCTCTAATGAGTCCATATTTTATTACTTCTGCGAGGCCAGATGCTAAT
TCTCTATCTGGTAAAGTATTCAGGGTATCCGTGTCTATAAGCACACATTGTGGCTGGTAGAATGCTCCAATCATATTTTTACCAAGTGGATGGTTTATTC
CAGTTTTGCCTCCAACAGAAGAATCTACCTAAAAACAGTTGGCCAAAGAACATGATACAAAAGTTAGTATCACTAAATAGAAAAATCTGTACTCATCAAA
CTAGATAAGATAATGTACATTTCAAGTCACATGTAATTTATTATAGAAAGGAGAAAACTCATAGAACCTGTGCCATAACAGTGGTGGGGATCTGAATAAA
ATTAACTCCACGAAGGTAGGAAGCGGCGGCATAACCACACATGTCACCTATAACTCCACCACCGAGAGCGACAAATGTACAACGACGATCCAGCCTTGAT
TCGATGGCTTTATCAAAGACTTTCATAAGAGTTTCCTGAAATAGCATATTGACAACGTCACATAAACCTTAAAGATGAAATATTTCTCTTGAAACTCATA
TTCGTAAAACCCAAAGCTGCTTACCATGTTTTTAAATTGCTCACCATCTGGCAAAATGACACTTTCTACGGTAACATTAGGGTTTCCATCTGTCAAAGCG
CTTATAGTTTTATCAAGATATAGAGGGGCAACTGTAGTGTTAGTAACGACAAGGACTCTCTTCCCATGAATATGTCTGCATATAAGACGGCAGGAAATTA
AGCATGGAAATTCACAAGAAGTCGCAAACGAATATAAAGACAATCAGACACACACACAAAATAAAATAAGTTTAACATAAAACTGGAAACAACTCCAAGT
TATGCCAAAAATGTTATCATGATAGATCCAATTTGTTTCTCTTAACAAGTAAAAACAACCAACCAACAAGCAAATGAAACCAAGACCCTAAGATGTTAAT
ATTTCTTTCTGAAACCTTATAGTTCAATATCCACATAAATCAGCAAATGCAACGATAACCATGAAGAGAAATATCTTGTATTAGTGCTGACCAACCCGGA
CGAGCACAATCAAAACTTACTTGGTCCTCCCAACTAGCTTGGCCCTCTTTCACAGGAAAGTGGGGCTCACCATGACTGGCAACAGTAAACATTCGTTCCT
CATTGTCTTTTTATTTTGTTGTTTTCTGTGTCCATTTATACTTGGTCATTTTTTGCTACAGAAAACAAAACCTATTGATGTAAAGACATCCTAGGATATA
CTGTTTGGATGTCACTAAGTTGATTTGAATACATCTCATCTTGCAAAGAGGCAGATTAACTAATTGTGACTCACTTTCAAACTGTACCAGCTTGAAATGG
ACTATGTTTTCATGAAGATCATTGATTCAAATAGAGGTGGTTTCTGGAGATATTGTTAATGTTTATTCATACGCGCCTTCACCAACTAATCTTTATATGC
ATCATAAAAATAACACTTCTTTGAGCACACTCTGTTACCCGCTTTAACAAACAAAGAAGACTATTAATAAGTCAATCCAAACCCATCATTTATAACTTCC
TTTTTTATAGGTAACCCATCCTTTATGACTAGCATCCAAAGTGAACTTCACCAATCTCTGCTCACATTTTGTAACATACTTGCACAGTGTGATGAAAGGT
TTACAGGAAAAATATTCATGAGTTTGATCACACTATCAGTATATTGTGAAAATACATCTAATTTGATCACTCGATAAATACGTAGCCAAAATTCCACTGG
AACCAAACTATAGGAACAGAAAATGAAGAAACTATACTGAACTCATTGCCCAACGAGTAGGCCCTTCTCTCCCTGCTTTATCTGTAAGCTGGTGTGGCAT
GTGCCAGGAAGTACGAAAAGGAAAGTGATCAGTTGCTGTCACACTGTAAAGTGGCCTCACAGTTTTGAGCGGTAATTCTCTTTGTTCGACATCAATGAAG
TGCATTCGTAGACAGTGTAGGAGGCTACGGCAAGTAGGAGGACTAGGGATTTGGGGAAAGCATAATGGAACACTAGTTCACTATGCCTTTTATTTATATG
AAATGAAATGAATGGGAAGATGTTTCGAAGCAACAAGAGAAGCTTAAATAACACTGTTTCTATAATTTATACTTTAGTGTGAAGAAAGAATTTTTGTATA
GATCAACAAATGAAAGGATATTTCACTTATCAAAAATAGAAAGTCCAACACACTCAACTACTACCACCAAACGAGAACTTCCCTCTATACAGCCTATGAA
AACTGAAAGATATTGACAATGATGAGCTAACACCAAAAAGCATAAGACATGGGGCATATAACGAAACATTTGAATTGAGGCAGACATATAAGTCTACCCT
CTAAACTGCCTAGGATATCACCAGAATGATAATTGAGAATGTCATATAAACATGTCATTTTGCCTTTAGAAACAATCAACTAATCGTATCCCGCACTCTA
TTCCAGTTCGCCGGGTATATTTTTTTTTCCTGCAGATGCTAAGAGTTCTTCTTTCCCCACACGGGCTTTTCAGGGAAAGACTTCCAAGTTCCTAATTTCA
CTTAACATCATCCAGTATTCCATTAGAAGTAGCTCTATTCTCTCTGTCAGTCAAACTAATACTAAAGAATGCAAAAGTTTTCCTTTCATTATTAAAAACA
AACACATATGAATATACTCTAAGCAATTTGATGAAATTCAAGCAGTAGATAGCACAAGTAAGTCACCTTTGTAGGAGGTCAGGTTGATCAAGAAGTCCAG
CCCCAATATAAATCGGGTAGCTCCGAGTACCCAGATCCACTTCAACAACTGTAGGAGCCTGTGAACTCGCTTTACTGGACGAGTGATCCATCACCTTCGT
GGCAGAAGTTGCCAACACCTTCAATCGTGTGGTGGCTTTCGACTTCAGCCCACACCTGGAAGAAGGTGAAGAGACGGGAGCAGGGAAACGAACGTGTATG
TCACGTGGAATTGCTCTGGATTGGTGGAGTTGGTGGGTCGAATTGGTGAAAGATAAAGCCTGTTTTGGGCAGAAAGACGACGCCATGAAAGTTGGTGTGG
CGGAGGGAAGGAGAAAAATTGTGGCGTCGACGATTTGTGGATGGCTGGTTAGGTGGTTATGGGACTTTCATTTCATAGTGTTATAATAAGATTAAAAAAA
ATTTTTGTTTAGGTGGGAATAGCGATGGAGGGCGTGGTAGGTGGAAATTTGGAAAATGCTTTTTCTGGTACAAGTTTTTTTATTTTGACTGTAATACAAA
AGTGCACAAATTGTCCTTTTATAACTACGGGGAAATGGTGGATTTGTCTTAATTATGTGTTTCAAAATAGATATATTTTTATTTTTAAAAATAATTCACA
TGTATTCTTATATAAGTGGTTCATGACAAATTTTAAATCTCTGTAAACTATTAAATCCTAACTATAGAACTCGAGTTAAGAGTTACAAATTATTTGAAGT
ATAACCATTGACATATTTCTCTAATTGCAGATCAAGAAGGGTTACAAATTATTTGAAGTTTAGCCATTCTCATATTTTTCTTATCACAATCAAGAAGATG
TCATAGTTTATTTAGAAGCAAATACCTAATGCTATATTGACTAATATAAGTTCTTAAGTTGTGAAACTTCTTTGCATCATTAAATTTAATTGATATATTA
TACTAGCATGTAGATTTATGTTTGATAAACTTGATATGGTAATTTAAGATTAAATAACAACGTGCTAGTTTAGTTGACATGATATTATAAAACTTAGACA
TAATATATGAACATGATTCTTAATTTGGCATTCACAAGCTCTAACTTTGAATATGCACTAATAGGCGGCACTTAAACTATAATAAAATTAAATGAATAGA
TACATATGTCTTACATATAGCATGATACAAAATTATCATGTAGGACTAATGTGTTCATTTGCTCAAGTTTATACAAATTTAAATGTTTATTTGCGCAAAT
CAAATATTACGGTCATAATTATCAATTGAGATCAAGTTAAGAATTATTAATTATGATTATGCATAAAATTTATTTACACTATTTGACTACAACGTGCATA
TGGGTCGCGATTTGCCTGGATATCTGGCGGGTCGTGACATTTAGCTACTATTGAAATTTTTTACTATGAATGAGGTATACCAACTCATATTTGTTGAGGG
TATTTTTTCTATTAATTTTAATGTAATATATGGGACTATACAATGTCAATTCAACATTTTCTCAACCATTTTTTTCTCTTTCATTATTATTTTTTTATTT
TCGATCTTTTTGATACATCTATTTTGAAATCAATTTTATTACTATCTCATTTTCACTTTGCTTATCATAGAAACAAAATTTTCTTTTCTCTTACATATTT
TATCAAATAAAAAATAATATTTATTTAAATATTATTTTATCACTAAATAAATACATAAAATATCAATATTCAAACTTAATATTTTAAAACATAAATAATA
AGACTAATTTAATAAATAAGCCTCTAATAAAAGGCAAGTGAATTTATATATAAAATAAATAGTGGAACACATACTATTAAATTATATATTATTGGCATAA
AAATATTATTATTATTATTATTTGATCATAAATTTAAATATATATTTTTAGTTGCAATTTATGGAGTCGACATTAAAAATAAATTTGTGTTGGTTATATA
TTTTGTTATGAATATTTAAAATGATGTTCCTTTTTTAAAGTACTTAGATACAATTTTAGAAGTGAACCATCAATTTCAAAATAAATTATTAGATGTTCAA
GTTTTTTAATATAACTTCAAATATAATAAAAAATTATATTTCAAATTTGTAAGGCCAAACATTGAATTTAAAAATAAATTAAAATATTATTATGAAAATG
TGATAATTTTTTTATGTTGGAATGGATCCTAAAACTATAAGTTGAAAAATATACAAGATATAAAGATGATTTAATTTAAAGTACGATAAATGAAAAAAAA
GGATTTTTCTATAAAATTTTAATAATAATAATAGTAATAGTAGTGGTAACAGTCATATTTTATATGCCAATAATATACAATTTAATAATATGTGTTCCAC
TATTTAATTTATATATAAATTTACTTGCACTTTATTAGAGGTTTATTTTATTAAATTAGTCTGATTAGTTAGGTTTTAAAATATTAAGTTTGAATCTTAA
TATCTTATTCATTTATTTTGTAATAAAATAATATTAAAAATAATATATTTTTTTTATTAATAAAATATATAAGAGAAAAGGATTTTTTTTATGGTAAGCA
AAAATAAAATGAGATAGTAATAAAATTGATTCAAAATAGATACTAGTAAGAAGATAAAAAATGAAAAAAAACATGAAAGAGATGTAGCGTGGATCCCAAA
TGCATATTTATTTAATATTTTATTAATATATTTAACAAGATGTAGCGTGAATCTCATATTTTCTTTTTAATTTCTCAATCAAAATTTATATTCTCTCTCC
TTTGGTTTCTTTAGCTGCCCACAATTCCATATGTTAAAATATGAGTGAAATCTCATACAACTATTGTTGATTATACCTCGCTCTAAATAAATTTTTTTAT
GGCTATTAGATTGGTTTGTTTAAGAAAATGTGTAATTACACACAATTGGAACAACATGAACTATTGTGTCATTGACACACAAGCGAAAATTGGCATAACT
TATACAATGTTATATAATTATTTATGAAAATATCAAAGAAGAAAAGAAATATTTATGATTTATAAGCATGAAAATATAGTTGCAAACGATATTGATCAAC
AAATGACACATTAATAATGTTGATTCGTCTTCTCTGTCATATAATCGATGAATGTACTTCAACGTGAGGGAATTAGTCATACTATGTGAGAGGATTATAT
TAAAAATCAGTAAACTACAATCTGTGTTCAGTTCTTTTTTATTGAATTAAAGCTTGATTAATTAAAGTTAGATGAAACAATTACTCAAAGGGAAAACAAA
CCTTTGTAATGATCTATTATGCAATCTTATAAATTTTTGTTTATTCGGTAAAATTGAATAATCAATTTCGGCTATTTTAATTGTTTACAACTTCTGAGAT
TTTTATGTTTATGAGAAAATATACAATACGAAAGTTCTATATGACATGTCCAAAATAAATTTCAATTTCATATTATGATATCATATCATGATTTTATATC
ACATGAACAAAATTTATTTTTCTATAAGGAGCACCTATTTCTTCTGAGGGATAAATAGAGTCCGAAGCCAAAAGGTTAACTTTTTTCTTTCAAAAAATCA
AAGCGGCACATCAAAAAAAAAAAAAAGGAGAAATCGCTTCATGGGGAGCGATTTTCTTCTCACAAAAATCCATCGTTAAAAAATATAAATCGCTATCTTT
GAAGCGCTTTTCTCAAAAAAAAAAAAAAAACACAGCAATTTTGGTTAAGAATTTTTTTTTTGAAAAAAAATCGTTGTATTAGATAGATCAGGAATTTCTT
TTTTTATGATTTTAATCTTGCCACTTTTGAACTTCCTTTTTAGATTCAATATTCTTTTATTATTATTTATAGTATAAAATTCAATTTACCTCATGCTTCA
ACAATTTTATTGAGCATATTGTCCTTGTCAATCAATTTTATATTATTAATAATTAACAATAGGAATGAAAATTAATAGCACATTAAGAATAGACATCGCT
GCAGCGATTCAAGGAAAACTAAAATCGCTGTCACAACAGCGGTCTTTAATTAAAAAAAAAATGATCTTTAATTTAAAAAAAAAAGTTTTTGGACAAAATC
GCTTTGAGAGCATTGATTTTAGTCATTGTACTAGAGAAAAATCGCTTCGTCAGGAATGATTTTGCCATTTTGATTTTAAAAAAAATTAATATATTATTTT
AAAATTTTTGATAATTTTTTTTGCCTTTTTGACTCCGAACTCGAAATGAATACATGAGGGTTGATGTATTTGATTTTTTGATGAATTTAAGTCTTTTGCA
TTTTGTATCCTAATGTATAGTATAGTATATTCTCTTTTGCAATTTATAGCATAATTTATTATCTTTAATAATTTGCACTATAGTTTCTTTATTTCCTTGC
AAACACATTATTTGCAATTTATTAAATTGAAAATCAGGCTATACTTCTTTTATTATTATCATAGTTTTAGAAAAATCAAACAATTCGTTGACCACCGAGA
AACGGCAAAAATGACCACTTATAATAGAGATAGGTTCAAAATACTAGTCTACCGAAGATACATTTGAAGTTTTGAACAGTTTTGCAACGTGTTCATTTAT
TTTGTCTATTTTAGGGTTACTGTAATTTTTATTCATTATTATTAAGAATTATAGTTTATGGAACTGAATAGTACTGTTTATGATACCTGAAAGGACTGAG
GCGGAGTGGTTCGCTTCATTTTTAATCAACAGTTTCAAGTTTAAATTTAATTTGATGCATAATCACATTTGTTAGGGAGATTTTATTTAATGTGGAATTT
ACGAATTCAGGTTTAGTCGAATTTCAATATAAGTATCAAATATCGAGTGGAAAATCAAATTTAGTCAAGCTTCAATATGAGTATCAAACATAATGTGAAA
AATAATAAGAAAAAAAATATCTATGATTAATTATTAACTTTCACAAATTATCTAGACTTAAGTCTTAATGAATTGAGATATCTAAATGTGCACATTATAA
AATTAAAGTGTTAAGTTGCTAGATTAAATTTACATATTTATTTGTGTATTATGTTTTAATTAATAATATTATAGTTTACTACATATTTGACAAAAATAAA
AGAATGCTCAGTTTTCACTTTTCACAAACTTAGAAGGACGAAAAATGTACTCATCTTATTTTTAACGGACTAATCTGCAGTTAGCCTCAAACATAAAAGA
CCATTGTTATTTTCTCCCAAATGCTCCTTTAGTTTTCTTTAAATACAAATTTTAATTCTTTTTTTGCTCTGCCAGACTAAAAAACGCGGGCATCAGCTTC
TCCCTTACGCTTGCGGGTTTTGCTCTGAAAAACACCCGCCGTTTTTGGCTTTCGAAAACAAGTATTTCTACTGGAGAAGTTGCCCATTTGCTGTCTGAAG
TTATGTATTTGGCTTAGTTTTTTCTAGGGTTCAATAATCTCAGTCTCGTATCATCTCACCTTAATCGTGCAAATTCTCTGATTTTGAAACTCTTCAAAGT
TCTTGGTATTTTGAAAAACAACATTGATAATCGTTCCCGTGGTAATGAAGAAAGTCAAGAGGAATGTGGCCATTGTAATTTCGTCGTCTGATGACGATGA
AGACTTCTCAGTCAAGTCGAATTTCACCCACACGAAATCGAAATCGAATTCGAAATCGGTATCGGCGTCAGTTCCGAGGAGGTACCCTAAAAGGGCTAAA
ACGGCGAAACTTTCGTTATCATGTCCACGCCCATCTAAAGAGGGTAGTGTTTTCGATGAGGTAATACATAGGACTCATTCGATTTAATTATAGTATTGTT
TAGTAAATAGGGCTACTATTTCTCGCTGTGCTTTTCATTTGAGTGAACGTTAGTTGTATGAACGGGAAACCGAGTTTGGTCTTACCTGTAGTAGATGTTA
AGTAGTGGCAGTTGGTGAGGGTGCATCCATTGCTTGCGGTTTGATCTGTGCAGATATTAGTTGAAAATTAATTATGGATTCCCTCATAAGTTATGTTGGG
TTTAACACTCCCAATAAAACAGTAGATTAGTTTTGTGAAATTATTCTTCCTATGTGGAGATTGTTTCGCCAAAAAGCGAACATTGTATTACTTATGCAAA
ATTGTGTGCTGGAATATCTTTACTCATCAAGCCAATCAAATGGCCCTCCTTATCAAAATATATTAGCCTCAATCTATGGATGCTTAAGAAGGGCTCGGCA
CCTAGTTCACATGAGAGGAACAAACATAAATAGACTCAGCTGCTATGTTTAACAACCATAGAACAACCCCCCATCCCCCCCCCCACCCCCCCACCCAAAT
ATCTTGTTTCACAGAAGTGAAAGAATGCATGTTAAGTAGAGAACTTATAGAGTGGATTACAAATATACCTTGAACCTATGCAAGATCAAATATAAAACTC
CTTGGCTTTACTGAATATATTTATTTAACAGTTTTATTTAGTAACCTTGGGTGATGTTTGCTTTATGGATTAAGTTCTCATGTCTCGACTAAACTGATTT
TGTTGGTGGTTCATTAGCTATATATTCTGTTGTTTCTGGGATACTCACTGCACTGTACTTTTTGCCTTTGAGTAACTCAGAATTCTAATGGCATATGCCA
TATGGTATAACTGATTGCAGATGAAACGGTTTTGTGAGGAGTTTGATGACGATTTCATGGGTATCAAGGTATCTGCTGGTATGCTAGTTTCAAAAGATTT
GGTTTTAGTATTTATTTGTATTAATGTCAACAATGAACTGGTTTGGGGAGTCGGATATGGCTTTCACATGTTAAAATTTTGGAGCTGAACCATGACTCAG
TATCATCTAACTATGCAAGGTTTTTTGACTTCATGTTGATAATTCAGTTGGCAAATGCTTATTGGTCTGCATTTACAGTGATTTACCCTTCAACTCCTCC
TGATTTTGTGTTGTTTTGATTGCCAGCCCTGTCTTCTCCATCAACGCATATGTTTTAACAGTCCTCTGAACCTCTTCATCTTCAGTTAGTCATCATTGGC
AAAATACTAAATTTTATGAAACTGAATCAGGTCGTCGAAGCAACAATGACATGTGGATCGACAAACATAAGCCTCATTTCCTGGAAGAGCTTGCAGTTCA
AAAGAAGAAGGTAAAGAGCTGTATGTTTTCCTCATAAATTTTCTCAGATGTGAAGGTTTTAATGTTTGTTTCCTGTGCTTGATTTTGCAGGTCGAAGAAG
TAAAAACATGGTTTGAAGAAAGGCTAAAAGCTGCAGTGGTACATAATTAAGAGTGTTTTAAAAGCCTTATAAGTTTCTTTATTTTCTTAGACTTCTAATA
TTCTGACAACACATGGTCATCAATCCTGGTTCAACCAAGTGAATATTGCATATCTACTTTCCGTTTCCCTAAAATCTTAAAGTTCACTGTTTCTTATTCT
TCGGCAGTGTTCTTAGAATCGTTTTTATAATATTGGAAATAATTACTTTATTGTTGCTTTGCTGGGGAACCCTGTCTTGTAATGAAGGTTGAGTGGAGCA
TTAAGCATACATATACTCAGAATAAAGTCTCTTTTTCTTGTTTCCCTGTTTGCAATGTGTTGCCTGGAGATCCATAGGGGTGTGGGATATAATTGGGATT
TTACAACAACTTATGGTCGCAGGTCTGTCTTGGTTACCATTCTTTGTTTTTGAGCAAATCGGTAATAAATTTTTGTGTCATAGTTTGCGCCAGCTTGATC
CAAAAAAGTTTGCGCTTGCCCTGGTCATTGTTTAGATGTGTAAGTGGAAATGGTAATTAGTTATGGTGCTAAAATGAAAAAGTTTGATCCAGGAAATTGT
TGTATCATAGTAGTATTGGTGACCTCTCCTGGTCTGACATTTAGCATCTGTAATTTTGAGGGTTTGGTCTTTTCAGGTGCACTTGTTTTTACAGTGCTTT
TGACATGACAAGTGTTTTCTGCAATGTTCAGACTTAACATGGTCGGAATTAAGATTTTTCCTCTGCTGGTTGCAGGATGGTCATAGTAATGTTCTTCTCG
TTGCTGGACCTTCTGGTGTTGGAAAAACTGTATGTCACTGTTTTCCTTTACTATTCTGAATCAGGAGTGCCATGTTTGAAACTTTTGTCTTGCTCCTTCA
AGGACTGTAAAATTGCATGATCATTGGGTGCTTGTCATCTTCTAGGCAACTATCCATGCTATTGCTTCGAATCTTGGTGTCACAATATGGGAGTGGACCA
CACCTACTCCAACAGTTTGGCCAGAGCATTTGCATAATTCTAATTCAGGTACATATTCATGTGTTGGAAAATGGAGCTTCTTCAAGCTATCAAGTGCTCG
TTCAGAAAAGTGGATTCATATTATCATTTCATTTTTTTTTTTAATGTTGATATAGGGTTAAAATACATGTCAAAGCTAGATGAGTTTGAAGGTTTTGTTG
AGAGGGTGAGAAAGTATGGATTGACTTCTCCAACGTTGAAGGGATCACAGGCTTCAGTCATACTCTTAGTTGATGATCTTCCTGTGGTAAATGTAAGAGC
TGCGTATGGAAGGCTTCAAAGGTGTTTGACCCTTCTTGTGCAATTTGTCCGCATTCCAACAGCTATAGTGATCACAAACTATGACAAGGATGTCTCTGCA
GACTTTAGCACACGCTGCTGGGAAGAACTCCTTCTATCTCTTCATAGTGCTGGGGCTTGTAAGGTTGCGTTCCTTGATAGACTTACTTTGGATTTTGAAT
TCTTTTCATCTGCTTATCTTGAATCAAATGTCAAACATCCCCTATGAGTATGAAAACATGATAAATTAGCTTCCTTGGCTAATTTTAAGCAATTTGACCT
GGAACATGCCAACACTATCCACGGCCTGCAGGCCGAAGGGTACAAAATAGTTCACTCTTGAAATCTGCATATTGAGTTAGAGGATCTTTTCTTGTCTTTG
ACAGTAAAACAGCAGGGAAGTTTATCATTTTTCAAAGGCAGGGGAAGAGGCGGTTATCCAACACTAGATTCTAAGTTACTAGAGTATGCCAACTTTTTTT
ACTTGAGTTCATGATTTTCAGGTCAACTTCAACCCTGTCACTGTCAATTCAATCAAGAAAACACTTACAGCTATATGCAGAAAGGAGCAGCTTGAAGTTG
GCGCTGATTCGATTGATCTAATAGCCAAAGCTAGTGGAGGTGATATCAGACAGGCAATTAATTCTCTGCAGTATCTCTGTCTTAAACCACATAGAAGGCC
TATTCTATCGTCAAAAGAAAGACTGGATAACACTAGTTGTTTGGATGATGTGCTTTGTTTGCCATTTGGAAAAGATGAAACACTCTCTCTATTCCATGCA
TTAGGCAAATTTCTACACAACAAAAGAGAAAGTGAGCACACAATTGCATCAGGTACATCTGACTTAACTTCATTCTCAGGATACAGTGAGTTGCAAGTGC
TTACAGAACTTAGTAACTGTGTGCTTCCACACCTCTTCTCTAGCCACAAATTACTCCATCTTTGCTATTGATGGCAGTGGGGCAGGTTTAAGGCTATGCG
GGGAGGGGGGGGGGGGGGGACGGGTTGAAGTGTTTTTTATTTAAAACTAATGAAGGGCGGGGCGGGTTGCGGGTATATGTGATTTTATGTGAGTGTATAC
TTAATTTTAATTTTTTACATGTTGTAAGAGTGATAGAACATTATTTATTAAGATAATTTCTTTAAAGCTACTAAAATATTCAAGACTGTAAATGAAAATG
GTTCACTAAAAATAATTTAGTTTCTTACATGTTTTCCAATTGACCTCTAAAAATAAAGTTTTAAGTCACTATCCTATTAAATTAATACAGCTTAATGAAA
AAATGAATTTATTTTTAGTATCAAGTCATAGGGAATGCATATCTTAGCATGTACTTGAATGGTCTAATCTTGCAATCTTGGTTTCTAATTTATGAGTCAC
AATATGCAATACTGTATCTTTGAAAAGTTTTTCAATTGCTAAATGTGGTTTCAGCACTTGTAGACACTACTCTAATAAAGTTGTTAAGCTGATTTCCTGA
GATGTAATAATGAAATATTGTTTAAGAATGACTGATATGAGCATTGGTGATTGTCCAAGAAGTAGTCTCCCAAGTAATGGTAATTAGAAGAGTAGAAGAT
TAACATTTTTCACCTTGTGTAAATTACTGCCATAGGTATGAACTTACACGTTATATGTGAGGTTTTTTTAATTACAAAGCTACAGCTCTTCTTTAACCAT
GTGGAGTAAGATATGAGAGTTCTCTACCAAGTGAATTGAAAGGGAATAATTGAGAATACTGTCTTTGGCAAACCCTCTGATACAGACTCATTTTTTTTTT
GCAGATAGAGACACATTCCTTCTGAAGGAAAAATTTGTCAGGTTTCCTCTTAAAATGGATGCTCCAGAAGTTATTCTTTGTCAAGCACATGGTCAAGCGA
CGACTCTTTCTGATTTTCTGCATGAAAATGGTACTTTTTCTTCTTAAGGCGGACGGGCTTTCCAACTAATCTGGTCTGTTCTTTGCTTGTTGCATTTCTT
TTGGAATGAACTTAAATGGTGGCAATGCTGGACTCAGGGCTACTTTTTTCTTTTTGTTTTTAATTCAAGCACCTAAATCTGCCATTCTGTGACATAATGC
TATTTCCATATCATATTCGACCTGCTTTATTTGTGGGCTATAACAAACAAATTAGATTCACCACAGGTCCCAATAGCTTTAACTTCTGCCTTTTTGGTGA
ATTTCACCGGCAAACTAAATGTTGGCAGAGCTTGTTTTTTTAAATATATTTTCCAGTTCCTTAGATTAGAGGAGAAATACTATTCTTTTGTTCAACTTGC
ATTCACTACCTAATGGATTGTGCATGAAATGGGGTTATTCAGACTTATAGCCATCATATCTGCACATAGAAATGTAAAGTATGTTGTTGTCTAACATTTA
TAGAATTTGTTGTTTGTCTTATTCAACTACTGATTTTCAATTTTGTTGCAGTTTTAGACTTTTTGAGTGAAGACGCAATAGATGATGCGTGGCTTGTGGC
ATCATACTTAAGCGATTCGGATTTTCTTCTGTCTTCACTTAGTGGACATTTATCTAGAGACTTTGGAGCTGAGAACATCATTCAGTCAGCTGCTGCTTCA
GTTGCTTCCAGAGGAGTATTATTTGGGAATGCTCATCCAGTGCCTTCTAGGTATAAAAACATTACCTGGTTCGTTATGTTTTGTTTATATAAAGTACCTA
AATATAATTTATTGCAAATTCCCGTGAGAAATCAGGTGGCATGCTATTCGACGTCCCAAACTATGGGAGGTTGAACAATCATCACGCCGCAATAAGGTAA
GATTCTTCCTGTCCCGTTCTCTGCATTTTGGTCTTGATCTTGCTCAGATAGCTTCTTATAACATGGATTTATCTGAATCAAGTCCTGAACATAATGTTTC
TCACTAAAGTAGTTGCTTAGGAAGCACTAGTGCACTACTATAATTTCCTAGTGATCCTTTAGTTGGTGGTGTAGGCGATTTAGTCCCCACATAAAACACA
ACATTATTCTTTTGTAATGTTTTGGTTGGTATTTTGTTTTCCTTGTAACTAATACATACTTATGCATGTGAGAACCTATATAACATTTTGTGGGATATAA
TGTAGAATAAGAATGTGGGTATTAGTAATACATGGATTAAGAACAATAAAATGACAAAAGTAATCCTCATATTAGTAAAACAGCCTCTTCTTTTTGTTTA
AAAATGTAAACATATATTTTAAGCAATACACTGTAATTGTATCAAACTAAACATCCAACATGACAATAATCCCTATATTACTTAACTGCATTTTTTGTCT
TTTTTTAAACCAAACAGCCTCATGTTGTCCACTGATTTTGGATTTTAATTTCATCCTAACTAAGTCGATGTGTTTGCAGCGTCAAATGTTTACTCATTGG
GGTGACTTGTATAATAGCCTAACCACATCAAATCAGATAGTTATGGCAACCGAGATTAGGCCTTCCCTTAAATGGCTTGGATGCAGAGCATCTGAAAGTT
TCCAAGCAGACGACATGGTTGAAGATGACTCGGATAGCACCTATTTGCACGAGAATAAGCTGGATTTGTCCGACGATGAGATAGAAGATTGGTAGTTTGA
AGCAGTGTTTGAGCTTGTATCAACATATAGTCCATGTGGGCTCTTTTTCACTTGTAAATTATGTATATTGCTGAAATTCTGTAAATTTTTTAGGGGAAAC
AATACAACTAGTTTATACTCATTGAAGTAGTTTATTAGGAAAGACCTTTGTTTTATAATTTGAGGAATATTAAACAAACGGTTGCTAGTTTTTACAAACC
TATCACTCTCCAGTAAAGTGAAGTGGAACTGGAAAACTATGTTAAGTTCTACTTTGGTAGGAGAAGAGATATGGACAAAAGTACTGTTTTGTCACTATCC
CAGTTGGCATTGAAGAATTGAATCTGAAATTTGTTTTGATAAATCTCACAAAGTTATATTCCATGAAAGGAAAAAAGTTTATCTCACCGATAGGATATTT
GTTAGTTTTATCTTCTATTTATTTAATTAATAAAGTACTTTAACCAATCCCTAGTGTAAATTTCAAATAACCTCACAAACTGGGAAACAAGCCAAAAATG
AAAAATCTCATAAATTTGTTTAGTTTCTTGAACTTGTGTATTTACTGAAAGTTAAAAATACTATAAAAAAAGATGTGTCAGTCACGCATCCTACTTGGTG
AGCTTACGCCGGCTATAGCCCTTTCCTTGCTCTTAGTTTGCATTCAAGGCACTAGTTTCACAAGTAAAAAATGTGGTTAATCGAATAAATCACAAATTGC
TACTCCACGGTTTCGTTCGCCCCTCCAGGCTTGGCTCCAATTTCTACAAGTTCAGCAGCACCAATTTCTACAAGAGCAGCACCAATTTCTACAAGTTCAG
CAGCAGCTTCTTAGGCTGGGCCATCAGCTTGAGGTTGTTCCTGTTCTTGATGCTTCAAACAGTATATGAATCTGCCTTGGGCAGCTCGGTTCGACCGAGC
CCATGGACGTGCTTCAACGGTATATGAATCTGCCTTGGGCAGCTCGGTTTGACCGAGCCCATGGCCGTGGTGTTTCGTCCCTAGTTGGATCGTTTCACTC
CACATTTTTTTTTGTAGTTAAACAAATATAATTATTTATTTATTCCTCATGAGAAGGTAAATTTTACTTGATAATAAATGAAAGCAATTACTTCTTTAAG
CCAACTCTCAACTTCACCTCACAAAAATAGGGGCATTTGTCAAACTACGCCCTGCCTACGATGATGTATTGTAATCCCATGCTTCACACTGGTTTAGGAC
TTGAAAGTAACAAGAGAAACCATTGAGTACACGATTCAAAACAACAACATATAAATGCAACTTTTGCAAAACTATTTTTTCCCAACATTTGATCCAAAAG
GACAAATGGAAAACACTAGTAACTGTTTCCGAGCAAAGCTAAAGCATACTTCAAAAATCCTAACATCCTCTTAACGCCAAAAGCTGGCAATCTATATCAT
CTAACTCCATCAGCCAGCCATACTTACACTGTCGATGATTGCATAAACCCAAATCATCTCTTTCGCTCACTCTCAAGAATCTGCATTTCTAAGTTACCCA
ATAAATTATAGCACATACTGGGAAACCAGTAGGGGGAAATTCAAGAACACATATATACATTTTTCCTGCTGGCTGCATGGACCACAATAAAGAGTGCACT
CTGTATCTCAAGGCAAAATCCTCTTCATTTCATGCACCTGATCAGTATTTTTGGCTTGATTATATACCGACTCAAATGCATGTGTCCATACATTGGCAAA
ACCTGTCACAGCCTGAAAGACATGTGGCAAACCCATCTGTAGATTGTTCAATGTCATCGCCCTAGTTACACTCACAGCTTTGTCATACTTGGCCTTCTCG
TCCTCAGCTTTTGCTCTTATTGCATCCACCTTAGCTCGTTTGTCAGTCACAGGATTCTTGTTCCTTGTACTACTGCTAGAGGAATCAGGTATAGAATACG
GCCCATACTTGGACTCTAGCGACCGAAGCTCAGAAGATTTCTTGTCAAGCTCTTTGAATGCCATCTCTGATTTCTTCTTTTGCTTGATCTCTTCTGATTG
CTGCACCACAATGGCATGAATAACAGTTAGTAAACTGTTGATTCCTTCCGATGCTACTTTGTCTGGAGCATTATTGACTGCAAGATGCCACTCTTCACAA
AGAGAGTAAACTGCATTGTCCTGGCTGGTCTTATGTACAGGGTTGTTGCCAAGCTGGAATAGGCTAAGACGGAGCCAGCCGGTTAGAGACTGAATATAAT
CCCGGTGAAATTTCACTAGGTTGCAAAAAGATAGGTGCCATTGTTCCAGTTCAAGCTCAAGTTGTAATGTTGATTGTCGATGAAGCTCAGAGGTAGGATA
AGTTGATGGCACGGTATTGAGATACTTCAACTGCTGCACTATATGTGTTTGAACATGATGGCACTCATACATGCTTCTCCACATGTACATCAACCTGCAA
ACCACAAACAGTAAGGAGACAAAAGATAGAAGGAAAAGTTCAAATGATTCTTGCAATATTAATCCTTTTTGCTGAAACTCGAAAAATTTGTTTCCCTTAC
TCACAAGGCACTACTAGTTTGTACATTAATTACTAGTGAAAGTTAAAGATTGTCCCATGAGATATAAAGGAGCAACATTGAATTTCATTAACATCATCCT
TAATATTGCCAGTATTCATTTTGCAACTGAATATAGTGGGCCTTTGTTTCTAGCAAACTACTGGTCTTTAACTACAATTTGACCCCACCCAAATAAAAGA
GGGTGACCTTAATTTCAGTCAACACAATTGACCACTTTGAATAATTTCAGTCCCACTCTTAAAGAGAAGTTGGCCTTTTCACAGTTTTTAACAGAAGAGC
AGACTGTTGCTGTATGCTGCTTTCGTATATTTTTAGGACATGAACCGAATCAGTTAAAGGAGTCAAAAGTTTCCCATTCTGTACGGAGAGCCATTCGTTG
CTTTTTACTACATATTGCTATAGCTGACTTTGACCCCTCAAAATTGTAAACACTCTGCACAGCCAAAACAATATTTTTTCCCCCAAGAGATGAACATAAA
GATGGTGAATAGAACTAACCCTTTGACTAGATCAACAAGCTGTGGATAGAGCTCTGACTCCCTTAATTTGATGATTTCAGCTGATGTAGTTTCAATAGCT
TGTGCAGCAACCATCATTTGTGATTCCAACTTTTCTACTTCTTTCTTGGCTTTCTCTGTTTTCACATAATCAGCTCTCTTCATCTCTAGTTTTCTAGCAT
GACCTCCCCTTTTCTCATGCTCCAATTTTAATGCCTCAGCATGCTATAAATCATAATCAAATAATTCATTAGAAAAAAATATAGTAATTGAGTTGGGACA
ACAATATAATATATTAAAGTTTAATTTTACCTTGACCTCAAGATAGAGTTTTTTCTCCCAAGCATATAATCTTTCCACTGTGGAACAGTGGGAAGCTGCT
TTGGCACCATTTACCCCATTGATGGATTTGTTCATTGGATCATCACAAAATCTTCCAATTCCATTCCATCTTGAACTTCCACCAAATGACCATGAAAAAG
GACTCATCAACTTATCTACAGAACCCCAAAAGAACCAATTTTTATACTATATTTTTGGGTAAGCATGTTGTACCTTGTGCAGTTATATGTATACATACCT
GAAGATCTTTGTTCGGAAAAAGCACAATTGGGAACTTCCAAAAGCAATGAGAGTTGTGCACCAGCATCAGCAGCATTAAGAAAGTACTCATCGAGTTCTT
TGATGATTTCCACCAAGTCTTTGCCTTTAGTAGAGACCACCACCGCAAGTTCACTTGTTGAGGTGGTTTCTTTAGAAAACTGGCTCACCGCCGACGGTGG
AGCCGCCACGCTCGCCGCTCCTACCGTGGTGGTGACGGCAGCCTCCGATGTTATCGTTGTCTCGTCCCATTCCTCCTCCGTGACTGACCTCGAAGATGAC
GGAGGAGGCACAAATGGGTCCCAGAAATCCCAATTTGACGTCGCCGGAGGAGGAGGTGGAGGCGGCGGCGGAGGGGGTGGTGGAAGGGCGGAAGATGTAG
TGGTAGAGGTTGTCCAGGATGTGGGACTCATCGGCGGCGGAGGAGGAGGCGGCGGAGGCGGCGGGTGAGGGGTGGTGAGTCGCCGTGGCGGCGAGGGTGG
AAGTGGTGGAAGGTGGTGGTTTTGCGGGTGGAGATCGGTTTCTCCGGTAGCGAACTGAAGCAAAGCAGAACCAGTATTCCTCAATGAACGCAAGTACATA
GAATGAGAAGCAGAAAAAGCTTGTCTTGATTTTACCAACTGTTTCATATATCTCTTTCGAGCTTTACATCTTGAAACCAATTCTTCTCTCTCTAATCTTG
AATACCAACAACCCATTTTTTTTATCTAATTTCTCTCCTCTCTTCTCTTCTTTAAAAAAAAAAAAAACACAACTCAAAAAAGAGCAAACCAAGCCTCACT
TTAACCTTTTCTCCTTTCTTGAACTATCAACCATGTTCCATGTGTGTTGTACTCCAAAGACTGACACACCAAATTTCAGACCAAAAAGAATTAAAAAAAA
AGAAAAGTAGTACTCTTCTTTTTGCTTACTCAGATAGATCAAAATTGAATCTTTACACCAGCTATCCCCAATTTGAACACTAACAAAATCACCATTTCAA
TGGGGAAATGTGTGAGAGAGAGAATGAGGGGAGGAACATAAATTTGGAATTGTACAGAGGCAATAGGTGTTGGACAGAGTGCCATTTCTTTTTTTTTAAA
TTTATAGTCCTAAAACAGAGCCAAAATGCCCTATTTGAGAGATGTTGTGTTATTTACCAAATTAGACATTACGTTGTCAAATGCATGAAATCTTGTTATG
ACCTGTGTTGAGGAAGTGATGGGTAGTTTGGTAATATAAATAATTCAACGTACACGAGTCAATTTATAAGGTAATAAATTGAGTTTAAAGTCCAGAGTGG
AGGGGGTTGGGTCATGACTCAATTGGGATGAAAATTACGAGGTCAATCTGGCTAAGGATTAACAACCCATATTAATCTTATGCAAGATTAATATCTATTA
AAGGAAAAATATTTAATTAATATGAATATTTTATTATATTAATTTTATTTAATATTAAATTTTGAAAATAATAATTAATATTAGAAATAAAATTATTTTT
AAAAAGTATATTTAAAACAATAAATAAAATTCCCTTTTTAAACTAGTGGACAAGTATTTAGTTATTTATATCCCCTTCGTCTGAAAAGGGAAAAAGAAAA
TAAGTAAGATTTACCTCACTAATATTTTTTGCCAGTTTTCTACATTTTTTCTTCTTTACATTCACGTCACTGTTTTTTTCTCTCAGTTTTGGACATTTTC
GAAAGAGCATGAACCTTTTAGAAGAGAGACTAGAAATTGTACTACTTAATCATATTTTAATAGATTTTTAATATATACGTAAAGAATTAAAATTATTGAA
TTTAAGTGAATCAGTGTAATATTAGAACTTTATTTTTTTTAAAAAAAATCATTATTTTGAAGTGCCTATAAGTGTCATAAGTATCATATTGATAAAAAAA
ATAATAACAAATATCAGATTGTAAAAACTATTCTATTTGTCTTATATTAGTTATCTACTTTATCAAATTTAGAAAGTGTTAATTATTTTTTATATCATTA
TTGTAATTAATTCTTTTTTAAAATATTTTTATTTATAAAAATTACAAAAAACTTTTTTAAAAAATGAATTAGTAAAGTTATTTTTTGACTTATTAAACAC
TTCAAAATGAAAGTGATCAAGGAAGGAAGTGTATTTAAGTGTATACCAGTGTACTATATTATTTCTAATAATTTTATTCTCTCTATTGAAAACATGCAAC
TCTTGAACATCTCAATAAAATAATTCACCTTAATTGTCGCAAGAATTAATTAGAAAAAAGACAAAATAAATTAAATGAGATATTTATTCACATATACTGT
TCACGAAAAATTCTAATCAAACTTGATAATTACAAACTGCTTTCTCTAATCATAATTATTTATCATTTGATTTTTTCACACATAAATTAAAAGGGATAAT
TTTATATTATTTTATTCAATAATATTTGTTCACATTTTATAATATGGGCCGATCCATATGGACTTACTCTGACCCAAAACTTATCGTATCAATTCAGTCT
ACAAATTATCTTCTGGTAAATCTCAAATCTTAATTAAGGAAAATACAATTTAATTTTCCCTTAATTTCGTTATTATTTGAAGAAAAGAGAATCTACGTAA
CTTTGCTTTTCTTTTTGTCTTCATCCTTGTCCTATTTTTGTTCTCCTTTTCGATGTTTTTACCAGATTAACGTTTCCTTTTCGAAATTGAAAAGTTGCAA
GTTGTTTCATTTTGTTTTTATTTTGATTTACCGTTATCTTTATTAATTAATTTAATTTATTGTTTATTCTCTGACAAACAAGACAAAGCAAAGTACTTTT
CCTTTTTTTTCTTCCTTATACTAATGGTAATTTTGTCTCTATGCCCACTACTTTAAACTAATTTCACTCTTAAAAAGTTGCTGCAACAAAAGTGAAAATA
TACTATTGCAACATTTCACCTAATAGGAGAATTGTGCGGTGACTGCACTATTAAATTAAATTAGAGTACCACTATTCACTTTTTCATATTTATTTTAATT
CATCGTATCAATGAGATGAGGGTTTTTTTGTCAAAATCTTTTATGAAATTTGATATATATTTTATTCTCCTCATATAGAGGTAAACCGCTTTCCAATAAC
TATAATTTCATATATAAAAATATTTAAATTTAAAATCTTTAATTAAGAATAAATAAATATTTACTATTCTACTGCGATCTCTTTTACGAATGATTTCTCA
CTCTAGTTAAGCTTACGTTGCGGAGTAGTAGTAATATTTTTGGGGAATTATGACTAGGACTAGACGAGGTAACACGTGAGCAGACCTGCAGCAGGCTGCA
AGTGGTAATCCAATTAATCTATTAATTAATACTAGATTGGAGTAATAAATTTCTATTGTAATATAAACTCTTGCCAAGGTATATACTTTTAAGATGGTCC
ACATATGACGAGGATCAACTAAGATTTTGGGATGATTTGTGACTCATTTTTCTAGAAGGTTCTACTTTGATATCTGCAACAATTTGAAATATCTGAGATG
TTCCATTCATTAAATATAACTAGTAAAAAGCACTATAATTTCTTTTATATAATACAATTGATGTTTGATGATAATGTCAAAAACATTTAATGGATTCAAA
ATATCACTCTTGCTGAGATTGTATTTACTCTCGTTACTTTAGAAATTCTAAGTTAGAACATAAAAAAAGTTTAATTGAATATGTTACTTTCAAGTACTCG
AATTAGAATTGCATTATAACCTATAGCCTATATAAAATTGTACCATAGCCTATAGCCTGTACAGCCATATGTAATTTTGGACACCATGTGATTAAAGTTT
TAGTTTTGTCAATCCCAAATTTAAATACTCCATATTTAAAAGGAAAAATTATATTCAATTATAAATTATTAATTTAAATTAAATGTTGTAATCACGGTTT
TTTTAATTTTAATTTGTAGAAATACTTGATTTCACTCACTACTTTTCCTCACCTCTTTCACATTTAGACAAACATAAATGTTAAATTGTATTTGTATTTG
TATAATGCGAGAGAAAATTATATACACAAATATAAATTTCCTCTAAATTTGACAGTAAAATTCAATTTAACACTTAAACTATATGTGTGTTTAAATACCC
CTTAACATCTTTTAAGTGAATTTAAATACACCCGATAGCAGACGTGACAAGTACAAAAAGTCACTGCGTGAATAAATACTAACTGAGCCCCTTTTTTTTG
GGCCAATAATCTTTCTTTCATTCATCTTCTTTACACCCCACCACCTCAATCGTTGCGCTTTTTTTACAAACAAAGCTGCCTACATACAATTTATACAAGT
GAGATACAAATAACAAAATTATACTTATAAAATATTACTATAGTTTTTATATTCGCTAAACTTAAACTTGGCTAAACAAAAAGAAATGGACTCTTACGGC
CTTTTTCTACGGTCCGAATTCTAAAAGCTCATAAACCATTAATCGTCATAGATGAGGCTGGTGTAGTGAACAACAAAATAAGCTGACGCCAAGAAAATGA
AGGTTCGTTAGATCTGCCAGCACACGAGCCTCATAGGGTAGCCAATAGATAAGAAATGCCCACGCCATAGCAGTTAGCACGCATATCAACACATTCTTCA
ACAATACCCTACGCTTTTCAACTCTCACGTTTATGCACGCGCCAATCATCTTCCTAATTATGACGTGTGTTCTTAACGTGCTTTCTGAAAGCGAATGGGA
TAACTTTTTTTGGGTTTTCCCTCCATAACAGAGAAGAAGTAAATTCGTTTCTTGTGTTCTTCCATATTCATTGTTTATCTTTTCACTCATATAAAAAATT
CTCTTTTCATCTGTTCTTCTACATAATATATATAATCCTCCAGTTCTCATAATTCCATTATTAAAAGCTTACGATATCAGTGTCCCGTATTATCGAATTA
TATTATCAATGGCAGCACCAAAAGTAGATGCAGAGTATCTGAAGGAAATAGAAAAGGCACGAAGAGATCTCCGAGCTCTCATCTCCAGCAAAAACTGTGC
TCCTATTATGCTTCGTTTAGCGTATGTATGCATAATCATCAAGTTTTGTGTTGAAATTGATTTTTGATCTGATATGATAAAGATGTTTTAATTTGCAGGT
GGCATGATGCAGGAACCTATGATGCTACAACTAAGACTGGAGGACCTGATGGATCAATCAGGAATGAGGTAGAGTACAAGCATGGCGCTAACAGCGGCCT
CAAAATCGCAATTGATCTTTGCGGTAAGCTTATTAGCCTTTTGTTTTTCTGGAGTTTCGCGTATATAAGAGATCTAGTGATAATCTGACGGAAATGAATT
TGTGTTCATTGATAATGTAATGATTTTAGTTCAAATATATGAGTGCTTTTGATTGATTTTTTTGGATGTTAACAGCGCTAATCACGTCATGTTTTATTAT
ATCGCTTTGCATACTGTTTTTGAGTTCTTATTGGAAGATGAAAAGCTTATCATATCATATTTATGAAATTCTGTTAGTTTGTTCTGCATATAATTGGAGT
CTTTCTTTGTGGTGAACAGTTTCTTATGCCTCTTTCTTTGTTCCTAGTATGGGAAGTGAAATTTACTTCGTACTGTTATCATTTTTCAGTTGAAAGCATT
TAGGAGAGGTTAGAATTTGTTTAATTTTTACACAGCCACACATAAACTCCCTTACTAGAACTGTAGATCATGAAGCGACTTGAAAACTTTGTATGTATCT
ATCATCTCCTCCCTGTTTAGCGAAATTTTTACTATTTTCAAGAAAAACAGACAATTTCTAAGTTTTCTCTAAATGAAGATAGACTGGTCCTTGTCTGCTG
AGTACACATCCTCCTCATATGCCATATTTTGTTTACAACAAGTGCTTGTTTTGTCAGTTTCATTAACTTTGAAGATACTAAATCCTATCTTCTAATAATC
TTTTGTGTTATATGGAGTACAGAAGAAATTAAGGCCAGACATCCTAAAATTACGTATGCTGACCTCTATCAGGTGAGAGTACTTGTGTCGAAGATCTGTT
CAAAATTTTGGGGAAGTTTTGTTTAATATTAGTTGTATTAGTAGTAGTAATGCAGAGGAGCAAAAATATTATGGTTTTTACGGATTTGAGTTGTGCGTAA
TTACCTTTTTATTCTGGACTGCAGCTTGCTGGAGTTGTTGCTGTTGAGGTAACTGGAGGTCCAACCATTGATTTTGTCCCTGGTAGAAAGGTACAGAAAA
GATGAAGACATGCCTCCTTTTACTATTTTGAACTTCAAATTCATTTGATGGGCTTGTCTTTAATTAGTAAATTCCACCTTTACATCAGGATTCATTAAGT
TCACCAGAAGAGGGACGCCTTCCTGATGCTAAACAAGGTTAGTCTTCTAAAAAGTTGGCTTGGCTGATCTATTACTTGAAATTAAGATAAAAGGTAATAA
ACTCAATTTTTCCTCTAATTCAAAATGTGAAGTTTACCCTCTGGGATTCTTCTCATTTGATTGAACAGGTAACCTTATCAGTATCACAAATTGACAAGGA
TCCTCATCCTCTTGTAGGGAAGGAATCCATGAGAATAGAAGATAAAAATAATGAAAAATAGCTAGCTTGTTTAAGATTTAACCTTACTGGCACCTGAGGT
GCGAATGGAATATTGAGTTGAACTTGATTTAGTGCATAAAATCAAGTGGAGCCTCATCTATCCTAGTTGCTTCAATTATCCTCATTATGCCATATTCTGT
GCCTGATTATTGTTGTTGCATCATTTTGTTTTGAACAACTTGAATATTATTTTCTTTTACTTGGTTCTGCATCTATGTAGAAGTGATGTCAATAACCTTG
GAGATGTCTCTTTGCTAATTTGCACTGGTTGCCTCCTAAACATGTTTTATGTGGGGTTCCCATTATTCTAAAGAAAATTTTGTGAAGGAAAATATATTCC
AATCGGAGAGAGCTCTTGAATATTATGAACATTGAACTGGACTTGGTGATATCCTATTGCAAAAATTGTAAATATTGCTAAAACAACTGCCAGCTACCTT
TGACTAATTAGAAGAATTGGCATGAATTTCTGAGAGGGCTCTACAACTCAGTGCTCTGATTTTGAAACATAATTCTCTGCATGTTGCTCATCACTTACTT
TGTTCCATGTTATAATGCCTTTTTAGGTCCACCGCACCTGAGGGATGTTTTTTACAGAATGGGACTCTCTGATAAAGATATAGTAGCATTGTCTGGAGGA
CACACACTGGTATTTTGTCTCATGAATCTGCATTTAGATATTTAGATATTTCTCTCAAATGATAATGCTGTTTGTCTTAAAGTTCCTCTTTTGTGTTCAC
TGTTACAGGGAAGAGCACACCCAGAGAGATCTGGCTTTGAGGGCCCTTGGACTAAAGAGCCTTTGAAATTTGACAACTCATACTTTGTGTAAGATTAGTA
TATGGTGGAACCTCTTTTTTATTTCATCATTGTTAAAAGAATGATTTCATGACTACTTGCCTAAATGGTACAATGATCTCTTAGGGAGCTCCTCAAGGAG
GATTCAGAAGATCTCTTAAAGCTTCCCACGGATAAAGCTTTGGTTGAAGATCCACAATTCCGCCCTTATGTTGAACTTTATGCAAAGGTATTATATCTCA
TATTTCCGTGCATTGTTTTAATGGTCAATTGTTGCAACACATAGTTTACATTTGTAACCACACTACATTGCATAATGCATGGAGGAAAATAACATAGAAA
ACCAGCAAGGCTGACTAAACTGTGGAAGTTTATCTCCACTCATTTGTCACTCTGTCGATATACATTGATGATTAAAGGATTTGCATGCTAGACTATTATT
TCCTATTGATGGTTTGACAAACAGTTAACTATGTGAGGGGTACTGGAATATTTTGCAACCTTAAGTAGTTCTGGTTTGCTGTGAGACACTTGATATTTAA
GCCTATGGTACAATCCTTGACTAGTCCACCCAGCACCAAGGTCTTTCACTCCCATATATGTTTAATTTGTAAACAAAATAATACACAACTATCTAGTAGA
ATCTTTCATCCAACTTAACCACAATCAAATATATCTATTTGGCTAATGAGCTACACTATTCTTCAAAAATTTTGGCGATCTCACTGGTAAAGTTTTCTGC
AATAGCTAATATCTAATTTGTGTGACAGGACGAAGAGGCTTTCTTCAGAGACTATGCAGAGTCACACAAGAAGCTCTCAGAGCTTGGATTCACACCACCT
TCATCTTGCTTCAAGTTAACAGTAAAGAACAGCACGGTGTTGGCACAAGGTGCCGTTGGAGTTGCTGTTGCAGCAGCTGTTGTAATATTGAGTTACTTCT
ATGAAGTCAACAGGAGAATCAAGCATTAGTAAGCACACACGTTCCATAAAGCTCAATATTACATTGGGGAACTCAGTTGAAGCAAAATGGAAACTGAATA
GCTCCATAATTCAATGTCATCAAAATTGGCGATTGTTATTGGCACCGCTAAGAATGATGCTAGTATTTCTTTATGTTTGATCAATAAATCTTGGGATGTG
CTGAGTGTAGCTACTCGAGTGTAAAATAACATGTCATTGGTGGCTTTGAAATATCATAGACCTACTCATGTTTCAAAAATATTCTCTGATTGAGAAAGAA
TTGTTCACGGATTGGCATCACATTTGTCATTTCTCTGTCTTCTACTAGTTTTAATGTCACTTATTATAGTTTATCGCACAAGAGCATAAAAGAAATTAGA
GATACGTTGTAATTTTAATCTCATATACGCGCGAAGTCTCCACTATCGGGTCAAAACTCCATTGAGATATCTGTAAATATATAGCCTTTAATTAAATCCA
AATGCTAGTATCAGTTTTGAAATGGCAAAATGGGGGTTGTTTTAGTCCAATCAATGCAATCGACTATTTTAGTCGTTTGTTTGTTCGTCATTTGGTAGTT
CTCTGTTCATTGTAGGAGTAGTAATACTCCATACAATTTTGTTTCTCTAGAGTATAAAATTATATGCTACTAGCACAACATTAAGTCATGTATTACTAAT
ATTTATATAAGTTATGTGAAAATCTATAACGTAGAATGTTGAGTTATTTAAGAATTTAAAATAACAAATTTTGGTGACTCTTAGCTAACTTGGAATTGAA
CTTACCGTCCGATATTTGGGTTCGCAATTTATTTTACATTCGCAATATTGTTGAAGTATCAATTTTATAGCGCAAGTTGAAGTCAAGAGATCAGGAATAT
ACGAAATTGTCCCAAAGTTCGATAATTGACAACTATAAATGTCAAAAATGAGCCAACTGACGCTAATTCGTCCAATTCGTCTAGAATTTTAAGGATTGGA
ATAAAAATAATTTAAATTGGCTTCAATCTTAACTCATTCAAGTCTTAGCCATGTTAAGATAATTCTCAACTGAGCCCAATTTAATTTCTAATTTCAACTC
ATTTTAAAACTCTTTATTTGCGTTGATGTAACGTATGTTTCTATATTGAAGGTAATAAAAGTTAAATAACAATATATAAAATTATTGAAATTAAGCTGCT
CATGACCTAACACAATTTTTAGTCCATTTAAATCTAACTCATTTGAGCCCAAAATAAATTTGGATGGGTCAAGACCAACTCAATTTCTATTTCAACTTAT
TTTAATATCTCTAATTTCAATCCAACCTTCAATTTGACACCCCCAAGGCCCTAATCCAATATATATGATGACGCGGAGTTTCACACATAAAAGTTCCAAA
TATCCTTTTAATTTTTACTAGTCAGTTATTTCTAAAATAAATTTTCATTTTTATTTGTTACTTTTGACATATTAAGAAAAAATATTTTTTTCTCATGTTT
TATCCTTAATATCAAATACTTTTTCCCAAATCATTTTCTAAGACATCATCTAATAAGGGATATTTTTTTAAAATATTTATATCATTAATTATTTTCTTAG
TGGTGTACTGAATCAAACTGTGACGTAAACGGATAGAGTAATTTGCTTCAAATTTTATTTCCTCATTACAAAGAGCTTAATTGCTGAATAATTTTGACAT
AAATAATCCAATATTAATTAGTATTTGCCTATTTTTTTCCGTCTTACAAAAAATCACAAATGATTCCTTTCTTTTTCCTCCAATAAAATGCCTACGTCTA
CTTCCTTTTCTCCTCCATGCTATTCACGAGTCATTATCATTGTCATACGTAAGAAGCAAAATAACCAATTCGTTTCTTTTATTGTTCTATATTCATTGCT
TCTATACATCACCCTTACAAAATTCCCCTCCCCAGTGCTAGCTCTATATATAATTCCCGTTTCCTATTTTCATTCATCAAATCAAAGTTAAGCCAAAAGG
CGAAGATCATTTGGCATAATATATAGTTTCAGCGTACCATTCATGGCGCCACAAGTAGATGAGAAATATCGTGAAGAGATAAACAAAGCACGAATAGAAC
TTGGAAATCTTGTAAAATCGAAGGAGTTCAGTGCTCCTGATTTCCTTCGTTTAGCGTACGCATCCCAATTCACAATTGCCAATTCTCATCATAACGATGA
TGCAGCAAATGCTACTTCTACTCATGATGCCACAAAAAAGAAAACTCAATCTGCCAATAATAATTCTCTCAACACAATTGGTAAGTTTATATTTCATATG
AATCGATTGTTGGTGTATCTTTTTGAATTAGACTAAAAAAAGAAAGTAAGAGAAATAAATCGAAACAGAGGGAGTACTATGCACCTTCTTATTAATGCCT
TTATATTGCAGATAAAATCAAGGCCAATCATCCCATAATAACGTATCCTGACCTCTATCAGGTGAGATATATATATACTTGTTGTATCAATAATAATTAT
CCGTTTTGTAATTTGCTAATTTAATTAACACCAGATGCATGCAAGCTAGTAATTGTTGAATATTTGGTACTGCAGCTTGCTGGGATTGTTGCTGTTAAAG
AACTTGGTGGTATAGACATCGAGTTTGTCCCTGGTAGAACGGTACGCAAAGGAAATATGAAAATTTATAATCCTATGTCATACAGTTTAAGAAAGACTTT
TAAAAATTGTGATTTTAAACCTGTTTGACCGGGTGACTGTGAATCAAGGATAAGAAAGAGAATTTTAAAGTTAATATTTCTAATTATAGAAAGATAACAT
TATTTTAGGAACGGACTAAAATGAAAATTGTACCACATACATTGGGACAATGCTAATTAGTATACTACTCCTTCTGTCCCAATTTATATATGACACCTTT
TATGTTTTGAGAGTCAAACAATATAAGTTTGACAGGAAATTTGCGCATGAAATCTTCAATTTTTTTGAAATGAAATTTATATATTTATAAACTACGTAAA
ATATACTACGAGTTATAATAATTGATAATTCAAAATGTTTAAAAGACCTGTGAAAAATTTAAGATCACAGATAGACTTGCTTGACTCTTGAAATCTGAAA
AGTGACGTATAAACTTCTTTACCCTATTATTTATTTGAAACGCATCACTAAATTTTGCTACCTTTCTACCAGGAATCATTAATTTTACCAGATGAAAACT
GCCTTCCTGATGTCAAACAAAGTAAGTTATATGTAAATTAGCTGATCTATATATCATTTTGAAGTTGCTATATTCCTCCATACGTCTTGTTGTTTACTGT
GTTTCGATGCTGTTTTTTCAGGTCCAGAAGAACTAAGAAATGTCTTCCGAAAAGTGAAAATCTCTGATCCCAAGCATATAGTAGCATTATATGGAGGTCT
CAAACTGGTATATGCATATATAGATCTGCATCAATATACTCATATTTCTCACACGTATATAAATGCTGTTTCGTCTTATCGTTCCTCTTCTCGGTTTGCT
GCTACAGGCCACAGCTGGAGCTCAGGCTACAAATTTGAAATTGGACAACTCATACTTTGTGTAAGATTACTATACACCCAGACTTCTTCTATATTTCAAC
ATTCATTACAAGGAAAAAAATGTCATATTTGCTTTTCCAAATGATATCTTAGGGACCTCCTCGACAAGAAGAAGAATTTAAGTCCCGCGGAAAAAGCTCT
GCTTGATGATCCGGAATTTCACCACTGCGTGCAATGTTATGCAACGGTATTATAATAGCTCATGTCTATTCTCAAAGTTCAATTGTTGCAACTCATCATA
AAACTCTTCAACATTATAAACATATCTACTGTGGACTGTGGCCCCTAAACAACTGTATTATCTCCAACTCAAAATGATTTTTCATATTCAGCATAAAGAG
GATTTCTTTGAGGACTATGAAGAGGCACACAAGAAGCTCGCTGATCTTGGCTTACCATATTCAGCATTTATCAAATCAACATTAGAAAAAAGTGCATCAC
AAGTGAAGAAGGTGCTGGCGGCACAAAAGGCTGTTGGAGTTGGAGTTGCTGTTGCAGCCGCGGTTGTAATATTGAGTTTCTTCTATGTAATCAACAGGAG
GACTGCTAAGCATTCGTCATATCAGTACCAGTAACATTGGTGGTGAACTCAATTGAAAGAAAAGATATGAACAGTTGGACTCCATGGTTCAGCTATAATA
AATCTTGGATATCTCCTATTAACCTCAGTTGTAAACATTCATCAAAATTCAATAAAAAAACTTGAATTCCTTTTGAGCAAGAATTGTTCACAAATTGCAT
TTCTTGGAGAAATCTAGTACTGAAAAAGAAGAAATAACTTTTTATTGAAGAATAATTGCCATAGGCACCAACAATATCAATAATTAGACGCTGCCTAAAG
ACATTAGGGTGTTACCACATAACCACCTTCTTGAGGAAGTATGGAGTAAAGGAGAACAAGTTTATCTCCGATGATAGTTAAAAATCAATGATGTTACCGT
AATTTAAAAGGGAAATTAGACCTACTAATCATATAGCTAAAATAAATAAATAAATAAAGTTAGTCAAGCTCGTGGACTCATCGACAAAGTAATGTCTTGA
AAAACCCTCAATCTTTTCTCAACTTTCCTTGGAAGGATTCCAGTATCTTTGCTTCCTTCAGGCTTGAATGTTTCCTGATTTGATCCCAGAGCGGCTGCAA
TTATAGCATCTTCAAAATCCTTGCTATCTGGCAGCAATCCTGCCCATATGTTTTCTGTTTTCTCTGGTGAAATTGACTGCTTTCTCATCTTATTTTCTGG
TTCACTGATGATTGTCCCAAGGGACTCGTTTCTCATTAGTTGAGTTGCGTTTCCAGATCTTGTTCTCTTAAGACTCTCTGGAATCGGGACATTTGCTGGT
TCATTCGTAGTCTTGGTCGAATAAAATGGTGGAGCATCGATATTGAGTAGATTCCCATACGAAATATTTGGGTTCATACTCTTTTGCAGAGAAGGAGCTG
TCTGGTTTCTGATGATGTTAGTAGAATTGATGTTCTCATTAGCAAATTCATCTTGAGGCTGGCTTAACTTGGTAGGTTTACTCAAAGTGCTAGTAGTATG
TTCCTTGCAAGGCTGAGGCTGCCAGATAGCAGAAGAGCCCAAGAAGGCATCAAACAGTTTCCTTTGTTCAATTCTATCACCACCTTTATTCATCATTTCA
GACTCGAGGTCGCGGAGCATCTGCTGTGCTCTTTCGTAGGCCTTGAGATGAGAATCTACACCTCTGGGGCCATCTATCACCGCTGGTTTAACTCTCCTAA
GTGTCTCTTTTGCCTCACCTACTCTCCCTTGTTTCATCAAGCAGATGCCCAAATTGCACATTTTGTTGTTGTCTGGTGCAATCACTAGTGCCCTACGATA
AGCATCCTCAGCTTCAATGTAGTTATTTTGTTGCATCAGCGCCCACCCTAAATTCCCCTGGAAGATTGACAAATAATTGTTATCAAACAATATTCATTTT
CATAGGTGAGATCCAAAACTATGAAGTACAAGTCTCACAATTCTATATTTACCAGTAATCTAGTTGCTTCTTGCTCCACAGAAACCTGAAACTTCTTCCC
CTGGGATCTCGCAGTCTTCGTACGCTTTCCATTAAAGGCCAAACCTTGTTGTATCAAAAACAATTTGTGCCTCAACAGGACTATTTGGTCATCCAATCTT
CCACATCTCTGCAGATATCACAAATTAAGCAGATATTTAAACGGAGGATAAAGAAGAACTGTGTTTATTCAAACAGTAATAAGCTTCTCAGATACTAGAG
ATGATAAATTGTTATGAAAAATGTAGCAGACCTTATATAGGTCCAAAAGGATATTGTCAAGAGCTTCCTGTGCTTGATCTGAACACCTAGTTCTCAAAGA
CTTAACAGCTTCAATGGCTTCTTCAGCCCTATTTTGTTGCTTCATTACAATTGCCATATCTTTGAGAGCACTATCAACTCTGTCTCCTGCGTTAATAGCT
GCCCAAAACAATGGAATCGCCCTTTCCGGATCCTTTTCGACCAACTGAAAAATATAAATGAAAAATAAATCACGTTACTTCCATAGTAGAACCAACCAAC
AATACAATGATTGGACTTCTCCTTTCAAAGATAAGAAAATATGTATCTAAACAGAAGTGGATCTTGGATTTAAATAGGGCTGAGTTCCAAGGGAATAAAA
CCCATATCTTATCCCCAAATGCAACAACAACATACCCACTATAGTACCACAAAGTGTATGTAGATAACTGTAACTCTACATTTAGAGGCGAAGAGATTGT
TTCCTCTATCTTACACCCGAATGAATTTGAAAAGTTAAAAATTAAATTATGTAGGGAAAGAAGCTTACTTGAACATTTTTGGCTCTAACATAAGGGCTGT
CGCCAATGGGGACTTTGTGGGCAACGTGAAAGGATTCGGAACGAGTTCTGGAGACTCCAAGGGGTTTGGCCGGAGAAGATGGAGCCGACTTGGTGGGTCT
GAAACCTGGGGGTGCATTCCACATATCTTGCAACATCTTCGTATATGCGAAATGTGATTGACAAGAATATGTGGAATCTGAACAGTAATGGAGGGAGAGT
TGAGAAGTGCTTAGGAGAATAGAACAAAAATAGGGAAGAAGGAAGAGAGACGGACTGACAAAATTTCAAGTTGGGTTTAATTTACGGAAACATTTTCAAA
TTTACGACCGTTGGAGGTTACCGTTTGCTTACTAGCCGTTGTCTATCTCATTATTTATTTACCAAATTCAGTATATATATTGCTAATTTACCCTTGCATT
TGGTTTTTGTTTTAGTAAAAATAAAGGTTTTTAGTCCCTACACTTCTACTAAAGGGTTTTTAGGCCCCTAAACTTATGGTGGCCTCATTTTTTTTTACCA
ACAAGGTTGTATGTTTTTTTTTTTCTTAAAATAATAATATAATTCCATCTAAAATTTGTTTTTGATTTTTTCTTTTATAGGTATATATTATTTTTGTATT
ATTTACGACAAGAATTAAAATATGTTAATTAAAAAAATATAAATTCTGATATATACTTTAAAATAAAAAAAGAAAAATCAAATCTTAAGAGACTATTAAA
ATAAAAAGACTTGGTTCTTAGAATTGATAATTTTTCACCTTTTCTTATCTCAAAATTTTAGAAAAATAGACATCAAATAAAAATACTAGTACAGTTTTTT
TGTTTGGAAGAAAAATACTTAAGAGGCATGTGGCACTGAAATTAGCTCAAGTCAAATGAAGGCCTCTAGAATTATTTGTAGTTCTTGATCTACCACTGCT
ATTAGGTAGCATAAACACCGGGTGTATCCTCCCATTAGAATTTACATGACACCAGTTTTTAAAAAGATATATTTTTATATTTGAAATAAATTAATTTTAA
ACAGCGAATCGTATCTTTAATAAGACCATTTATGGTCGCACAAATATTATAATACATTGCAGATCCTAATTTCTTTTACAAAAACAATTTTTAATTAAAA
TTTATAAAGAGACAAGCTGTATCATATATATATATATAGGAGGGATCGGTCACTAAGAATTATTGACTTAAAATATCATTATAAATATCATCTCTTATCT
ATTTATTAGATTTTAATTTCTTTTAAAATTGTATATGGAAAACAAAAGAAAAGATATTTTATTTTAGGCTTGGAGTTTATGCTCCCGTCTATTACACGAG
GGCGGAAGATGGATGCCGATTGACCTGGTAGTCTTGGTTAAAATTTTACGTATCTTAAAAATATTTTACGATTTATTAATTCAAAAATGTTAAAATTCAA
AACACATCAATTTCAAATCGTGACCCGTAGATATATTCCTCCAAAGTCCACACTCCACACTCCACACTCCACTCTAAGCTTACTCCTTTTAAAACACTGT
GCGCTCCCATCTAATAGAGCTAAAGCCCAAGACCCATTTAATTTATGTAATTCACTGCAATGACAAGTGAAAACTGCGCAGATAAGCTTAACGAGCAAAA
GGGGAAGAAACAATGACAGTTCTCCATTTTTGTTTGAAAGGACGAAAGGATATTGTTCCTGCTGACTTGCAATTGGAAGTTGAGTAATAGTGATCAAGAA
GAACTAAAATGTGTGTGCTCATGTCATGATGAAAGAAATAATTGTCTTAAAAAACATAAATGCGACAGAGATTGCATAACCGAAGACCCTGACAAAATGA
ACAAGATCCTACATGCCTCAAGCAGTACAGCAACTGATAGTATATTTTTCCAGACAGCAAACTAGAAACATAGCGAACAATGCACTTCACAAATCTAAGG
ACCTCGGAAACTGTCTGCTTTGTCCAGTCTTGAGATACCTGAGCTTGAGGACTCTCCCATTACATCAGGAGAAGATGTTGGATGGTGTTCGCGCTTCAAA
GAAGTAGGCAGTCCTGAAACTTCCTGAAAGAAAATTAGAAGGAGTAACATTTCTTTAGGCTAAATTTACACAATTTCATGATTAGGATAGAGAATGTCAT
GTTGCAATGTTTGCACTCGATAAGAATTCAGATGACTGATTTTCCACTCAACATTCAATAGCAAGCAATTATTTATACCATTATCTGAAGGAATCAAAAT
TTGAGAAAATCAACAACCCTGGCCAAATCAAAACCAGTTGCCACCGGAAATACAGGCCTTAGATATAGATTATTGCTATGATTCCTTCAGACAGAAATAT
CAGGTGCAGATGTAATATTTCCTCTTTATAATGCAGTGACTTCACTATTTTAATCTTAAATGCAGGCATGTGTGCTCAGGTGAAGCACCACAGCAAATAA
AACCCTAAGAACTATTTCCTCTGAAGTTATCTCATCTTAGGGGTTATAAGAAGAAAAAGGTAAATGCTTCAATTCAATCGTTACAGACACAATACAGTGC
TTCACTTTCAGAGATGGCCACAGTAGCAATTGCTGTTTACTGTTAGTCAGCCCCCAGTCTTACATTTAGCAAAGGACAGTTTAAAATTTCACTGCAACAT
AAAGTATCAACATGGAGGATGAAGATGAATCATGAACTACAAAACCCTAGATAAATGAACGTATTAGGATGCACCATTTAATAGACCTATTAAACAATTC
TTATCAAATTTGGATGACATAATAAATGAAATTTTTGTTGGAAAGAACAATTACCTGTATCTTTTATTGTTTTATTCAGTTTCATTCTAAGTTGGAATGA
ACCTTATTTGACATGCTTTTTTCCTTCCAAAGCGAAATAATCACTCCGTCGAAAGAAATGAGATTATCGCGAATACACACATTAATTAACCAAATTGCCC
AACAAAAACTGTAGCATAGGGTTTCATGCAGCGTCCTTTCATTGTTAGGTTTTCATGCAACGGTTTACATTAAGCAAAAGATGGCAACTTACAGAAGAAT
ACAAGTAAGAAAGAATAACATGGCTGGGGTCCTCAAACTTGAGAGCTTATCACACAACTATACTCATGAGATTGTTCCCATGTGACACTGATATAGCAAG
AAAAAGTCATTAATGCATCTTACCTTCATCAAATGCAGTCTCAAGTCACAAGGCCGAACTTGATTACCAATACAGGCCATAACAAAATTTGAATATTGAA
ACAAAACATCTGCAGCAGCTTGCTTCTTTTCTTCGATCTGGAATTGTAAATGAGAGTTAAAGCTAATAACACAATATAGAAATAAAAACTGCAAAAAGTC
TCTTGCACATTGCATGGTAAATGGTAATCAAACTTTAACTTTTCAGCAATCAGTTGTCACTCCAAAAATAAGGAGAACATTAACAGTTCACTGAAGTCGC
CAATAATATCTTACATTATTTTCCATCTTAGATGGGTTAACTCATTGATTTACACACCAGTGGCATTCCAAATACATGTATTGAAAAGACAAATGACAGC
AAATGCTTAAAAAATCATTAACAATCAAACTAATCTTGAATAGATTTTTTTGTATAAGGTAAATAATTTAATTAATGTAAAAACTCCTGTAAACAAGCTT
AATACAAGAAAAATAGAGAAACCCACAATGATAAGCATCTGTATGAACGTCACACAACCTTCTGAACTAATAAGAACTTCACGGTACACCAAAAACTAAG
TAAAAATAAGAGACTATTTCTGAGAATAAAATATATATGCCTATATCTCTATATTTCACAGTCAAACACTTCCATCAATCCTCAGAGATATGAAGAAAAC
TCTCATTTAGTGGGGATTTCCACTTCAACATTATTAACAATCAAAATTTCCCATACAAAATTATTTCATGGACAAAAAAGGTTCACTCTAGATTATCATT
TTTCACTTTGATCCGATTCCTTTTTTTTGTTTCTTTAGCTAGCACTTTACCAAACTTAGTCAAAGTTACAATCTGAGGAATATACCTCCTTTTCTTTACG
TTCCTGCTTTAAAGAAAGATTAAGGGTAGATTTGCCACTTCTTAAGCCTTCACTGATTGCAATTGCCTTTAAGGAGGTAATCTTTTGCCACAGAATGCAA
AACTAGAGTCTAGAAATCAATATTCACTACTTGCTTAATCAAACTAGGTGATTTCTTCACATTTGTCGTCTAAACCTTGATATGCAGAATTACCCAGTAC
CCCTGTGTTGGTAAGAGGTAGTAGGGTAACCAGTGGAATAGTAGAAGTGTGCCTAAGAGGTAGTAGGGTAACCAGTGGAATAGTAGAAGTGTGCCTAAGC
TAGACATGATGACACCATAATTAAACAAAGACAACATAACACTACTTTCTTTAAAAAAAAAGAGAGAGATGCAAGAAGAAGCTCCTTAATTACTCAAAGA
ATTGATTGATTACAAACATAAACCAATTGAGATATCACTAAATAATATTCAGAATTTCAGCATTTGGAATGATCATCAAATTTTGATAAATTTGATTTCT
CCCCAGTTTTGATATTCATTCTAGACTTAAATACTACCAACAACAAGGGCACGGGATTTCAAAATCCAAGGTTCAAGATTCTTTCTTCCATTCTTATAAC
TACTTTATGTTTGGTAATACTGGTTCAAATTGATCAAAGATACCGACTTAATCGTAATCTTGTATGTCACTTTTTCCACCAAAACAAGAAATTGTTACAA
TTGTTCAACTGCATCCGATACAAGGACTAAATTACTTGCTAAAGACTTGAAAGAAAAACCCAATAAGAAGCTCCGATTAAGCTTCAAAAAACCACAAACA
ATGTGGAAAGTCTATTAAAATCAAAAGCAAAAGACCTAAAGTCGCAACTAAAAACTCAACAAAAATTAAAAAATTAGGGCTACAAAGCAAAAGGATACCA
GACCCAGGATAATGGAAGAAAGCAGAAAGTTCGATACCTCGTAATCGTCCTTCATGGCTGAAATGGGTTTCTCCTCCGTTCTGTTTCTCCCTCAAATAAC
CTCAGTATATTAATATAGATTATAGAAACCATATTAATATAGGAAAAAACGATATAAATAATCATCAGGGCCCATTAGCTCAGTTGGTTAGAGCGTCGTG
CTAATAACGCGAAGGTCGCAGGTTCGAGACCTGCATGGGCCATTTATTTCTTTTTTTGCAATTAAAATTTCGCATGGCTGACATGATCTGTTTTAACTTA
ACTTTCTTCTTTTTCAAATAATAGAATTTCTGTGTTTTAAATTAGGGAGTTTGAAAAATAAAAATATAGCGTTTAAAATTTGAACTTGAAGTCTAAGATT
ATTAAAATGTTTTTAATGATTGAGCCAACATCTTATTTCATTAAGAGATTTAATCTGTGTACAAAAATAAAAATCTTATATATAGAGCAATTTATTTTTA
TCAAAGGAATTCGATTGAACACATTCATCTTATAAAATGAATAAAAATCTCATGTATAGAACACATTCATCTTCTAACGTCTTATTTCGTTAGGAGATTT
AATATGTACACCAAAATAAAAATCTTATCTATGAAGCAATTTATTTTTGCCAAAGGAATCCAAATGAACACATTCATCTTCCCGCCTCCAGTTGTTTAGT
AGATTCAAGACGAGATTGAATTTGTAATTTACACGTTAAAGGAAGTTTAAAAATTAAAAGTTGACTTTCACATATGTCGATAAAATCTTATATATAGAGC
AATTTATTTTTGACAAAAGAATTCGAATAAACATATTCGATTTTCCGCCTCCAGCTATCTAGAAAATTGAAGATGAAATTGAATTTATAAGTATACGTTA
AAAGGACGTTTAGAAATTAAAAGTTAACTTTCACATATGTCAATAATAATTGAAAAAATAATTTTTTTGTTAATCCTAAAATTTTGAAAGGCTATAAATT
TGTATTAATTAATTTATTCTTATAGCATATTGTGATTATAATTTTTATAGATGAAAAAGATAATACATAAAATTTAAAATACAATTTACAACTAAAGATG
TGATGTAATGTGATAGTATCTATGTAGTTCTAAAAAGTATAAAACAATATTTTGAAATGTTTCATTATAAAAATGAAAATTACAAAGTGAAAAGCTTTGC
ATATCTAACATTCATTTTAATTGTTTATTTTTGTTGACTCAATAGTTAGATATCACTTATAATGTCTTCGTGGCACTTTGTGTTCTGATTATTTTTATTA
TCTTATATTATTATAAGTGAAAAAGCATAATTCAAAGTTAATTTATTATTTTATTTTGGTAATATTGATTAATATTAATTTATTAAAATTTTAATGTATT
ATTAATTTGAGCCCTAATTTATTTTTTTTCTCTGGATTATCATAATTGTCCTTTTCATCGTTCAAGTTTTATAGTTTTTATTATCAGTTGTTTCAAAACC
TTTTCAGATACTCAATGATCTATATAAATATCTCCAACAATATGTCATTGTTTAATCAATCTCTTTTTTTCCTTTATGCCTCATTCAAATACATCATTGC
AGATAAAAAAAAAATGCTTTGTTTTTCCTGTTTATTGTGTTTTTTTATCCAAATTAATTTGTTTCCTTCACATTATCACGAGTTGCTCTGTTCTTCATGT
TGTTTTTTGTGTTATCTCTCATAAATTTGTTTTCTTCTTTATCAAAAGTCTTTCTGTTTTAGAAGATAAATTGAATAAATTTATGTTTTATTTATTTCCA
TCTGTCAGTAGCGTTTACTAATTTCAGAATACATTAAATGTCTTGTATAAAACTCTCTCAGACCGTCCTCTAAGCGTATATATATATATATATATATATT
TCTCTTTATGGTTGCAAAAGATTTTCAGTGGTCTCTTTGAAGCCAATATGACATTATATGCTTAGAGGACGGTCTGAGAGAGTTTTATAGTATTGGCCCA
GGATGATACAATAATTCTCGCAGTTGAGGAATCGTGAGGATCACATCAATGAGTTCATTTCTAAGATGAATTAGCATAGACACCCAGGTTACCTGATCAA
ATTTTTTTTGTATTATCAGTTTTAGTATGAATTATTATAAGATGGAACACTTAAAATTCTAGGTGCTATTCCTTTTGCTCCACCAATTTATGTATCTCAT
AAGTTTACTAATTGGTTGTTGTTTATTTATACTTAAAAAAAGAGTTTATTATAATTTGTAATACATTTTTATTGATCTATTTTTATTATGTAAGTAGACA
TGTAAATAAAAATGCAATAAATAAAATATTTATCACATGATCGTTTTTCCTTCATAATATTTGTTGATTTCTTTTCCTATATTATCTTATGAATTTTACT
TTTTATCCATGACATATTGCTCGAACAAGATAGTGTCTGTGAGTGTGAGTTATATGAGTTGTTTCCTATATTTATGTTTGGAAGTTTTATTAGCCACTTT
TGTTTAACATTTGATAACGACATGATTACTCATTCTTTTTTTTTCAGGGAGGAGAAACTATTTCTTCTTTTGCAGTTTTTATATCCTGGCATTTTCCTTT
TTATACATTTGAGAACGACAATATCAAATTAATGCTTCGATTTTTTTTAATACATCTCAAAGCAATTTTTTTTATTTTTTTTCTCTATAATTTCGTGCAA
CTCAGGATACACATATTTTAATTTTTTTTTAACTTAAATATACCAATTAATATGAAATGTACGTGCAATGCATGTTCAAGATATTAATTGATGTTAAAAA
GTATGAGTTGGTGTTCCTTTGTTAAGGTGGGTGATCTCCATATTTGAATTCATTAATTTATTCTATGCAAAGAAGTTGAAGTGTCCCGAGATTTGTATTT
ACTTTGATATAATAATTGAATAAAAATTATTTTAGTTATATAAAAATATTGGAATCTTTCATCATATAAATAATCAGAGAAATTTACTTTTCACAAATAT
ACCTAGATCATATATTAATTAATCATGTATATTATATATTTTTACCAGCCATTTTTAATTTAATTGAACACCTAATCACTAAATTAATTCTTATCCAAAC
TTATATTTTATTCTAAGAAGCGGCAAACTTTTGCTTCTTTTATTTTCAAAATTGATATATGTATGTATGTTTCTTTTAAAACATTATTGATATGACAAAG
TATTAGTCATTATTTTCTCAATCCCTATTTAGTTGTTTACTTTAGATGTGATATATATATTAAGGATAATTTTATTTTTATCTTAAAAGATTATCCAATT
TCCTAAGTTAATAAATGTATTTTTTGATTTAAAAAAATATGCATTGCAATTTAGTAGTACTAAATTTTTTTTAGAATTAAATAAAAACATATTAAGATTT
TTTTTTTTAAAAAAATACACAAATAAATAAAAATAAATATATATATAAAAAAGGCAATAAAATAGGAACAGAAGAACATATTATTTATATATATTTAGGA
AAGTGATGACAGTTGTGTTTTTCCACTAAGAAAAACTATACTCTTTTTGTGAGTGATGGGGTTCCTATTCCATGTGATTGAATTACCGAAATTGGCATTC
TTATGGAGATATCTCAAATTAACGGTGATTGTTTTCGTTACTCGGCTGGGACTCTGCAAACCTCCCCCTGAAGAAGACGATGCCGATTCAAGCTACAACC
CCAATAGTTACATCCTTCTATTAGACGGCACTTGCCCTTCCCTTGTCACCGTTCCAATCGAGGTTGCCACCGCCGCCGTCAAGCTCAAAGTCCCCATACT
CCTCTACAGCGATTACCTCCTCTGCCGCCGGCGGAAATGCGGTCAATCAGTGAAGGGATGCTCAATCTGCCTTGAATCCATGGAGCTAGATGAGGAGGTC
AGAGAGCTCATCACCTGCAGCCATGTCTTCCACAGGGGATGCCTTGATACTTGGGTGAACGATGGACACGTCACTTGCCCCTTGTGCAGATCTATGTTGC
TACCCCCTAAGTTGACCTCTTTCCGATCTAATTCTCTAAATCCATCCATTAGTTAGTTTTCGATGCTTATTACAAACTTCTGCTTTAACTATAACAGATG
CAAAATTAGTGTTTACAGACATTTCCTGTACAGATTTCCATACTTTTTCTAATAAAAAATCTGATAAACTTATTGAGACTTTTGCATAAGCTATAGAACA
GTTACAAAGTTAGTTTCCTGTACAGATTGCAATACTATTGCTTATCAAAGCTCTGCTTTAAGCTCATGAGTTTTCTGAGCTCTTCCATTTTTGTTTGTTT
CTTCCGTTTTTGATAGAGAGGTATGATGGTTAGGCTTTTCTTTTAGTCAAGGAAAGAATGGTGGAAACCATCAACTTGCTGTCTATGGGCTTGGTTAAAT
AAGCATCCATACCAACCTGTAAGCATTTTGCTTCATCTGATGACATTGCATGAGCTGTTAGTGCAACAATGGGAATGTGTGTTCCTGTCCCCATTTCTGA
TTTTCTAATTGCCTTTGTTGCTTCATAACCATCCATCTTCGGCATCTGTTAAGAAGCAATTATATCAGCAAACACAGCAGTTTCTTATAACCGTAAATTC
ATGCTCTACTTACTTGACAATCCATGAGGATCAAGTCATAAGGAAGGGAATGAGAGCCTTCAGCTTGGGAGGTAATTGAATTATCATCTTCCTGAAGAGA
TTCATTTCTACATTCATCTGAATTAGGCACAGGTTTCAGTGCTTCCACTGCCTGTAGTCCATCTCCTACAACCACCACTTTAGCTCCCAATTTTTCCAGC
ATTATGGTAGCGACTCTTTGCAGAACTGGGGTATCCTCAGCAAGCAGTATGCATAAACCTGCTAGAGATTTCTGCCCTGCTACCTTATTTGAGCAGGCAT
TTGTGACCTCTTTGGTGGAGGTGCTTGTTAAATTATGTTCTCCATCCCTAGTTTGTCCCAGATGAGTCCTGTCAGGAGCATTTTCTTCCAGATCTACGCT
ATTGAAGTCAATGAAGTAGTTGTTTAAGGTCCCATAGTGTGAAAGAGAGGCGTTGACAAAATTTTCTTCCCTCTTTTTTTCAGGAAGGAATGCACTTGCG
CATTTGTCATTTCCATTATCTGACTTGTCAGAATCATCCGAGCAGGCGATATCGGAGTGGTTAGGATCAATTTCAAGGCATTCATGCGAATCTCCTTCTA
CTGGTGCATTACAAAAAGACTGCAGCTCAAGAGTTTTTTCTTTTATAATAGCTTCCAAAATCTGAATCATTTTCCCCTTATATAGTGGTCTATTGACCAT
AAGTAGGTGTCTCCTTCTCCGGAGTTCCATCTTGATGGTACTCGATGTATCATGGTAAAGAATCCATGCAAACTTTGCTCTACCATGGTATTTATCAAGA
AAATTTAGCTGCTCCTTCCATATACTTGTGCTCAAGTCAAGGATGCCAATGTCAACAACTATGACAAAAGGTGATGAGGCATCAGGATCTTGAATGCTCA
AATCTTCAGGTTCTAAGCATTCACAAGTTGTGTCTTTCAAATGGCATCTGGATATAGAAATACCCTGAAGAATTTGAGTGAGCTCATTCCAGTCAGATGC
TCCCCAAGTGTGCACCCCATTTCTCTCTAACCACTGGGACATTATAACTCTACCCATTTTTCCGTTGAGTGCAAGCAACACCTGATGGATGTGCGGTAAT
ACCGCATTATACAAAATTAGAGATGACTGAATCTACAGAGAATGATAAATAACACCTGTAATACTCTATCACTCAAGTGAATCTGTGAGTTGAATGAATA
CATTTAGTCCATGAAGTTTATACTTACCCTCATTTTATGTTCCTCGAAACTAAACTGGAAGTGCTGCCCAGCGACTTCTGCTGGACAGTTTAGTTGAAGG
CATAATTGCATCACTGTTCCTGGTCCATTTTTCTTTACAACTTTAATCTCTCCACCCATTTTGTTAACCTGTATATCATCCTATCATCATCAGAAGCTGT
CAAAGCAGTCAATATATCTTCACTTTTATGCTTAAAGCCAATTCCAAGGGAAACATTTTAAGAAATGATGGATAGTGGAACTTTGCTCAGAGAGTTGTTG
TTCATGCCATCCTTTACCTTGTAAGAGGCTTATGACCACATCAAGTCTTAGAAAATCACAAGATAGAACCTGAAATTTATTTAGAGAAAAAAATTGAACT
CACCAGGGTACGTACAATGCATAGTCCGAGGCCAGTCCCACCATGCCTGAGTGTGAACATAATCAAACGATGAGTTTTTTTCCTTCCCAGGTACTAACTA
GCTTTTAAGGTAGTAAATTCATGCATGTAATCTGTTATTTAACTAAAGAAGTTCACCCATATATGAGAACGATGTGAAAACTTCTTACAAGCGAGTGGTA
GAAGGATCAGCTTGCTCGAAACTTTCAAATACAGATTCCCATTTACTTGGATCAATTCCTAGAGCAACAAAAAAGGGAAAATCCAGAGAATGAGAGTTGG
TATGCAGTAGCAGAAAGTGGGATAACAAGTTAACTGTTGACTTTATGGTTATTTTGGTTATTCTTACCACAGCCAGAGTCCTCAACTTCAAACCACAAGA
TCATTTTGTTATCTTTCTTGGAGAACTTTTTTCCCTGGCTTTCTTGTCGTTTCAACTTCACTTTAGGAGCAGACCAAGAGTCTTTCTGATTAAGTGGAAA
ATTCCCTCCGCGAGCACTTCCACACCATCCGCGAAGAATGATGTAGCCAGCTGTAAGTTATTTCTCATGTTAAAATAACCAAAATCATGACCCTAATCTC
TTCGTTTTATGAGAGTTTATATCAATATAGGGTCAGTAGAGTCACTCTGTTTGATTCGTGCAAGGGCTTTTCCAATTATGAGGACAAATAGAAAGAGTTG
AAAATGTATTTATTAAAAAGTTGCGCTTACAGGTTGTGAACTTGAGGGAATTGCTAATCAGATTTGCGAAAATTTGAACGACTCTGGCTGAGTCTCCTTT
AACTAATTTTGGCATATCATCTACAGATAGAAAAATGAGAAAATAATATGCATTCAGAAAACAATGTGAAGAGTCTCGAAATCAATTTGTAAGGAGAACA
ATGATGTACCAGAGAGATCTAGAACTGTCTCAACATTGTGATTAATGCACTGGACAGAGAACATATCAACAAGTCCTTCAAGTTCTCGAGCCAAGTCAAA
TTCTGTTTCTTCCAACACTAGTTTTCCAGATTCTACCTGCCCAATGAATATATGATTTTTCTCAGGTCTAATTAAAACACTCTTTTGAGTAATGAGCTTA
AGCTAGCTGCAACATTACCCTAAATAGTCTATTACCATTTCATCTATGCTATAATCTCTCCGAGGAACAGTAGGGTGACCTTAGTTAATCAAAGAGTAAA
CTCTTTCGAAAAGTATCATCAAAAGAGTTGTTAGTGTGCATCTTACCTTACTGAGATCCAAAATGTTGTTTAGAAGCCGAAGCAAGGCAGTTGAGCATTT
ACGAATTTGAGTAATAGTTGCATACTGTTCATTTGTAAGAAAACCATCACTTATAAGAATGTCCAGCAAGCCAATAACTGCAGCCATAGGTGTTCGTAAT
TCATGACTGTGAAAAAACAAAGCATGAAGTAACTGTAGAAATGTACATATGAGAAACTAAAAATTTAAACTGAGAATGAATCTTTCGCAGAGGTAAGATG
TAGAATAGAAGAGCGGAAGTAACAAAGGAGTGATGAATATTCACCTCATGTTCGCTAGAAATTGGCTTTTGTAATTGCTCGATGCCTCTGCTTTCCTTCT
TGCATCTAACTGGCTTATCAGCTCTGCTCTAAGTTTCATTTCCTTTGACACTCCATCTGTTAGTACGAAGATGCAGACACATCCAATGATTAGGATGCAT
ATTGATGCTGAGATCAATATTACAAGAGTCTTGATAGCCCTCTCATCTACCTTTCCCATTATATATTTCCTTGGAATGATGATAACTCCTACCTGCAAAG
TTTGCAGATCATTAAGCATCGATAAATCAGCAGAACGAGCTTATCCAATCATGATACTGAAGTGTACTAAGCTAACAATTTACCATTGGAAGTCTCTTTA
ACTGCAGGTAAAATGAGTCAATATAATAGAGCTGATTCCCAAGTTTAGCATTCTCTATGTGCACTTCTTGACTTGGGGTAAGCCTCTTTCCATAATCCTT
CTGTAAGCACTCAGCCCCAGATCGTATAACGGGGTCTTCAGAATCAATAGCCATCATTAGCTTTGGTCCTTTTGTAGTATTCATCAAGAGAGGGCTATTC
GTGGATGTAGCGAGCAACCATCCTTCTTGAGAGGTTAAATAAATGTGACCACTATGAAACTCAACAATTTCTTTCATCAATTGACCTACACTATACAGTG
CTGTAGTAACTCCTACAACAGCAACTATGCTTTTATTCGATGGATCCCAAACTGGCAGTGCTGCTGAAAGCAACGGTGAATCTGTATACTTGCTCACAGC
CACATGCCATGAAGCTGCACCATCTGGTACTTGTGATATACCAGCAATGTTGATCAACTCGTCTGGTGGAATAATGCTTCTCTTCCCATTCCTTTCTCCA
GTTGAAGGATCTAAAGGTTCTCTGTACCAAATTGCTGAGATGTTGTTGTGTATAGTTTGGTCATTCCATCCTTGACGAGACGATAACAAATTTACATCAT
ATGTATTACTAATAGAATAATTGGCAAGATCAGAGTATATGTAGAATGTATTGTTACTCCTGTGATCTCTATGGAAAGCCTGAACAAAACCATTTTTATA
GTTGATGGTTAACGAATTAAGAGCTTTCCGACTAGCAAACAGAGCCCAGGTTACATCCTTCATGGATTCGTACAGCTGCTGAGGGGCAAACATTTTGAAT
TAATAAAAGATAACAGTACCAAATAAGTTGAGCAAGAGAAAAAGGAAACAACCTCAACTTGTTGAGCTTGATCAACAGGCTTGCTATACTTTCTGATTAC
ATACTCTGATAGCTTAACCTGAGCTGTAGTTATTTCAACAGTAGAATTCAAAATATTCCACATCCTTAATATTGGTCTCTGCAGAAGCTCATGACGAAGA
CCAAATGCGAGTGTGTTTAGTGATTTTGTTGTGTAAACTCTAGTAAAATGCCATGTTAATAAAGTTAGCATTCCAATCAAAATTGCTAGCATGACCTGCA
TACAACCATACAGAAAAAGCCCAAATCAACAATCTGAATCAATCGAGATTCAATTTTCAAAATCAACAAAAATTGGAGAGCAAAACTATAAAACAGCAAA
AAATTATCTCTATTGTTGCTTACCATAATAGCAAGACGAACAACGAAAACACCACGATACGATGAGTGACAAATACTACTATCAAATGGAAGTTCTTCAT
CGACTTGATAATTTCTTGGGGTACCACTACCACTACGCGATGGAGATTGGTTTCTTTTGGAAAAATCAGCAAATCCAAGCATCTTACTGAGAATTCTTTC
AGGCAATGATCCTTTTGGTGTAATTGGAGGGGATGAAGATTCAATGCTCAGAGTAGTAGTAGTTCCATAAGTTGCTTTATTATGTGCCATTAATATTCTC
TGTTCAACTGTATAGAAAAAGAATAAATCATTAGAGTTGGAGGAGGAATTTGGAAGCTGATAGACAGACAAGTAGTGTAAATGACAGAGACTTAAAGAAG
GACCAGTCAGTGTTATTATATAAAAATACTGGTGGAAATGAACCAATGTCAGTGTGACACTGAATAGTGGGAGTTATGTGTGTTATTTGTTTACTTTGTT
CCACATCCACATAACATTTTTTATTTCCTCTTCTATCTAAACCGGTCATTTGTTGGAAACAAATTATTTCAGGATCAGAATAGTATAAATGTGATAAATT
ATTCTAAATACTATAATCAAACAATTTATCCCAATACTTTTTTCTTATTCCATGACTAGTTATAAGTTACGTAGCTTAATTATCTTTTATTTTAGTTTTC
GACCAACCACCGAACTAGTAGCTATCACCCGTTATGTTAAAGACTTACTCATTCTTGTGTTTATATTCAATTAAATAATTTAAAAATTAAGTGAAAATAC
AAATCATCTTATCATGATTAAGTGATGACTGTATGTAAAACAAAAGTATTTGTCATGCAATCCTTAATATAAAAGATTTTATCCTTTTTTATCACTCATG
TTGCTGCCTGAGTAATTTAAGTTCAATCTTGACAATAAAATTCGCCCGATTTAATTCTTAGAACTTGAATGGAGGCATATTTATTACTCCTTTATAATTA
GAAGGGTCAAATACCCTTTTCCCTTTTTAATAATATGTGAGTCGTCTAGAATAACTTTATCAGTACAAATATGTATCAAATATTTTAAAATATTCCAAAT
GGATAAAATGCAATCTACATTAGGGCAGAAAGAGTATATAGAGTAACTGGTAAAACTTTTACCCCAGGAGTACAAAAAAGAAAAAAACTTGTATAAAGTT
AAAACAGACTCAGAAATGAGAAAACTCAAAATGTTTTTTAATCAATATGTTTGATATCAAGAACCTCCATATTTTGGATAAATCCTTAATCATTGATCCC
ACCACTTGAAAACCTTTTTCCCTTTTCTTCTGTTAGTAGCTAGTACTTTTTATCATACGTAACTTCTGATTTAATTGTACAAATGTGACCTGAAAAGAAA
CAAGGTATCATAAAAAGGATTACACGATAAAGTAAAATTATACTAGTTAATTGGTTGTCTTAACTATCGTTCTAAATAATTATCACTTGCTATCAATATT
CAGTGATAATTAAGTGGGCTAAGGTTTCATGTTCGGAATTTATATAATTTTTGTATATGTAATTTTATATAATATAATTTGTGTAATGTTTAAAGTTTTA
ATATTTGTGTTTCTACGAAAATAGTTTAATTATACAAACGTACATGTGAATTATACAAACGAGACAACTTAAACGATCGATACAACCAGCACATATGCAA
TTATAACTATGAAACGTAATTAAATTAATTATTATAGTGACTATTTGAGAAAATTCGCCGAAGAAAAAAGAAAGGGAAAGTCACACAAAGTCCTCAAAAT
TGATAAGTCTTTGGTTATTATAAGGCTCTTTTTTGGGGGTATATTTTTGCTGAAACATACCACTTGATAGATTGAGACTAGTGACAAGTGAGTAGTCACC
ATCGAAATCTTGTACTGGCATTGGCTATGCAAAAATGTAGTTGTCTTATAAGACCTTAATAATTGATTTTATAGTACATACATTATTTCTTATGGTCTAC
ACTGCCTTGCTGTGTTGAACTGGACTCCCTCTTTCTTGTTTTTATGTTTTGTAACAAAACTCGTGCAACATCCCCATTTACAATTGCTCAATAGTTGGAT
TATGTTTGCCCTAAGGTGTGTCAAAATTTGTCTCACCTCGGTTAGCTCGAGTATATTATTAAATTAAAATGGAGGGAATAATAGCTAATTTAAAACTTAT
AATAGCTAATTTAAAACTTATTATGAGTTTTACTCTTTTTTTTTTGCTAGAACCACAGTTATATAGGTAGAGAAAAAGTCTAACGAGTTCATGACTCGGC
TTGTTGGTCTCACTTGTACTATAAAAACGCTTTGTTAGGCTCGACTCAACTTGATAACTCGGGTCCATAATATCACAAGTTAGATTAGGCTATACTAGTA
CTATAAATTAAACACTATATACTCTTAAAAAAAAATATTTCCATATATTTATCGTGAATCAAGGTCACTATACTTTGGAGAGAAATTATATGGTAATGTT
GTTTATCTGAATAGAGAACACATATGCTAAAAAAAAAAAAAGGATTAATTATCAGAATTGCTCTATGCAAAAAATTATACTATATTTATTTGAGATTAAA
GTTTTTTTTTATATATATATATATTCTCCTTCATATATTTGCAGACACGTCATAAAGAAACAATGTTCTTAAAATAGTGTTAGGTTATAAAAAGGGATAA
TGCACAAGTACCCCTCAACCTATGACCAAAATCTCAGAGACACATTTATACTATACAAAGATTCTATTACCCCTGAACTTATTTTATTAATAATATTCTA
CCCCTTTTCGACTTACGTGGCACTAACTTGTGGGCCCAACACTGGTTGACTTTTTATTTCAAACTAGTGCCACGTAAGCCTAAAAGGGATAGAAAATTAC
TTATATAATAAGTTTAGAGGGTAATAGGACCTTAATATAGTATAAGTGTGTCTCTAGAATTTCGAACATAGATTAAGGAAATACTTTTACATTTTCCCTA
TAAAAAATAGCGTTCAATCCTACAAATCGACCAATTTAAGACCATATTTGTGCAAAATGAGGAGAAGGACGTCCCCTTTACACTCCCCCCTCCCCCAAGG
GCCAACTGCCAAGGACCTTTTAAAGTTTGCATTATTTAAAGGACGATTCCATATAAAGAGAGAGGTCATAAGTTCATATAAATCAAAATTTTCAAGAACC
CAAATATTCGAATAAGCAGACAAGCCATATATTTGCAAGATTGCAAAATATAGGAGACACAACACGTGTATTTATTTTGGAATTACACCCAGCAAAAGGC
AAAAAGGGTATCTCTCAATTTATTTTAAAAAAACACTCATAGTGCTAAAGAGGCTGCATTTCCCTCGTTTTAATTTACGTGACATATTTTTTATTTGAGT
CCTATTTATTTGACAAAAAAGCCAATAAAAATATATTCTTTTATTAAAAATTTATTTGTTTTAAAGAAGGTCTAACAAAGTATTTTTTATATTACGTTAA
ATTTCATATTTAATTAAATAATATTAAATAAATTGAAATAAAAGGAATTAATTGTTATAGAACAAAGATATTGTAAACTATACGCTAATTCATCCCAACT
GTATGACCAAACAATCAGTTTGACACTATATGCTTTATTCGTCATTAAAAAGAATTGAGATATTTATATATTAGTATAATTTAATATTTATGCTATTGTT
TTGCTTTCATAGTAGGTTCCACTACATAAAAAGAAAAGTAGTTTGGTTGAATTAAAAATATTATAACCTTTTTAAAGTATAGTTTATGAATCAAAAGTTT
TTATTTTTTTTTAGGTTGTGGTGCAACTCCTTTTGCCGATATTGGACAAAAATAAGTAATTGAATAGAAAAGGTAAAGCTCACAGAGCATAAGTATGATA
TGATGTCGCGATACGTAAAGGAAGGAGAATTCACGGTTCGATTTGGTTCGATACATATCTCAAATATATTTAAAGATGATTAATATTTATTTGTATTAAG
TAATTATATTTAATAAGAAACTTTACTAATCATATTTTAGTGATTAATTAAAGTCTAAAGCCAAACACATAACGTTAATCTATATATCGAGACCCGAGTA
TGTTAGCCTATAAACCAAGTAACCAACATTATTATTAAGAAAAATTGTATATAATAGCAAACTAATAATCTAAAACAAATGGAGTAACTAGGGTTTGATT
TAATTGTGCTCCATAGCAAACATTAGCCAAAGTTTGCCAGACGCCTCTCTCCCAAAAATCTCGTTCGCCACTCTCCCATTCTCGCTCACCTCTCTCGCTT
TATACACAAAAGTGTATAATTTCTGTTTCTGTTTTCTATAAAGCGAGAGAAAATTGTATACACACATGCAAAAACATATATCTCCGTGTTAAACACTTAA
TTATACAATTTACAAACATTTTACTTCAATTCAATTGTAGACAAATGCAAATTTTATACAAATATTGCAGAGAAAAAGGCCAACGTATTATACAATTGCA
GTGGAATACAATTTTCTCTAGCTTTATACAACAGAAGCGTATATATTGTGTTTCTGCTTTTGTATAAAGCGAGAGAAAAACATATATCTTCTTGCTATAC
ACTTATAATTATGCAAAGTACATACATTTTAATTCGATTCAATTGTATGCAAAGCAAATTTTATAAAAATATTGCAGCGAAATAGGCAACGAATTATACA
ATTGTGCATTATATAATTATAGTGAAATAGGATAGCGAATTATACAATTGCAGGGTAATAGGCGAGCGAATTATACAATTTAGGCCAGCGAATTATACAA
TTGTATATGTATAGCGAATTATATAGTTTTATGTTTGCTATGGAGCGTAATAATGCAAACTTTGTTATAGCATACAAATATGAATTTTTTATTTGCTATA
TGTGAAAGTTGCCCTTATTATTAATTATTTCATCTGTTTCATAATACTTGATCCTTGTTGACTTGATATATTATTTAATAAATAAAATATATTATATTGA
ACTAATTTTAGTAATGGTGTTTTGAAATTCTAAAGTATAGTTGGTAGTTTACTAAAACTGACAAATGAAATAGAACACTTATTCTTAATACAGGAGTCGA
GTAAAATAAAATGACAAAACAATAGTTACTTACAACTTACTACTGTATATAAAAGTTTGACATCTAGGGGTACTCTCTTTAGCGTCCATAAACTGTCAAA
GGTCGCACGAAAAATAGTCCAAATTAATTTTTTTCTTAACATAGTGGTCCGATTAGTGGGTGGTTAACTGATAAGAATGGAAATAAAGTTCATCAAATAT
AATTGCAAGAGGTGGCTAAAATTAATAAAATACACTTTTAGCTCTTGCTTTTTCAATTTTGGGTTTGATTTGTGCGCTTCATCCTCAAGAACAGTAATTA
ATCACTTACTAATAGTGATCTAATTTGTGGTCTTAATTCATTTGATTTTCCACTCTATAGCAAAATAAACATATAGTGCTAGGTTCCATCATCGTCGGCT
GCACAAATTATCCACTTCTATATAGGAAAAAAATAATATCAACTAGCAATTAGTAGTAACAAGCTCTAATTTACCAAAGAGAAAAAAAAAGGAGTAATGT
AGTGACACTTTTACTTTCTAAAAAAAAAATTCCCCTTTGAACCAATCATGTAGTCAATGTTATGATCATTATGGGCAAAGTGGGGAATTGAACGTGCGCA
TGGTGAATTGACCCACTTTGCTAGAACTTGTAGTGTGCATTAATGACATTTAAATTAAAATATTTTGCCATATACAACGAAACATCTCCTTTTAATTGAG
ACTCATTTTTCAGTTTAATGAAATATTTAAGGAGGTACATAGAAAAGAATAATCAAGAAGCAAAAGTGTGCAATACTTTTAATAATTGAACAACCATAAG
TTATAATAGGTGTAATGAAGTGGGGCTAAAGAAGCAATTAAAAAATATGTAAACCTAATTTTCCAGTGAAGGAAATTCAAATAATTAAACCCTTTGCGCC
CTAATTCCGACTAATTGTACATGTAAATAATTTGAAAGAAAATATTGAGTTTTAATTTGCTAGACTCGCAAACTCATGAATGAGTAATCTGTGGCGTATG
ATGATTGAAAAAAAAAAACTTCAAAATGGACAAAAGAAAAGTTTGGCAAGAACGTCAATGTCAATCTTTTGACACTAAAAATGAATTGGAGTATTTGATT
CGTTACTTTAGTTGTACTAGTTTGATAAAGAGTATAATTTCTTTTTATGTCCATTGGGATTTGAGAGCTTAGCTAGTAGTGGTAGTGTGGTACTAAGAAT
TGGAAAACTTTAAATTCCATGCATTTTGATATTGGTGAGTGAGTTGGTATCCGCATTATACTAGAGATCGATAAAGATATTATACTAATAAATTTATTAG
GACATGTCCAATGCTCATCACTAAGAGCTGCTTATCTATTACTTACCAGTTCTTCTGTTTGCTAAAGGACAAGATTTTTTGGAGAATATATATATCTAGT
GTTTGGTTACCAGAGTTTAAAATATCTCATAAAGATTGATACTTGATTCCAAAAGAAGAAGAAAATCTAGAATTAATGTTTAAGATTTTCTGTTTGATAA
CATGTATTGTTTGTTTGTCATAACAGACCTCATATATTTGTCGTTTAGATTATATTATTATCAAGCTGAAAACATGCGCGTCATGTTAGCTTGTATTATG
CTTTATAAAGTTTTTTACTTAGCTCTCTCATTTTAATTAATATGGGATGATCACTTAAAATATCATGCATATGTTCCTTTCTCTTGAGAAGCTTGTTATC
CTAAAGCATATCAATAAAAAAAAATTATGTTATTTGTCCCCATTGATCTGCTCTTTGCCATGAGCATCATATACATCCTTCGCTTATTGATATTGAATTA
AAAGAAGTTAAAAAAATTAAAATGTGAGAAGGATAAAATATAACGAAGGATATAATCGTTATATCATATTTAGATGATAAAATTGAGGTATAGATAATCT
CTTTTCCCTTATTAAATAAAAAAAATACATTAAAACATTTTCAAGAATATTTAATATCATACCAAACACATTAATATTTTTGACAAGAGAGAGAGAGCGG
AGACAAGGACCGAATTTGCTGATCAAATTTACACGTTTAACCGCATTGGCTTCCTCAGTAGATAATCAAATAGTGCCATGTTTCCAATAACCTACACAAT
ATTACATGGTTTTCGTCATATGGGACCTAAAGATAACATTGTACAACAATATTTGTTCACTTAGGAAATTAATGAATAATTTTATATTTAGTTTTTTTAA
TTTATTTTTATTATTAATTATAGTTATTTTCATATTATATTTTTCAAGACAATATATTTATTATATAAAAAGGGTTATCAGTTACTTAGTAAAATTATGT
TTTTATTTAGGGAAAATGCACAAGTATCCCCTTAATCTATGTCCGAAATTTCAGAGACACACTTATATTATACTAAGGTCCTATTATCCCCTTGAACTTA
TTTTATAAGTAATTTTCTACCCCTTTTGGCCTACATGGCACTAGCTTGAAAAAAAAAGTCAACCAACGTTGGACCCTGAAGATAGTGCTACGTAGGCCAA
AAAGGGGTAGAAAATTATTAATAAAATAAGTTCAGAGGTAATAGGACCTTAGTATAGTATAAGTGTGTCTCTAAGATTTCGCGCATAGGTTGAGGGGTAC
TTGTACATTATTCCTTTTATTTATAATTTTTTAAGAAGCGTGCAAAATCAATAGCAGACAACTATTATTGGACATAAACAATTGTAGTAATGGACATGAT
TTAATCCATTAAATAACATCAAATGGGGGCACTAAGCATGAAATTTCATATTATTAATTATCGTACCCACATGTCTAAGTAAGAAGTTTCTAATGATAAT
ACATAAAACGATGTTTACCGAATTGATCATGAGAAACATTTTTAAATTAAAGGAAAGTGATTTGTGACATAATATCCGGACTCTAAAGTCTAAACCACGT
ATATTGTGATAGCCAGACAAGCTAATAACGAACAGACGCTAAGGGACAAGTATAGTTTGTGTTTGTATATTCTTATTTTAATAAAAAGTAATCTTACTTT
GAGCAAGATAGGGCATTAGATAGCCACAAATCATCCAAAATCACAATAAAGTTAATATTCTAATTAAATTCGAGATTGAACGCAGTAAAGTAGTTTTAAC
ATTATGCGATGGTGCAAAATATTCAAATGCTTAGTCCTAAGCCGGCCCATGATATGGATAATCATGGTGATCAATAAGAAAATCAATCAAATAACAACTT
GTCAATATATATCAAGTTGTAGTTTTGTTATACTACGAAATGATCGGTTAGGCATAGCAGATTAATGTACAGCATAAAACTGGACAGCTAGAAATTAGGT
ATGAATTAATGTCACTTCCCATACCACTTGTTAATATATTCTTACTAAAAGGTAAAATGCTATTAATATTCTGTTACCATCATATGAATGTATCCGCTCT
TGGCATGCACAACTTTAAAATATGTTACTAGTTGGTAAGGTCTGCTTACTTATATACCAAACCAAACATTTCTTTTGTGTTCTTGTTGAGGTGGGACTTT
TTATTTCTAGGTGTCACAGGATAAATCTGAATAACAGCAGCATCGCGAAGTAACATAATTGTATTGAAGGAATAAAAACAGAGAGAATCCCTATCATTAT
ATCCATGATTACAACTAAATATACATTCAATTATGGATAACATGTGTGTCTTGTCAATGATCAACTATATCTAAGCAAGAATTGTTTTCCTGGTGTCTAT
TCTTTTTTGAAGATAACACAGATTGCTAAGAGGGTGAAGAAGTAGAAAGTCATGAGGTGGGGCTGATGTGTGAAATTTAATTTACTGCAAAGACTAAAAT
CCTTATCCTCTATGTATTATTATAACATGTACAAAAATATTGAAAATATTTAAAAGAGGGCTTCAATTAAAAGCTCCACCAGTGAAAACACAAGAAAGGT
CAGTACTTTGTGCTCTTGGCCTTCTTCATAGTAGCAGCTTTAGCACTAGACTTAAGTTGGGTGGCGCGATTAAAGGAACTTTTGGGGTTAAGAGCCTTTC
TGATCTTAAACACAGTCCAGGCAGTCCCAACAGCATGCCCTGCTGCATCAAGCCCTTCGCTTGCCACTTTTGCTGCCTCTTCTCCATACCTACAAAAAAC
CCAAAGTTACTTCGTCTAAGTTAATTACAAAAGATTAAGCAGCATGCATTCCTCTTATTGTATTGCTTAACTAACATAGTGTGTGTTCAATTAGTTGAGT
TAAGTTTCTCGAGATGACAGCAGTGGAAATGTATTTGTATGGTAAGACTAGAGTTCATAAATAAGGATATAGCCAGGAGAGTTCATCAAACTGAGCTTTA
CTTCTGTGAAACAAGTTCAGTTGTCACGGTGGATGATGTTGACATCACATTCTTTCCAGCTACTTCAACAGCATCACATATTTTGCCTATAACAAATTAA
GACAAATATCAGGCTCCTGTTGAAAGACAAATCATATACGTTGACAACATACTCTTGTAAATACAAATGCCGAATGCACTGTGCAAAGCACACAAAAGTT
CTTTTATCTAACAAACTTAATCTGATACAGGTGTCTGTGAATGTGAAATAATTCTTTTGGTCCTAAATCTGACTCTTAGAAGAAAAAATAACTACTAAAT
GGAAAACATATAGACTCCGGAAGGCTACAAACGAAGTCAGAAAAAAAAAAGGAAGCTGTTTGACTTACAAAATCCGTCCAGAGTAGCAAGGACCATCTCT
CCTGGCAGCATCTTGAAGAACTTTTTTCCTGCTACGGAATTTACAACTGAACTAGTGAAGAATCCTGAAACCGAGAGAACTCCCGAAAGGACTCCTAAAG
CTACTTTCTCAGTCATCTTTGTTACTGTTTTAACCCTGAAAATTAAACACAGCACATAATTTTGAGTAGAAAGTTGATTCTTCTCTTAGATGATTTACAG
CTAGGCATATGAGTATATCCCTGATAACATATTCAATGTAAATGCACACCAGCAACAGCTAGCTCAAATGAAAGCTAGATATCATGGCACTTAAATTCTG
GATTTCTCTTGTATCATAACTTGAAACATGTACAGAACAGTAGGTAAGAACTATGTGAATAAACAAGGAAAAGATTTTCTTTTGTATTTTAGCTCCTTTG
TCTATCATTAAAATTCAAGGAGATTTGGTATAAATTACAAATACCTTGCAGAAAATAAGAAGCCACAAACATAGAAAAGGCTAATCCTAATTTAAGAGTC
AACATAGTCTAGATGAGATGAAGCAAGAAATACCATCAATATTAGAAGGTCACAATACCTTTGGATCCTCTTCAATGTCTCAGGACTAATCTCGGCCTTC
GTCCCTGTAGCCATCCTTTGCTTTAAAACCTCATTTCCGCGCATCAATCGTTCTGCTGACACATCTCCACACCACAAAATCCCCTTAATCAGCTGCCCTG
ATCCTTGAGCAACTAATTTTGCAGCTGCTCCACTATATTCCTCCACATTGGGTGCTAACGTGGTCCAATATTGAGCACATCGTTCTTCTAACACCTCCTT
CTTCTTCTCCGATTTCAAGTCATCTGGAGACAATTCCCTTGCCACAGTTCCTCCCATTGCCAATGCGGCATTTTCGTCCACTTTCTGAACAGAAAAGGTG
CTGTAACTCTTCAAAATATCATCCAGCTCCTTCAACAATGCCTCCTGACCCTTTGAAGCAATCGTCAAACCATAATTCAACGAATCATCCGTCGGTCCCT
TATCTTTCTTTTTCTTTTTCTTTTTTTTACCCTTTTCTTTGTCGTCATCAGTAGTGCAATCCGATTCATCCTCTTTCAGAGCTTGAAATGAGAAGAAATA
ATGTGAATCATCCAATTTCACCGCAGTCAGGTCCTTAGTTATCGGCCATTGAATATCATCTCCCACATTAGCAAGGATAGCAACCGTATTCTTATCTTGC
AGGAGACGACACAGAGACAAATCTCCGTCAGCTAGCTCAACAGAGTAATTTTTATCGATCAAATGAATGAGGACACCGGGGATAACGAGAAGGTTTTCCT
CATGGGACTCAGGAGGGGGAGATGGAGCAGAAGGGATAATATGGTAATTTTCAGGGAAGAGATTCTCGGCGAGGTCAGTTTCGTTTAGGGTTGGATACAA
ATTGGGACGAGAAGAAGAGGTTGTTTGGAGATCTGGATCATTGTGAATGACACGTGGGTACAATGGGGCTTTTTTGAGATTAGGGTTCTGAGAAGCCATT
GAAAAGCTTAGAAAAAATTATTCAGGATGGAGGAAGAAGGAAAAACAAGATTGGTTTTTTTCTTTTTTTTAAGGAATAAGAGGCGAAGATAGCGAGACAC
GTGGAAAATTTGTTTGGATGAATAACTGCTATAACTGTCTGGAATCTTTCCCGCCAAGTCCATTTGGAACGACAAATAAGAAACATAAATGGGACAAACA
TTCTATCCTAATTCATGTCCTCCGCGTTATTTACTTTTTCTAGAAAAAAGGAATATTTTTCCTTCCATTTTAGCACTCATTGTCTTTTTAGGCAAAACAA
TGGGATATTTCTTAGTAAATAATAAAGTTTTTGTTGACTGAAGAGAATGCTATAGAGCAGATACAGAGAAAATCAAGGTCCACCATTGTGATCCATTTTG
ATCATCTTTTATGGCAGAGTGGTACAGTCGGTGGCCGGAGCTGAAAAAGACGTTCTCCTCCATTTATGTTCCAGAATATACATAATCCATTTGCTTTCTT
TGGCATACATCATATTTTATGGAAAAAAATATTCTCCTCTGTTAAAATGGACTCTATGAACCAGTTATTTTGACTTTATTGGGGGTAGAAAGTAAGAAAA
AATTGTTTTCAAAAATTAACAATGAAAGTCCGTATCTCCATGGGACCAAGCTCGACTACAAGACTAGACATGTCTAACGGGCCTCCTCTAATTGGTGCAG
ACTCACGGCCACTGTCATGTTCTATATTCCAGTTCATCTTCTTCATCTCATTCTTGCCTTGATTCGCCGATAAGCTTGTTTCCTTGATTGCCTTTATCTG
AATATACAATGTAAATATGTGTCAATGCCCTCTAACAATATCAGTAGACTGTCCGGGTTAGTATCTTAATATGCATTAGTTAATCAACACAGACAGAGGA
AGTAGTTCTCAATATTATAAAGCTGCATTACCCTTTTTCCAGCAAACATTTCCTTCAGTTGAACTTTGGTTATTTTCGAATAATCAGCGTCTTCCCCAGC
CTATGCACATCCACAACACATAAATCACAATGATCAGTAGTGATATCAGTTAACAAGGCACAAAACATAGGTCCAACATATAATGATGTCATGTGTCACA
CTCTCAATTTTATATTTTGTTTCAGAATTCAAGTAAATGTAAGAAGTTAATGATTTTTCTGAAGTAAAGCCGCTGTTTCTTGGTGAAGTGAGGCTGAGAC
AAGCAAATGAGAGAAGATTTTACCTCGTATAGATGAGCCAAACGGATAAGTACACCTCCGTTATCCAACTCCTGGAAGATAAAAACAGAAATGACTTCAT
TATTTCATCAAAGGATAAGGATCATTTTAATCACTGCACGCTCTATACAATAATAACCTGGAGAGTAATCAGTGCAACATTAGGAGGTAAACTATAATTG
GGATTCATGATGGTGGCTTTGGTCATATGCGAAGCTTTCCATTCTTCCTGATTCTGCAAGATCAAGTTGTGCAATTTCCCGATATCAAGCAAAAATATTG
ATCATTTAAAATTAAGGAATATCATAAGGTGTGTAGGGCCTGCCGAATTTGGTCCTCTTCATAATATGTAGATTGTTGAGATTACCTCATGTGCAAAAGC
TAAAATAAGAGGTGAATAAATTTCTTGGCCAGTTGTTCTGCGCCAACGTGAACCATCACTGTTTTTATGAATTCCCAGATAGTAGTTCCCTCGAACCTGA
CCAAGGGATATGAGAACAGGTAAGTTCAAAAGAAGCATACTAATCAGAGGTTGCTACATTTTGTATTTCTGAAGTACATTTTCCTTGATGAGCAGCTAAG
TTACGGTTGAAATCTTATTGCAGCCTAGGCCTGCTTTGGAATGCCATATCAAACGTACCGTGAGTCCCTCACATGTACTCCCCACACAGACAGGCTCATC
AAGGGCTTCACCCACTCCTCTACCATCATCATTGATCAAGCGCCTGGTATAATTTGAAATCCATTACATTTGGAAGTCCAACAATTATATTAAGCATGAT
ATATTTATAAACAAACTAAAGAAAAAAGTTCAAAGATTTGAACCTGTGCAACATGAGTTCTATTTCTCCATCCTTTATGCTGGCTCCACCTGTTGCACGA
TCTACCAAAACAGACAATTCTGATTTGTTATCTGTTATGTACATTCCAAGATTTACCTGAGAATAAACATAGTATCAATACGTGAGCTCAATCATAAAAG
TGCAATTTCAATTCAAGAAAGTCTGTTGGGAAAGTAACTGGATAATAGTTCCCAGCAACAGGTTGAGTAACTTGGAGGTCCCAATCAGCTCTGTAATTTC
TAACCTGATGAGCAACAAATTATCACCCAAATTAGCTCAAAAATAAACAGAAAATTGAGATAAAGTGAATAAAATATGAAGCCCAGTACATTGAAATCCT
GATGACTATTTTCCTTGTTCATAAATTGCCAATGTAAAGGATGTTTATAATATTTCTGTTCCATTAACAAGCACATTGAGCCAATATAGCAGACAGATAA
AAGCATGTTCAGCTAGTAAGCCAACATCAAGAATTATCTAGTTCAAATTGAATAGATGGTGATACAACTCAATGACATTTGTTTCAATTTGTAGATAAAC
ACTTCAAGGAATTTAAACGGACATTGACAAAAGCTCTCAGCACGTTGCCATAGTATAAGGTAATGAAAGTCAAAATGTTGAGACAATAAACATGAACTAA
AAAGGGAGAGAGTATATTGACAAGATATATGCACACAGAACAAAGAGACTATATTAATGAGAAACTGTCTCCTTAGGTTTTATACAGCTTAAATGTACTT
AAAGAGGAACGAAAAGTTAAGCTTACTCTTTTAAGAAAGTCCCTCCCATTAGAGTCAGTGTAGAACACTTTATCAGTGGCCATATTTGCTGTGATTTTGG
TAATGACCTCTTTTCCAACACTATCTTCTGTCGGTATAGGACCAATCTTCAATTGAAGAGGTATGTCAGATATACAGTTCATAACTACCCTTCAATGTGA
AATATCATTCGGCAGAGTTGACTTACAGTGAATTCGAGTTCAGCGTGTTCTTTGTCTTTGTAAATCCTAATTACCTGAAACATTGACATATCAAGACATA
ATAGAATCAATCAATACAGTTTATAACAGAATAAATTGGAAAAGATCAAAATGATGCTGACTAAAATTGAGTTAATCAAGGAATCATGCACCACACCTGA
GATATCCATGAGTTGAATTGCTGGTGGATTTCATCGACCAGGGGTCCACGCATTACCTTTATTGGAACCTGCTAGCAAAAAGGAAATTATTCTGCTATGA
AGAAAACTAGATACTGTGTGAGAGATGCAAATCAAAACTTCAGTGAAATAACTAATTGATTTATTTCGGAAAAGATGTAGGACCACAATTGCTGTAATCA
GTTTTACTTGTTAAATAACAGGAACAAAAGGGAGAAGACTACTCACTGATCTCGCAACTATGACTGGGGGTGATCCATCGGGTCTGAAAATGTAGGCACC
AGAATCCTGCAATGGATAATACAATTAACATCCTAACTTACTATGTCTCCTTTAGTAATGCCATCCAACATTTAATTATACCTACAAGAACATCAGCAAG
TACCTGATCCAAGTTCGAACTCGAGGCATACCAAAGATAGCTTTGTTGTACAGGTATATCAACCTAATAATAGTCATTTGTTAGTTAGAAGGATGAGACG
GCCCTCGACATAGAAAAGAAAGACAAAGATCAACTAGATAAATACGGGGTAATATGAATTATTTTGTGTACTATAATCATCATCAAGCATGTCTGTCACA
GCTATGCACAGAAATAGAATGGAAGATCTTTTGTTTGTTACTAAAAGTTTTTTTAATGTAATTTAGTAGATGACAATCAAAGAAAACAACAGCCTTTACT
TATAAACCCACCCTTATCTTCATTCCTAAGCAATTGGATCAAAGTTCTCATTCTACTCTTTGTTTTAGATATATTTCAGCAGATGTAATCATCCCGACCC
TAATAAACCGGGGAGGAGAGATGAGACTTGTATGAAGAAAAAAGAGAATATAATGCATTTGATAGCATGTAATAGAGTATAACCTGTTGACAAGGACCGT
TAGACCGCGTCCAGGTAAATAACTAGTATGCTTTACAAGTCTTAACTCAGCAAGAAAAAAAATGGCAAGGATGCATTCAATATGCTTCCAGGTTGAGATA
CTGACATAATTAAGAACTTACTCCTGTTATAGAATTATATAGACGTTTAAGTTGACCAGTACTTGAGGAAAAGGACGCCTTTAAGTTCCCTGGTCCAATT
TCAACAGTCTCGTTCAGTGGAATGTCCATCTTTGTGACATAGCCCGCAGAGCTCCCTGTATATTTCAGCAGACATTGAAACATATGAAGGATGGATTTAT
CATTTTACTTTTTGAAAACAGGCAATGCCTTCTTATATTTTAGTCATCTATGAGCATATTAGTGATGAAAAAGAGACATAGAGAGATAGAACATTTTGTA
TTACCCTTCTGTGAAGCTTTAGAAATAAAATAAGTATTCCAGCCAAGAGGTGACACAGACACTCGAAAGAAGAGCCAATATTTGGGAGTTTGTTTGGGTG
ATATTCCAAGATATGCCTTAACATACAACTTTCGTAAGTTGCTGGTAATATTATCCAACTCTATAAATTGTGCCTCAATTAGATTTCCCATGGAATCTTT
TACAATAAGATCAGCATCGTTGACCTGTTAAAGCAAATACAATTAGATAACCATCAACAGTGAATAAGCCATTCCAAAAAAGCATAAGAGAAAGAAAGAG
AATTAGGAAAATAGATCAGTTATATAATTGTCTGAATTATATGGGACTGACATATTAAATAAAATCAGCTGGCGACTGGTCTAATGATAAAATGAGCAAC
AGAAAGAAAAAACAGAAAAGATTATTCATTCACCGGGATCTTGATGATATCAGTTCGATTCCATCCAAGAGGATTGTATGCCACAACAACCTGAAAGTGG
GAGTATTGGTGTAAAAACATTTTTGCCAGCATATTGATAAGGTATGAAGCATGTTAATATATAGAAGGATAATTTACCAAATTCTTCCCCTCAGTGATGT
CTTCTTCAGTTGGTGGACAATAACTTATATTGAGCAGTTGACACTGTTCACGACATGTAAAAAAATAGAAAAAAAGGACATGTCAAATAACTAGTGGTTA
TTTAAGACTTCTCGCCAAATTACTACTTCCCCTAAGCATATCATTTGGAAAGAAAAAACTATACAAACGGAACTTTTGAAACTTCAATAGTAACTTTTAT
CTACATTTGAATGTTCTAAATGTTAAGGATCTTATTAACAATTAGTTTTTAAGCTTGAAGAACTGAAGGGAAACCCAAGTAACCGAAAATTCACCTGGTT
GAATAATGATGAAGTGGTAGAACATGGACCTGATCTGGAATTAACCAGGCATGATAAAGCAGAATTCACCACAACTTCAGACTGAAAATCAGAAGAACTA
TAAACATTAGATCATCCTAAACAAAAGCGTAAAAACTAAAGTTCAGGCAGAAGAGATCAAGTCCAAATTAAGAATAGGAGCCCACTTCAGAAGCTCCAAT
AGCCAAGCGTTTTGCATAGTCATCAGTTGTATGTTGTTTAGCAGTACCAGTCACAGCATCATGGTGTTGTGTAACTCCCAGTGCATCTCCTAAGCTAAAC
GTGTTGAAGCCATTTGATTTCCTCCCAGTTAAGAATTCAAGCTGGCGAGCCGCCTGTCAAAGGATAATTCAAGGTTAAATTTGATGTCTTCAACCTATAA
TCTCACTACTGAACCCATTATGCTTTGGCAAATATGGACTCAAATTTAAGTATATGATAAAATTTTAGTAGTTTCTACAGAGATATCTATGCTCCATGTG
CAAAATGTTGGGTTTAGTTGAACCCATTTAACATCATTTCGCATGACCTTATCCTAGATTAAGTGAAGTAACGACAACAGAAACTCCAATTGTTAGCAAG
ATTAAGAACAATTTACCAATCACCGTGTACATTGAGGTACAACCATAATAAATGTTGACACATAACACAATAACCACTTAAAAAGTAAACACACTTTTAC
AGTTTAAGCTTTTAGATGAGATTAGTTGCACAGTCCAACATGATACCAGAGCAAGAACGAGGTCAATAAAAAACTTAAGCCAACATGTGAGGAGTGTGTT
GAGACATAATATGATAGAGTAAGTAAATAAAAGTGTGCTCTCTCTAATAGCTTAAAGTATTAGATCAGATGGTCAGATTCCAACTGTAAGGATATCTTAT
TAAGCTTCTCATAGAGACCGGTGACAGAAACTAGGTTATCAAAATGGAGATCACAGTTACACAATTTTCTTTACTACATTCAGGTTCCTTTTGACGTTGA
TTTTGTAATATGGAATCATGGAGCCAGAAGAAAGAAGCTAAGCAGGCTCACCAGATAATATCCACTTAGCATACGAATATATCGCTTTAAAGCTGGTCGA
CTGGTAAAGAAACCAGTCCAATAAGAATTTTCACCATCTGCATATCTGAAATTAGTTAGGGATGTTAGATAAACTCCATAAAATATTCAAGATAAACCAG
GAGGTATAGAATATCAAGCAAGTGCTCACGGAAAGTAATCATCAGTTTTTAGAGGCCAAGATTCATTGGTTGCATGTTTTGTATCTACATAAATTGATGG
AGTAGAGTACAATGCATTCACTCGACCGTCCTGTCAAAAGAAAATGAGAGCAAGTTAGTCTCTATGATTTTGCAAATGTTTAAACTGGACTGGAACAAAT
AGAGCTATTGGTTCTCCATTAGGATTCGCTCATGAAGTTTTTGAGCTAGCTGATAAATGTACTGGACAACACCAAAACAGGCTAAGAGTCTTGTTATTAC
ATTTTCTTGAAATAGAACTTACGAGAAGACATATTGAAGCAATCACTCAGACAGTTGAAGAAACGTGTTCAAGATTTTTATCGAGGATTTAACTAAATTT
CTGCAGAGCCTGAAGTATTTACCTTGTTGACATAGTGAATTAATTTATCCATTTCCTTGAACCAAGATTCAGCATATTGGTATTGGAAGTCATCTCCCAT
GGTCCACATGACGTGATTCGTACGTGTCACGTTTGCCTACACATCACAATATTCAGCTTTTCATTCATTGCATTTACATGTAGATCTATTTCTAGCTACA
GTTCTACGAAAATTGATGATTATGAATAACTGAAAAGAATTGTAATCAGGGTACTTGTGTAATTGCAGCATTGATGAAGTCATTAACCCGTATATCGACA
TTTATGTCAAAGATAAGAGGATCATCCTGCAATTCATATACCAAATATATCAGAAATTTGTTCTCCTTTGATATACTAAAACAAACCATAGAGAGACTAA
TCTTTTATTTCTGCCAGTACCTGGACTGGAACAAAATCATCAGCATCATCCACTTCGAAATGAAAACCATGTGGTGGACTATAATGTACAGGAAATGCGT
TGGTAAATATCTGCAAAGGAACCACAAACAGTGTTAACCACAAGTGAGCAATGATATAAAATAAATGCACAAAGCTTAAGAATGCTTCATCAACCTGGGA
GGAAGAACCAAATGTTCTCGAACCACGCCATATAACCTCAAGAGCTTTATCCTCCTTACGTTTTGCTCTGTCTTGATAATCAATGCGCGCAAAGTGAACA
GAATCAAATCCTACCTGTGAAAGTTATCCGGGAGAAGTGAAAGAAGTATCAATATTTCGAGTCAGATCAGGATTATAAACTTCAAAATAATTTACGTCTA
ATAAAAATTTAAGTTATATATAATACACTCTAAACCACATCTTATGAACGCTCAGCTTACATACCTCTGCGCCAAGAAGATAAGCTTGCACGGCAGAGTG
CCCAAATGGATCGATCTGCCATCCTGCACGAGGAGTGATATTGAATTCATTCTTTATCAGTTGATGGCCTAGTGTTGTCTGATCAATCATATCTATATAA
TGGGTAGTCGCTTCATCATGCATACACCAACCACCATTTCTGTTCCAGAATTCTCTTTTTCATAAAAAATTCACCCGAAAGAACATAAATAGAAGTTCCT
TGCAAGAAAGCTAACATACACGAATTCCAGCTGGCCAGAAGCTACAAGATTTTTCACTTCTGCTTGAATTTCCGGGCTTTGCCTAATCCACCACCGATGG
AAAAATGCCTACAGAAGGATCAACAGAAACATGCCTAATGAATTGTGCATCTTTTGTTCCTTATAACAACTTCGCCTCAATACCAAATAAGTTGTATGCA
CACAAAATTAAGAAGAAGAAAAACAGCTTTACCATTTCAGCAAAGACAAATTTCCTATTCCGATCACGACGTAACGACATAACAACAGAGTCCAGTACAT
TTTCAACACAGGCACCCTGCAATGCATCATCAATCATTTTTTACTAACAACAGCTAAAACATAATTTCCAATTTGAATATAAGATGTAAATATGACCTGT
ATGCTATTATTTGATCCAACATAGTACTGATCAACAGTCTTTAACCAGCCAACATCATCGTGTGAATGAGGAACCAAATGAACATTCAGTTTGCTTTCAA
CAATGTTACCCCCAGTATTGTACTTTAGGTATCGATTAGCACCAATTGCCCCATAAACACAAACAGTACTACAGAAAATGAACAGAAAAACTGAAGCTGG
ATTAACAGAAGTTCTCATTTTCAAACCCAACTTAGAAAACTGTGATAAACATGTTTACTTAAATATATATAGAGAGAAAGATTGAATTGCTAAAATCTTC
TAATTTTAATTTACATTAATGCTAAAACATTTATTTGCCTTTTATTCAACAATATTTGCTTTTTTCTCAAATACTACATTTCAGACTACTTAATTAGCTT
GACTTCTTATTTATGTAAGTTGGACTTTTTTTTGCGCAAAATATAAAAAAGAAGTCAAACTAAATAAATAGTCTGACAATCTAGTATTGGAGGAAAAAAA
AGTAAATATTTTAAAATAAAAGGAAAATAAATATTTTAGTCTTAATGTAAATTTAAATTAGCAGAAAAATGCATTTTAGCAATTCAATCTTTCTCTCTCT
CTTTATATATATATATAAAGTTGTCGTTTACAGAGTTTTGTTTATGGAAAGATTTTATTCCAACATGTTTTTGTTTTTTTTTTTTTCATATTAGTGGTTA
TCATATGTAGGTCGTTTGGTCAAAGCATATTAATAATATTATGTTTAAGTATAGGTTTATTTGTCATCTAATCAATCACCGTCTTGATTGCAATTGTAAA
CTTTCACATGATACCCTTATCAGTTTCGAACCTTACATAAACGGTGTTGATACATAGCATTTGATACATAAGATTCTTTTTATTAGCTTAAAAAGAAAGA
GAAACTTCAAATTAAATTTTTGATACATTGAGAACAATATGTGTATCAGGTACATGAAAACATTGAGAAAAACTAAACATTATACTTTTGAATCATGTAT
ATGATATGTTGGGACTGATACATAAATTCAATAGATTATCTTGCATTTATAACTTGATACGTTGTGAACGATTAAACAAATATATATTTATAACATCAAA
TAACTAACAAACTTGGGGTTTTATGTATCAAAAAATAAATGAATGATGATAAATTACAATACCCTTTATTTGAGGGTTTTTTCCACAATCATTTTAGAAG
TCGAAGATGTATCCTTCTCAAACTAATTGGACAAAAATCAATACTAAAAAATCAACCTTCATTCATACGTATCAACAAATTTTTAAGATGAAAAAGCTTT
TCAAAAAATTAAAAATAAAAAACTGAAGTGATTCAAAGAATTACCTCTTGAATATTTTGAATTATTAATTAAAAGAGAAAAGATTTGAAAATTAAAAAAT
GCATTAATGGAGGTAACAGTGGAGACTTGGGAGATTTATCGCATGGAAAAATAATAATATTGAGTATGAGATTTCAAATTGATGTATCCAAAAAGGAAAT
GAGTGAGTAGAATAAGACATTTTTTATATTTTTTAAACAGTAGAAAAAGTTTAAAAAATATGATAAAAAATGGTGCTTAGTTAGGTAATATTTTTTTTTA
AAAAAAAAAGGGGGGGGGGGGGGGAGGGGAGGGGGGTAAGTTGATTGAGAAGCGAATGCTTACCTAACAAAATAAAAATTTCAATAGTCAAAATTAAATA
AGCTGCTAAACTTTTCTTCCCTAACAAATTCTAAATAGTGATATAGTTATTATAAATCAATATAACTCTTAATCATATTTTGAACCATGACAAGCATCAA
TATATTTTTAAAAGTCCCCACAAATCTTCATCGATTTTATAACAAGAATGACTCGAAAAATTTGAAAGAATAATCAACATGAAGTATTGAGGTAAAATGT
GACAAAACTGCATTGGTTTTTCCCATGTCATGTAGTACCAGCCTTCCTGTCACATTAGGAGGGAGGGACATTGGATTTCACGTGCAAAATGTATGGATGC
TTTTTTAATTATTCCAGCCTGTTTTTTTTTTTTTTTGGTCTAATTCCCAAAAAAATAAAAATAAAAAGAGGAAATTGTTGTAGGGTCTAATTGGTTATTG
TTGGCGTAAATAAATAGGTACGAAAGAAGTGAATCACTAGGGGACAACAACACGAAAAGTAAATTAAGTAAAAAGCAATTTGTCAAACAAGAATCTTTTT
TTAAACATAAAATGGTATAGTACCCTTTGTTAGCCTTCTTCATAATATATTGTATTGACAATTTAAGTACTAACATATATTTAGATTATCTCTATCTAAC
AGTAAAGAGACTTAATTTGGTGTGGTACAATAGTTGTTATTTTTCGATTTTCTTGTCTACATATTCAATTTGAGTTATAACTACAGTCCGTAATAAATAA
TACACTTGCTATTTCATAACCAACAAAAAGAGTAAACAACATTAATTTTCTTACTAGCGAAGAACCCATTCACCAACAATTCAACATGCACAATGAATGA
AGAGGCAATATGGCGCTTTAGTATGACAAATCATAATGACACAGACCTCTAAAGTTGAAATTGAGCATATTGTATATCGTATATACATACAAAGGTATTC
AAAAGTCTTTTAAAAGATTGGATTATTTCGTCCATTACCTTGTGAATTGAGTTAAATATAGTCCTAATCGACTAGTCCGCTAACATAACACCAAAAGTTT
CAACATCAATACTATATATTATTAAGCACATGATTTAGTTTTAATGGTTCCAATCATTGTACTGCAATTATTGATGACAAGATAAAGACGTGACACAGAC
ACGTCCAAATTTGATATAAGTTCTTTATCCTTCTATCCATGAATAAAGTCGATCTACAAGCGAAGAACTTGTCCCATCATTCGTTATTTTGAGCAAGGCA
ATATGCATCATTCTCTTTTGATGTTAGTTAGTAATTGGAAATATTCAATGCCCATTGATATTAACATTTCTGAAGTCTTTTAAGGACAAACCTAATTTCT
TGGTTGTCATCCCATTGATATTAACATTTCTGAAGTCTTTTAAGGACAAACCTAATTCCTTGGTTGTCATTTGGTAGTTGTTCTACAATGAATGCCTTTT
AATACACAATGACGTCTGAAATGCTAGGACATCAAATTTAATTGGACCTCTCCAACACTATTCTTAATCCCTTAAAAAGAGAAGAACTCTTGGTATAAAA
GATCACGAGTATATCAATAAACAAAGGCAATCAGAAGTAATCCGAATCTGCATTTTCAGTGATCACAAAGGATGTTAATAAGAGGCTAAAATTAAATGTT
TTTGACACTGAAACATTAATTGTCACTTCATAGATTTTTTGGGGACGCATAATTTTTCACAAAAGAAAACGCTGGGTAGCTGAAGGTAAACACCATCTTG
TTTCTTGCTAGGATCTGTCCTTAACGTGATTTTTTGAGAGAGAAATACAAATCATCTGGAAGCCACCACAAATGAATCTAACTGAAAGTTCCATAATCTT
ATAATAGTACTTTAAAGACGATTCAATTAGTCCCTCAAGAGTAATGAGATACAGCCCTACCCCACAGACATAATAAGACCCATTCCAATGAGCAATTTCA
GCAGCAGCAGCATACTTGATTACCATCTGAACTTCTCTACCTACAAGATTAACAGTAATGTTCATACTACCGGAGCAAGGTAGGAGTATACATAACAAGA
TGCAGTTTTCTTCAAAAACAAAGCATTAAGAAGTTATATACCTGAGCTGCAAATAGTTGTACGCATCTTTACTTCTTGTCCTCTTTCTGTTCCTTATCAT
TGTCCTCATCCTTCTTCTGCTAGGACAAGTTAGTTCATTTTTCAATTCTATTTGGAAAAACAACAGCAAACATGCTACTTTGGTAAAAAGATGACCCCTA
GAAATCCCTGGCTTTCCTCCTTCCACAATGAAAGATAATATAACCTTAATGAAAACACAACTGGAAACTAATGGTAAGGAAAGAAAGCTGAAGCATCAAG
AGTAACATAATTGCACCTACTCGTCTTTTTGATATATTTGTCACCCATACTGTTTTTTCGTTTACTTGGAAATATTAAATAATACCCTAGGATCTGTTAA
GACGGAGGTCTTCTAGAATGCAAAAAGGCTATTTTAATAGGCATGGTCAGCTTTGCATCTCTTGTCTGAAGAGCACCAATTCTTAAGGGGTCGTTTGGGA
AGAGGATGCATTAGAAAAAATAATGCATGTTAGCTATGTTAGCTTTGTGTACTCCTAATGCTTTATTTGCTACACTTTCTCAACCTATCTCTATCTGGTA
TTATGATGTGTATAACTAATCCAGGGGAAACCCTGGCATTAGCAATGCAAGTAGTTTTGATGAATGCATTAGTATGGTTAAAGACACTTTCTCCACATCC
TTTCCACCATTTTTGTCGAGGGTATTTTTGTAAACAATTTTTTTTTTTGGAAAATATGTCATGCATGTTATATTTCACACCGAACGAAACACTTCATAAG
GAATAATCTCAGCATACCAACATCATTCATATCAGCATTACTAACAGTCTAACACCATATGAGCTCAAAGTACAAATACAGGCACATAAACCAGAAACAA
CAATTAAACAGGAAACTAAACCCGAATACGCTCTTTGATTAATAATTAATAAACTAATTATAATTAATAAGCTAATTAACTCACCTCGGACTGCCCTTGC
ATGGAAGCAAGCAAATCTTTGACAGAAGGATCGTTTGGATCAACACCTGGAAGCTGTCAATCAAATGCAAAGTTAAGTCAAAAGTGGCAAAAGATATACA
CTGCAATCCTTAAGGAAAAACACATACTTTCTCTGGTGAAATAACAGAGTTTTGTGTACAGGAGACTTACTGAGGCAAGGATTGATGACACAAATGATTG
ATCTGCCAACAGCTTACTCATATCTGTCGGATTTGACTGATCATTTGTACTGTCTTGCACAGACAGTTGAAGAGCTGCAAGCACCAGAAGGTTCGAGACA
AATCAGAAGTGTGCAATAATGAGCGGAACTTGTAAGGTAACAACTACAAAGGATACTGTGCAAGCTTCGACCTTTTCAAGGAATTGGGGATTTTGATAAG
GGTAAGCCAGTGCCATGAACAGCCAAGTAATAGAGTCTAACACAACCTCCATTGGCAATTAAAGGCCAATTTCAGGACAAAAAAGGTTAAGTAAAGCATA
AAATAATAGGCATTTCTTCAAAAAATAAACCTTAACTACTATGTGAGCCCATTCTATCATATATTATCATATCGAGAAACACGGAGAGGAGATCAGATCG
GTGCTCGTTTTTTCTTTTGAACCAGAGGAGTGGGGCCCCCGCTCCCTCTCTTCCTTCAAACATCAACTTTTCAAAATACAATACTCATGTTGTGGCACAC
TTCCCTTCTAAATTTGCCCAAAAAAAGAACACTTTTCTATACTTAGAAACAGCTTAACTTTAAACCTCTCATTTTATGCTTAATGAGATGAATTATAGCC
ACATAAATGCCCATGACTTGTTTCAGGCCACAAGTTTTAAGTCTTCCATTCTTTCTTAAATAAAGTGCTCGTCACCCACGCCACATAAATTGAGGCAGAG
GGAATAGTTGTTTTCGATCAGGAAATCATTAGAAGTGCATAGAATAAGTCAAGATTAGTTATGCACATCCTAGGTTAGGTACGTTGTGAGAAATGCAAGA
AAACAAGGAATAAATATTGTGAATGAACTTAACTGGGTTAGGTATGTTGCTAACAGTTAAAACTATGTATCTATGAGGTTGTGACAGGATACCAGCATAT
CACCATTTAAGACTGCAGATATCATAACGTACCAAGTGCCAAGTCTTGATCTTCAGAAGCCGCTTCTGACATGTCAGTGTCTCGTGTAGCAACATTGGAG
GACGAGTCATCCATCGACATTGCAAGGGCTTGCTGTAACAAGGCATTCTCATCATCCTGCAAGAGATCCAATTATAATTGAAGTGTTATTTCATCTTGAC
TTCCAAAAGGCCAGCATCAAATACCCTTCAAGCTAACACCCAGTTTTATTAAAGAAAATTTTCAGTGTAAAACTACAGGAAACAATATCCTCTTGCATGA
GTGTGAACAAGGTAAAGTGCAATGCCAGAACAACTCTTACTAAGGTATTTAAGGAAGTCCAAGAAAATAGAGGATTGATGCAATTCCAGAAACTCAATGT
GTAATACATGGTTCGGCTAACCAGTAGAGTCTTGCACCCCACCTCCCCACAGAAAAGGAGAAAAAATTCCATATACCAAAACAATCTCAAACTTGAACAG
TTGATAGGAAATATCACATTTAGTTACATCCAAAAGAACGAAAAAAGTTCTTTTTTCCAACTAACATTCAGAAGTATCAGATATGAAGAATATGGATAAG
ATAAGAACCATTAGGTCAGTTGCTTTGCTTTCAGGCTCAGAAGTTCCTGCATTGACATTTTCAGCCATAGCAACATCCTGAGAAGTAGACTGATTTTCTC
CTTTCTCTTGGTTACCAGCTTCTTCTGCAGCCTTCTTTGCAGCTGCTTCCTGCCTCGCCCTTTCTTCCTCCATTGAAACTCGGAGTGCGAGAGCAAGTTC
TGGATCCAAATTAGGATCTACACCAAAATCATATCCAGACACTCCACCAGCAGCAGCCGCTGCAGCAGCAGCAGCAAATCCACTGCCACCTTCTCCATCA
CCAGTGAAAATAGGAGTACTGCCGATGACAGATGAGGGATACAACTTATTAAGGAATTGCTTTTCACAAGTACAGGCAGAAAAAATCTTATTTAGTAATG
ATAACAAAATGGTAGGATAAGAAGATGGTTATATCAGGGATCACCTTATGAGAACATCAGAGAGAGCATTAGGACCAGGAGGAATATGAATGATGTGACT
ACTGTCGTTGGTATTAAGCGCAGCAACTAGTGCCTCTAGCTTCTCAGCTTTCCCTTCATCATCTTCACCAAAATTAACCACATCAAGAGCTACACTATTC
TTCTTCAACTTTCTCCCAATCATCTCCAAGACCTTCTTGTCATATTTAACAGGGCTGAAAGAAGTGAAATGTCAATAGAATGATCAAAAGTTGAAAGCAG
CAAAGACAAAACAGAGAAAAGCATCTGAACATCACCTGCCAGCAAAAACAATAATCCTTTGTTGTTGCTTCTTGTTTTGTCGGTGCTTCAAAGCCAACTG
GGCTACCTGGATTCCAGCAGCCAAATTCATCTCACCGCCTATCTCCAATCCTGAATGAGGGAAGACAAGGCCAAATCAGCAACTAAAGAGTTAATACAAG
AGTTCATTGAACAGCCCAAGACACTAAGAGATACTACTGTCATGCAGTAATATAGAACTCAAGCACCACAAGGACTTCGGAACCACCTTTTTGATGAAAA
AAATATATCCATTGATGGCATCGAGAAGATATAGGAGTACAAAAGTGATTCAGATAGCTCCATAATATGGGGATTAAGCCAAGACTGGAAGCTCCCAAAA
TCTATATAAGATCAGTGTTATTTACAAGGGACAGTTTGCTCCAGCTAAATAGACCCAATAGGCACCTAGCTTTCAACGAGTGGTTTGGAGTAGACCATCA
AAACATAGCACAATATCGTTCCATGAATACACACCAAAAGTACTGATGGGAGTTGGGACCATTCTCCTGATTTTCTTGATGATTTTATAGTGAAAATCAA
AGCAATAATACATACGTATCCTTTTGTGCAAACATCTGGAGAACAATTCACAAGATAATGTAATTATGCAGTTCACTTCCTACCTAGCCCCCAATCTTGA
CTCCTATTTTGCTACTCTATACACTTAACAGATAATTGGCATATCATTCTCCCTCGCCCCCTTTTTTTTCTTTCCAGACATCTTTTCTCCTCAGGCTCTA
TGCATCTGGAATTTCTTTGAAATTACAAAGTGGCTTCAACTCTACATGTAAATACTCCAGAATTTAAGCTTAAGCATAAGACACCTTTTTGAAATTCTTT
TTGTTATTTGAACTGGTAACTTAGCATTCCTCGGCATGCTGGTCACCTCCAAAAATTTGAACTTAAGAGAGGCCAATTACAGTAATCCTATGAAGTCAAC
TAATTGAACTTCCTCGATACATTGCTCTAGACCAGAGAGCATGGAGGTCAAGGATTAGGGTAGAAGGCCAGTAGGTAGTTGAACATTTTCTCTCTATTCT
ATGGGAGGGCTTGACTCTACTTTAGAGCACTTTATCCCCCTTATCAATCACTACTAGTGTGCTATTTTTATCATATACCTAAATTTTATTGTTATTGTTG
TTCCTTTTACTTTGTTATCAATACTATTTTGATGTCAATACTTCTCTTCTTCATATTTTCATCATAGCCTTTTGCTCTTGACCTGTTTTGAAAATATTTT
TCTTGGTAGAGGTTCTAATTGGAAACAGCCTCTCTAACTCCCCGAAGGAAAGGATAAGGTATGTGTACCCCCACCTACACCCTCTTAAAACCCCAGTGTG
TATGTTGTTGTTGGTGTGCCTATCATACTCCTTACATACAATATTATCCTTCTGAAAAGGCATAGAACAAGTGATTAGGCACAGTAAGAAGATGACATTA
AGTCACTAACAAGACAAGTGTAACAACCCATGGAGTAAGGCAAGAAGTAGTTAAACATGCAATGACAGGTACTCTAGCACCTCTAATGATAGATATCATA
ATCTGTCTAGTCACACCTCTTCTATATATGATGCATTACACCCAAAACAAAGTCCGAGGAAACTGAGCTCTTTAAGATACTTCTAAATACAAAACTCATC
TCCACATGTCTACTCTTTTCCAGGTACCTTAATAAACCTAGCGCCCCAATATATTCCATGTCAAGGTAACGAAAGCTCTGGGCTAGATAAGTTGTAATAA
ATGCCTTTAAAAAAGCGTAAAAAACAAGGAACAGAGCTTACCGTGCATACAAGCTAAAATTTTTCCAAGATCGCTGGTCGGAGTGACTAACACTCGAACC
CCTTTACCAGCCATCGTCAAAATTCCAACTGTATTCTCGGGATTAGACTGGATCACACACAAAAAAAAGGAACAGTTAAACTTAGCGCAATTAGTTTTCA
CTAAAAGTACGAGAACACCCAGATATATCATAAACCCTAGAAAGAATATAACTTGAGAAATATAATCGAAACCTGGGTTTTGGCACCACAGATTAGATTA
ACAGCGTCTGCTAGAGCTTGGAACCTATTGGGCGAGTAATCACCGTTTCTCATCCACTCCGAATTGTCGATGCAGATCATTGTCGCCTGATTAAAAAAAA
AAGTTAACAAAAATTAACCCTAGTTCGCTATAACATTGTAGAGATAGAACTGAAATTGGAATCAATAAACATTATGCAGACCTCGAGCACCATGGTTAAC
GATTGAAGAAAAATCCAATAATTGGAAGATTAAACTGAGAAATCTTTTCGTTCTCTCTGAAAAATAAATTGGAAGGAATTTGAGTTTACTTGCGGAGGGA
GTTGGTGCTTTAAGGAGGAAAAATCACAATCCGAAGAAGATACAGGATAGTTCGCGTAGCGGTGACGCGGGTCGGGTTTTTTTCCTAAAAGAGCGGCCCT
ATTATATACTGTTTTTCGACTTGCAAGTAAATGTATCTAAGGCCCAATTGAGTTAATTTATGTTTATTTATTATATTAGAATTAAGCCGGATAAAATCGT
ATAGAAAATTGAATTAAATGGGAAAAAAAATTGTGACTAGATAGTTTGATTTAGTTTGTTATTCAAGAAAAAACTGAAATTTATTTGGGTTGTTTCAATT
TTAATTGAAAAAAATCAATTCGAGATCAAATTAATATGATATTATATACATTTTACATATAAAGTATTATTTTGATATAATTTGTAAATATTTGTTATAT
CCTTTCATAGTTTTTATCTTTTAAGATTTTATTCAAATTTGAGGCTTATAATTTTGAATGGTACAACAAAGGTTGTGGATTTGTAGTTCATTATATTAGT
AGTTTAATAAAAGCTTAAATAAATATTAATGCTTAAAAGATTCAAATCAACACTAAGAATGACAATAATGTTTAATATCTAATTTTTTAGTTTTACATTA
ATTTACATAATTAAAATCTATAACTTAATTGTAGTTTTTCTTTTTAATGTTAATCATGTAATTTTGATATTTCTTTGACTTATTTTAGTATGATTCAGTA
TTTTTAAATTATAGACCTTTCCATTATGACTTATCAATTTGCATGATTAGTTTTATGCAACTTCATTTAAATATTTAAGTGTCATCATTCATTTTTTTTT
TCATGTATTATTTTAAAAAATATCTTAAAATAATTGTATTTTGGTATGACAAAAAATATATTTGAACACAAGTTAATTATACGTTGTATGAATATTTTAT
CGAAAAAACCCTAAAAGAATCAAAATTCAAGAAACTCTAAAAAAACTTCACAATAAAATTTGAGGTTGTTCAACGACATCTCCACCCCCACCCCCATCTC
AAATCTTATTAATTTATTTGATTCATATATTTAAAAAATTGACATAAATAATTTAATTTAGTATTTGAAAAATTCACGCCAATTCCATTTATGTACACCC
AACGGCTAACACCCTAAAAAGGCTTAGATAACGGATATCTTTATATATTGTTAAACATTAAATACTACACAGAATAACCTAATTAGAACTAGATCTACTA
AATTATTATTATGTAAGTTTCCTATTAATTTATTATCAAATAAACATTCAAATCAAATCAAACGAGTGAGTTTTCCAATTTAGATATTTTTATGCTTTTT
ATGAGTTTTTCAATTTAGATATTTTTATGTTCTTTATTACATCAATTGATTATATTCTTTATCTAAGATTATGTTGTTTGTTTTTTCGTATAATTATGAT
TAAGTGTGAAAAATAGATACGTGAAAGCAATTTACATATTTTCCTTTTCAAATTTATGAAAAAGTTGTCATTTTCTTCTAAAATCATCCCATTTGAAAAT
TTAATGATTTAAGGTAACAAAGATTTGTGAAATAACACATTAACTAAAGTGGGAAAACTAGATGTCTTCAATTAGAGTGAAATTTTTAACACATTAACTT
CTCTTTTCCTATTTCAAATTTTTAAAAATCAGAGAGAAATTGATAAATAAATCAGTATCACTTGAAAAATAAAGGAAAAATCATCAATCTTATTGCACCA
TGTTTTTTTTTGTTATCGGATAAAGATTTTCAACGTAGTGTTATTTGTATATCATATTTTGTTCATATGAAGTGTCTCGATATTTTAGTTTTTTATTTTA
ATTTAGATCTTTTATAACTTTTCTTTTTTTAATCCGTTTAAAGAGAATACTACTTATCAATCTTTTGATCTAAAACAACTTTTACACATTTTTTTAAATC
TAAAAATACTTTTTTATTCGCTCTTTTGACTTCACATGTATCTATGAAAATATAAATCATCTCTCTATTTTATTTTAAAAAAAATATGTATTATATGTCA
TTATGTTATTGAGTGAAATAAAAACTCCACGTCAACCAAAAAAATTTTTACCATCCAAACGGAAAAGGTTCACAGGACAAAACTTGGCAAAACAAGCCTG
TGTTTGTTTGTCTTTTTCTTTTCTTATAGGAGTAATTTATAATTGTTCATACAAAGATTTTCTTAAATAGACAGCCAAGAACTGGATGGACAACAAGCTT
TTTGAGAACACCGCACTGCGATTGAATGGCTGATGAAGAGAAAAAGAGCATCTATATAGCCTGGAAAATTTGGACAAAAGCAAGATGAACAAGTTGATTA
GTATGTCTAAGGTTGTGGATTCTGTAATATAAGGAGCGAAACTATATCATCTCATCATTGTTTTGATCAAACCTCTCCATGATTTCTAGGAGAAAGTGGA
ATATGTAACTCATCACATTCTGAGATCTCATTGGTACAACTTTGCTCAATAGGGACTCGTTGTTCCGACTCAACTGTACTCTCATCAAACACCTCTGTGC
TGATAGTAGCAACGCTATGAATTTGATCTACCTCATCCTCCGCCATGGAGTCTAATGATGTGGTTGCTAATAATGTTTCTGGAGAAACGACAGAACCTTC
TAGTCTAGTTTTCACCTTGTGTCGCCATCCATGTAGCGAAGTCCTAACATTCTCTGAAACAATGGTCTTCTTGTATCTCGAACCCATCTGCTCAAACATG
GATCACTGACTTGACATAAAATGTGTAGAATGATTACTAAGGACAAAAAAAAGAGATTACATTGTGTTTGTTAGTTACCTGAGCAACAATAACATAGAGC
GGAAATGTGACAAAGCTACACCAGAATTGAGAAACAACCCTGCAGCAACAAGTCACAAGGATCATGCGAAAATCAGTGTATTCAGAAACAAGTTAACAAG
GAAGTGAGACACAAGATAGTTACCCAAATGACAAGCGAATCACAAGAAATGTGTGATTGTCTGTGAAACATGAAGATCCCTTAATTTCCCACTGCACCAA
GAAAAGGAAATTAGTTGTCATCCCCATGTACATATGGAAAAAATTTGTATTCATGCAGTGACACGAATGTCTGTGTTGCCTCGCCTAAGGATTAGGTATA
AACATAAAACAGACACAAACTACATATGAAAACATTGTCTGTTTAACTCTCTGTGTTGTTTAGCCCATAGTTCAATAGTACTTTGCAGTTTGTTATAAGA
GTTGAAAAGTTATATATATGTTCTTTAAAGTTGTACAATTTCTGTTTCCAACCAAAACTAATTGCTTCTCCAGTTGAAAATTTTGGTCAAGTTATATTGT
AGAGGCTCCCAAAAAGGCAAAATAATCAAGAGCGTCAAACGAGAAAAACACTAGGCAGAAGAATCTATGTCCCTTGCTTTGATCACAAAAGGGTGCAGAG
AAAATGGAGAGTATGTGAATAATCAATGTTTGAAACTTGCATCTACCGACTAACAGAAGGGATGTATTGGGTGAAGAATTAATTTACAGTAAAGCAAAAC
TTCTATCAGAACACTAGTTTCTCAAGTTCTTACCAGTGACCATATGTATGTTGCCATCTCAAATGCATTCTGCATATGATTGAAAGAAGAGCAATCAGTA
AAGCATATCCAAGGACGCTATATCATTGAGCTAAAAATTAGTTGTAATATTCTTCTTGTTACCATTTGGATTCGAGGATAAAAAGATGTTATTGGTCATA
CCTGGAATGATACAAATTGTATTATCCGCAGCAGAAATCTAGGCTTCCCAAACCAGAAGAGCTCATCTCTAAGGTTGAACTGATGAAATCCTTCCAATGG
ACTACTGTCAATGATTTCAACTGCCAGCTTGACCACCACGCGATGAAGCTTGGTACCAACCAAAAGGATTAACTTCCAATAACAATTTTTGACAAAGTCA
GAAATATGAGAACAAATTATTCTTCAGAAGCAAAATGAAAAATGGAACAGCAAATAACAAGGACTTACGATAGCTGGAAAGAAGGAGATCCAAAAGTAGA
TATTTGTGCCTGGACAATGATCATTAAAATTGTACTGAAAAAAGCATTCCGAGGCAGAAATTCCTGATAATATCTAGTAGATAAAAGTTACCATGAAAGC
TTAAAAATACACAAACTATGACGAAAATCCATAGTGGAACACTGCAGACAAGAAAAAGAAAAGGAGTGTCTTAGATGACTGGATCCATAGTAAAATTGTG
CAGTAAAGCCAAAAAAATAGAATATCTTAGATGTCTTTCCATAACCATAGTATCTTACAGTTTGTGAAATATTGCATTTAGTCCTCCAACAGGGACATAT
ATGTCAGCTTTTGTCTTACAGTACCATATAAATGGAAATAAACAACACATCGTATATGCCTAGAGATACGGAAAGCTTTAACTGTTGATCATGACAGTCA
GGAACAGAAAATTGGAATGAGTTATATGAATTCTCATAGAATCTGTTATAAGTACTTACTATAGTTCACGTGGAGCAGCTATTTTTTTACCATGAGATAG
AAAATAACTAATTCTAGTTGAAGGGAAAGATAGGAAGGCCAAGTTATAGATTTAAAACGAAAGGTTCTTGTTGGCGAACATAAAACATAGAAGTAGAACT
TGTTGGTGAAGATAAAATAGAGAAATAGAAAGACAATATTTATACTCCCTCCAAGGAGGGTCAAGAATTCAATCTTAACATCTTTACTGGTTTAACCAAA
CATGATAGCTGTAGCTATTAAGTGGAAACACGGAACTGTAATAAAAAAGAAAACATAAATTGTGTAACCTCAGAACTAGCAATTACATATATCTGTATGA
CTACAGATATTTTATATGGAGTTATTATTGCTCTGGCATCATGTAGGATGATTCATATGTTGGAAGACCTAGTACTGAATGTTACATTGTGACACAAAAG
TTATGTTCAAAACATAAACTTAAACTTCAAATAGACATGTCATTGTACCTTATGCCAACAATATCACGAAATTCTTCCTCCATGCTTCGAAGCATATACT
TATGGAAATCATAAGTTAATGGCAGCTGATGAGTCTGCAAGACCACAATAACAATATAAAGACACGAACTTGTTTTTCTGTCAAAGGGATATATAGAGGT
GTAAATCCTGATATCGCAACAACAACAAATACATTTGGCAGTAGGAAGTCACTGTAATTTTAGATAGCGAGCCCTTTGTTTCATGGATTAGTAAAAATGC
TTCTATTAATAAAGAGAACTTAATCAGTGGAACAACATAGAAGTACCAAAATTAGGGCCTACTTGGTATTTATTCACATCATCTACATAAGTGAATGTTG
TATTAAGTGGTTATTAGCTTAAAGAGTCATTTTCATAAAATAACCAAAATTCAAATATGATTAATAACTGATTTATATTGTTATAAACGGGGGCAGCATG
AAGTCAGCCATAGAAAGTCAGTCAGTCTTCACTTCCAAGTTTAATGACGATTGAGTGAAATATTTGCATTTGTGAAGTATAACAATACATGACTTACAGT
AATAAAACCCAAGCGCAAAGCCATGTAGTCAGCTTCATTTATAGAACTCCAGAACTGGCGGCTGAAACAAAGCTAAAAAGGGAATATGGAATTAAATATC
TTGAATCACTGGACTCATTGCATCACTTGTCAAGACTCAAGAGGTTGTGAAGATTAAAGCATGAAGGTGAAATTTTCGTCAGACGTACATAATGATAAGA
GAAAATTATTAAATTTGATTGATGCCAATACAAGCAGGACATATGAATATGCTTTGATGCACTGGTTTACAATAATTCTTTCTGAATACGTGAATTAAAG
TAACAGCAAATGTAAGACCTAAACATAATTCTACAGTATTGTTAAGATTTGTGACTTGGACCTGAGTGAACAATGATTGTTTGCATAGTCATAGAATTAG
TGAATGACATTGCCGATTAGTATCACCCTAAATCATAGTTTTAGCTGCAAAAGCAACCTTGAATTTGATATTCTATATTAATTTTTAGTTTTTCATCTTC
TTATTGTGTACATGTTAACACTTCTCCCCGCACTTGTCCAGAACAAATGTACACAGTTGTCCAGAACCCTTTTCAATGACTGAGATACCTCCACCACTGG
GCTATGATAACTCCCCTTAAATTGAGATAGAAGAAGCATTTCACATAACAAGGATTCACTCAACCAGATAAACAAGATTCGTCGTGAAATACCAGCCAAA
CAAGAGCTCTGTGCTGGCTCCATGGATGAGTGGTCTGGTGAAAAGTAAAAGTTGATAGACGTCCCATTCTCGTATTGTTTGGGACAGCTTCTTCAGAACC
TAAGGTTAAACTTGCAAGTAAGTGTCCTGGAAATGATAAATAAAGTATGAAGAATAGTAGTATGGCTGGAAATTTTAGCACCTTCTAGTCTTTGAAGAGC
AATCGACTTGGCATAGTTCTCCCATGTTCTCCAGCTATATATCTGCATGGTTAATTCATGTTTCTTGATGGATTTGAGAAGAAAGTTTTGAGATGTAATA
AGAGGTTAATCATGAAGAAGATATCCAACCTTGATCATTGCCAGGGCAATGGCAAAAAAGCTATACGATACATGGCTAACACCGAGGACAAGCAAAAAGC
GATGGAGCTGCTCCAGGCTCTCCTTCGAAGCAAACGATTGGAGACCCTGGTAAAATCAACATGAGTGTTCTCTGCTCATATGAATCCAGTACAAGCCCTG
GCCACTTTACTAAAGCAATTTGAAACTTGCAAAGAGAATTAAATGAAATGAGAAAATGTGAGAGAACTTCCTTTCTTTTTTCTTCCTAAAGACAAGCTTC
ACTAGTTGCCTGACCTAGGGAGTCCGGAGGAGTCTTTGTCTAAATGAGTCCTATTTTCAAGTTCAAGGCACGTTAAACTTCCAAAAAAATTTGCTTCTTA
GCGCGACCAATCTTGTAATTGATGAGTATTAGATGTAGTAATATCATGGAACTTCACTGGACGAAAACATTTGACTATAAATTATGCTACATTTAGGATT
TACATAGAACAATCTCATGTGACAAATTTTAGCTTACAACAATAGACTAGAGATTCCACGGTAGCATTAGTTATTTTCAGTTGATGATAGCTTGTGACAG
ATCAACCAAAAACTGTTAAAAGTAAATGTCAGATTAAATTTTGAGTGGAACATTCATTACTGGGCTACCTCAGGACAAAAATCTTCATGTCCACTGCTTA
ACAGTAGCCTTGATGTTGAGAAATTCGAGTATGAAGAACCTGATAAAGCAAATCTTGTAATTGCTGACTTCATCTTGTTTCTTGGCGGAGAACAGGGATA
AAAGTGGCTGCTCACTGCTGACGATTTGACACAAATCTTTGCAATATAAACGATCCAATGACCCATAAGCAGTGAGAGCAGTCCAAAAACCATAAGCTCT
GCTTGCCGCACAAAAAAAGGGAAGAGAAAGCAAAACAAATGAGTTCATCAAGCAATCATAAATTGTAGTGGAATGGATAGGATCCCTCCACTTTAGCGCA
AAAAAGCAGTAGCGTTTAGAAGAACCAACACCACCTGTTTAGGTTTTATTAGACTGGAGGTGTAAGTTCTGACATCAACAGCTTTAGCTCAAACTCTATA
TTTGTGTTTAAGAACACACTTAATATGTACAATTTTCTATAACCGATAACTCTATTCCTACTTATTTCCATATAGTATATTCGACGTTCAAGTAAAAAAT
TATCTGCAGAAACCTTCTATATATGCAGTGATCAAGAAAGACTCAATATACAGATGATTAATAGGTGGCTTACCTTCCTTGATTTTCTCTAGTGCAGCAT
ACAGAGGTTCCCTCTTTGTCCTATGCAACCACTATAACAACAAAACACATAAGTCAACAGAAAATTTTTCACTTCCAAGAAAGATAGTCTTTTTTTCCTT
ACCTTTCCAAACTTCTTCAAACTTCCATGGATCAAGAAACCAATGCTCACCAGAACAGCTACGACTGTTGCCACGGCCCATGTTGGTGTTTCAGCAAACG
ACGCCCCTTCCAAATTACCCATCTTGACAAATAAGTAAAGTATGCAACAACCTTTAGAAAACTACATAAACCTTATTTACATCATCTTCTTGAAACAGAA
CAATTTGTGTTGCAGAAAGATGGAATTTTTTTCAAGTGCAAAAACTGCAGCAATGACTTATCATTAGTATTCATCAGCTGGATTTGGTTGGCAACTTCAT
AGTCATAGTGATGAACATTTAGTAAGGCCATGGGGTGTTACAAAACATAATGGTCCCATGTGAAATGCCTGATGCAAATCTTTAGGCTATATGTTGTATA
ACCAATTGGCATTCTGACCATCCTTGTTCTGCTATAAATGCCCGCCACACCTATGTTGTAGTAATTACAGTTTTTCCTCTTTTCTTAAAAATCATATTAC
CTAGGTTTAGGCACATGAAAAAAAAAAAAAAAAATCTTGATTGTAGCTATTGAAATTTGAACGCTTTTATTCAAAGATTTTCGCCCACTCTCATAGTTGG
AGCTATGGGTGTCACGGGTTTAGTTTGGATCGGTTATTAGTTGTTTTAAAATTATTAAAATCAAATATAATATATATTTATTGATTCGGTGGTTATCAAT
TTTGATTTGGTATGGTTCTCTTGCTAGATTATTAACCATATATAAAAATTAAAAAAAAAAACAATTCATTCAAAATATGACTTAAATTACTCAATCACTA
AATTTACTCTCTAAAACTTTAAAATTCCCTATATTGGCCTAGAAGTAAGAGAAAATAACATTGTCAGTCCCATAAAGAATTGTTGTAGATACTAATATAC
ATGAATAAATGTTTTCATCTTGAACATTTTTGCTTTTAATAATGAAATTTTAATGAATATACAGATCTTTAAAATTGTTTATAAAAATAATATATTAAAT
ATGTATATTAATAAAATATATATATAATTCATCGTTTTGGCTCGGTTATTTCTTCAATTTGTATGAATAAAATCATAACCAAATTAAATACTATCGATTT
TCAAAAATCTAAAATAATCAAATTAAACACAATAAATTTATTTTATTTTTATCGATTTGGTTCAATTTTTCGATTTGGATTGATTTTTATCCAAACCGCG
AACAACCTTAATTGGAGCTACCATATGATGTTTGGGTTCACGTTGTTCGAATTTAAATAACACACTTCATTCGATTTATATGATACACTTCCTATTTTTT
TTAATTGACAAATATTTTACTCAGATCCTACATATTTTGGAAAAAGTCACAAAAAGTCCAACTTCAACTGTGTTTTGGAACGTCGCGAAGTCTTGCATAT
TTCCTAAACCTAGTGCAGATCTGATCAGTCAAACTACATTACATAAATTAAAAACTAGAGCAATAATTCCTACCAAAACATAAAATATAATAGTATATAT
ATTATTAATTTAAAATTTTGCAAGAATTATAAACTTTAAATTTAAATTCATTTATGCCTTCTTTATTAGTGTTTTCGTCAACATTGACCCAGTCTGGTTT
AGACCATAAAATTGTTCTTTTTTTTTGTAAGAGTTGTCGTATTGTTGGGGAGGTTGGTTTCTATGTTCTTCCAACAATGGAGTAACACAATGCATCATAC
AAACACAATCAACCTAAAATTGCATCAGCACTTTCAAGGTGTCACAGCTCAAACGTTGTGCTAAAATTTTGTTAGAAAGAATAATGTAGCCATGGTAAAA
CGTTTGAAGTTGTAGAATTGACTTGTGTAAACTTCGATTAATTTTAAGAAATTATTATTAACTCCTATCAACACAATATTCACTTTGGTTAATCTTTGAA
CAAATAAAACAAATCAACTACTACTTTTTTTTCCCACAATAATCTAAAATCTTTGTTATTTTAAGGAATTGTGACAATCTTTAGTTCCCACATGCTCCCT
CACGCCTATTTATGGGGTGTGGGTCTTGCTGGTTATCACGCTATATGTTTACTGACACTAGTTGTAGCAGTTAAACATAGACAAAAGTATTATTCCCTCG
ATCCATTTAAATAAATTTTATTTTGGTCCATTCACGTAGTTAAGAAAATATGATTATCTTTTTCTCATTTTGTTCATGTTTTAGATAAGTATATCTTTTT
GTAATCTATAGTATTTTTTTTTCATATTTACTTGTCGTGTTTAATTTTTTTCACATTCATTAAAAAAATAATTATTGATATAAATATTTTACCAAAAAAT
TTCTTTTCATTGAAATTTAGTATTACTATGTCAAAAGTGGTAAGCGAGCTATAAAATTTTTAACAAAATTATTTAAAATTTTTTTTAAAAAACACACGAA
CTAACTGAATGAATTCAATATCTATTATCTATATAAAAGATTAATTCTAAACATGTATGAGTAGTAATATTATACGTTGGCTGGCTCTGCCCTGATGATA
AATAAAAGCAAAACTTTATTTTAAAATTAAAAGTGATTGGGAGAATACTATTTAATTAAAAGAAGTAGGAATGGTAATAGATTTATGACTGGACGGATGG
CGTACTCGGTATAAATAAATTTAAAAAAGATGAATTATGTGCCGGCGAAATTTAACAAGTGCATTAAATAATTGCATAATGTAAACAAATTAATGACGGT
ACTATTTTATTAACAATAATTTAAGCTTATCATTCTAGAGGGCTTATTTGGCAGTTGAGAATTTATAGAAAGGTAGAGGAACAGCTTTAGTAGTTGGAGT
TCTGACGTAAAAAACAAATTCAGTTTATAAAAGTAAATTTGTACAACTACTCAAAAGTATTTATTTTTCTTTAAAATTTAATCTAACATCTTGCTTCTGA
AAAAATAAAACATTTTTTACTACTACTCTAGTAAACATTCCGTATAGCGTCCGCAATCTAAAAAAATGTAGCGGTCAAAGATCAGACGTTGTGCAATTCT
TTTGTTTACATCTAATATCGGGATAAATGCGAAATCAGAACTTGAAGATGATGAATATACAATTAAAATTAAATACATGTTAAAATAAAACTAATGTACT
TACATATAAATATGAATTAAAAAAAGTTCATTTTGCCTCGTGAAGTCTTAAATTCAAAATTAGCTAGCTTCTTTCGTTTAATATTTTTAAGGTTCAAATA
AAAAAGTTACTAAAATTTAAATGAAAAGACGTGATGCACCACACGTGATCCCGTGGATTCGCCTCACGTGGGTGGACAAATAGAGAAAATACATGCTTGA
TTCTAATGAACAATTTATTGGTAGGTGGTTAATTTGTTTACAGTTGATCTCCAGCAAAACTGCTGCAATTAAGGTGATCAAAGCTCATCTTGTGGTTTGT
TTACAGCAAATCCATTCTCCACCCAAGCCAGATACCCACCTCCCATGTTGCTCGCGTGCTTGAATTCCTACCAATTTCATCATATCATATTGTTTATTTT
ACCAAAAATCACATAATTGTATAACCAGATAGAAAAGAAAAAAAAGGAGAGACAATTCAACTTACAGCATTAACAAGATCAGTAGTAGCATACAGGGACC
TCACACCACTTTGACATCCCTGAATGATTACCCATCAAATTACATACGTAACATTTATCTTGGGAAATAAACAATACAATTATAATTAGATGTATTACCA
CAATTAGTTTTTCTTCTTTGTCGCACGCTGAAGATACCTGCTCCATAAATTTTGGATTCTTCACCCTACCTAAAATCACCAAAATATCATTCATTTTACC
TAATTTGGAAATAAAGATACAAACACAAAAGAAAGAGGAGAGACCTTGTGGAGTATTAAACATATAGGGAATATTCAAAGAGTTGTGTACATGCCCTTTC
TTATATTCTTCTTCTGTCCTGTTCAATATGAATTGAATGAAAATCAGATCAGATTTCAACTTTCATATTTGAAGAAAAAATATTAATCGTTAATATTTTT
ACCGAACATCAACATAACGGTATCCAGATTGGATGAGTTGACGAGCTGCATGAACATCTACTGTAACAACCTCTGCTCCTGAGCTACAAAACAGAAGCAG
AACAACAAAAAGAAGAGACATAATACCATTACCCATAATTAATTGAAGTAACAAATTGTGAATATAAAGAATTTTGTTCTATTGTACCCAAGTTGACTTG
TTGCCATGACAATAAATGGAAGTTGTACTTTTATACAAGATTTTTTTTTCAAAAGAGAAACTTTGACTTCAGTAAATGCTGTTGAATCTATTGGCGTTTT
CGATTGTTTTGAGGATGAAAATTAATTGGCATCTGGAACAGAGAAGCCAGTGGATTTTGATTTTGCCGTCTGTTGTTTACGGCACTATGTTTCGTGCGTT
TTAGGCTACTGACGCTGTGGCACAAAAATTAATATGAGCAAATGGGCCATTTTGTAGAGCCCGTCAAAGTCTTAACCAGAAAGTCTTTCGTGGATAATGT
CAAATGACAAATTTTTTTTAAATATATATAATATTTTTTATTTTAAAATAAATTGATATTTTTTTTTTATTTTTCAATTAAAATGTTAAAAAGATAAAAT
AACATGATAAAAAGATTTTTCCTTTTTATCAAACAAGTCATCTTTTAAGGTGTGTTCAGTGAGAAGGAAAATGTTTTTTTCACGGTTAGTTTTTTAATTT
ATTTTTCTTGTGTCTAAGAAAGGGTTTAGTAGCGCAGTCACATATCGTCAAGGGTGTCCAATTCGTCGAAAAAACTTAGCATATATATAAGTGAAATAAT
ATATCAAACAATTAAATAATATATTTTCGACATTCTTAACATAATAAGTTGTTATTTCTAGACACACTTTAAAGAAATATTGACTTCACCATTGGGTGGA
TTGACACGTGAACAAGGCATGTCAATGTGGAATGAACAGAGATGAAAGTAACTCCATAAAAAATGCATTTCAACTAAAATAGGCAATCCCTCCATCTCTT
AAAATAGAGAGATGGCTTTAACGTGTCAAATTTGAAACTAACTTTATAGTCGACTTAATATATAAAACAAGCTTTATGTAGTGCACTCTGACTAGAATGA
CAAGTTTATGTGTTTTAATATATGTTATTTTTTCGTATTTCTTCAGTTTATAGTAAAATTTAGTGGACGCTTTTTCTTCTCTCTAAATTGAGTGGAAGAC
AAGTTGGATAATGAAAAAGCTTCTGCTGAATTTTATTGGGGTCGAACAGAACACAAGCGGCCTATAAACGTTCAGTGGGCTTTTGTCTAATTTACCCAAA
ATGTTCATTTTCATGTAATCATTTTTTTCTCTCAACATTACACGTATAAATAAAGATATACTAATTAATTAGTTAATAAAGTCATAGTTTGTCAAATTAT
AATCTATGATCTACTTTTAGTTATAATTATGCGGCTCAACTTTTTAGTTTTGTATACTTCGCACATTTGTACAATTTAAAATTTGTATAATATAATTTAT
ACAACTTTTATATAATTCAGAATTTGTATAAGCATTTTCACTTATGATGTTTGTAAATGTATAAATTTGTTGTTTCGAGTTTTGTACAAAAATAACTGAA
TTATACAAATGTACCTGCAAATTATATAAATATGCAAATCCACGAATTAGACAAACGAGACAGCTTATACTATAACTACAACATGTAAATATACAAAGAA
TAAGCATAACTAAATTTATTATGATGGCTATTTGCGAAACTTTCCACGGAGGATTTTTGGAAATCTTTGCCATAAAATGTTTTTTTTCTGATTGGAACGG
TAGCTCCGGTATTTGTATAACAGAAAGCGTTTGTATATCTTTATCAAACAATCTTATTAAATTATCATCAAGCAAGAAGAAATATGACACAACCGTTAGC
GAGCATGAATATAGAAGGAATAGATCCTTAATTGGCCAAACGTGCCTCTCTCAAAGATGATATGTATTTTGTTTCGAAAGATAATAAATACACCAAATTT
TTTATTCCATCTTTAAGATAAATAAATTGTTTATGATAAATCAAAAGCAAACAACTTCTTCTCTTTATCTTAAAACAAAACCGATCGTTCCCCTTGTTGA
TTTCTTTCCCCAAAATTTCACAATCCTAGTTAACTGATTGGTATAACCAAGTGAAAAAAATCTACAAGTTGTTGGGTTTGAAGGAAAAGTAACCTGCATT
TGGTTTAATCTGTTAGAAACCACAGTAGTTAGGGTTTGATACTGGAAGTGCAACAACTTGTTAAAAAAAGAAATGTGTACTACCACTTATAATAAACATG
ACTATATTTATTGATCCTAAACCCAAAAGATAACGAACTATTTTGGGTGTGGATATTTCAAAGTCTTGTGCATTTTGCATTGTTGGCCCACTATGTTTTA
CATTTTGTTGTGAAAAAATAATTGAGGAGTTGACCAATTTCTTTATCTTCAAAAGATGGAATAAAGTTGGTGTATTTATTATCTTTATACCAATTTGGGG
AAAAATCTCAGCAATGAATGATACCGAATCGGAAATCTCAGCTCTACTAAGTAAGCATTCCACTCCATTTTATTTTCCCAATAACTCTACTTAATTTCAC
TATTCTCAAACACAAACATCACATTAATTTGCAGTTCAAACAGATCAACTACTCCATTGCAACAGTACTGCTGATGATGATAATGATGACTCTCCAGTTG
AACAAGTTGCACTCACCGTCCCCATCACCGACGATCCTACTTTGCCGGTGGTTACTTTTCGCATGTGGCTTCTCGGCACTATCGCTTGTATCCTACTCTC
ATTCCTCAACCAATTCTTCTGGTACCGCAATGAACCGCTCACCATCACCTCTATCTCCGCCCAAATTGCGGTGGTTCCGTTAGGCCACCTCATGGCCAAG
GGTATTACTGACCGAGTTTTCTTCCAAGGAAGCAAGTGGGAATTCACACTGAATCCTGGCCCATTCAACGTGAAAGAGCACGTGCTTATCACGATCTTCG
CTAATTCCGGCGCCGGGAACCCGTATGCGATTCACGTGGTTAGCGCCGTGAAGTTGTTCTACAAGCACAAGTTGACTTTTCGGGTGGCGTTGATCGTCAT
TATTACCACGCAAGTGTTGGGATTTGGTTGGGCTGGGATTTTCCGACGGTATTTGGTAGAGCCGGCAGCCATGTGGTGGCCCCAAAATCTCGTTCAGGTC
TCCATATTCAGGTATGGCCACTATTAAAACAAAATGACAAGAGATAGTTGAATTGAATAGATGCACAGCTAAATTTATGTGGCGCGTTTAATTGCTTATG
AATTGTGTCGGCGGTACGTGAGCGGTGACCCACGTATCTTTTTACTTTAAAAATTATACGGAAAAGGGTTGAAATTGTCCTTAACTATACGAAATAGATT
ATTTATATTTTTATTATATTTTGAGATAAAAAATATCCGATAATTTACGAGATCTCAAGAGTTAACACCTCAATTTTTTAGTGATGTGATATGCCTCATG
AGACTGATACCTTCACCTAAGTGTTGACAATTAAGATTCACTGTAAAGAACTTGACATTTAGTGACAATAAAGTTGCCACAAAATTTCAAAATATTGTCA
CTAAAGGTTATGAGTAATTTTTAGCCACGACTAAAGCTCCAACAACCATTCGCTAACAAAATCAATTTTTTCAACAAAAAAAAACATGATAATTAATTTT
TGATTGCAACTTATTTTTTATTAAAGACACTCAATATTATTACAAAAAATCATAAAAATTACTTCTGGATTCACATCTACTACTATATAATTCATCATTG
TAGATTTTATACCTATATATATAACATAAAGATAAAACGTACAATGTCTTCAAACTCCTATTTAATCAAATATCATTTTTATTTTTTAAAAACAATGAAA
AAAACCCATCAAATTAGATAATGTTAAAAAAATTTATTGACGATTTTTCAGGCTTTTGTGGCGACTATTGTCGCTGCTAAAGTTCTAGTTCTTTTGTAGT
GAATCCTAGTTGGCAACGCTTAAGTGGAGGGATTAGTCTCATGTGACATTGCCACATTACTAAAAAATTGGGGTGTTAACTCTTGAGGATATTTGTAGTC
TCTTAGGATAACGGCGGGGGAATTCTTGATCCCAAAATGTATAAGTGATCTATTTCACATAGTTCAGAAACAATTTTGATCCTTTTCCGAAAATATAATA
TTGCTCACTCTCTTTACTTCTATTTATCTATTGATTCAAAAACAATTTTTTTCTACTTCGATTTGTTATTTTAGCATATGAAAAAATTATATATTTTCTC
TTACTCTTAATAAACTAATTATCTTAATCATTTTTTAAAATTTAGTATTTACTTCATTTCATTTTGTGTGGCTTTATTTATCTTTGATATGATATTTAAA
ATAATAATCATGTTTATTATTATTTTAATGGATTAACTAAATTCAAATATGACAAGTTAAAGTAAAAAAAAGGAGTATCTTTTTATAACTATAAATATCT
CGGTTTTTAATTTTTCCTCTTACTATTTAGTCAGAATTATGCAAGTATTTAGTAAATATAAAATTGTTATGAGATAATTTATGTAATTATCATTTTATAT
AGAATTTCTCATTTTATCATACATAAAATAATACTACATAAATTTCTTTTAACTTATAGATCTATGCTTACTTTTAAATAGCAAATCAAATATAATATTA
ATTTTATAAACGAATAATTTACCTCCTAATTAGATACTAAACATGATATTACTTTGTGATTCAGTACACCTACATAATTCACCTCTAGGTTAGCTACTAG
GATTTAGTATCTAAGATTTGTTTTTGATTACAGATTAGCGGTTGTTTCTTTTTAAAATTTTGTGGTTGGTAAAATCTATCACATATATAAATAGATAAAA
GAAGAAGTAAACCAAAATAAATTATAAATAAGGTGCGATTAATAAATCATAAATATGATGTGATTATAAATTATATTATTAGATAATTTTGATGTCTAGT
CAAATATGATCACACAAAATTTAAACACAAGGTGTAATGTTAGAAAAAATAGTAACTATAATGATATTATAAATTATGTCATCTGAGATCAAATTAAAAT
TAAATTATTTTAAATTAAATAGTACCTTATATTGAAACAAATTCTTACCAAAAAAAAAAAAAGTGTGACATAGATAATAGTAAGTAGCGTTCCCAGAAGG
AAAAATATAGCACATTCATGCTTGCAAGTCTTTACAAGAAAAAATAAAGTTTCCATCATTATTATGAAAATACATAAACTCTTTTTTCTTCAATTGATAT
ACATTTCCGTATCAACTGTTATTGAATAATTAGTAAGCTATTAAATTCATTTCAATTGATATTTTTCCTTTCCCTGCCGCCAATTTCAAACCAAAAAGGT
TAGTTTTGTCATTTTAAAATTTAATCCACGTATTATTATATACATTTTTATTTCATACTCTATTCCGCACAAACTAAGATATATATCGCATAATTTATAC
ACATATTGCATTTTGGTTTATGATATCATAATTTAATATTTGTTAATTTTAATAGTAATTTTTATATAGATAAATATAATCATGTCGAAAATGTTGATTC
GTTAAACTGAACATGTTACCTTTGATTTGGTTTGATTTGATTTTTTTATCCTTTTTTGAACACTCACCACTGCTTTAATATTTTTCCTTCCAATGGCAGG
GCCCTTCATGATAAAGAAGAGAGACCCAAGAATGGAGTGACAAGAAACCAATTTTTCCTCATTGCCTTTATCTGCAGCTTTGGTTACTACGTCTTTCCAG
GTTATCTTTTTCCAATGCTAAGTTCCGTTTCTTGGCTGTGTTTATTGTTCCCTTCCTCTGTCCTAGTCCAACAGTTGGGTTCAGGGCTTCATGGTCTTGG
AGTAGGCACCATTGGGTTCGATTGGTCCACCATATCCTCCTATCTTGGGAGCCCACTAGCTAGCCCATGGTTTGCAACTGCAAACATTGCTGTTGGTTAT
TTTCTCATTATGTATGTTGTTACACCTCTCATGTACTGGTTCAATGTCTACAAGGCCAGAAACTTCCCAATATTCTCGGATGGCTTGTTTAAAGAAAAAC
GGTCATGATTACAACATTTCAAACATCATAGACCCTAACTTTCACATTGATTTAGAGAAGTATGACCACGAGGGTCGTCTTTATCTCAGCATTGTCCTTT
TACTAACTTATGGATTCAGCTTTGCCTGCCTCACTGCCACGGTTGTTCATGTCTTCCTCTTTCATGGATGGTAAGCTTCATACTTTACTGTTATAGGGGA
TAAAATTCAGTATTTTAATGTGGCAATAGTTTTCAGACTAGAAAAGTTTAGTGCATAATGTTTAGTAACCATTAGTGAATGTAACCCCTGCCTTGATGTA
TAGAATGGAAGCACCACTTGACTAGTTATAGTGGTGCAGGGATCTATGGCATCTCAGCAAGTCTGCTTTACAGGAAAAGAAAATGGACGTGCACACGAAG
CTCATGAGAAAATACAAGCAACTTCCTGAATGGTGGTTCACGATTATACTACTAATAAATATTATAGCAACTGTATTTGTATGTGAATATTACAAAAACC
AGCTTCAATTACCATGGTGGGGTGTTTTGTTAGCATGTGGCCTGGCGTTCTTTTTCACCCTCCCAATTGGAGTCATTACTGCTACCACAAATCAAGTAAG
CACATATTTAATTTTCAGTAAAATAACAGCTTGAGATCATCAATAGCTACAGTTTTTGTCCAAATACTCACTATCGGATTTAGTTAAAATTATAGCTTGG
TGTCAGTGTTGTGAGTTGCTTTCTTCATTTGGCAACTCTGATGTTCCACGATCTTTGTTGCTCAGACACCTGGTTTGAATGTGATCACGGAGTACATAAT
GGGATACTTGTATCCAGGATATCCAGTTGCTAATATGTGCTTCAAGGTGTATGGCTATATCAGTATGAAGCAAGGTTTAACCTTCCTGCAAGACTTAAAA
CTTGGACATTATATGAAGATTCCTCCAAGGGCAATGTTCGTGGCTCAGGTTAGTTTTCTTAATCTTTTGGCATAGAGAAGTAACAGAGTTCTGCAAATTG
AAAAGCTTGGTTGGAAAAAGGTGTTATCCATGTTTTAGGTGTACAACTATAAAGACCTGTCACAAATCTGTTTTTTTTTTGGATTTTTTATTCAGGTAGT
TGGAACCTTAATATCAGCGTTTGCACATCTGGGAACAGCATGGTGGCTAATGGACTCTGTCCCATATATTTGCAATAGGGCTCTGCTTCCTCAAGGCAGT
CCATGGACATGCCCAGCTGATCATGTATTCTATGATGCCTCAGTTGTCTGGGGTCTAATTGGGTCACAGAGAATTTTTGGAAATCTTGGCTATTACTCAG
CCATAAATTGGTTTTTTCTGATTGGCGCTATAGCTCCTGTATTTGTTTGGCTGTTACAGAAAGCTTTCCCAAACCATCACTGGATTAGATTGATGTCGGT
GCCTGTGGTATTAGCCGGAATAATTAAAATACCACCTGCTACTGCTGTCAACTACAACAGTTGGATCATTATTGCATTAGTTTCAGGATTTGTTGTATAT
CGATACTACAAGAGTTGGTGGAGTCGTCACAATTATGTTTTATCTGGGGCATTAGATGCCGGATTAACATTCATGGGAGTATTATTGTATTTGTGCTTAG
GACAGGAGCATGTTAGCCTTCAGTGGTGGGGAAGTCATACAGATACATGCCCTTTGGCTTCTTGTCCAACTGCTAAAGGGATTGTGGTTGACGGGTGTCC
TATATTTTAAGCAGATTTGCTGCAGGATATGTGGTGAAGGCCATGGTTCCATCAACGTAGTTCGTCTGGTCATGTCTGTCCCCACTGTTACAAGACTTCT
GTTTGTGATCATGGCTCTTGCTTGAGTCGACAGGTTCCTAGGACGTGCCATTAGCAGCAAGAATTGGAGGACTCTATGTAAAAAGTTTTATGATTAGTCC
AAGATGTCACAAACTTGTGCCAGAAAATCATGACTCAAGAAAATGCTCCTCCACCTCCTGTGATGAAGTTAGAACTGTTTTGGGACACATACAATACTGT
ATAATATTTTCATTGTTGATGAATCTCCTTCATGTACGCAAAAAAAAAAAAAACATTATACTTAGCAATTTTCCTCAATATTTTAATTAATTTTCTCCTC
TCCGCTATTTGGGTAAGGAAGATAACAAGTGTAACACCATCTCTACGGCTGAAAGTGATCTGAGTTACACAGGAAAGAGTCATTGAACTTGGATGTGGAT
TAGCTATTGCAATGTCAACAGAAGAAATAGAAGTTATATAAGATGGAAATCCTCAAGTAGCTGGTTGTATCCTTTTCATCCAATTGCTAGATGAGTCTAA
TAATAACACTAAGTTTTGCTACTGTATGCTTTTCTGATTCCTTTCTTTCTTCCAACTTTTTCGGTTCATCAGTATATGTCCAGCTGCATATGAAAGAATT
ACAGCTGCTTTCCCACTCCCTTTGATTATCATATACATAAAAGCATCTTCTCTTATATTCCTGGGGGACCATCCATAAATCAGGAAGAACAAGCAGAAAG
GCTAGTTATTGCTAATGGTTCCTCGTAATATTTGAAGAAAAACAATTTGGATTCGAATTGAAGGACAATTGAACTTCACATCTTAACTTAAATACAAGCA
CCATTTAGTTTCTTTCTTACATTCACTGAAAGGATGAGTCACTTTAGTTCAGCAAGTAGGCCACAAGTCAGAGTTTCTCTAGCAGTGTATATATGGATTT
TAATATCCTCAGTTCATCAACTCAACTATTTGTCAAGGTGGCTGTTGCTGGATATTGGGATACAATATGCAGATGAGATTATATTACTTCTATGATTCTG
ATCACTATTGAAATACCCTATTCGTCGTTGTATTGTTGTTCTGAATCTTGCTAATGTGTGGCTAGCCTCAGTGCAAGAACTAGGTGGAAATTTTTTTTGA
CTAATGACTTAGAGAGCTTTTCCCAGGATCCTGAAGAATTATATTGAACAAGCAAATTAAAGATTTAGATGGTGGCATGGGAATGTATAGAAAAGGTGAA
ATGTGTGGTACCACTGAAAAAGAGTGAAGAAGGTACTATAGATGCTAGGGTGTCATTTTCTTCATAAAAAAGATAAACCACTTTCTCATGTTTTCTTGAC
ATTGTTTGGTGTACCCAAGTTGGCTAAGGAATATTTTCTCAACACATCAGCCTACCTTGAGTCTTTTCTGTCTATTTTCAGTGGCTAATCATTGTCCCAA
AGTATATTTGTATTGATAATCATTGTTGTTTTTTAGTGCCTAATACTCTTCTTGTGCAATGTGAGTGCTCAATGAAGAACAGCCACACAACTTGTTTTAG
TTTTTCTTTTTATCACTAATATGAATTATTTAATGAATGGCCCTCAGATTTCAGAAACTAATGATTTAAGATGCATTATTTTATGAAAATTATGGAACAG
AGAAGGCCAAAATTCTAGCTAGTTTTTGCCATTGGCTGATGAATTTGCCAAGCTTATCTAGACAGCTTTCATCAGGCCAATTTTTTTTAAAAAAATTATA
GCATCTTCTGCTATCACATTGTAAGGTGTGGATCTATGCATCTATCTAATAATCATCCTCTTTGGTATGGAAGCAACTAGTGAAGATATTTGTCTAGACA
TACAGTAGTTGATTACTATAACTCCGTCTCGCTCAAATATATAGGTTTGATTGAACATAAAGATTTTTTAAACTTATGATTTATAATAAAATAATATAGA
TATTTATTAAATTGTCAGTGTCGTGACGAGACAAGGTAATAATAATAATACATGGTTAAGGTGATTGGATCGGCATTCTAAGCTTGTTAATTATGTTGGG
TGAGCTTCCAGATGCCTCCAAGCTGCAAGTGAAAATCTTGGTGATAATTCTGTAGCTGAAAAAAATAATTCCTATGGACTCACCTCTCATTTTCCTACAA
GTGTGCATTTGGAATCTGTATTGTTAATTGACAATATCTCTCTAGTGCCACAAATCCGAAAAAAATCTTTCAAAAGGAAATGAAAATATCTTCATAAATT
CTGTATACTATCAAATATCAATTCAACAAAAAGAGTAACTGCTAGCCTGGTAGCTACCTATAAAAAAAATTAATGTGAAAAGATGGAAATATCTTTTAAA
AGTTAACCGAGCAGTTTGATTTTTTTATACTACTACTACTTTCTTTCATTAGTCAAAAAGGTATTTGAAAGCTAAAATATCTTCTTATCATGATAATTTC
CCTTTTGCTTACACTAAATAATTTTTAAAAAAAAGAACAAATGCTTCCATAAAGTTTATACGCCGCGCAAAGGACGACGTTGCCCACTAATTATTTTGGC
TATCTAATTACTAATAATTGTGTTTGTTTTATTTTAATGTTTTCAATGGAAGAATGATGGATTCACAAGAATAATTGCACTTCCAATTGACCGTTGGTTG
GAAATTGCACAAAGGTAAAAAGTAAAGTGAGAAAGGCAGCCAAAAAATTATTCCCTAATAAAAAAATTGGGAGATTCCCTCAAATTGGAGTTTATCAGGT
GTAAAATAATAGTGTGCTTAAACATGATATGTAGGTACAAAATAACATACTTCTTTAATTATATATTATATGAAATGGGATGAAGAGAGGTGTGTTACTA
TCCAATTAATTGTTTGCATATTGATATTTTTTTCAACAAAGCAGAATAGAAGTCATTATTCAATAGGCAAAAGTTAAAATATCTAAACAGCCTTCACAAT
TATGTAAATAGAACAATTAGCTATTTTCGCAATCTGGTAATATCATCCATCAACAAGAATTATTATAAAATTCTACTAGTATAAGAAAGGGGTAAACCAT
GGTCTAACTGTTCATGGATCTGAGTTCTTCCAACTGTGCCTTTATTTGATCTTGAACAAGCTCTAATCTCTTTGAATAAACTTCCAATTCCAGAATCTGT
TGCTTCCTCCATTTCTCATCCGTCTTCATATTGATATCACAGCTCATTAAACTGTTCCCAAATCCTACTAAAGGGGATGGACCCAATGACATTCCGAACC
CAGAATATCTAGATCCATTCAAATTGTTAAACAATTCCTTGAAAATGGGTGATAGACAGCTCCTCACAGTTTCCTCGATCAAACTAGGAATTGAAGCTGC
AGCTGTAGCTGTGGCTGTGGCCTGGGGGGCGGCCATCGAGACCGGAGTTGGGGGGAGAATGACATTTGTTCCTCCACCAGATGACTGATGATAGTACTGT
TGAATATACCCGGGTTTTTCTTCTCCTCCTCGAGGCCTTTTTTTCGACTTAGAAGTTTTAACATCAAACCCGTTAGGATTAAGATTGAAGTTAGGGGTGT
GATCAATGAAATTTGCGTGGTTAAGGTTGAGATGTGAATCCTCATCATCAAATCCACCATCATCTGCTGGTGGTGGTGGTGGGGGACCACTGCTACGGAC
GACAATTGGTCCGGCATTGCTCCAGATCTTGCGAGAGATCTCGAAGGTGGCTTGATCGTGAGGGCTCTTAAACACAAATTCCTTACCAGATCCCATCTTG
CTCATCACTGTCCGATACTTCTTCTTCAATCTCCTCAGCTTCTCTACTAATTGATTCTTGTTGAAATCCAACTGCAGCTTGTTCTTGATTTGGTCATAGA
ACGCACCTGTATCATGATGATGATGCGAAGATGAATTTATCCCACCGCGCTGGGTTGTGTATTCCAGAAATCCTTGTAACAATTCGATCTCATCTTCATC
CATCCACAGCCGTTGAAAAAGCTTGCGAGAATCATCCAAAACTAAGGGCTTTTTTTCTTCCACAACCATCGTGGCCGGAGTAACGCCGAAATCGTTGATC
CGCTCTCGTTTTGGTTCAATACAAAGTGAATCAGTTGCAGGGACACCGACAACGGCTATAGTAACCTCTCCGGCGACGGAATGGTTCGCAACGGGCACGG
GAGGAGAGGAAGTGGAATCGTCCTCTTCCTCCTCCTCCTCATCGACATCTACGTCGTCATCTTCATCAACAACGGCTTCGTTCTGGGGATGACCGCTCTC
TTCATCATCTTCCTCATCGTCAAGATCATCATCGTTGTAGACGACGGCCTGATCTTCTACGGAAGCCATTTGAG