BAC Sequence – LE_HBa0017C15

>C01HBa0017C15.3
TGTATATATATTTAATTGAATACAATTGGAGAGAGAGGTTGTTATAAAAACAATATATTGTTGTTATTGTTTTTTTTCTTTTGTAATATTTTTGAACTAA
TTCTATCTTTTCATAAATGAGTTAAATTTTTTACTTATTCCATAATTCTTCCATAAATAATTTTTTTTTATTTGGCTATACTTGATATCTATAAATTTTA
ATTTTAATTGTGCATCACTAGATATTGAAATTGTCCAAAGAATGTAACAAATAAACACGTTCAAATATTTTAGGTATTATAAGATTGAAATGCAAACACT
TTTACATGGAATGGATAAAAATAAGGGATAATTGTATATAATAGCAAACTAATAACCTAAAATAAATGGAGTAACTACGGTTTAATTTAATTATGCTCCA
TAGCAAACGTTCGCCAAAGTTTGTCAGTCGCCTCTCTCCCAAAAATCTCGTTCGCCACTCTCCCTCTGCTCGCCTCTCTCGCTTTATACACAGAAGTGTA
TAAATTGTGTTTCTGTTTTGTATGAAGCGGGAAAAAATTGTATATACACATGCAAAAACATATATTTTCGTGCTATACACTTAATTATACAATTTACAAA
CATTTTACTTCAATTCAATTGTAGACAAATGCAAATTTTATACAAATATTGCAGCGAAAAAGGCCAGCGAATTATACAATTGTAGTGAAATACAATTTTC
TCTCGCTTTATACAACAGAAGTGTATATATTGTGTTTCTGTTTTTGTATAAAGCGAGAGAAAAACATATATCTTTTTCCTATACACTTATAATTATGCAA
TATACATACATTTTACTTTGTTTCAATTGTATGCAAAATAAATTTTATCAATGTCTCTTCATGTTATCTCAACAATCAAAAGAAATTAGGAGACATTAAT
CCCAAAATTAACATCTAAACAAAAGCTTATAGTTTCAGATTTTCTATTATTGAATATTATGCATTAAAATTTCGATCATGAATTACAACAAACATGAAAG
GAAAACAACAAGCAACAATAGTATTTGTATTTAAATTTATGTGAAGGCTGCCATCTTTATAAAATCTTTAAGAAAACATATGTGATTCCCTAATTCTTTT
CTTCAGAATTGTTTTTGACTTGATGAAATACTTGCGGCTCAACATTTGAAGCAGACTTGCAGAGTCTTATAGAGACCTCTTTATATATGTTTGAACTAGA
GTTTTGGAGATATTTTGGTCCAAACAATTTTGGCCCTTTGGCTTGAAGAACATGAGTATTTGAGCTCATTTTGTCAACTTGATATATTGGTCCAAATATA
ATTTGCACTTGATTTAAGTCATATAATTTTAAATTAAATATTAATTTAACTTTATTAACCAATAATTTTACTTTCTATGATAAATTTAAGATTTAATATA
AATTTATTAATAAAATTTCATTATCAACAAGATTTAAAATAGACCTGAAAACAGTGAAATTGAAATAATTGTATTATATAGCCAACTCTAACTAGTTAGG
ACATGATTGTGAAATTGAGATATTGGATTCATAGATCCAACTCGAGCTAGTGAACTTTATAATTAGGTATCGTATCTAAGTTAACACAAACTAAAAGCAT
TTATAAATAATTTAGCAAGATTCATATAAGACAAATAATTAAAGATCTTTGTTAATGATATTAAATATTATATTTGAGATATGTATAGCCTTTTGAAAAT
ATATTAATTAATAAACGTATGTTCTTAATTAATATTATAAAAAATAAATTATTTATATTTTTTATTTAGTATATTTTAATTAAATTAATTATTAAAGTTA
AAAGCACATCATGAAATGCGTGTTTGACAAAAAGATTAATATTATAAATATAATATCATAAAATTATAAAAACATTTAACAGAAAGATAATCTATCAAGT
CTAACTAAAAAAAATAGTATGCAACATAAAATATCTGGTCAATACTTCTAAAACAAATGAAATTGAAAATATAACATAAGTTATAAATTTAAAACAAAAA
ATTTAATGTAATACTCTTATATCAAATTCCAACATAACATACCTCAACATGATTTAAAAAAAAAAATATAAGTTCATAACCTTATTCAACAATAAATTCT
ACTCTAATTTAAAAATTAAAATACTAACAAAATTATACTGATAAAAAATTCTTATAGATAATACGAAAAATTATATGAAATCATATGAAGTAATGATTGA
TAATGAGAAGGAAATGAAATATAGATAGTATAAAATATAAATGTATATTTTTAGAAAACAATTAGAATATTAATAAAAATAAAAAAGAATTTAAAATAAT
AAAATAAAAAATAAATTTAAACGAAAAAAATTAGAAATATAAGGAAGAAATAATCAACTTATAATTACACCATTTAATTATTATCAGCAATTCGCAACTC
CTCTATGATTAAAATAATGTAATTATCTCTGTCAATTACGCTCAATTACCTGCTGACCAAGTAATTAAATAGATGACCAACCAAACATGCCATACAATGT
AATTGCACTCAATTATATCAAATCAGCTAGCAAGCTGATTTTCCAAACACACCTTAAAGGTTTTTAGACAAAGCAGAAGAAAGAAATTTTTGTTTCACAT
AAATGGATTCACAAGTGTCTTCGTAAAAAACTACATGTTTCTCAAATGTTCATTCACATTCAAATATGTTTAGATCTCCTAAATACAATTTATGTTATTT
TTGGTATAAATACCCACACGCGCAGACACCCACATGTACACGTACGCGTATATTCGCGCACACTCACCCACGCGCACATACACGCAAACACATACACACA
CAAATGACCCTTTTTTTTTAAAAAAAAACTTATAACTATGTTATTTTTAAAGATTTTTAAAATTTATCAAAACACTCGGAAATGGAGGATAAAATTTGTA
TAGTAGAAGTGAAATAGAAAAAGTTAGTGGAGTTAAAAATCAAAATCTTCTTTTTGTGGGGAAATTAAGTAATTGAAGAATACTTTTGGGGTTGTAAATG
AAAACCTTTTATCTCCTTAAAACTCAAAAATCTTATTTACTTTCCACTCCCTCACCAATCTTTTATTCTCCATTTGTCACTCTTAATTTCCACATCTACA
AACAAACACTGCACTCTCAGCTAGGGTTTCTCTTCCCGACGATTCACCGCCACCGTCGCCGCCCATGGCTGAAGTAATGGACGCTCCGTCGGAAGGTTTA
GAACGCCGCCGTGAACGAAGCAAGGAAAATCCAAACAAGTCGACGGAAGAGCCACCGGTATCTTCTCCACCACCGCCTCCTCCTCCTCCGCCGTCGAGGC
GTGGCCGTGATAGAGATTCACGGGAACGGAGGGATGACAGGGATTTTGATCGTAGAGGTGGTCGTGGGGACTATTACGATCGTAATCGTTCTCCTCCTCA
TCATCCTCCTGGTCGAGAGCGTGACTACAAACGTGGAAGGCCTAGCCATAGCCCTCCTCCTCCTCTTCCTCCTTATCGTGACCGACGTGGTGGATATTCT
CCTCCTCACCGTCGTTCGCCTCCATTTCCACCTTATAAGCGTTCTCGTAGAGATGACTATGATGGACGCCGTGGAAGTCCTAGAGGTGGTTTTGGGCATG
GTGATCGAAGGTAAATTACGAAGCTTTTTCTCCGCATATGATTGGAAATTCTCTTATAAATCTTCGATTATCAGTCTGTTTAGCCAATCAGTGGGATTTC
TTATGGATGGCCGCAGTTAGGTTGTTACTGAGGCATGTTATGGCTATGTAGTAGGATTACATAAATAATTAAGTGGAGGATGGCAGACGCGCAGACTCAT
GATTCACCTTGTTTTAAGCTGAATAATAGTAGATTTTTGGGACCTGGGTGATGAAAGGAAGGAGTAGGAAGAACTTATTTACTATATAATTCAAGCTGAA
AAATAGTAGATTTCTGGGACCTGGGTAGTGAAAGAAAGGAGTAGTAAGAACTTATATACTATAATAAATATGGTGAAATATAGCATTTGTTGGTCCATTA
GTGTGTTGGATTAGTATATGCAACAGCAATACAGTACACTTTCCAGGGCATTACCCATTTCCCCTAAGAAATTGCTATGAGAATGTTTAGGTGCTGACAA
AGGTTATGTTTGGGCTTTTTGAGGGTTCAGTACTATTAGAACAGTGGTGTAAGCTGAAGAAGTTAGCTTCTGTGAGGTACCAGTTTTGGTCCTTCCCATA
ATGCACATATTTTTTGAAAAATGTAGCTTCTCTGAGGTTCCGGTTTTGGTATGGTGTATAATGCTCATATCTGATTACACCTTAATCATGTACTAGATAA
GTTGGTTATATCAATTTCCTACATTTATTCCGCCCACTGTGTCTGTTTCATTCAAATACTAATGGACTCTTTAGTGATGACCGACAAACCTTTTGTTTAG
TTCAAGCTCAATGACATGTTGATGACAGATGCTGCAATTCTGTCTGTCTATGCTAGCAGACATATTAAGGTGCCAACATTGTATGTAAACATGAAATTGG
AGGATGTTTTTTTTTGAGAAGCTATCAAGTTGGATGTATTAAGCACAAAATGGTAGCAAGGAGGAGATACTTCTTCCTACTTGATAGCTAATGCCCTGGG
AGAAGCTGGCCATAGTGCTCTGATTTTTCCAATGTCCGTCTGCCTGCGGCGGCCCTCCTATAATTGAATACCATTCATTCAATTGAAAATGTTTCAATGC
GGTTACCCTCTTCCCTAGTGCACTGTCTTCCAAATTAAATCTGCATAACCATCTCATCGAAAGGCTCGTGTTTTGTGTCCTCAAGTTCTTGATCCCTAAT
CTTCTTCCATTCCTCCCTTTTTTTCTTGATTGATGTGACGGTACTCCATTCGACTTGGAGGAAGTTCTTGAACTTTTTCTACCCTGATGGGTATTGGACA
AAGAGACATAATATAAGATGTCATGGAATTAAGTGACCCAAAGAGAGAGGTATTGTCTCTTCCAGTTAGCCAATGTCTTTTCACATTTCCTTATAACACC
ATGCCAAATAGAATCTGCTACCTGTTTTGCCCCTTAAGTCATCCCCAAGTACTCTGTGGGGAGACTTTCTATTTGACATGCAAGATTGGTAGCCAAAACC
TGCATATTCTGGACTGAATTAACTGTAAACAAGCTGCTTTTGACCAGTTAACATGGTGTACTGATACAGCTTCAGAAGTATTTAGGATCACGTAATTGTT
CGCATAATTACATGAAGGAGTACCATCCACGCCTTTGGGAATATGAATTGCTGTTTTTTTTTAAAATTTTTTTTGGAGTTCTTAATACTCTACTTGCATT
TAACACAGTGCTGTCTAACAGGATTTGTCAGTAAAAAATATGTTGCTGCATACTCTAGTGAACAGAAAACAGCCTGGGTTAAGTTATTTCTAGTGCTAAG
CTTTATAAAATGTAGACAATAATCAACACTCATTTGGAAACCCTATGACCAGAGATCAGTGATGACAGAGTAATCGTAGGAAATAAAAGGATTATATGGA
CTGTAAGTTATGCGTGAAATCCTCCAATTTATATTATTGAGGAGCAAATGGAAATCCGATAAAATTTTTTAGGTCCGCTGCAGCTTTCAAGAAAATTAGT
TGATGTTACGGTTAGGAATTCTCACTCAGACCACTGGTGATCAGGAAAATAGATTCTACAAGCTGTTATTTCACCTCTGTAGAATCTAGGAACCATGGTA
TTATTTTGCTGTATACCTGAAGAGTTGCAGAACAATCTTAGAATCACCTTATAACCTTCATAGCGTAATTGTTCGACTTCATTTTAACTTACCAACTTTT
ATTCTGAAGCTAAAATCATTCACTTTCTTAGGTTTCTAAACATTAGATTAGAGATTACGGAGTGTGTTAGATCTATCAAGCAACCTTTGATATGTTGGTG
CAAGTTTCCTGATGTTAGAGAAATCCAATATGAACACAAAAAACTGTTATCTAAAGATATTTGTATTTTTCTAGCTTACTCTGTAGTGAGTTCTTGCATC
CAATGACATATGGTGATAATTTTTTGATGAAGTAGTGGTATTTCAATTGAAGAACCATCAAGAAGATGCATAATCACAAAAACAGAAATAGAAAAGTACA
TATCAAAGAGTTTGTTATCCTCGTTACAGTGTGTCAGTCCATTCTAGGGAGCTAAGAAAGTTCTAATATCAGCAACTGCTAATTACAGGTGTTAACTTAA
CCAGCTAAAAAGGATAAGCAACATTTTTCCTTGAGAGTGTCATTTGGAGTTGAGAATTTCATAAGATCACGTTTGGTTCTTTTCGCTCCACAAACACCAA
AAAATAACTACAGGAATCATCAACTAAATGTTCTTGATGGGCTTCTCAACTCTCTGTGAACTTCTTCTTTTATAAGTCTCTCTCATATGATGTGGCATGA
CCCAATTCAAACCAAAAATACAGTAAAACATATTCTGCAGTTCAGTGGCCACTGAACAATGTAGGAAAGAAGCGACTGACACTCTCCAGGAGGTTGACTG
CTGGAAGCCTTTTCTGTGAGGGTGTCTTGTGTTAAACATGACCCAGTTAGAATAGTCCAAATTGAAGCATATAACCTTGGTGGGCAATTCAGTTTTCTGT
ATCAGCTTCCATGACCAGAGGTCATTAAACTTATTCAGGATCACATCAATGGTGAACATCTTTATTCTGGCGAACTGCAAACATATCCATTTCCCAACAG
TGTATTGACCTTTTGAGTTGCACTTCTCAATTACTGTCAAGTCTATTTTGTGCAAGGGAGTCCTTACTAAAGAATGACATGCACAGATTAGAACAGATAA
AAGCACGATCAGCCGTTTATTTGTTAAATAAGAACAAAAATATACCTGAGGAAACTAACGAATTTCTGCCTCTTTTTCTTGTCTTTATTTGCACACTTCT
CTAGTCGTCCAAAGTAGCATCATTCATTGTGTTTTCTTTATTATTCATGCTTTTATGGCATTTGTCCTTTTGCATAATTCTTGTCTTGCAATTTTTTTGC
ATTTACAAATCTGATCTTTTCTGTTGTCAAATTATCTTGCAAGTGTTCTTATGATGGTGCTTACGAAATCTTCTTGATATTGCAGATATGGTTATGACCA
TCAAGGAGGTTATGACCGTGAGATGGGGGGTAGACCTGGTTATCCTGATGAGAGGCATCATGGACGATTTGCAGGACGCTCGTCTGGTGGCTATCGAGGA
GGAGGTCAGTCTCATTTATATTTTACTCTCATGGAGTATCTGCTATCAGTGGGCGTGTTAAATGTGTAGTGTTTCTGCTTTGTAAAGTCTTAACTTCTAT
TTGAGTAATATGTGTTTTTGGGGTGCTTTATGTAAATATTCGTTGCTCTATAGGATTTGTTTCATTTTGTTTTCTTAGATGGTTCCCCTAAAACCCACTC
ATGTCTTCAACAAACTGGAGGGAGAAATGTTCATATTTGAACTTTTTGATGGTCTTTTAGGTGCAACCTGGTTGATTTTTCAGTTATTCTTTTGTAGCTT
TAGTCTAGTACTATTATTCACGATCAAATTATTTGCTCCAAATTTTTTGTGGCGTTTGGCATTTCTTGGGATGGAGTTTTGACCTATATATATTTTTTTG
ATAGACTGGGGCCCTGTTCGCGGAGGATTTGCAGATAGCTTTGGTGCAGGGAACAATCAAAGGTACAAGTTTGTGCCATAAATTATTACTCTTTCCAATG
TTCTTATTTTTGCCTTTACACCTCCCTGCAACTTCTATGCTTGTAAAAGAGCACCCTCCCCCCCTTCCCCCTCCCCATAGACTCCCATCTAGTAAAGTCA
GTCCTGTACATTCCTATAGTAGGTGTTAAGTTTGCAAGTAACGAGTGCAGCTGCATGATCAATGCTATTATATGAGTGGCAGTGCTTGCTCCCATGTTAT
CTTTGTCATTTAGCATCATGATGAATGAATTCTTTGTCTCTGATTTTTTGTTGGGCATCAATATGTGACAGGAAAATTGTGTTTTACAAGAAAGTGGCTT
GAGATAAATGAAAAGAAAAAGAAATGATTATTTTTTGCAGGTCTGCTTGGATGTAAAATAGAAAGAGGCTGTTTGGATTGGCTTTAAGTACTTGTTTTTA
AGCCAAAATAACCAAAAAAAGCCAAAAGCCATTAGTTATAAGTCCATCCAAATAGGCTCTAAGAATGTGGGGTGGTTACAACTTGCACAAACACCTACTT
ACCATCTATCTCCTCCCCTAGTCTCCTTGCAAAATAGAACTTTTCCAGAGGCGCGTCTTTTTCTAACAAATTTGTAAATGTGTTCCTCTCCTTCATTAAA
TACTGGATGATTAACTCTCATGCTCCTTTTTCTTTTCCATTCAACCGAATAATACCTTTATGCATGAGAGTATGAGACTTTTCCACGATTTTTATGTGAT
TTTCTTTCAGTTGAATTGTTATATGAATATGGTCTGGGACCTGTGTTATTTCATTAGTCTTTCTTAAAATCTTTAAGATGGGTTTGTCATGTGGTTTAAA
TAATCAATGCACTCTTTTGTACATGTTGCAGAGAGGGATTGAAGTCTTATAAGCAGTTCATTCAGGAGCTTGAAGATGATATCTTGCCAGCTGAAGCTGA
GCGCAGGTGAGACTGAAACCATGATGATAAAATCTTGTTCTTTAGATGTGTCAATTTAAGCTTAGTTTATTGGCCTCAGTGTAACTTGCAGATTTTTTAT
TTGTTTTGAGTACATTCTCTCATATTCGTGTAAAAATATGTCACTGCAAAATAATGGAGCTAATTCTCCTCATATGCAGGTACCAAGAATACAAGGCTGG
GTACATAGAAGCACAAAAAAGAGCTTATTTTAACGCTCATAAAGATGAAGAATGGTACACTTCCAGCTCAGCTAGCTTGTCCTGCTATGTTTATTTGTTT
TGGCTTTCTAATAGAAGTTCTTTGTATATGCAGGTTGAAAGACAAATACCATCCATCAAACTTAATTTCTGTTATTGAAAGGTACATGTTGATACCATGA
ACAGAATGTTGTAGGGATAATTTTGGCGATGCTCTTGTTTGTTTCTTGGACAAACTGCTTTTAGACCTTTTACTTATTGTTCTAGTCAGGTGTATGACTT
TGGTTCTATTGAAGTCTTTTCTCCGTCTTAATTTCCTGTAGGAGGAATGAGCTTGCAAGGAAATCGGCAAAGGATTTCTTACTTGATTTGCAGAGTGGAA
CTCTAGACATGTAAGACCTGTTTGTTCTTAATATATGGAATGTGCAAGATGAAATTGTATCCTGCTTTCTGAAGTGATAAATCTTTGCATGAATAGAGGT
CCTGGTGTTGCACCTCCTCCTACAAACAAATCAGGACAGTCAAGTGAGCCAAATTCTGATGAAGAAGCAGATGAAAATGGCAAAAGGAGGAGGCATGGGA
GGGGACACAATAAAGACCCTGACTTACTTTTAGCTGCTCCAAAGGCTCACCTAGTGAGTTCTGATCCCAGAAGAGTCCAGATTGATGTTGAACAAGCACA
GGCACTTGTGAGGAAGCTTGACTCGGAGAAGGGAATAGAGGATAACATACTATCTCGGTCTGATAATGATAGGGGAAGCAGAGACAAGTCTCATGGTTCC
ACAGGCCCAGTTATTATCATAAGGGGCTTAACTTCAGTGAAAGGTCTCGAGGGAACTGAGTTACTTGATACACTTCTAACCTATCTGTGGCGCATTCATG
GGGTGGATTATTATGGCCTGGCAGAGACAAATGAAGCCAAGGGTCTCCGGCATGTGAGAGTGGACGGCAAGGCTGCTGATGCAACAAGCAATGGAGCAGA
GTGGGAATCAAAAGTGGATTCTCATTGGCAAGACAGGCTGAAGGGGAAGGATCCCTTGGAGGTAATGGCTGCAAAGGAAAAACTTGATGCTGTTGCCGCC
GAAGCCTTAGATCCCTATGTCCGTAAAATTAGGGATGAGAAGTATGGCTGGAAATATGGTTGCGGAGCCAAGGGTTGTACAAAGCTCTTCCATGCGTCTG
AATTTGTCCATAAACATTTAAAGTTGAAACACCCTGATCTGTCAGTGGATCTGACTACTAAAGTGCGTGAAGATTTGTATTTCCAGAACTATATGAAGTA
AGTGCAGTACACAGTAATATCTTATTTTCCACCTTCTTACTTTTAGTTTCAAGGCTAAAAGGTTTTAAATGATCTCAGTGATGAAAATTCTCCTGGTGGG
ACTCCTGTAATGCTGCCATCTGTGCCGGTAACCCATCCATTTCTTCTTCTTTATGTTAAGTAACATTTCTCGGGTTCTTACTTCGCATGTGTTTTTGAAC
GTCTTGAATTTTCTACTCCAGGCTTTTTCTCATACTTTTTAAGGTGACTAAGTAATGCTGTAGTATCCATCAATGATGTCTTGTGAACTTTGCTGTGTTC
TTTCTATAGTCTTCATTTTGAAGAATCTAAAAAAAAACATGCTTCATGTTTTAGGTTTTGTCATATTAATTTGTGGTCGATTGGTTTTCGGACAAATTTT
ACATGTACTGTAACAGAGGATTCTAGTTCCATAAATAATTACTGCTATTTTTTTGAAGTGTTGTTGGATGTTTTGGTTAATGGTATTGATACTGATATAT
GGTGTCATCTAAGTATATGTCTTATTTAAAATTAGATACAGAGTTATTTCTTGTAATATCTTTGTCCAAATAGAGGGAAGAATATGGAGGATTTATGTAA
CAACTCCAACTAGTCGGGATTGAGGTGTAGTGGATGGATTTATTGTCCAATATTCTATTAAATAATATAACAAGTGCAATATAATAAAGAGCTTAGTTTT
CAAAATATATAATAATAATAATAAAAACAAAGAGCTTAATTAGATGTATTGTTATCAAAAAGTTTAATTACCTCAAATAAAGAAAAAAAAAGAACAAATT
TAAAGTGAGATAAGATAAATCACAAGATGAATGAATAGAGGGTACAGTTTTGGGTCCATTATTCATCAACTTTTGAACCTTCCGCCATTGGTCTAAGGTA
GTCGTTTATTTAACTTTTGAACCTTTCACATTGACAAATGTTGCATTCCTCTTGTAAACACAACAAAACTTTCAAAAAATTCTTATGATTTAAATTATAA
TACCATAAAACATACTAGAAGAAAGTAATTGAGTGACAACAAGAGATGATTGAATTTCCAATAATAATGCGAAAGGTGCTGTTGTCATCTACATGCTTTT
CTGAAGATACTGGCATAGTTATTGTCAGTTATTGTTCTTGGGGAAATCAAATAGGGCAACAAGCTTCTGATTGTTGAACTTGTAAATTGATATTGTGATT
ATTTTCAATAACATGATTAGCGAAATGACCCCTTTGAATTTGTCCACGTGATGAAGACTATGAGACTGAAATCTGTGATCTTCCATTTGGATGTGCGATT
GATTCTGGCATCTTTTCTACGTAATGTCTGATATTGAACATTGTATGTTACAACTGATTCCATCTTCTAGAAACTGGTTATAGAATTGGTAGGCTGGAAA
ACTATCAAGTTTAGCATGTTCTCTAAGTCGTATCTAAGTTTTATAACATCCTCATCTCTCTAGTAGTATTGTGATGTAAAAAAGTATAGAACTGAAATCG
AAGTTCTAAATTCAGCACATCGAATGGATTATAGAAACCTGTACTTATTATTTTCTGGTCCTAGGGCATTAGTTCAATGGTAAAAGTAGTATAACACGAA
ATGTGTGGTAGGCACTGCACATCTCGTGAGTTGAACCAAATCTACTATAGAAGTGGAGAAGGAACGGTATCGTGCCATTTATCCACCTAGTATTGAAGGT
AGAAACAACAGAATTTTCAGTCATTGAAAAAACATATACTGATAGTACTGGTGGTTTGGACAAGTGTGCTTCAGTACCTCATTCTCCCTCCATTTCAATT
TATAGGGCCTACCCTACTAAATGATAAGGGAGTCAGATGAGCAAGTTTAAAGTTCGAATTCCCCAACTCTACATGGGCTTCTGGCTTTTCTTAGTTGACA
ACTTTATTGAAATTATATGTTCAGCAACGAAAAATTTGTACTTTGACTGGGTACAAACTTCAAGGAAAAAAGGTCTTTGGATACTTATGCTCTTAGATAT
GCCATGACATTTGTGTGGCTACTAGACTTTTGAATCTTGTGATTTTAACCATGCCATAACATTTGTGTGGTTATAAACCCTTGTCATTAGGTGTAAAATA
GAAAGTTCAAGTTAAATTGCTTTCAAACATAATAAAATGACATTCTTTTTGGAACAGACTAATACAGAGATAGTTCTTTTTTTTGAACAGAGGATAGTGT
TTTTAAAATTGTTGAGAAAGCTCCAATAATGGTTAAGTTAAACAGTTCTAATTGATTGCCCTTTTATTATAAGAATGTTTGAGGTTTTGTTTGGGTGCAA
AAACTACTCACACATTTCCCAGTTAGAAAATTGTTGATAGTACATGCACGTTTTAGTCCTGAATGTTGCCTTCACAGTTAGTGATGTTTAACCGAATTGG
TTTGAACTGAGTAATTTTGGGTCTCTGTCATCTTCATTGCTGTGATGAATTCTCATCAGCTGGATTGTTCTTGTTGTTGGCACTCGGATATAATCCATTG
TTTGTCATCTGTGTTTCAATGCTGTTTATCTTTTTTTGTGTTCTTGCCTATGTATCATAGTTTCATTCTCCTGATGGAGCTAGCCCGTCTTTATATGTTA
ATTAATTGAATAAGAGCAGTTTGATCCAATGCAGTAAACAGTCCTCGTTTTACTTGAACTTACAATCGGTGTTGAATTTAACTGCATGTTGGTTCTATGC
AGAAAGAGAAGCCACTTAGGCGCCGACCTGGGCTAGATGGCCGGCTGAAGGATGACAGAGGGAACCGTAAAGATCGGGATGGACGTGCTAATGGCGGTGA
AAGGTTTGATATGTCTGAAAATCCACAATCTGGAGATTTTCAGTCCAATAATGATGGTGCCTCTGGGGGAAATCCTGATGAAGAAATGTTTGATACTTTT
GGTGGACAAGGGATTCCAGTTGCTTCTTTCCCTTCAGACATGGCTCCTCCACCAGTATTGATGCCTGTTCCTGGTGCTGGGTAACTTAAAATGATTCTTT
CCCATAACTTGTTAAATTTGCAAAACGTAAGTCTTACCCATGTCTAGGATATGATTCTTGAATTTTGATTATTTTTTCATTTTCACTGCAATGTAGTCCT
CTTGGTCCATTTGTTCCTGCGCCTCCTGAAGTTGCAATGCGAATGATGCGAGAACAAGGAGGCCCTACTCCATTTGAAGGCGGTAGAAATGGGAGGTCTG
GGCCTGCAGGCCCGATAATTGCTTTACCTCCCGGATTTCGACAGGATCCTCGTCGCTTGCGAAGGTATTTCGTGCATTGTATGATTTTCAGATTGCTTAA
TGGTGAAACTACTAGTTATCATCATTCAAATGTTCATCTCACTAGAATAAGTAAAATTTGGTCAATTGTGAAATTCGCGCGGTTTTTTTTACTGCACAAG
TGAATTTATTTTTCTCGGGTTAGAAGAGACAATATGGGTTCCAAAGTGTTGGTATAGTACATTGATGACTTGTAAAGTATGTTGGTGAAAAGGCTGATTC
TAGATAATGGCTCTTTGAATGGTTTAATGGAAGATTATAATAAAGGCTTTGCACCGTCTTGTGTTGGTGTGAAGATGCAGGGAATAAAAACTAGGGCTGA
GTTTTAGGCTGTGTGAGCAAGGGCTCACATCAGCTTATAAATGGTCCCTGGAAAATGGGTTTGGAGGTCCGTGTTGACATAGCACCAGTCCCAAATCTGA
CGTGTTGGTTAACGATTATTCCCTTTGTCCCAACTTACGACTTACTTTCCTTTTTCGTCAGTCCCAAAAAGAATTAACACATTTCTATATTAAGTAACAA
AAGTATTGTTAGGCTAGGCTAACAAAAATCTATATGTTGGAAACAACACATGTATAATTTAACGCTTCTAGCTGTCTATCCCCTACTCATCTAGAATGTC
TTGTACATGCTTCACACTTTTTAATTGCTTTTATTTTGGTATTTGGATGTACCCTTTTAATGTGTTACTTACTAACCTAGTTATTGAGCACCTAATTTGC
TTCCTCTTCTACTGACCCGTCTTAATATTATGATTCTATCATCTTATTTTTTAATTATAGTACTTGCTTTGTTTTCGTTACTTCGGGTTTCTTAACCATT
TTTGCCGTCAATGTTTCTTTCCTTTGCCGTGGGTCAAGGTAGGGGTAAGGGGTACACTCCACCTTCTCCATATCTCACTTATTGTGTATGTTGTTTGTAT
GTTTCTTCCATTTGATATTTTCATCATAGCTTCCTTACTCTTGTATTTTTTGAACCTATTTTGAAAAATGTTTTTATTGAGTCAAGAATCTTAACAGAAA
CAGTCTCACTACCTCCAAATGTAGGGGTAAGGTCTGTGTACACCCCACCCTTCCCTAAACATCACTTGTAGGATTACAATGGACATTGTTGGGTACGGCA
AGGGGGTGCATTATGTATTGAGCCTTTACAGGATGAAGGCAATGATGTCAGCGAGTGATGTTGCATGGACCATTAGCACTTATGTGGGTAGTATGGAGGG
AAATCAATAGGAGACTCTTTGAAGCTAATGAGCTTCTGTTGATTTTTTTTTAGATTGAGTAAAGTGTAATGTTATTGATAAATGGTGAATATGGATTCTA
TTTGTACAAAAGATCGGGTGTCTTCGCAGAGAATAATATGTTTCTGTATATTCTCTGTTTTGTTGTTCACCTGTTGTACACAGGAGCACTTTCCTACTAT
CGGTAATATTATACTTTACTTGATTTAAAAAAAAGAACGAGAAGAAAGCATGATACGCACATTACATGGTAGTTGTGCTACAATTTGGAGCTATTGCCTT
GTTCATGCATGGTTTTGTAGAAGCAGTTCTTGTGAATACTAGTCACGGTGAGCCATGTCCAAGATAAATCTGCACATGCTGGTTTGTCTATGTTTGAAGA
TTAGGTTGAAGTAGACTTTTAATAATGGGTTCCACGTTGAGAAGAAGATGGACAGATAAGACAACGGGAGTCTAGTTTGTGTTGTGTTCACCCTTTTTGT
TTATTTTCTCAAGGCAAGATTCAGAATCAAGAAACTTGTTTTGCTTCCTAAGTGTGGAGGAATGTCTTGCCAAAGAGGAGCTACTTCTGGAAATTCTTGG
AAGTTGTTTACTTGCTTCTCGATCTGTTAGTACTGATTTTCTGTTATTGTTACAGTTGCGCGCTTCCAAAATACAACTACTCAAGATGAGTATGCCTCAG
CACCACTGTGTAATGCTGGTGGTGGGTCATGTGTTATGTATTCAGTTGTCATGTGTTCTATGTTATAGTGACATACATCACTCCTACAATTTTTGTAAAA
ATGTATGTTTGTTTCCATGCGACATGTAGAATTATCCTCGAAGAAGTTGAAAACTGGAGGTGTGAGTAACATATTTTAGATTTGCAAATTGTGGCATTTT
GTTGGTGTTTCATATGCTGGAGTCATTGGAATGACTATCTCGTGTGGAAGTTTTTCAACTTTGAATCTATTTTCAGAATTGGAGGAAAAGGCAGTACAAG
AGAGCTGTAAAAGATCATATAGTTACGTTGTGCCTTAAGCAGATTATATGTATCTGTTTTTATCTTGGTTGCATTTTTGTTTCATTCGAGAAATTTCTTC
CCTGATTGAATCCTGAAACTGTTGTTGTTTTGAGTTCGAATGGAGATGTGATTGACCTCTATGCATTTGCATGAATACATGCCATGGAATGTGATTTAAT
TTCTTATGAATAAACACTGCTTTCTTTTTTTTAAAAAAAGACTATCCATACTTCCTTTACTGACTTACAGTTCAACAATTTTGCAGCTATCAAGATCTCG
ATGCGCCTGAAGATGAAGTTACCGTAATAGATTACAGGAGTTTGTAGAGTAGACACGGAGAACGTTGTATTTCTTCCAGTGAGTAGAGGCAATTTGCGTT
GATGCTACATTTAACCATTTTGATGTTGAAGCAATGAGCATATACTTGATGTCTTGAAGTTAACAATGATCGATGGGACCAACTACATTGACATGCATAG
TTGGTCTTTTAGTTGAAGAGGAATTGTCCCGGGGGGCTAAGTAGTTACAAGATTTCTTTGGTAGCAAGCAGTGCCTACTTGCTAGATCTTTCCAGGTTCC
GCATTAGCATTAAGTTCGTAGAATTTCTAAATTTTTTTGTCCTCCCCACCACTTGTTGTAGCAAAGATTTCAGGAGATATATGCTAATAAGAAGTTGGAA
TGGTTGAAGACAAGAAGGGGTAAGATATGCTACTGTAAAAATTAATTTGTGTGACTAGATTTATCAGTTTGATTTTTTTGGTTGCTACGTTGCGCGATAC
TTAAAATTGAAGGGAGATATTGTGACTCTTGAGATTTCTGATATGATGCCTATTGATCGTGTTTTATTCCGGCTAGACGGTTCTTTTGTTACCTTGTGCC
TGATTGAGCTCAAAATGGACAAACCAAAGCCATATATCACAGACTCGGAATACTCCGAACACAACGAAGAGTTGTCCTGCAGTTTGGACTGGATTATGAA
AACTTTAGTTTGTAATTTTTGGTGATTTATATAAATTTCATAAGCAACCATGTTTCATATGGAAGAAACATGTAAAATATGAGTACTTGCTTTTTCTCCA
TCTTTGTTACCCAAATGATTACAACATTGACCAAATTTTGAAGTGAAAATATCATATAAGTGCAATAGTATTGGGCTAATATCCAATTGGTGGGGCTAAA
TATAAGAAGTGATAAAAGCTTTATTTCATTAATTCAGTTATTTAGAGAAATTTCTTTTTATTGTTGGTCCAAAAAAAAATAGCTACTAGCAAATTTCTTC
CCATAACATGGACAATTAAAAGAAACAAAACTCATGGCTAATACACAAATTGGTGGGAAAATGTTCTAAGGCTATTCTCATATATATATTTTAATTGAAT
CGGTGAGAAAAAAAATATTTTCTTTTTTAAAAAAGAATGACTTGGATTGACTTGACACGAAGTTTAAGAAACTAAAGAATCTTTGAATTTTGTGGTTTTA
AATTAAAGTAATGTGGAACGTATAAAACTGGTCTTTAAAGAGGTCATTCTTTTTTAAACAAACTAAAAAAAGAAAGGAGATCATTCTTTTTTAAACAAAG
GATTAGAAATGTTTTCGTGTGAAAAAATTAGAAAAATTCCTGTTCTTTTCAGTACGAATCTATTCCTATCAAATACATTTTCCCAATGAGTCGGTTAGGT
TGGAAGTGAATGAAAAAATCACGTTCTATAACACAAATTTCTCGGGAAATACATACATTTTTCCAGTGAGCCGGTTCGGTCGGAAATGAATGGTAAAATC
ATGTTCTATCGCACAAATTTCTCTCTGATTCGCGATTTGTGATGGAAATACATACACTTTCCCGGTGAGCCAGTTCAGTCGGAAATGAATGGAAAAATCA
TGTTTTATCGCACAAATTTCTCTCTGATTCGCGATTCGTGATGGAAATACATATATTTTCCCAGTGAGCCGGTTCGGTCGGAAAATGAATGAAAACATCA
TGTTCTAACTAATTCACTAATGAAATACAGTTGTTTCTAGTAGTGGAAAACCAAAAGGGTAATTAACCTCAAAGTCAAGAAGAAAATGGATAGCATAAGT
TCAATAAAAATCACATTTATATATATATATATATATATGTTTCCTTTGTTTACAAAATTATTGCAGATAATAGAATTCTGGGCTCTTTTTAAGTGCTACT
TGGTTCCTCCTCTTCAACTTCAGATGCATTAGTTTCCATCTTCTCAAACTTTGCAACTCGAAAAATCGCCAAATTAGTATCCCCTGAATGACAAGATGTT
TCGAAAAGACTAATCAACTCGGGGTAGTAGGATGTTTAACACGTATCATACAAGAGTTTTAACTTTTATAAACTGACGATTTAAATGAACTTTTAAGAGT
ATTAAGGTCACCTAACTCATAATAAGTGACACTAGTAAACCAAAAAAACAGAAAATTTAGAACATGATGATGGTTTAAATGTTGCTTACGTTGTCAGTGT
ATATAAGTTAAATACTCGCGCAAACAATACAACCACTCATAAATCATAAGAAAGTATGAGAAAAGAATTTAGTGAATGGAAATGAAAGATAGAAGAACTA
TTGTAAAGTATGCTTTTTTCTTCACAAAGATGATGTAACAAGTAGTAGCGGAGCTAGGATTTTGGTTCAACATATGAAGAAGTAGACACACGAAGTTGAT
AAAATGTGAGAAAAAGGAAAGCAGGGCGGTGAAAGCTTTTACCAAACGTCACGAGACTTCCAGGCAATGCAGCAGCAGCCACACCAGGTACGAGCCTTTT
CTCACCGATGAAAGTACCATTCGTGCTGTCTAAATCTGTCACTACGAGATAGTCCTCCATGTTCTGCAGCCGAGCATGTATTGCAGATACTGTTTGTACA
TCAACAGATTTTCAGATATAAGCAGAAACTAAACGTTTCGTTTGGCAACAGTTTGTTCTCTTATTCAGAAAGAGTTTAACTTATGTATACTGACGGTGTA
ATTTACTACTGAGTCACCTCAAAGAAGAGAGGCAACCAGTTATAACAAGTTAAATAGCATCGATAGTGTAAAAGTTGCAGTAAACTGTGCCACGGAAGAT
CAAGTTGGTGAGTCGTGTGATTAGAAAACTTCCCAGACAGTTCGGAGAGGACTGAATTAGAACGAGAGGTTATATAAGCTATCACACGAATGGTTTTATT
ACCTGTAGGCACCGGAATGACTACATCAGCCTTATCAGCAACGCGTCCAACAATTACTGCACCCTAAAGATGTGTAACAGAACTTGCAGTTAACATACAT
GACATACGTCGAAACAGGAAACTGGATCATCACATCATACTACTTACGGAAGGTATTTCAAGAGAGCGCGGCTTTGCAGTTGGAGAACCAATGTGTCTTG
TGTCTCCATCACCTTAATTTTGATGTATTCAACATTTGATAGTAAGTCAATAGCTCTAAACTAAACATCAAACAAAATGCTAAAAACTCCTCGTGTCGTT
AACCATATACTATACTCTGCAGCTTATACACATCGATTATCTTGCTTCAATGGATCAACAATTAGCAGTACATATAGCGTATGAACAGTGGCGGAGGAAT
TTCACAAAGGGTATCCAGAAATAGCACAACAAAAGTGGGATAAACATTTGCTACTAGTCGTGAGAGTCAAACACGCAAAGCATTGTCTCATTACAAGCGT
CTGAAATCATTAGGCTACAATAGCTTGTTGTATTAAGGGTGTTCAATATATGTTATTTAATCATTTCGTGTATTACTTAATTTGTATATACAATATTTTT
TTTCTAAATTGGACACCCTGACAACCATGTAGCTACGCCACTGTGTATGAGCCATAGTAATGAAGTCAAGAACAAAGAAAAACAGCATAAGTTTAGTAAC
ACTACTCACCAAAAGTCTAGGCAGATGGAGGACATCACTTAGCATTGTATTTCGTCATTTTCAACGACTTCATTGACCGTCAAAACACAACCTTTTCACC
CATTTTATTGACCTTTAGGCAACATTCCTAAGTGCAGTTTTTTTTAACCAAACGGATCTTAGACCTAATTCACATCCAAAAACTAGCTCAAAAAGAGTCG
GATTGTCTAGGTAAAAAGTCCAGGGTTCTCGTCCTTCACCGGCGGGACTCATTCCATTCATCACCCTTTTTTCTTTTAAGTACTACTCCTTCGTTTCATT
TTACTTGACCTCTATATTATGTCATTTTACTTGTCCATTTTAGTAAATCAAGTGCCCTTAGTTTTAAATAATTACAATAGTTGTACTTGTCCAATATAAA
ATTCCAAAACATCGTTAATAACGTTAATTAGTAAAATACACTTCTAATAACCTTTCTTAAGCGACATACATTATAATAAAAATAACTTTTAGCAGCAATA
AATATTGATATTAATAAAGAGTGTTAAAATCTTTATCGGCATTAGTTAAGTGTTATTAGAATCAATATCGCTAAAGGCTTTGAGGACATATACAAAGAGT
ACTAATTGCCGCTAAAATACATATTTAGTTCTTAATTGCCGCGAATGATTATTTTTTATGTAGTGATATCAAGTCAACATGGATCAATTAATATAAAACG
GACAGAGTACTAGCATTTCATAAATTCGATCCCATTCTACAATTAAAGTACTAACACACCACCACCACCGCCAACAACAATAACAACATAATGTAATTCT
ACGAGTCGAGTCTGAAGAGGATAGTGTGTACGAAAGAAACTACTACATGTTAAATAAAAAAGAACACATACCTATAAATTCAAGAATCCATGATACTGAA
CCATTAGTTGAATTACTTTCAACCATAGAAGCATAGATAGGTCCAAAATGCCTCAATTGCCTAGCACTACATTTTATTTTTTTGGTTATGCAATTATATC
CAAGAAAATTAATTGAATTTGAAGAAGAAATAGTAACTCTAGAAGGGAAAAAAGATGGTATTTTTGGGAGATTAGCATAAGAAATAGACTGTGAAGTTGT
AGTTAATTCCATTTTTTTTTGTGATTTTTTTGGTTCACTCTTTATGACATGTATTTATATGGTTTGTGGATAAAATTGCTTTGGAGGAAAATGTGGTTGA
GAACTTGGCTTTTATAAAATGTTATAGTCACCAAGATTGTGGATAACAAAAATGTCAAAAAGTAATACTAGTGCCTCCTAGCAAAAATTAATTTTGTTGG
ACACTTATAGTTTCTTTATTAATTATAATTTTTAGATTTTTATTTTTGATATAAAATCTATAAATATATTTTTTAATTTGATATAGCTGATATTTATGTT
CTCAAATTTTATGTGTGCACAAATAAAAAAATTAAAGTTGTATAAAGTATGCTAAGTAGACACAAGCTCGAGGCCTATCTAGGAGGAGGTTATCGAGTTC
ACGTGAATCTGTGCTCTCCTCTCGAAATAGTGTTATAATTTTTAAAATATTTAAATATAGATATATGAACCCACATTTGAAGTATCATATAATCTCGTGC
GATGATGATGGGTCCACCTCTCTAAGTGAATTTAGAAATTTGAACCTTTTATATTTTATTTTTCTTTTTATAATTGGGTAACACCTCTGATCTAAGTGGT
TTGAATAGATAATAAAGTAAAAATCCTATTGGCTAGAAAATCTTATCAGGTATTTTACTTATATTATTTTACCTTTTGAACATTTTTACCCTTATAACTT
TAATACCTTTTAATTAAAAAAAGATCAATTTATTTTAAAATAAAGGGAAAATGCACAAGTACCCCTCAACCTGTGTCTTAAATCTCAGAGACACACTAAA
CTATATTAAGATCCTATTATCCCCTGAACTTATTTTATAAATAATTTTCTATCCCTTTTTGGCCTACGTGACACTAGTTTGAAAAAAAAATGTCAACACA
CGTTGAGCCCAGTAGATAGTGTCACGTAGGCTGAAAAGGAGTAGAGAAATTGTTTATAAAACAAGTTCAGGGGGGTAATAGGACCTTAGTATAGTATAAG
TGTGATTCAGAAATTTCGGGCATAGGTTGAGGGGGTACTTGTGCATTATCCCTAAAATAAAAGAGATATTATAGATATTTTTATTTTTCTGGTCATTCAA
TATTATCATATAAAAAATAACTTTGTACCAATAATTTTAAAATTTTTAATGGTTTTTAGAGATAAGAACATACTCCCTCTGTCCACTATTAATTGTCATA
GTTTCTATTTTAGAGTCAAACTATAAGAAATTGGACAAACATTTTAAGATGCAATTTTTCATCATAGACATATGCAAAAAATTTCAATTTATAATACTTT
TCATATAATTTTTGAATATTTAAATTTTTTGTTTAAAATATTGAATTAATGTAGTCTAATTTAAAAATTTTCGAAAAGCGCAACATGACAGATAAAAGTG
GATGGACTGAGTAGATGTTAAACCAATATAATTTATATCTTAGATCCATCTTTTCGTAAAAATGCATCCATGATCTTAAAATCTTGAATACGCCTCTACC
ACATATTCTATACAATACATAACATATATAATACAAATCAGTTTGAATATGTCGCTCGAGCTTTAAAAAAAACTCAGGTTATACAATTTGGATTTTAAAG
TGTGTGACCCAATAAAAATAAAATAAGTCTCATAAAATTTGAATCTTTCCATTGAATAAACTTCTCCTAAATTAAAACTCTATTCTAAAAAGAATTATAA
GTGGGGGACTTTTAATTATTTTTTTTGGTTGAATTTGGGCTAAGATTCAAGAAATACAATTATTTTTCAACTCAAAAATTGTTTGGACAATGAAATAGAG
ACCGATTGAACTATGAAGAAGTAGGGTTATTTAAAATCAAATTGAAATTTATACTTTAAATTAAAATAATTATATTTGTTCATAGATAATAGGTTATCGA
TTTAATGGTTATGATTATTTCAATTATTCAATTGTCGGTTTAAGATTTTTTCTTAATGGCTTAATTTATAACCAATAGAAATATTAAATTATATTCAATA
ATATATATTTTTATTTTGGCAGTCTCAAACTTTCGATTATTTACAATGTGTTAGTGTTGTTTTTGAGCAAGATACAATCTATCAACTCGTGTGGTTGTTA
ATTTGGTATGTCACCATGTTTCTAAGTGATTTTTAGTCATTTATTTTTTGTGTCAAATCTTTACGGTTAAATCGACAATCGAATATAAGTCAATATTTTA
ATGATTCTTAACGGTTTAGTATATTTACAAATCAATAACCATAAGTCGAAATGAGAATCAAATCGACCGATACACAGCCCTACTACGAAGAGAATGGGGC
TGGGGAGAACCAAAACAAATATTTTTTTTTTAGAAAAATTAGAAAATATTTATCCTATGTTAACTCAGAAAAGATTAAGAAATAGAAGGAATTAGTTTTA
GGTTATCAAAATAATAAAACCTATGATGGGGTCACTTTAATCTTTTATATATGATATATATTACCAGTTTAAAAGCTACACGAAGTTATTCTATTTTAAT
TATTAAAATGAGATGAAAAAAAAAGTTTATTCTCCATTTATTTATTAGTTAAAGTGGCTTTATTTTAAATAAAAATATATATATTATCTGAATACTTTGA
TAATAATTATTTTATGTCATCAAACTAACCCGGTCAGTAAATTTCATTTAAATTTTGATGAAAAATTCTAATAAAATGGAAAAATACTTTTATTTTAAAA
TATTTTTCCAATTGAGTAAGATAAATATTTTTTAATTTAAAAATCATGTTAGGGAAAATTTGTTTAGAAGAAATATATATATATATATATATATATATAA
ATTTCAAAAAAGATAGTTTTAACCGGTTAAGTAACAATAACGACATTTTCTATCATCTAGAATATTTTTATTCATTTTACATAATTTAAAAATAAGTTTA
ATCCTTTTATTTAGAATAGTTTAGAAGGGTAATACACTTTTTAGAATAGTTTAAAAGGGTATATTAAGATGTATTTCTGATATTTTATCTACAGTTAAAA
GAAAATATCTGTATATCTTTTCTCTATAAATAACACAAAAAACTAAATAAATAAAAAGTATACTCTAAAATATAGTATACATGTCCTTCACATGGTTTTC
AACTAAAATAAAAACAAGAGACATTTCATTCTTGAACTTTTATGTTTGTTTGCTCTTATTTGAATAAAATTAGGTATATGTGAAATGAAATATTTGAATT
CACATATACCAAACATCTTCTCATATATATATATATATATAGAAGGATATGTATAGAAATGTTCAAGAAAACCTTTTTTCTTCTCATGTGTTTTTTCTAA
TAAAAAAGGAAGTTTCATCATTTGAATGAGTTATTATTATTTTTTCTTTATTATCCATGACAATATTTGAAAAGAAAAATAATAATCTTTTATCAAGAAA
AATAACTAATCTCTGGTCAATGAATTTATATCATTTATAAAAGAAATTTATATCAAACCGCATACTGTTATTGAAAAATAGATAAATTATTAAAATTATT
TTTTTCACTGATCACTAATCTAGAGAAACAATTCATTTATGATTACACTACCCTATCAATCATTAACTTGATTAATTATCAAATACAAGTAACAGATTTA
TTGGTTATTTCATATTTTATTCATTGATTTTCACCTTATTATCTCAGTTATTTTATTTTTCGTTCATTTCTTTTCACCTTATTATCTCGTTGTATAATCT
TGTTTTTTAATTCTAAATGAAATCTGCTAGACTGTACGAATATATCAATGAATTTATAAATTTGTTATTATTCGAACAAAGCTCGCTTAACCAATTCATT
CCTTTTCACCTTATTATCTCATTTATTTCATTTTTCGTTCATTTCTTTTAATCTTATTATCTCGTTGTATAATCTTGTTTTTTAAATCTAAATGAAATCT
GCTAAACTGTACGAATATATCAATAAATTTATAAATTTGCTATTATTCAAACAAAGCTCACTTAACCAGGGACAGAATTATGTCAAGTAATCATGTCAAG
TGCTTAGAATATTTTTTTAAAAATGAAATATACACTGCAATCAAATGCATATATATAACTTAAGATATTTTAGATTTTTATTGATATTTTTCAAAATGAT
ATACGAATTAAGAAAAAATCGCGAAAAAAATATATTACAACATTAGATAAGAAATATGTACTTTTACCTAATTTATTTTATCTTTAATAATTTCTTTACA
GAAAATCTTTACATAAATATCTGGATTAATTTATCATTTACTCTTCTAATCTATATATAAACTACATTGTTATGAAACTATATAAAATAATGAGAAGAAT
AAAGAAGGGAGAAGAAAAACGATTTCTTATTCATCTTTAATTGTAAATATATTATTAATTAAGTAAATAATTTTTTTTAAAAAAAATAAAAATAAAATTG
CAGAGAGTACAAATCCCTTGTTTGCATTAAAGACTTTGTAGAATTTTAGGCTTTACAATCTAAGCATAAATAGTACTAATTAATGTCACTGACTTAAATT
GTACTTTTAAATTATTCTCTGGCTATGTTTCCTCTAATTTGGGGGTGGGGTGGGGAGATATATTATGAAATTTTATTAAAGAATTTTTTTTAAAAAAAAT
TGACCAAACTTCTAACTCAAATTCCTTATATGGTACTTCTTCTAATTTAAATTAATTTTAAAAAAATAGAAATATTAAGTGATGTTTTTATCTTTTAACT
AATTTTTTTTTGTTTGATATGATTAAAAGAATATTAAATTTTTTACTTGAAAAAAATGCATGTTGTCTTTATACATATCAATATCATGAATAGGTTGGTG
AGATATATATATATATATTTTAGAAACTTTAAATTGGCTAAATTTTATATTCCTTAATAAGTATTCCTTCTATTTTAATTTTTTTTTTATCTTTTTTTTA
AAATTAATACATGTTTCTTAGTTTGATAATCTTTTAATTTTGACATCGTATATGACAAGTTTGTACATTATATATACATCTGGCTAGGGCTATATTTACT
TTTTTTTTCAAAATATTTTTTCACTTTGCTTAAGAAGCAATTTTTGGACTTTAGAAAATTCCAAATTCAATTTGATTTGGATTCCACATTAGGAAAACAA
CTTAGAATATATTTTCCAATTTATCTTCATAATTTTAAATAAATATTCTTTTTTCCCCCGTAAAAAGTACAATCAAACACAACTTCATATTTAAGGATAT
CTACGAAAAAATAAGAATTAATTCGAGAAAGTGACAGTGAGATGGTTCAAACATGTGAGAGGAGATGTCCAAATGCCCTAGTGCACATGTGTGAGAGGCT
GAGTATGGATTGTTTCAAGAAAGGGGATAGATCGAAGAAATATTCGGGAAAAGTAATATTAGACAAGATACGATACAATTTGAGTTTACTGATGATATAA
ATTTAGATAGGAGGTTGTAATGAAAGTGAATTAGGATAAGAACTTGGTAAGTAATCGTGCATTATATTGTTGTCGTTTATATATAATACTAGTAGTTGTA
GATTGCTAGTATATGTTACTTTTTGTATTTCAATTATTATTATTTTTGAACAGCTAAAGGTCGATCAAACAAAATTATTTTTCTATCTCTGAAGTAGGGG
TAAAATTTATATTTAATCTACCGATTTTCAGGTTAAAACTTAAAGCGCGGAATTTTTTTTTATAGTGTAATGCAAACATCCTCTTTCTTATAATATAATA
TATACTCTACTCGCTGTCCAACAATAGTTGTTCCTTATTGACTAAATACGCCTCTTGAGAAACAATGCATAAATAATATTACTATATTATCCTTTAACTT
TATTAAATTTAATAATTTGAAAAATGTGTTAAGTGATAAATAAAATTTAATAGTGAAGATAAAATAAATTATCGCTTGATTTTATAGATTAGATAAATAT
AGTTGGATAACTATTTTAGTATAGGGGTTAACTATTATTGAATAAAGTAAAAAAAATAAATATAATCAAGCTCTCTTTGTTGTGTTATGTGGACCCTACA
AATTGCTTCCTAATTCTTTAGTTAATTAATTAATCATTTCCTAATGATCAACCCCATAGGCCATACATAAGTGAATAATTTATTGTCCCGTTTGATGTGG
TATTATTTTTATATTTTTTTTTAATAAAAATTTATTATAGTATTTTTTTATCAAAAAAACATTTTTAACTTTTTTTTTCTTGTACGGTTATGACACATAT
TTACTTTCTTGAAAATCTTATGGAATATTTAAGATAAAAAATTTAATTATTATTTTTAAAAAAAATTGATCTTAGTGATATATATTAGAGGAGATTTTAT
TGAATATCCTTTTGGTAATTGGTATAAAAAAATCAATTAGTTCATTAAAATATTAAAGGGAATATTTTGAATAATTCTTATTTTAATTCTCTTATTTATG
ATTGTAAGAAGCTAATAAAAGATTTTCCATTAATGTATATTTCTCTTGTTAAAAAATTCAGCAAAATTAAGGTGTAATATGTTTTTTAAATTTGGTTTTT
GTTTATATTTATGTCTTTTAATTTTTGGTGTGCTTAAAATAGAAACTTAAACTCATATAAAGTTGAATAAATAGACACATGTCTTCAGGTGGCATAGCCA
GAAATTTCACGAAGGGTATTCAAGAATCGCATAGGTAAAAAAATAATTTGACGTATGGGTGCACTAAGATTTTGAAATCGAACTATGTAACATTAACAAT
TAAATTTTTTAATGAAAAAATATACTAAATTTTTTAAAAATCAAACCACGAAAGATTTAGCTTGAATTTTCATGTTTATTAAATAGGAAGTGGACGAAAA
AGAAAAAAAGAGAAAGAGAAAATTCCGTTTATGATGAAATCACTTTTATACTTCAAGATTTCACCAATCTATGGCGACTTAACAACAAGATATGAAAAAT
AAAGAGTAAAATCAAACGAGTTTTTCTAAAAAAGAAATTCTATATAGAGCCTTTTTCATTTTTAATAGCGGCATAAAAAAATTCCTAATTAAATTTAAAT
TAAATAATTACTTTTAAATTTTTTTAAAAAAGTGATCAAAATTTAATGTTTACTGTTTTTTTTATTGTATTTTAAAGTTGTAGGTCTCTAATTTGAGATT
ATTTTAATAGATAATATGAGTTTTGAATTGTTGAAAAAAAATATTTATTAATCATGATTAGGTCTCTAATCAAGATTTTTAATAGATAATATTTAGTTTG
AATTATTAAAAATATAATTGATTCATTAACTATAATTAGAACATAATTAGGAGCTTTTTGAAAATGTAAAAAAACAAACGCAGCGCGCGTTGATCCAAAG
ATATCGTTGAGATAGGAGACTTTAGTGTGCTTAAGAGCGTTTAAAATGTATTATTTAACCATTTAAGGTGTAAATTGTAATTTTTTGATGAAGATAGTGT
ACCTCCGCCTCTACACGTCTCCTACATTACGTTTTACATGACAATTTGAGCCCTACGTGATGTCATATCTGCATTATCACACGTAAAATTCACATTTTTG
CTTATTCAATTTTATTACAAATTTAAGTATCTGCTCGTACATTTCAAAACTAAAAAACATGTTTATATATTATGCAAGTTATTTCTATATTTAGTTAGAT
ATAATGGGGATTTTATATCATTTATTTCTAATACAATAAATATATATTAATATATACTCGCTTATGATTTGAAAGTATTAATTGGAAAGACCTTCTTTTA
ATAAATAATATATATAAAAAAGGAACTACTAAGTCACATGATTTTGAAACCAATAGAGTAAATAATTCTTTATTTATACAACCCCACATGTTAAAAACTC
TATTTTTCTTTGTCTTTTATTTGCAAAGTAATTCAAGATTTCCTTTGCTATATATATTGTTTTTAAGAAAGAAGAAAAAATGGAAGAAAAGATAGAGAAA
ATATAAAATACCATCAAAGAATATGGTGTCATGAATAAAATTATTTTCTCTTTAAATGAAAATTTTGTTTTTTAGCTTCGAGTTTGAAAAAAAAAATTAA
TAAAGAATTTTATCCGACCAAAGTCGTTTAGAGGTCATTTAATAAGAAATAAGTTATTCATCTATTAATTTTCGTATAAGTCATACGGTGTTTTCTCGGT
AAATGCAAAATAAGTTATTCTGCATAAAATTAATACGACGTTTGGTTGACAATTTAGAAATCCGGATATATGATATAACTAAAAGAATTATATGTATTAT
TTAATGCTATGATAGACAACTAAATAGCTAATACATGTATAACTAATTGATGCATAACTAAGTAACCATAAATTCACTCGTAACTAATCCCTATATCATT
AATATCTGGATAACTCTAATCAACTACTAAATGACCCTCAGGTCTATCTAATATTTGAATTAGTCTTTGTTTTACTATTAAAAAAACAAAAAAGACACAT
ATAAGTCTGTCTAACATAAATTTGAATTAGTCTCGATTCCAATGCAGATAACGAATATTCGAAGAAAAACAAAAACAAATAAATAAGGGTGGGGTGGGGT
GGGGGTGTGCTGGGGGGGGGGTTAAAAGTTTCAAATTAAGTCATTTTCCTTAATTTAATAATGTGGGTGTTTATCTATCCCTAATCTTTCTCCTATATTT
TCTCACTCTTTTTGTTGCAATGTAAAATCTCTCTCTTTTTTTCCCTTTTGGCTTCTTTATTTGAAATTCCTTAAGCTGCTGACACCTTAGCTATCTCTTG
TTGTGTTTCTCTTTTCTCAAACTCTTTTTGTTTTCATTAATAACTGGATCTTGATTTCTTTTTCTTCACCAAACTAACAATTTTGGGGTGTTTTTGCTCA
AAAAAGATTCTTACTTTTTGTTCATTTACTCATTTTTAAAGCTTGGGGTTTTGCATTACCATTTCATCTTTCAATTTTGTTTAATGGGTCTTCAAAAAGT
TTGAGTCTTGGGTATTGTATAATTCATGTTTTTGAGTTTTTGAGTTCATTTTTTTTTTTAAAAGGGGTTCTTGTATATTGAGTTTTAAGCTTAATTTCTG
TGTTTTTTTTTCTCTGTGTTGAATTCTGTTGATTTTTTGTTGAGAGATACTGATAAGTGGTCACTAGCTCCCAAGACTTTGTTGGACTGCTTCACTAGCT
TTCTTAATTCAGGTATGATTAAATGTTGATTTTGTGATGAATTTTTTTAGTTTGAGCTTGTTATGTTACCTGGTTTTATTAGGCCTTTACTTGTCTAAGC
ATTTTTGTATGTATTTTTTTGGTGGGGGGGGTGGGGGTAGGGGAGGTGTGAATGGGTTGTAATTGGTGTGAGTGAAGTCTGTAAATTTTAGGAGTTCATT
TTCATTTTGATAACAAGGAGGAGGATATACCATTGTAATCTCATTAGTGGGGTGTGGGGAGGGTGGTGTGTATGCACTCTAGCACAACAAGGAAAAGAAA
GATCGATTCTTTGGAATCATTTGTGAAGGTAAGAGTGCTGTGGATGAAGTTTTATCGAACAACGAAGAGAAAGATCGATTCTTTGGAATCACTTCTGAAT
GTAGAGTGGCGTGGATGGAGTTTTATGGAACAACGAAGAGAAAGATCGATTCTTTGGAATCACTTCTGAACGTAGAGTGGCGCGGATGGAGTTTTATGGA
ACAACAAAGAGAAAGATCGATTCTTAGGAATCGTTTCTGAAGGTAGAGAGGTAGGTTTCGATAGATTTTCTTATTTGATTAGGCGTGTTAAATTGGTTTT
GGGGTTTGGAGGGGGTGGGGCTAGGTGTGAATGGGATTTTGTTAGTGTTAGTGAAGTCTGTAAATTTTCAACTAGGAGTCCAAGTGTGAGTAAAGCTAGT
GTTGGTCATGGATTTTGAAAATTTCTTCATATATTTATTTGGCCATGAAATTTGACTAGATCTTGAAAAAATATCTTCAAAATATTTTCAAGTTTCCAGA
CCAATTTTTTGGGAAAATTTTCACTTCCACTCGTAAAGCTTCAATTTTTATCATAGAAAAATGCATGTACAGACACAATTTCAAGTTTCAAAATCACAAT
TTCAAGAACTCAATTTTCAAGTTTCGACTTCAAAATAATATTTTGACGTGGTTGAGGATTAGGTCACTTGGTGAGCTCCCTGCCTTCCATAGTGGAGGTA
GAGAGTTCATTAGTAGTGTAGCTTCCGCTTCCGCTTTCCCCGGTCCATGATGTAATAAAGGAAGTGTAGGTATTTTAACTCTTTTAGTGTGAGGTTATGC
TGTGCAATACAATTAACAAGACGTTTTGTACATTTTTGCTTATGTTATTTTAATCAGAATTTTCATAGTGAAACCAACAAGAGCCTATTGGTGGAAAAGG
TTCCCCAACGAAATTGATTTCCTTTGCAGCTAAATCGTTGAGTTCGTGGTATGCTGATTTTGAAGCTAAACGATTGATCAATATTACAGTCATCTTCTTT
TATTTTTTTGTTTTCAGAAGTTAACAGCTTCTTTATTTTATTCGACAAATATGACGTATATATTTATTTGCTTTGATCAAATCGTAAAGTTATTCTATAT
AACTACGATTGAGCTCAGTGAATTTCTTTGTGGACTGCATAATATAAACACTTTTACTTCTTCTGTTTCATCTCATTTTACCCCAAATAACTTATTGTGT
CGTTTTATTTCGTGGTTAATGAGATAAGGTGGGTCTGGTGAGTTTTTAGAAGTTTGATGCCTTGAATTATTTACCGGGGAATTCTGAATAAGTTATCCCT
TTTCATCTTTTATGTTATTCTGTGTGAATCTATGTGAACTTGCTTTCTGAAGTTGGTGGTTTATATCTATCGTTTCTAAATTCTGTGGGTTCAGCCCTTT
TGTCGTGCTGTTATCTGAATAAAATTCTCAACTTATCCCAAGTTTTTTTTTGGCAGTTTGTGATATTAAGCTCGACTGGCTTCGTCGTGAACGAGGTCAC
TCGCTTGGAACGTATCGCCTTTATTTTTGCCTCGACTTTATAACAAACAATTTTATCTCCTTCTATTGGCAATTACATGCTATTTTTTTATTTATTGAAC
ATTTTTAGGATATGAGCATCAAAAGTGAAACCGAGGAAAGGATGACATCCAAAGTTGACATGGATTCACCAGATGAAGCTAGCGGTGGAGATTTAGGAGA
AAGTGTACCACTTAAAAAAGGTCCCTGGACTTCTGCGGAAGATGTAATTTTAGTGGATTATGTAATGACACATGGTGAGGGGAACTGGAATGCTGTACAG
AGGCATTCAGGACTTGCTCGTTGTGGTAAAAGTTGCCGCTTGCGGTGGGCAAATCACCTGAGACCAGATTTAAAGAAAGGTGCATTCACACCAGAGGAAG
AGCAGCGGATAGTTGAACTGCATGCTAAAATGGGAAATAAATGGGCACGCATGGCTGTTGAGGTTCATACTATCTCTCTATCTTTTCATAAAATCTTCAA
ATAAAATGTCTTTAACTGGCATCTGTCATTTATGTTTTTTACTTCATATTAGTTCCTATTTAAGTTGGATTTCCTACCTCCGATAAGTTAGAGGTTTCTG
CCATTACTGTGGACCAGTAGTCCTTGATAAGTACTCTCTTTATTACTCCCTCTATCAGATTTTATGTGGTATGCTTTTTTTTAGTCTATCCCAAAAGAAT
GACATATTTATATATTTAGAAACAATCTAACTTTAAACTTCCTATTTTACCCTAATGAGATGATTTAGTACTACAGAGATGTCGATGGCTTGTTTTATGC
CTTAATTTCCTCAAGTTTCAAAAGTCTTTCATTCGTAAACGTTGTGCTCAGTCAAACAACATCAGGTAAAATGACATGGAGGGAGTAATACATAAATTTT
TTGATTAAGTAACTAGTGCTCCCTCCATCTTAATTTATGTTGCACTGTTTGGCTTGGCAAAAAGTTTAAGAAAGGATGACTTTAGAAATTCGTGGTCTAA
AATATATCTTAGACATTTTGTGGTTATAAATCATTTCATTAAGCGTAAAAGGGGAATTTTAAAGTCAAGTTGTTTCTAATTATAGAAAAGTGACAAAGTT
ACCTATTTAAAAAAAAATATAGAAAAGTGATGTTCAATTTGAGATAAACTAAAATGAAAAGGGTCCGACATGAATTGGGACAGAAAGAGTATTGTTTTGA
TCAGTATGTCGTCTAATTATGAGTTTCTGCTATCCTTCAAATTTCCAGTTGCGTGTCAGGGGATCTTAATCTGTTCAGTCTTTTAATCAGATTTAGTTTT
TTTCTTTCCGGTATCCCCCTGCTTGTAATCATGATATCCCAAACTCTATATTTGTTACAACTTTGTGTTATCGTGTTAAATTATAATAAGTAATCCTCAA
TGATACAGTTGAGGCCTTTCGGAAACAGCCTCTCTACCTCCACAAGGTAGTGGTATGATCTGTGGACACTCTACCCTCCCCAGACCCCACTTAGTGGGAT
TTCTCTGGGTATGTTGTTGTTGTTGTAATCCTCAATGATACTACAATGTACAACGGACAAAAAACACAGTAAGATCCTCACTAAGAGCACTTCCTAAAAC
CAGTCCTGATGGCTCCTCTTGTTGGACTGAACATGGGCCTACCGAATTGTTTCTCAAAGAACTAGCAACTGAGCTAACTTTGGCAGTCATCAATAGCATC
AGTCATGTCAATAATTTGCTATGTAACTAGAGCTGCATTTTCTTTAAATCCTGGTCAGAGTATGAAATGAATTTCCTAACTGATAGACTTGTTTCTGTTA
CGTATGTCGATTGGACTCATTTTCAGAACTGAAGTGGACTCAGATTAATCTATCTTTTGAAAATGAGACTTGAATATTTAGAAATATAAGAATAGTACTA
CGAGATGCAAATTTCTTACTTCAAAATGATGAAAACATGTACTTCAAATCTTAATGAAGATTGTTGTGATAATTCCTAGAAGCATAATAGGGCTACCACT
TCGGGGCACACGGTTCTGAGCCTTAAAATCCAAAATATTACATCTACCCAAATGGGCATTAGGGGTTGATAATGTGAACAGTGTATGGCTGTACCAGCGT
AGCTTTGCCAATAAGGCTTTTGTTGGCATTTGTTTTTTCTGTATCTCTTTAAATAGAACTAGTCATTCACTATTGAAGTTATGTTCTCTGGAGTTTATTG
CTGCATTTATTTTGCTCTATGTTCGACACTAAGGCGTGTCCAAAATCCACCTAATTATGCCTTGATCAGAAGAGATATGACATGGATTTAGAGATTCATA
TACCACTGTAACAGTTGCCAGAATCCAAGATGTAAAAGGTTTCGGGCTCAATGAGGTATTGCATCGTCAAGTCTCATCTACATAAACAGATTTATATGAA
CATTTATTGTACACTTGGTCATTGTCCCTTGACCAGGATCAGGAAAGTAGAGAAACATGTTTGCCTGGTTAAAAGGTGAGAACTGAAGTTACACATAATG
AACGCCATATTATCAGAGCCCCTTTCTCCCAAGACGATTTTCTCTAATACTATCTGCTGTCACTTGTAATTGTCCAAGTTACATTCTTCCATCATTTTGA
TACACATGAGTATGCTTTGGCCTTTGGGTGATATGTATGTATATCTTGTGCGATAATGAATGGTGCTTTTGTTCTTTGTAGAACTTTTACAGTTATACTT
CTTTTCGTATTTTTCATTTAAAATAAGATCTCATGACTTTGTAAGAATCTGTCTCAACACTTATTTAGTCCCGGATTTGCTGTCCAACTTCTACTTTAGG
TTCTCCGACAGCTCATAATACTTTAGTAGTCTATTATGGACTAGGAAAGGTTCAAATTCTTTAATACACTAACCTATCATTTCTACGCTGAGACCTGCTT
CTGCATAAATACCATAATTGAACTCTTATCGCAATAACAATTAAAGAGAAATAATGTAAAGCTGGAGATATAATTTACTGAGTAAGGAATGTGATATCTT
CAAATTTCTTTTCAGTTTAATTATCGGTGGTATATGATTCATATTAACTTTTGTTATGCCTTTTCTACCCTTTCAGTTGCCTGGCCGTACAGATAATGAG
ATAAAGAACTACTGGAACACTAGAATAAAGAGACGACAACGTGCAGGCTTGCCAATTTACCCTGCAGATATTTCTTTCATGGCAAGTCAGAACAAACAAA
ATGAGGAATTGGGTGCATTCTCCTCCGCAGATGCACAAAATCCTGATGTCTTGGGAATTAACAATTTTGAGATTCCTGCTGTGGAGTTCAAAAAATTGGA
ACTCACTCATCTGTTGTATCCGCCACAACTTGCAGACATTCCTGCTCGTAGCTTGCTTAATGATCCTGTAAGTAACTTTCTGTCCCAGGGTCATAGAGCT
CCCTATAGTAGTACATATTTCCTTTCTACAACTTATCCTGCAAAGCGTATACGAGGATCAGAATCTGTGTTCTCCGGTTCAAATGGTGATCTCCTCAACT
CCTTGCAATATCAGAATGACGGTTCTTTGCTTGCTCAAGCTCAAGCTCAACCCTTGGATTTTTCTTCATATAATCATAATTTAACATATGATGATCAGCG
AGCAATCTCAAATATAGTTCCGGGCGGCCATGCCTATTTAAATGGCAACTCCTCTTCAGAGCCCACATGGGCAATGAAGCTGGAGCTCCCTTCACTCCAA
AACCAGACAGAGAACTGGGGTTCACCTCATTCGGCTCTTCCTTCATTAGACTCTGTTGATATTCTAATTCAATCCCCTCCAGCTGGACATAGTGAATCCG
GTAGTCTGTCACCTAGCAACAGTGGTCTACTGGATGCTGTGCTTCATGAATCTCAAACTATGAAAGCTTCAAATGATAACTCATACCAAGGGAACGAGAC
ATCTGGTAATGCAGTCAATAATTCATGTCCAGATCTCAAAGGATGTGATATTTATGGGCATCCAGTCTCTCCTTTAAGTCAATTCTCTGCATCAGTATTC
AGTGACTACGCCCCTATCAATGAAAGTTCATTACACGAGTTCCCGTCAATGGCCACAATGCCAGGTAAGGACAGTTTATTTACTGACTACTACTGGTTAT
CTGCATAGCTGAAGTTTATTGTGTTACTATAATTGGATTCTTCCATGATGTTGAAGGAGGCGAGATTAAGCAAGAGATTGGCGATCTATCCCCCTTGGAC
GATGAAGACAACACATCAAACCAGACGATCTTTTCCAGTCCCAAGACACAGCATGCTAATAACCATCTGGCTTCGAAAGATCCTTTTGGTTCTTGCTTTT
TCGATGATTGCGACTGGGATTGCAAGCAAATCCATGCAGTAACCACATCATCAGGTCAAGCTAATGGACACAATTCTTGTTCTTGGGATGCCATATCAGC
CATGGAAGCAACAGGAAGAATGAGATTATGACAGTTTTGAAGTTTTGGTAACATCTTTCGATACAACAGGTTGTTATCTAATGACACTGAGCATGTAATA
TGAAAACACTTCTGGATTTTCCTGTGTGCTTCGGTTTAAGGCAATTTAGAGACAAACAATGAAACTTTTTTTAATGTGGGATCAAATTGGACTTTGCCTT
ATCTCAACTGTGTGGGCTGTTTTCGATATTTCATATCGAAAACAAGTAGAACATAGATGCACTAGTTAGCTTGAAGCAATTAATTTGAAATAAAACGTAA
CCAGGTGCACTAAGTTCCTGTTTTCTGCGGGATACGAAAGAGTTTGATCACATTCTTGCCTTTGATGATGTATATTCACTTAAATTTTGAGTGCAATCGA
TATAATTTCACAAGCGAGATTTTGTAAAGAATATAAAAAAGGATACATTTTTTGAGATTTCACAAGCAAGATTTTGAAAAGAATATAAAAAAGGATATAA
TGTACAAGGTAAATCCGCAAAGGAGAGGTAACCTTTCCTAGGCAAGCGCAATTTGACGAGCTCGATTCAAAAGACTCGCTGGTAAGAGGGTTCCGAATTT
GAGACCTCGAACATGAAAGTCTCAAGCCCAAACCATTGGGTCAAAATTACATATTTGATAAAATGGGTTGAATAACATAAGAACCAAAAATATAATAAAG
GCAATGCTCAAGGCTAAATCATAATTTCCACTATTCAAACAGACATGAGAAAAGAGAATCAACCAAACAACTCATATATCAACAGAAGAATCAACTCATT
TCTTCCTATATCAGCTGCTCCTGTCTTAATTCAACAGCTTAAATGACAGTTCTGATCTGAACTTTCACTGAATGTAAAGAACACAACTAGTAAAACATTT
GTAGCTAAGAGTTGGTCTTACAGAGTTCCGGAGCAACGGCTACTTGCCAGCTTAGGAATTCAGAAATTTGGTACAAAGCCAGAGAAGAGGCAGCATCGTT
TTTCTACTATGCAGCACTTGTGAAGTAGAAACAAGAGAAATCCTCCAATCAGGGGTTGAAGTTATCAAGGCTATAATGGCAACAGCAAAGGTATCGACTT
TCTAGAATCATGTCTTAACCCTAAATAGCATACTGAAATCCAAACTTGGTGTCAGCATAAGCGTTCAAAAACTCAGTATGACTGGTATTACAAACAGACT
TGTTCGGTATCTCAGAGAACTATAGTACAATTACCCCTTCCTGTAACATTTTCAACACATCTTCCAATATACAGAACAATAAAACCAGGGTTCTCTATCT
AAAATCATGTCCGGTGCCTTACCCTCCTGCCATTGGTATCACCACCATCTGAAAGCTGGGCCCAAACGCTTCTAGACTTTCCGCCTCCACTGCTACAATC
ATCCTCACAACCAGCAACGGTTTTAAGAAGCTCTGACTGAAGAGAAGGGCAGTTTTCCTTAAGGTATTCAAATCCATCTGATTGCATGACAGCTGCAAAA
ACATGCCAACAAATAGATGAGGGAAACTGCAGTGCAAAAAAAGCACGCAAAAACACACCTGCAGGCTGCAGTTTTCCATATATCGTAGCCTTTATAATAG
AAAGGTCCCCAAATGAACTTTAACACTAGTTATAGTCGACGCTAAACTCCCCAAGGAGGCAGCAACTCATCAAACAAATGCTCGAGACATTTGGACATCC
AAAGGGATATGCACGTTCTTTTGCAACATTCTATAGCATAGTCATTTTTTTTCTTTGGATCAGGTCTATAACAGTATCTCACTTAGCCTCATGACTTAGT
GAGATTTCTTTTAGAGCCCACTTGATGAGAAACAGGTTTGCAATTAAAATAAACTTTGTGATTCATTTCATCATTTTTAGCTCATTCACCAAATAATAGC
CTGTTTGAATTGGTTTATTCAAGTGCTTTAAGCACTTTTGGAGTATTTGGGTAAATTAAAAAATGCTTATAGCACACTTGGTTTTAAGCTAAAATGACAA
AAATAAGACCAAAGCTATTTCAGAATTTCTAACTTCTGGTTTTTGGCTTATAAGTCAAAAACTAAAAGGCAATCCAAGCAGGTTCTAATATTTCAAGCCC
ATTTTAGCAACAAGTGCCCCCTCCCAAAAGCACTCAATAACAAAACCAGAAAGTAATACATTGACCTATAATTTTTTTAGGTGTCTTGATTCAAATTTGA
CACATCCTAACTTGGTGAACACCAAAGCTTCTGATGCAGAAATAAGAGGCTGTGTTTGATGCTTTCTGCTTTAAGGGTTTACAGTGGTGAAGCCAAGTAC
ATTTCTCTTTCAGTTCAGAGAAAAGTCTCATTGCTATTTTGATGTTCATATGCAGAAAAGTCATTTAATTTCCCAATTGAGAGTTTATTTCACTTGAGTG
GATTCCAATCATAAATCATTCCATGATGCACCCTAATGCAGCTCTAGAGAAAAGCAACCTAACAACAGAACAACGGTAGCTGGAGTTTGACAGCTAAGTC
AGACTTCTTTTGGTGCTATGTAGCGTGTGGCTTAAGACTGGAGGTGCATAGCTGGGTGTAGTCTTGCTGGTACAACAAAGGGAGATTAATGGTTCCATAG
AGGTTCAGTTGATAACACAATCGGGTGAAATTGTGTTCAACGGAATTGAAGTCAGCATGTTATCATCAGTGGCACAGATGTACATGAAAAATCATGAGCA
CAAGTTATAACCATTTCTCATCCCTTCACCAGGGCAGGATAGCAATCCACTTCATCAGTGTACTAGTAGATACTTTTTTGCTAGGGGCTTGTTACATAGT
CTAGAAAGGTACTGATCACATGTATATCTGGGATGACATGCAGCTCTTCAAGTTTGTAAGAAGAAGGGAGGCCGTGAAAAAACAAGAAGGTAAAGACAAA
AGAAATGCATCATAGAAGCCCTTCACACCCAAATCTAACTCTTCAATAAAATATCTCTAGAGAACCTCCAATGCAAGAGAACCCAAACTGTTGAATATAG
GAATGAAATGGGTCCAAATGGAGCGAGAAGGACACTGAGTATTCATATAACGAAGCCTTAGCTAGTAATCAGGCAGAGCTTCTGTGTTTGTCGTTGTTGT
TTACGATACTCTAAAGCAGCTTCAATTTAGAAAAGTTCTAAGCAAAATGCTCTTATTCAACCTGGCAGCTGCACTTCTCAATTTTCAGTATTTTTCCATG
AGAAGAGTAAAAAAAAAAAGAACATTCTCAATAAAAGAAGAAAGACTTATTTCCTTTATGTCCTATCAGACATAAAATATATGGTCAGCCTCAGGAAAGA
AGCGCATAATGCCCTACTGAATAGGTTCTGGAAAGGGGGGGGGACACAAATGACGAGGCAAATGCACAATGTTCATGCTAAACAAACCACCTGTTTTCAT
TCATTGCAATCCAAGACAAGGAAAATGCACTAGTTTCACCGAAACAGTTCAGGAAAACTGCAGAAATCACTATAAAATATGGACAAGTTGCAATAATAAT
ATCTCTTGTACCTGCAAGATTTTCAGCAGCAAACCTAAGGCAAACTGCTTTGAGTTCCGTGGCATGGTAACGGTCAGCTAAAGCAAGAGTTCTGGAAACA
GAGTTCACCGAGATATCTTTGCAAAGATGAGATTCGCACACACGCCTGAGTCTTGTTAATTCATACCGATCGGCTGCTGCTAGCAATTTTGCTGTCAATG
TATCGGTCACAGAAGGAATAGAAGAAGAACTAGTATCTTCTATCTCTTCATCTACAAGAGAATCTCTGTATATGAAGTGCAACATAGCCTGTTTTGTGCC
ACAAGAATAGATATATCAAATGAAGGGTGAGTGAGAATTTCATGTTTTTTCTGAAGTTTTTAATCTTTTTCAGCCAAAACACGGAAGTTACTTTGGAGAA
ACAAATACAGCAAGAGAGATGGAGCAATGCCACTATTTGAAGCAATGAGAAATTCAGTCTTCTTCGACAGCACAAGAACCAATTTAAAATAAAATGATTA
ACAAAGTAAAAATGAAAAATGAAATTGATGCTCACTTTAAAGACCCTGGGTTCCATATCTGTGACAACAATCTCCTGCTTATCGCCCATCAGTTCATCAA
ACAATTCAGTGCGAAATACAGGAGAACGAGCAGTTAATACCAGCTTATGGGCATGAAATTTTTCACCAGCCACGCTGAAAACAACATCAGTGCCTTCCAT
ATTCTCTAATAGCATTCCAAAGTGTGATCCCATATCAGAACCTGGAACCTGGATTGGCTGTAAGCTCGCGATATCAATTGTAGAACGAACAACTCCCACA
GTACAGTTGATTTTCAAACAATCATCCTTGAGATAATCTGAATTCTCAAGTAAAGCTCGTCTAAAGAAACGTTTGTATCCCCTGCATACACACAGATAAA
CAATATAGCAAATTTTGTCTTATGTTGTAACAGCAAATATTAGGCTTAAAGTGAAAGGGAAAAATAAAGGTCGATTAGGCCCAGACAGACTCTAGTTTGT
ATTTTTTCTTTTCACATTCATGCCAAAGAATAGAAAATTTCAAGAAAGGCAAAAACCTAATAACAGAGCATGTGCCAATAAAGGAATTGCATCACTGTCA
GCACGTACCTAATATTGCCCCTAAATACTTTGACCAGTTAGATCTACGTTGCTTGGACTCGGGTGTCCGTATCCCCGAATACTAAAAGCTAAACACTCTA
CCCTCCCGGACCCACCTGTGGGATTCCACTGGGTATGTTGTTGTCGTATCTAAGATAAAATTATAAAACTATGAGGCAGGATTGAGTAGGGGATGAGGTT
TGGAATAGGATTTTGGGGGGAGGGGGGGGGAGGGGGGGAGCAAATAATGAGAGTAGGGAGAAATCCATGGGACTCGTTTCCTACTTTTTACAATAAAAGT
CATTTTCCTTAGTTCCAAGAAGCTTTCTTTCCTAAAGAAAATATTTTCCAAAAGTTTTTACCAATCGAATAAGAGAAATACCATACCAAACACAGATGAC
AATTAGTAAGTAATGAAGAATTTTTTTGTTTCATGCAATTAGTCGATAAAAAAGGATATGATTTCCTTCTAAGAGGCAACACCAAAGGAACATTCTTTAG
TAATTTCTTTAGACTTCATTAATTATTCTTCTATCAAATGTATGAATAAAATGTTATTCCTATTCACTCAATATTTCGTAAAAACTTATAGCTATGTTTT
ATTAAGCATTCTTTGCAGACATACTTGGCATTTTACTGAAAGTTGAGATCTTTATTTGAGAAAGTAAAAAGAAAGAAAAGAGAGCTTTATAAGGAAAGCT
AAGTTGGAATTAGCTAACTTATCATTAATTATCATATATAATCATTGGAATCAAAGGCGTTTAATTTGATAAATATAATGTCTAATTGTAAAATTCAGGT
ATGATCATTTAACCTTTATGTGAGAACTAACAAAAAAGGTGATGAAATTCTATATGTAAAAATGATCTATAAAATACTCTGTGTTACCAGGGCCTGAGGC
ATAAGGGTGCAGGGGAACTTCAATTGAACCCGATTTGTTGATTGTTATACTATGCAATGTTACAATTACAACATACCAAGGTACTACATCACAAGCTTTT
GTATTTATAGTACTAAAATATTGCGAAGGAAATATTATAAAATCTACTACATATATTGATAATATACTTATAAATCTCATATTTGAAAAAAACATTAGCT
CCCAAAAATGATATATGACTTGATTTTCGAATTACGGGAATAACTACTAAGTAATAGTAATTGATATTTAAAAATTAATTAAAATACAAACATAATAGTG
GGAGGTGCAAAACAAAGAAATAACTTCAATGTCGAAATATATTGACAAAAGAAGATGGGGAAGTGAAGAAGTAAATGAGTTAATAATTTATTCATGTTTT
GTAGATATCATCTACTCTCTCCAATCACTTTTACTTGACCTCTTTGAACTTTGCACGTCCCTTAAAGACAATGATATATATGAGCATTTTACTGCAATAT
CCATACTAATTAATGTTTAGCCTTAGATCTTGTGAAAATAATTTGGATATAAGTAATTAAATATTAAAGGTAAGACATGAAAACAAATATGTTTGTCTAT
TGAAATGCCAAAAGTGATGAGTAAAAGCAAAAATATATTTTTAGTATAGTCGACTTGCAAGAGTGAATGAAGGAGTAAAAAAGTTGAGATTTTAATGACA
GAGAAGGTTATAACGTTACACTCTTTACAAACTGTACTTGATTGCATTATCACAACATACATAGAATTAATATTAAAAGGACGGGTAGAAATCAACTTTC
TATCTTCATCCATGGATCCTTTATTCATACTTATTCAATTGGAGGTATGATCCAATCTATATTACCTTTTCATTTTATTTATACAAAAGTATCAAGTAAT
GTTATTCTTTATTATTTCATTAAACTTGTTTTTGTACAGAAAGAAAAAACAAATTTTATCGCAAACTGGTAGTGAGTAGGAATGGAGATTTCATACTATT
TTTCAAAACTCATACAATTGTCCTTCAACTCGATAATTTGACTAACTTCACTTACAGAAAGTCAACCGAGCAACGAGAGAGAGTTGTTCGGATGGTAAAC
ACCCTTACTTTCAACCCGAAGGTTGTGAGTTCGAGTCACCAAGGAAGCAAAGTCATTTAGTTGTGTCCACCAAGAAAGTAAGAAATGCATCTAAATACTC
GAACACAAATTGTCATACTTAACAGAATCCCAATTGAACTCTGCCTAATCGAGCTTACCAAAGCATAGCTGGTTCTGAAGCCCGCTATGAAAAGGTGTGT
CGCAGTAGGTAGACAACCAGCATAATATCATCTAACTATAGTTAATACCCCTAATACAGAATCCTGAATAAAGAGGATAGAAATATAATTACAGTCGACC
CCAACTAATTTCTTTCACAGCTTCACATAAGGCAGAGGAGTTTGATCATTTTGGGGCAATGGTGGACGCATAGAGGCATACTAGATTTACAACAATGACA
TACCCAATAAAATCCCAGGGATCTAAACAACATACTTGATTTGATTGAACAAAATTCTAATCAACACAATTGGAACTAATACTTCCCAGAAAGCTCACAC
ATAACAGCTGCAACAGCACATCTTTTTAACATAAACCAATACAATAAACAACAACAACAACAATAAAGCATGAAATTCACTTCAAATTAAAGCTAAATTA
CATAAGCTAAATAAAAAACACAACTTTACCACTGCCCCAAAAGCTGGACATCAAATTAAAACTAAATTAACAGGAGTTAAAGCAAATTACCACATGCTGC
CGCGGTATTTCAATGTATATGGTCCACTTTCAAGTGACCGATCAAAATGACTATGAACCTTATGCTTCTCTTTACCACTCTGATCAACCAACGTCAATTC
AAACAAAGCCCTAACATCCGTTCCTTCACTCGCCAACGCAATAAAAAGTGACACATACGTTGAATTATCCTCAGGATTTTTCCCATCGGGATAAAAGTAA
ATAGCCCATTGATGTCCACCAACGGTGAAAGTATCACTCGCGATGTGTTTCCCAACTCCCATTCCTTTCGCCAAAGAATACCCCTGAATCACAAACCGGT
GTGAACCGTTTACCGTTTCCGTCACCGACCGGGAACTCGTCGCCCGGGTTAACGGACTCGTATCGGAGACGTGAGTGATTATCGGCTGCTCCGACATTGT
GAATTGTGGATTTTTTTGGCTCTTTAGGGTTTGTAAAAGGGGAAATTCATGGAGGAAAGGGACTTACAGGGAATAAATTGAAAAGTTTAGGGCAAAAAAT
GGGAAGATTGAGAATGAAAAATTGATTTTTAGGGTTTTGGATTTTGTTCGGAAGATTTGAAAGGTAAAATAATGGTCGGAGATTGGGTGGCGTTTAAGAA
CTTTTGGAGGAAAAATATGAGAAGTGTGAGTACTTCCCATCTTAGTATATGTTTTATGATTATTTTATTTTTCCGACCGACTAAATTTAGATACGTGTCG
TGTAGGTATTTATACGAAGATAGTGTTTTCAATGTAAGATTTTTTTTTTTTCATATTCAATGATCGAACACGAGAATTCTATAATTAAGGATTTGATTAA
GGAAGAAGTAGATTCGTCGTTTTGCACCAGATTTTTTGATGGTTGATGTGTTCGTTTTTATTAGGTAGCTTATCGAGATTTCATTAAGTTATGAACTAAT
TATTTAGATACACGCTAGTACACTAATTTATGATGTTACGAAATCTAACCAGATTTTGGTGTGTTGGGATACATGGAGTCAAAATTAGGTGTAATTTGTT
TTAGATACACTGTATCCGAGTAGATTCACATATATCTATGATACATAAACAAATTTCGCTCGCCTCCCATATCACTCGCCACTCTCATATCTCGCTCGTG
TTATGATACATGTGAATCACATCATATATGTGTAAATAGTAAGTATCTATTATTTAATATGATTCACATTTATATGACTTAAATTTTGGTATGGGATTTT
TAAATCCGAGAGAAAATGTAATTATTTCAGACCATGGGGAGAATTAAGAAAGATGATTGAAATGTTTATGTAATTAAATAATTTTTCCAAATTAACTCGT
GTTTCACTTGACAGGTATTTTACTAATCATATATTTATTTAAAAGAGAATCATAAGCTCGCCTATATGGCGCAATCACAAACCAGGATTCACTTTTAACT
TATTTATTTTCAATATAAACTTTTTTCTTTCATGAAAAGTTGCGATTTTTTATAAAAAGTTGTAACTTTTACGAAGAGTTACAACTTTTATGGAGAGTTG
AAAATTTAATGAAGAGTTACAACTTTTATAAAAAAAAAATGATATGTATGAAAGATTTTGACTTGTCCAAAGTGTTGCGACCATTTCGATAAGACACAAT
AAACATTTATTCACACTACTCTTTGTTGTCTATAAATAAATAGATTTTCTCTCATTTTATTAATTCAACGAAAATTCTGAACTACTTCTTCTTCTGCACA
ATTAAATATTTGTACAGTTTGCTCCTGTTTAATGGCTCAGTGACACCATTGTTATTGTATCAACACACTGCCAAATAAAATCTTTCTGCCTTGAGAGGAT
CTATTCCTTTAAACCTCGATTTCTAAAATGAAGTAATTTTCTTAAGAGATATTGTGCATTCAGTGGGCTCAGCTTATTCCTTTATGTTTCATTTTATTAC
TTGAAGATCCTGGTATATTTTTTACAGTCATTAATTTATGTTTATTTTATTAATTTTTATTTTTGAGTACATGTTTTAGATTTTGTTGTTTATGTTTATG
CTTTTGATTATTATGTTGAAGTAAAAATATGTTAATCAAGAGTTTAATGTAGCCATTACATTGTTGGTGTCATGAAGATTATAATTCTTAAACTTTTGAA
ATAAATGACTTTGATCTTTATAGTGTTTTCACTGGATAAAAGATCCATGAAATGTCCAAGAAGGAACTATGAGTGTTCAAAAGCTAGGTAGTTCTACAGG
ACCTTAGAGTTTTATTTATTTAACTTTCTATTTTATCGAGGCATTGAATCGATTAGTGACATCCAAATAATAAAGAAATGTAGTGGGATGGTAAGTATTG
TACTCAACCTTAATTAAATGTTTAGGGTTCAAATGTTGGATTGGAGTCAATGAATTACCCCTCAAAGTAGGATGAATTTATATTAATTAAATATAAAGAA
AATAATTATCTCCCTATAACATTAGATTAAAAGTCCCAAAAAATTAAGTTTTAATCATATTTATCGAAACATAAACACAAAATATGTCTTTTGTCTATGA
AAGTAGTGTCATCGACTAAGTAAAATTTTGAATAAGGGATTTGCCAAAACATCATTTAATCCAAATTATTTGAGCCACGAATATTATTTCATTGAAATCC
AAGAGATGTATTTTTATATTTTAAACTTATCAAGTACACAACTAATTATATTAAAAGTAAAATATTTAGATTTTGTAGGTAGAATCATTGAGTAGGAGAA
AAACACTCGCAATAGATGATAGAAAATGTTTGTGCAACTTTCTGAACATACAAATATAGACAATAAAATAATTATGTATCTTCCGAAAGACTTTGGTGAT
GAACAATAAAATGAAGAATTATTAACAAAATTCATAAACACTTGGAATCAATTTTTTGTTTTGTTTTAAGATTAAAAAACATTTCATATCTTCTTTCGAT
AAAATATTCTTGAAAATCTATCATAGGGTTTTACCCTCTCGAAAACACTTATATTATCAAATATTTAAAAGTAGATTATTGACGTAGTGCACCACCGCGC
AAAGCGCGGACAATTTACCCAGCTAGCAATAAAATGATAAATTTATTATATTATATTTTTAAGAAAAGCTTTCGTATATAGCCACTCAAAAATAGTTTAA
CTATGTTCCATAGCTATAATTTGTTGATTACGGTTCATACTTACATGTTATAGGGAGGAGAGTGACAATCCAGGTTGTGAAAGGGAGGAGAGAAGTGAAT
TGTATATGTATATCAGTAGGATATGTGCATATATGTTATCGGTATACATATGTATTTTTGTATCTGGTAAGTGAAATTGAAAGAAGCGAGTGAGAGAGAT
CAATAATTTACCCTTGGAAAGTAATGATTCACAGGTTTATTTGTATAATTGAGTTATACAGATTTTAGAATTATATGAAATATGATAAAACTCGAAATAA
CGAATTGATACAAACATAAATAAATTAGATTACGTAAATTATATTATATAACATTCGAAAATTATGTATTTTTACAAACTTTTATTTATTTTTTCTAAAT
TTTGAAAGTGGAAAATAAAGGAAAATCCATTTCTTCTTCTATGACCAATAAAATTTTTAATTTGGAATATTTTTTATTTAATCTTTTTTGAAAAAAATAA
AAAAATAAAAAAATCTTTTCTAAACCCCCTTTTACCTTACTATAGCAAGTACTAGTTCATCGACTCATTTGGAGTGTTGAAGAGCTCAAAGAAAATGGGC
GAAAATGGAGGAACCCAAATCTCAACTAACACAAACAAGATGATAACTGTTGAAGAAGCACTTGAGATTGTGCTAAATGTGGCTCAGCGTTTGCCGCCTG
TGACTTTGCCTATTCATGAGGTTTTAGGCAAAGTTTTGGCTGAGGATATCACTGCGCCTGACCCTCTTCCTCCATATCCGGCATCTATAAAGGTACTATT
TTTTCATACTTATGTACTGTTTTATCAAATGGGTATTGCTCGATATTGGAAAATATGTTGTATATGTTAGTGTTAATTGACTTTTCTTTTGGTGTTTAGT
TGTTGAATTTTGGAATTAATGACATGGGTTTTCTGGGAAAGTTATTATCTTTATATAGTTGATGCCCCTTTTCGCAGGTTGGAGTGTCTTAACTGTTGGG
GGGTTGGAGGGGTTATGTGTAGGGGTGGAGCCAGATAGGGTCAAGGGGTTCATCTGGACTTCCTTTTGGTGGAAAATTACATAGTTTTATGGGAATTAGA
TGCTGAACCCCCTTTGGCTTCTTGGTGTGTTTACTTTTGAATATTTGAACAGCTTTAGTAAAAATTCTGGCTCCGTCACAGTTAGGTGGCGAAAGAAGGA
TAATTGTCCTTATATTGGCCACCTGATGGTTAAGTGGCCACCATTTGAATGACAGTATCATGAGTTCCAAATCTGGCCTCGTTTAAAGTAGATGGGATTG
GTAAAGAAAATGGACTTTGAGGCAGTTTGACCTAAGCTAGCTGGTGTTGTGAGGATTGCTCAAGATCAAATGGAGATAAAAACCCATTCTTGTGAGGGTT
AGGTAGCGTAGGTAGGATGATTACCATTTACAGACAACGTGATGATTCAGAGGCCACTGTTTGAATGACAGTATCATGAGTTCCAAATCTGCTGGCTTTT
GGTTATTGCTATCAAAATGGTTTTCATCTACCTCTTTAATCAATCTATCAACTAAGCCTCGTTTAAAATAGATAGGATTGGTAAATGGACTTTGAGGCTA
ATTTGACCAAACAATGCTAGCTCGTTAGGTGAGGATTGCTCAAGATCATAAGGAGATAAAAACCCTTCCAATCAACGAACATGTGACACATAACAATATT
AACTATGTCTAACTCTATATGAATTTTCCATAGACTAATTTCCTTTATTCAGGCTCCCCAAAATGATTTTGCTTCATAGAAGTGCAATCAATCATAGTAC
CTGAGTAACTATGTTAAATTAACAAGAATTCTAATTTATGGCTGGCTTGCTCTTTTTTTCCAATAATGGCCAAGAGGGATTTCTCTGTTCCCACTTCTAA
ACTGATGGATGATGTCCCTTCCCTATGCTTTTCACCACTTAATGGAGTTAGGTTTCATTTGTTTGCACTAAATTAAGGTCTGTTAATTATTAAGATCTCA
ATCATTAAATACATTGTTTTTTTGGGTTTCAAAGTTTATCATTCAAATTTTAATTATTATATGCATTTGTTTATTATTTTTATGTTACGACCATATAATA
AGTCTGAATAGATTTGAATGAATAACTCCTAGAAATTAGAATAAAGTTGTAATATAATTAGTTCTAATGGTGAAACAGCACTGTGAAGCTGATGAATTTT
CCGGTCATAGAGAAATTCAGAAAATGCGAGATGTCAGCTTGTTCAAGGAGTATTTCTCACGATCAATGGGCTTTGATTTTTTTTTTGGGGGGTGGGGGGT
GGGGCGGTTGTTAAATTGACAATACATGATAAACTTGAGATTAAGATGGATTCGAGATAGAAATAGAAACAGTATCAGTTCGGAAGATGAAAGAGAAACG
GGAGATGGCTAAAGATATAAATTGATGAGACTGAATGTTTATATAGTTACTTCAGTTGGAAGCAGAAAATAGCTCAACAGAAGGCATCTTGATAAATAGT
TTCTTTTATGTTGTTGCCTCCCTCTTTGAGGGGTATGGTTAACTTTCTTTTGGGTGGACCTGTTGCAGGACGGGTATGCTGTTGTTGCCGCTGATGGACC
TGGTGAATATCCTGTAATTACTGAATCAAGAGCAGGAAATGATGCACTTGGTGTGACGGTTACTCCTGGGACTGTTGCATATGTAACTACTGGAGGTCTG
TTTGTTCAGATATTGTGGTTCCTTTGATAGTGTTAGATCCATACCTTTATCCCTAGACTATATATTTGATCTTGTTGATCTTGGTAAAATATAGAGCTAT
ATCAAAAAACAAGCAAAGAAACATCCTTATAGGGAAACATTGATGCTTGACATCTAACTATAACATATATTGTGTCGTTGGAAGATTGTGTTGTTGGTAG
GTGCTGGTGTGACCACTTGTTAGATCCCGCGTTCAGACTGAAATTCCATTTGAAGCTCTAGGGATAAAGTTGAGGGCAGGACATGTCATATAGGGAAAGT
CCATCTTCAAATCCGACTTCTAACTCCCTCATCTTAGATTTCTTGTTAGAGCAGAAATAAGGCATGGAGCAAAAAAAATCTAAATAGGCCTTGGGGTTAG
CTAGAAAACTCCGACTCTTATTAGGCATGAAAGCTCCTATTAAATAATATCCTCAGTGATATTCAGGCTCTGTTTTGAGCTTCAGGGTGTGACTTGTGAG
TTTTGTGGCTTGATATAATTGAAATTGAAAGGATAATAGAAGTGTTAAGGTTCGGGCAATTATTCCTGTTAAAAGATTAATTCGATTTTTACTACCACCA
TTTATGTTGTCTTGGGATATAAGTGTGAAGAGTCACATTTATGTGCTGAATCTATATGCATGTCCGCTTGTTCTGAGACTGAAGTCATTTTATTGGGATA
TGGATTGAGACTTCATCATTGACCAAACTCGCTGAAATGAAATTTATAAGAATGTTATTTTACCCCTAAGAAACCAACCAATGAGGAAATTCTCAACTGT
CAAAATTACGCAAAAATAAAGAACCCAGGGTATAAATCACTCAAAAATACAAGTGAGCTTGAATGAAAAAAAACCCTAAACATAACATTTAAGAAACTAA
GACCATATTGAAGATTAAAACAGAAATTATAAAAATACAACTGCAACGAAACAAATTTTGATGTCAGAATCGACGAGATCCAACAAGAACTCAATCGGCA
GAACTCGAACCGGAACCAGAACTAAAACTCCCAAATTTCGAAGTTTTTCTTTTTCTTTTTAAGTAACGAAATTGTTGTATTATCTCTATCTTTTTATATC
TGTATTCTTGATTCTGAAAATCCTCCTCTTTGTATTGTTGTGTGTATGCATTTATGTATTTTTGTATTGTGTGTTCTATCTGTATTCTTGATTCTGAAAA
ATTACCTCTTTGTGTTGCTGTGTGTATGTATTGATATAATTAATGCAGATTCAGTTGGTGATATAAACTTCACATAATTGATTTAGCCTTTGGTTTGTAG
TATTAAATCCTGCATTGCTAATACAGTATAAATTATGCAGGATTCTATGTGTTATTTTAGGTGGAATAGAATGTGGAATAAAAATACATGTGTTAGCTAT
ACATAAGTTGGATTAGCTAAAGACAAAAAATGCACCTAAAATAAGCAATCCATGCTCACTAAACATTTTTTACATTATTGTTCGCTGCACACAATCCGCA
CATTATTATTCACGCAACAATTCCTGCATTATAGTCCTCGCGCGCAATTAGTCCCAAACCAAATGAACCCTTTACATATTATTAACCTATTGCAACTGGA
GTTTGTAGCTCACAAGCCCCTTGAAGATAACGAGCAATCAATCTGGTCCAGTTTGTTGGATGTAATTTCTATTTTGGTGGGTTTGGATGACTCTATTTCT
CTCGACAAATGGTCATCCAACTAGTACTGTCTTGGGTGTCAATTAATTTTTCTTTGCTGTACACCTATCCAGGTCCAGTGCCTGATGGTGCTGATGCTGT
TGTTCAAGTAGAGGACACTGAATCAATTTCAGTTGCTTCAGCTGAACGGAAGCGAGTGCGAATATTGAAGCAAACTAGCCCTGGAGTTGATATTCGTGCA
GTGGTAAGAACTTGATGCTGTACCTGTGGTATGTCTTATGCCTTGGTAGAATAGAGTTCCGATTGTAGAACAGTTTTATTGTTGGTTTGATGTGTTCTTT
TGTTTTCTGGAAAATAATGTCTGTTTGAATATCATTGTGGAATTTGTTGCTTGTAGGCTGGAAGATTTTTTTTTAAGAAGGAATTTTTTGATAGTGTTCC
ATTCTCTGCAAAGCAAAACATTCTTTTTATATAGGAAACAACTGGGTTATTTTTAAAACAAAAAGATGAAGTAGTAGAGATTAATTGGACAATTATTTTA
CCATGTGATCCAAAAGCTATTTTACTTATATGGATGTCTGTGTTGATTGCAAGCTAGTGTGAGTGACTGATGTGGCAGAATGACTTCCCATTTCTGGATG
GTTGATCGGTAGAAGTCTGGATACTGGCATGAAAATTTTCAGAAAAATAATCCACATAGTTTAGTAAGTGCTATTGTCTGTTGAAGTGATTAGTTGTATT
AACTAGAGCCTGTTAATCCCAACAGAGACAAAAACCACTTGATGTTTCTTCTCATCTGTCTAAGCTTTGGTAGACAGAGTTATCCGGTACCTGTGCTGGT
GAGAGGTAGCAGGTATCCAGGGGAATTAGTCGAGGTGGGTTCAAGCTGGCCTCCCAGTACCACCGTCATAAAAATTAAAAAGAGAAAATGAATTCATACA
GTATCTGGCAATGAGCTGCACCCTCAGACCTAACGATACATTAAGCTGATTGAAGTCTATTGCTGTCCTACTGCTGATTGGTGTGGCTATAAGGAATTTG
TGCTACCCGGGGTAGACCATACGAGGGACAAGTGAGCTCAATAGACATGTTGGTCTTTTTGCATGTCTGAACTAGGGACAGCTTACAGCCTAATAGTGCT
TGTTAACTTGTTATCTTTTGCTCAAATATGACAACCCACTGTTTTGGAGTCAAGTCAGTCTTACTGCATCTTCATAAAATTCTTGACCCCTGCAAGCCAT
GAACTGCATTTTTTAATATTGCTTATTTGAGATCCGTTCTCCTTGTAGCTGCTTAAATTTATTATTCGGGTGTTCTTGTTTAGAAGGATGCTATAGGCCT
TGAAATTGAAACCATTGCTTTCAATTACTTACTCCATATGACTACCACTATGATTACTTAGTTGGTTCTTTTCAACTGCATTAAAATTGTCTTTTCCAGG
GTTCTGACATTGCACAGGGTACTATCGTACTGAAATCTGGAGAGCGATTAGGTGCTGCAGAAATTGGTCTACTCGCTACAGTAGGTGTTGTCGCAGTGAA
GGTATTTGTTTTATTTCCTTGCAGTTTAAATGTTATAACCCAGAATGTCTGCCTATATCTTCCTTTTTTCCATGCCAATTCTTGTGCAATCATGTTGTGT
TTTGGATTGCTGATAAACAGGTGTATCCCTGTCCAACAATTGGTGTCTTGTCAACAGGGGATGAGCTTGTAGAACCAACAGTTGGGAGTTTAAATCGTGG
TCAGGTTGTAGAAGCTACTATGATTTTATTTTCTTCTAAAAACAATTTTATTTTGAACAGGTAACGTTTTTGTGTATTAATAACAAACTACACAAAGGGG
GTGTAGTCCCCCAAATTCACATCCAGATGAGCAAAAAAAAAGAAGCTCCTAGTCCTTAATCTTCTCATAAGGAATCTAGTACATTATAAATTGATTCTAA
TTCTTCCATTAAGCTATGTTCCCCCAAAAAAGAGAAGCCCTAAACATTTCATCTTTAGTTTCTGTATACTAATGGCTTTGTCTTCAAAACAAACTTGGTT
TCCTTCTCCCCACACAGTCCACAAAATGCTAGCTGGGACAATTTTCCATCTCTCTTTCTGATTGGAGGGATTGGTATCGCTGTTCCAACATTTCAGTGCC
TCAGCTACTCTTCCCGGCATAGTCCAGCTAATGCCCCTCAAGTTAATGAAAATCTTCCACAACTGGTCAGTCCAGCTGCAGTGGAGAAAGAGATGAGAGA
TTGTCTCTGCTTCCTTGCCATAAAGAAAACACCTTGAGCAAAGATTGGAACATCTTCTCATGAGTGTATCTTGTGTGAGTACAACTTCTCTGGCTGGCAA
CCAAGAGAAGCACACTACTTTGTGGGGGAATTTAACCCTCCAAATCATCTTCCAAGGCCAAGTCCCACTCTAATTGTTTGAGGTTGTGAATACTCTGTAT
GCTGCTTGCACTGTAAATTTTTCTGCGCTTATTCCTTAACCATATCATGCAATCTGCCTCAGTTGAAGTTCCTTTGAACTGTTCTAAAGTTCCGAAAAAG
CTTGCTAGTCTAAAACAATATCTGATGCTCCTTATAAAAAAAACATAATAAAATAGCATCTTTATCCAAGTATCTGTTTTCACTAAAAAGAATATAATAA
ATCTAACATTTGGTTATAGTACTTTCGTGATTCGGTCAAACACTATTTTGGACGGAGTATTTCTACCCCAAAGCTATTAGATCCTATAATTGAGTTGGAA
AGTACTTTTGTCAAAAAGCACCTCTCTGAAAGGGCTCCCTGTGGGTGATTGAATAGGTCAAACCTATGAGCTTACGGTGAATAAACAACAGAAGCAATCT
TGAGGCATGAATTTCACAAGAATCCATGTGAAGATCCTGTAATGCTATCTTATAAAACTATCTTGTTTCCTTGCATCATTATGATGGTTAGAAAACTGTT
ATGTGGGACAGTGTAGCACTATTTCAAGCCAAATACACCAGAAAGTAGCAAGCACAGCACACTTCCATAAGAAAAGTTTCCTTCTCTACGAAGACCAAAA
GCACTAGTGTTAATTAAAAAGAACAAACTGCTGAAAATAATTCACGATTCTCATATACTTGAAAGCAATTCCTCTATATTTGTTGTCCCAAAGAACATTG
ATAAACTAATATGGGTGAGACTCATGGTATATTTGCACATGATTTACCAGACGTGATGAATATCTTTATTTAATTTTCTTCTTTATCAAGAAGTCACAAT
TCAATTTTCAATATTTTGCCAAAAAACTAGAATCGTTCATAAATTCTCGTCACGAACTATCCATATATAGTATGTGTTCATTGAAATGCTGGACTTCTTG
TGTGAAAAATGTATATCAGTTGACTTCAAATTCCACTTCATTCAGGTCAATACGTTAATGCTACAATATTTTTATTCCAAGGCAAATAAAGGGTGATCTC
AAATTGGAATTTCTGAGTCAATCTTTTATTTTTACACTGACATACAAGTCTCTGGCTAGTATATGCTGCTTCTATTTTTAGTGTATCAACAACAATTGAG
CGTAATTCCAACCAGTTGACATTTCCTGTATGAATCATGGGTTTCCTATTTTCTATTCTTTGCTAAATTCGAATTGATTGCAGAATTGAAGGTCTTTTGA
GGCAACTTCCCTTCATGTGATTCTATGTCTGCCTTTTCTTAAATGCTTTACGTTGATCTTGTCCAATCATATACAGTATTAATATTCACATTTCTATGAT
TTCAACTTGAGAATTTATGTTGAGCTTTAGACTGGCTTTGACTTTGTCGGTAACTTCATATTGTATATCACTTTCACCTAATTTTAACCATCTAATCTTA
CTATTATATGGGAGAAATAGAAGTGTTCGGCAGGTCTTGCTTGAATATGTGAATATTGTCTATTATATTCAACTAATATAACCCTTCGGGGTGACCCCGT
GGTTTGAGCTTGGGACTTCCATGTTGGAGGTCTCAAGTTCGAAACCCCTTGCCAACGAAAGCAAGGGATTTGCCTTCTGGGTCGAGCTCGTCGCACTAGG
CTTCCCTAGTGCGGGTTACCTCTCCTATGTGGTTTGCGAGCTATTGCATAGGAGCGGGGTTTTACCCTGTGCGCACCCAAAAGGGTAGCGGCTGCGGGTT
TCCCTTGTCGTCAAAAAAAATAATATTCAACTAATACAATATCTTGATACAAGTATCTGCAAATGTCCCTTCGAATCATTCACACACTTGAAATAGATTT
TCTTTGAATACTTTTGCTTGGTCTGTTCCATTAAAAAAAGATTGACATTGCATATGATTTAGAATAGGGAGACCCTTGATGTATCACAAATGTAATATAA
CAATTATGCCTCAATCCAAACAAGTTGATGATAATGCCGCTCCATTAATTAAGCTTATCATAAGTTGATATACAAAAGTAAAAATAAAATAGAAAGCATA
TATATCTTTGAGGAATAAAAGACTCATATAACACATTGGACCCAAAGTGAACGTACTAACACGACTAAACATATTCCGAGTATTTCGTATCACCTCTTTA
GATTTTTCTCTTCCATTGTATCCTGTTTTCGCTAAGTGTGCATGGGTTCTAAGAGATTGTTAGTCTTTTGAGACACATTCTTTCTATGTGATTTTAGGTC
TACCTAGGTTTTCTAAATTGCAAACGGAACACTGTATTAGGTGTAGACATTCGCCTCTGGTGTATTTTACTTAATTTCACTTTATCATAAGCAGATCAGG
GACTCCAACCGTGCAATGATCCTAACTGCTGCAACACAGCATCAGTGCAAAGTTATTGATCTTGGTATAGCTCGTGATGATGAGCAGGAGATTGAGAGGA
TATTAGACAATGCATTTGCTTCTGGAATTGACATCCTTCTCTCCTCTGGAGGTGTTTCCATGGGAGACCGGGATTTTGTGAAGCCTTTACTTCAAAAGAA
AGGGAGAGTATTATTTCAGAAGGTAATGCTGGCAATATCTGTATACAGATTTTGGAAGCTTATATTTTCATATGGTAACACTCCCTGTGTATGTTTATAG
GATTGAGCTGGGAGTTTGTACATATATGTATATCTAGGTGTTTCTTGTTTGTATCGACACATTTTGTGTCTATAAATTCAGAAAATAAGTACTTACTGTC
TTTCTTTGCAAATCAGGTTCTCATGAAACCAGGAAAGCCTCTCACATTTGCTGAGATCCTTCCCGGATCATCTGACAGGACTTCCAGTAAGATTCTTGCA
TTTGGGCTACCTGGAAATCCTGTGAGCTGTTTGGTCTGTTTCCATCTCTTTGTGGTTCCAGCCATTAAGCACCTCTCTGGGTGGGCAAACCCACATCTTC
CAAGGTTGCAAAGAGTTGATAAAAGAAGCCCTCTTCTCTCTCTTTCACTCAATCCTTTTCCTATTCAATTTTTGGGTGATTTATAGCTGTCCAATCTCAG
TAAAGCAGTATCCATTTCTAACAATTGTAGAGTGCAAGCTCGTCTAAAGCATTCAGTAAAGACAGATCCTCACCGTTTAGAATTCCATCGAGCTGTTATC
TCCTGGCAGTTGAATGATGGGTCGGGTTATCAAGGGTAAGCCTTGTATTTTCTGTTTTTGTTTCTCTTTCTTTCAGAACATGCAGTTCTATCCAACTATA
ATCTTTCAAGGGTAAACTTTTGAAGTTTAGTAGTTCGTATCATTTTCCAAATACATTGGTCAAAATATCATTTTCCAAATGCACTTACTGGTGTCATAGA
TGCTGTTCTCTTGGATTTTAATCTAAGAAAGCTCCCTTCTTGTTTACTCTGTCTGATGTATCACATATTGCAAATGGTGGAAGTGCTTGATATATGAGCT
TATTCAGTAAATTAAAAATCAGTTGATGTGGATGCAATTCTTTCAACTTTGTTTTGCGGTCTTGAATGTACAATATTTCAATAAATCCATAATTTGACGT
ATTTGTAACGATATAATTTCATGCCTCCCTATGTTTATTTTTCATATAACACGGTTCATAGGTCACTAGATTTTGCATTTTTTGCTTCTTTCGCTGTTTG
CCTGTAAAATCCTAGCTTTCTCAAATTGTGTTGGGGGTGGATTCTAGTGTAACTGTACATATCGTGAAATGGGATATTGTGGGACTGTATCCACATAGCA
TTGCTTAAAGACTTCTATGTCGAGGTAGGGACGAGATGTGAGTTCAGAGAACCTCCAGTTTTATATTACTCCTAGTTCGCCTTATAAGATAATTTAGTTA
TTGGAATCAAATGGGTCTAAATCACTTTGTAGTTCATTCATTTAGTCAACCCCAAGTAGAGCAGTTGATTGATATTTTGTTTTGGGGAAGAGGGAAGAGG
GGTCAAATTGAAGTTGTCCAAGAGGAAGTTGAAAGAGAACGTATTTTGCAATGCATTACAAGGTGAAGACCATGAATATGCCGCGATGAGGGACCTAAGC
TAATCTAGTTACTGGCAGGCAATCCTTGCTTATCTGCATGATATTATAGGTTTTCAAGTAACATGCTTTTCTGAAGAACTTTTTTTCTTTTAATCTTCTA
CAAGGCAAACTTTTATTAATTAAGGTAATTAGATTTAGTAATCGTTCATTGAAGGGAACTCAGGAGTATGAAGACCCAATATTATATCAAGTATAATACC
TCATTCATGCTCTATTAGCAGACTGTTGCAGTGGCCATTGAATGACATCAAAAGCTTCTTTTCGCTCTTTATGATTTACAGGTTCATAGCTGAGAGTACA
GGCCATCAAATTAGTAGTCGACTTCTGAGTATGAAGTCAGCCAATGCTTTGTTAGAGCTTCCAGCTTCAGAAACTTCAGTACCTGCTGGTGCTTCAGTGT
CTGCAATTCTAATTTCTGATATAAGCAATTTCCCTGGGACCAGGAACCTGCAATTGACAGACTTAAGTAGCACCCAACAAGAACATAAGCTAGCAGCTGC
AGATGCTGGCAGTTCTGAAGCATCTGAATTCAAGGTAGCTATTCTTACAGTAAGTGATACTGTTGCCACAGGATTGGGACCTGATCGCAGGTAATTTTTA
AGTACGAAGCTGCTCCTCTGTCTTTTCCATTTGTTGCTCAGTTGTTTTGAACTTATGTTCCATATATACCAATGTTTCATAATATCTTAATCGAAGGCAA
TTCCCTATTTCCTTATTCTTTTGATTATTTTTCTTGTCCCCTTTATCCTTATTCTTCTGCATTCATGCTGATAGTTTTTTAGAGGAAAGAGTGCACTACT
TGCATGCTATATCTTGTTAGCTAGTAATTTGTTCATGACATGCATATCCCATATCATTTCTTATTGATGTGCTTAGATTGGTTGTCTTGAGATAGAAAGA
GGGAATTAAGACCATTTTGGCGTGTTCTTATATAATAACCAGTAACTTATTTGAAGAAGCACATCCTGAGTTATTCTGGGATGGTCATTTTTCAAAACCA
ACTTCATTTGTCATTGAGATGCGTAGAGTGGTCATCGTGAAGACCATCAGTGACTCCTCATTTCTCCACCCACTAGGGGATTCTCCTCAGCAAGCCATCT
AACAAGAGAGTGACATCTTTTTCAAACTTTATAATGACCCCCCCCCCCCCCCCCCCCCACACACACACACACAGAGACAGAGAGAGAGAATTTGCCTCAA
TGACTACTATATTAAATGACTATACTATTCCTTCAGTTCGCCACTCCTTGTCTGAGACATGAGGGTGCAACTGACACATCAGTTCTCAGTTCTTGGAATT
GAAAGAGATGCATCAGGGTACACCTCCCTTGCCCTACCTTTTTGTAAAGAGAGGTTGCGTCAAGATACACCTTTTTGGTTCGTCATTCCAGAAGGGTCAC
TATAATGATGCGAAAGGAAAAGTGGCATATCTGATATTACTCCGTGTAAAAGTGGAGCATGTGAGTACACAGACCCTTTGCTACATATATAAATCTACTT
CATATGACTTGGTGTTTAAATGGCTCATATATCGTTAATTAGGATCATATTGCTCTAGTGCTTCCAGAAGAGGCAAAATTTACCATCCTTAATGTCTCAT
CTGCAAGTGAACATTTCGTCAAATGCTTAGATATTCTATTTTGAGTTCATCATAGGCTGGTTACGTTAAATCATTTTTGTTTTCCCTCTTTTCGTTCTTT
GAGACACTCCTTATTTTTCCATCCATTGGGGGATTCTCCACAACTAGCCGTCTAACAAGGAGTGACATGCTTTTCAACCTTCATAATGAGTTGCTGCCCC
CCCACCCCCACCCCCACCCACAAACACCCACAAAGAAAAAGAGAAAAATAAAAGCTTCAAAATTTTGCAAAATGGTACCTCTAAGTTTTAACTATTTTGC
AAGAAAAGAGGAAGTACATCAAAATTTGTAGTCGTTGGCAACCATTATAAGAGTTGAACTATTATATAATTTGTCTCTGTGGCCACTATAAATGACATAC
TATTTCTTTAGTTCACCACTCCTTGTCTGTGACATGATGGTGCAACCGACACATCAAATTTCAATTCTTGAAATTGAAAGAGATGCATCGGGATACACCT
CCCTCCCTTAGACTTTTGAGGTCGCATCAGGATACACCTTTTTGGTTCGTCGTTCCAAAAGGGTCACTTTAGTGATGCAAAAGGAAAAATGACAAATCTG
ACATTACTCCATGTAAAAGTCGAACATGTGAGTACACAGACTCTTTGCTACAAATATTAAGCTACTTCATATTAGTTGCTGTTTGAATGGCTCATATATC
ATTAATTAGGATCATATCACTTACTGCTTCCAAAAGAGGCAAAATTTATCATTTTAAATGCCTAAATGATTTAAAAACTGGGAGGATGGTAGTCATTATT
TGACAAGTTGAAACTCTGCAGTGGGCATTTTTACTTCCTTTCTCCTTCTACCTCCTCTACAGCCGTATTTTTCTATTTTCTGGTTGGTTTTTGAATGGAT
AAGAGAACTACCATTATACAATTGATTAGAGTGGTTGCTATTTCTTTAGTTTCCAGTTAAATGTCTCATCTGCAAGTGAAAATTTTGTCAAATGCTTAGA
TATTTTATTTTGACTTCATCATAGGCTGGTTACTTTAAATAATTGTTGTTTTCCCTCTTTTTGTTCTTTGAGACACTCCACAGCTATCTGTCTAGCATGA
TGTGCTTTTCGACCTTCATAATGAGCTTCAATCTGAGCCAACCCCCACCCACCCACAAAGAAAATGAAACGGGAAAAGCAACAGCTTCATCACCTAGATT
ATAGTGCTTTTGGATTCAAAATTTTAAGTGAAAGTTGCTCGGGAAAGATTTTACCTTTAACTATTTGCAAGAGAATTGGAAGTACCTCAAAAAACTTTAT
AGTAACTATTAATAAGAGTGGAACTATTATTTTATGTGGCCCCCCCCCCCCCCCCTTTTTTTTTAACAAAGAAAGGTCGCATCAGGATACACCTTTTTGG
TTCGTCATATCGAAAGGGTCACTTAAGTGATGCAAAAGGAAAAGTAGCAAATCTGATATTACTCCGTATACAAGTGGAACATGTGAGTACCCACATTCAT
TGCTACAATATTATGCAGACTACTTCATATTACTTGGTGTTTGAATGGATCATGTATTGTTAATTAGGATCATACCACTTAGTGCTTTCAGAAGAGGCAA
AATTTACCATCCTAAACGCCTAAATGATAAAAGAACCGGAAGGATGGTAATCATTATTTGACAAGTTGAAACTTTGCAGTGGGGATGTTTACTTTTTTTC
TTCTTCTAGACCTACTTCTGTATTCTTTCTATTTTTTGCTTGGTGTTTACATGGATAAGAGAACTGCCATTGTACAATTGATTAGATAGGCCAATATTTC
TGTTTGTTTTCCGGTTAAAGTGTCTCATCTGCAAGTGAACATTTTGTCAAATGCATAGATATTCTAGTTTGAGTTTAGCATAGGCTGATTCTTCAATTGA
TTTTTGTTTTCCCTCTTCTTTTCTCTGCATTAACACTGTCTTCATCTTGGATTGAATTTACATGGCCACTTGATATTTCCGTGCTCCGAGGAAATGCTAG
AGCCGACTAAAAACCTTCCCTGAATGTGTGATGAAGAATGCAAAGGGAAGAGCAATGAGAGGTCAGGCCTTTAAAATTGGATACACTAAATGTGTCTATG
CCATATGGTTAGAGCGGAATCAGGGAGTCTTTGAGAAGAAAGCCAGAGATTATGAAGTCATTACCAGGGAGATAGCATATATGTGTAGTGTTAGAGCACA
GTTTCTACCAACTTGTTATTCTAGCTAGAGATTTGTTGCCTTAAGAGATAGACTGGTTAGCTAGTTTTGATGTAGTTTCTTTTTCTCTGATGTGATAGCT
TGTATGTCAACTAGATATAGATCTGTAATGTTGATGCTTTGGTGATTAATACAAAATGTTAGTTACAAAAAAAAAAAGCCTTGCCTTCCTTGATTATTAA
ATGGTCCAATTTCTTTATGCTATGTGATCTTGCAGTGGTCCAAGGGCAGTTTCTGTCGTCAATGCATCATCAGAAAGGCTTGGAGGGACAAGTATAGTTG
CAACAGCTGTTGTGCCAGATGATGTGCAAAAGATTAAAGACATGTTGCAGAAGTGGAGTGACGTTGACAAAGTGGATCTTATTCTTACCCTTGGTATGTG
AGCTATAATGGCCATGGTCCGTTTCTTTTTCAAGCAATAAAATATTTATGAATGACTTGCTGGTTTTCATTCACTAGTATCATTTCAATGGCTGGAGCAG
CAATAAGTCAATTTATTTTTATTTTTCTACTGAAATGGCTCTTTCACAACACAAAGTTGTCATCTAGAACCTTCATTCTTCATCTTGTTTCTCTCATACT
TTTACTGGACGAGACAGGTGGGACTGGCTGTACACCTAGGGATGTTACCCCTGAAGCTACCAAAAGTATGATACAGAAAGAAACACCCGGTCTTCTCTAT
GTTATGATGCGAGAAAGTTTGAAGGTATTAAAGTTCTCATATCACTGGTATTCCATGGGCATTTTATTCTACTATATACGTATTGCAGGTGCTAAAATTT
GCAGATATTTTAGACATCCTTGTCTGTATAATCTTCATCTAGTTGATTACTGATACTGTGGGGTGTCGAACAATGAATGAAAAAATAGAGCTAGGTGTAT
AGCCACATGCTCATGTTATTATTCACAGTGCATTTTTATTGAAAAACTGGGGAAAGAAAAGATAAATCTATTATTTCTTAAGCATATTCAAAAATTAAAT
ACCAAAATTTGTATGAGTAATCTTGAAAGTTGATCACACATGGTCTTATCCTTGAGGTTGATGAAATTAGAATTAAGACCATGGAAGATTACCGTTTAAA
TCCAACATAGGCAAAAAAAGTACTTAATTTTTTCCTTTTCTGCCTAAGCTAGGTGGAGTTATCCAGTGGATAGTTGTGGTGCATGTAAGTTGATCCAGTA
CCGACACCACCGTTATCCAAAAAAGTTAATAAATGAATAGAAGGGGGAGAAGAGCAATCTCTCAAAGCTGACTTCTGTCCTGGCCCAAAAAGAGCCATGT
CCCAAACTGCACCCCGCCCACCAAGAAAAGTATCTGAAGCAGCAACTTTCCTCAAGTATCAAAATGAACTAGAGAATTCAAGTTAACCAAGTGATTTTCT
GTTTGCCTTTATGGTGGCCTAACAACAATAGATGTGTATTGTCAAACACTAATGAAGTGACTTCTTTTGATAGCATCAGAGATTTAATCTTCAGCATGCT
TTCTTTATTTTCTTAATCAGTTATCAGGTGGTTGAAATTTTTGCATGTTCACATAAGGTAGCTATGGAATTTGCATGTTTATGTAAGATGGCTATAATAT
TTTGCCTTTATGGTGGACTCACAATCATGCATCTTACTTCACATAGGTTACGCCCTCTGCAATGCTCTCACGTGCAGCAGCTGGAATAAGAGGATCAACA
TTGGTAAGCCAGAAGTCCAAACTATTCTATTTTCACCATTATGCATCACCTAACCACCCACATGAATCAGCAGAAAGTTCCCTCATATTGTTGATAAGCT
CTGCTTAAAATTGTGCTCAACTGACAGAAAGGGAAGGCATTTGTGGTTTTAGAACTTGAGACAACTATTGCAGTAAGACCGAATTACCTTGACTAAACTA
AGATTATTAAATTTGTACAAGCATGCACTTTGAGTTGAATTACGCTGGGTCACTGAGTTGACATACTAGCTAAGCATACATTTTCACAAGCACATTGTGC
TATAATTTCTCAGATTAATATGTAAAACTTATTTTTAAGTCTAAGTTTTTATTTTGCCTTTACTTTAAAGGAAGCTAATGGCATCTTAGAGTTATAACAG
TTCTGCTGCAAGTTTATGTGAAGTTTCTGTGTATAGTATCCTAAACCTATTTTCAGCAAGTCCAAAATCATTGAGCTGAAGAGGTTTTAGTTATTTTTAT
AGGTATTTTCGCTGTTCTAATTTTTTTCTCTATTCATTTGCTTATCATTTGAGTTTAACTCAGAACTGGGGATGTGTTTCATCAGTGTGTTATGATAGGA
TCTTCTATATAAGGACAAGATATTAGTTTGCTAGCAAAGGTTGTTTCTTTGTAATCTTAGTCTTCCATTTGTTTGAATACCTTAGCTTAGCAAGTCGAAT
CTTAGTGTTGAGTTTAGAACTATGGTTCATCTTTCATTTTTACTGAACTCATTTGCTTAGCAAGTTGAACTGAGTGTTGAGTGTCAGAACTATGGTTGTA
TTATCATCAATTAATGCATCTTCTCTCCCTAATCCAATAATCTATATTTTTCTCTGTGTGTTGGTTTTACTGTGCATTCATGTTTTAGGTGTATTTTACC
TCCGGCAACAAGTGTCAGACTTATGATCACACTTCCATAGTTAAAAGAAACGGGAATGAGAATCATTAATATCTTCAATGTAAAATTACAAGTAGTGGAA
ATTTTAAAGTGTTGAAGTGTGTGACCATCTCATCTAAAAACTTAAAACATAAGCTGACAGATATCACACTTTTATTACTTGGTGGGTTTTTTGGATTGAC
TTATTTTAAGCAGCTTTTGGCTTTTAAGCTCATTTCATTTTTGGAGGTGTTTGGGAAAGATATAAAGTGCTTAAAAACACTTTCTTTAGGTTGAAAAATA
TAATGATAAACATTTGGCTTTTAGCTCATAAGCAACTTTTAAAAAGCCAATCCAAACGCCCCTTATATTCTAACCCCCCACCCCCACCCAACGCGTAGAC
CTTTTTTTTCATGGGCCAAGAATGTGAAAATTCCTTTTGATAATGGGTGTCTTTGAGATTCAATCCCAAGACCTCTTCTTTATGTTAAAAAATGGATTTT
GGGCCTAACTCAAACCCTGAATCTAGCTTTAGAGACGAGGATTGCCCAAAGTCACATAAAGAGAACTAATTCCCTAAGCGCACTGATGTGGGGCTCAACA
CTCCTTTACACCCAGAACTGGACATTTGGAGCATGGACAATGTAAGATGCCCATATCGGATAAACAGTGAATTGGGATGAACCCGATTCTGATACCATGT
TGAAGTATGTAACCATCTCATCTAAGAAGCTTAAGCTGTTAAGAGAACACCATTGAAATTGCTTAATTATGTTCTCAATACGCCTCACGTGTAGGCCTGA
CTTTTTAATTTCATGGGCCAAACACGTGAAAAATCTTTTTGATAATGGATGACAGAGAGATTCGATCCCAAGACGTCTTGTCTGTTGTGATACCATAGTA
AAGAAATGGACCTTGACCCATCCCAATGCCTCAACCCTAAAAGCTGGCTCATGATGGGAGGATTGTACTAGACCATATACGGAGACCAAGAACCCCTTAT
TCCACTGATGTGGGATTCCAGCAGGAAGCTAGTTCCTTTATTTGCTTTTCGTTCTTTTTCTTTTGCAGTTGGGCTGTGCTCCGACCCTATGATAGTTTAT
GGTAGTTAAGGATGAGAGGTACTTTGAGTTGATAGTGAATCCCATCTCCAGATACAAGTTGTTTTCGTATTCAACTTGAATTATTTTCCATTTCAAAATA
CTTGAGTTCATTGGAAGTGTCGGTTGTTTTGTTAATTATATATTCAGCGCATGAGAAACCTCCTTCCTTGGTCTCAACTTTTGCTGCTTTTTTTCCCTTT
AAAATGGTTCTCCTGGTATCGTTAGGATACTTTTTTTTGCCCTATTCATGTTTTACCCTTAATACTGGAGACTGCAAGGTTGACACCTGCAAGGTTAAAC
TGCTAAATGGTCTGTGAGGCAAACCATCTGTGTCAAGAAGAGAGGCATTAGGCTAATTAGCAACATAAGTGAGTAAACTTGCAGATTTTTCTTCCTTTAC
CAGGAGAGCCAAGTGCAAGCTGCATTATAATTTCCTTCTATGTAATGAAGGTGCATCTATCTCTCCTTTACCAAAAAAAAGTGCATCTAGCTCTAGTTGA
CACAAGATTTAATTGTATCCTTCATTGGTTAGAAATCTTTTACTCTTCTGGGAGCTTTTCTAACTGCTGCGCCTTGTTATATGAGTTCCTCAGAAGTTTA
CGTTATGTATGTTTCACAATGTTTTCAGATCATCAATATGCCAGGCAATCCAAATGCAGTCGCGGAGTGCATGGAAGCTTTGTTGCCTTCACTTAAGCAT
GCACTGAAGCAGGTAAGGGGTGACAAGAGAGAGAAACATCCTCGTCATATTCCTCATGCACAAGCTGCTCCCACAGATACTTGGGAACGTAGTTACAAGT
TGGCTTCGGGTGGTGGTGAAGAGCATGGTTGCTCGTGTTCCCACTAACATGTATATCTTGTTGATATTATACTCTTGACATTAACTTGGAACCATGTGCA
TCTAAAGCACCTTTTCGAATGAGTTATGTTGTATCTTATATACAAGGCCACTTCAAAGGACATGAAATTTGAATAAATCTCTTTTTTTGGTAACTAACTG
TTTTGTTTATTACCAGAAGCAAACATTACATATCAAGCAACTAAACACAGCATGCTTTGTTCTCAGTATCTCTCATCTTACAGCTCTAGATGGAGCTCTA
ACAATAAGCTCTTTATCTCAAAAAAATCTGTTATTCATCTCAATTCACACCTCTTATATGTATTCAGCCAAAATGATCTTGAAGATTTGGGTTGTTATAG
ACTTCCCCTTTCCATGTTGTATGCACCATTGTATAAATTGACCCCAAGGTCTTCATTTTTGCATAAGACCTGCTGTTGCTAGTTTCTTGTGAAGCAGCCA
CAGTGAAATAGGCTTCTGGCCTTGCTGCATTCTTGAACTAAACACTTCTTACATTCAGTTCTTTGCTGCTCCCCTAGCATACAAATAGATTTTCTTGATC
ATACTTCCTTTCTTGCCCCGTCTGCTAAATAGCTTGTTTGAACTGCATTTGAATTTGAGAATGTTAGTAGTCCCAAAGCCAAAGGGGACTCTGATAAAAA
GGAATGGAAGAAATGGTCTCAATTTACACACAATGCATATGCCATTCTGATTGCTTCTTGGCTGTCTTTTGAAGTGTTAAAAGTATCAACAGGCCTGTGC
CTGTCTGTCCTAAGTGAGATCTTTTTTAAAGCTAGTTTAGAAACAATTTTGATTTGGAAGAAAGTGAACTTTTACTCACAATCACAGGCACTGGTGTTGG
AATGGAAATATTTGTAAAGAATTGTGTGCTAGGTTGGCATTTCAATTTGCTTGTTGGTTGGAATGAGGCAATGTTGCATAGGGAAGTTGAATGAGCACAA
AGATTAAAAAATGAATCAAATAATTGTATTCATACAAAAAGAACACATATTGTGAGTTTTTACATGACTTCACTAGTAGGTATCATAAAAACCATAGTTT
CACACACTCCAAAACCCAAAATCAAACAAATAGTCTATCTAAAAAGCTAGAGAGAGATCATCACACCAGTAAACATGATCTCAACACAACCTTACTACCA
AACTAAAAAAAAATATCAACTCAAGAAGAGGTAGTAGTATTAGCATTAGTTGGTGAAAGATTTTTTGCTGGTGGGAAGAGGGCAACAGCACCTCTATCTG
GACTTGAGAACTTCCTGTAAATTGCCTTGAGCTTATTTTCTGCAGCACCCAAGTGACAGCTAACCAACTCCTTTCCACTTTCCATCAACTGATCTTCTGA
GTATCCAGTATGATGCTGCAGAGTTTGAGTCCATAGAGGACTTTTGTTGAGAGTGCAACGAGCAGCGTAAACAGACGATGCTGCCAGCATTGATGGACAG
GATGTTATTATGGTCTTATAGTTCATCAGACCAAGTTCAGCAAAGAAGAAAGCCATGTTTTCCATCTGCAACAGCAACATAGTTGAGTTAAATTAGCCAC
AGACAATACACATACATATGGATAAGTGTGTCAAAAGATGATTAGTGTATAGTACCTCCTGATCATTTGGTGTTGAAGCTTTAATGTACCTAACCAAAAA
CACATATGGCGTTGGAACTGTCAGATACCATTCCAGCTTACCAAGAATTGCTTTCTCCATCTGAAGTATCTGATCTCTGGCATATGCATTGTCTGATATA
TGAATGAAATCATTGACCTCTGGTGCCCAAATCTCTTCATACTTGCAAGCAATTAGCATTGAACTAATGCCAACTAACTGAAGTTCCCTCCTTGGAACTG
TCTTCACCGAGAGGAAACGGTCCAGTATGTTCATTGTAAGGTAAAGACTTTCAGGCATTAGCTCAAACTTCCTATGAACTTCTATTAACCAGTCCACAAG
AATGGCTCTCATCTTATGATTCAGCTCAGGTTGAAAATCCATGTAGTCATTCACTCGACCTTCGTCCTGGTTTAGACACAACAATCATTCAACATATTAG
ACTCTGAAAAGTGGAACACAAAACATAACTGAACAAGCAAAAGAGAGTCACCATATATACCTCAGTGAGCTTGTAGAAGTTGTAGATGTCCTCAACATAC
TCCACAGCAGCCAAATGATTATCAACATCCGCAGCATCGATATCGTCAATCTTTGGTCTATTGGCAACTCCACAAGCAGCCTGAGAAAGATCACAATTTT
CAGAATCTTGATATTACCCAAAACTGCACTATTCATCTAAAGAGGGGAAAATCTAAATGTATATAACAACCTTGCTTCTTGCAGTGAGGGTAGAAGTGAG
AGTCTTTCCAGATTTCTTTGTTTTTCTTCTGCTACTCAAAGGACTTTGCTTCACTTCCTTATCAGGGCTTATAACAATAACAGTTTCAGGTGCAAGATTG
TCTGATGCCTTCTTCTTAACTTGTACCTTTGTAGTAGCAACTTTGTTGACAACTTCTGCAAGTGGTTTCTACAGACAAAAAGAAACAAAACACAAGTTAT
ATCATATCATCCACCATTTCAAGATTTATAAATCCATTTTTTCAATGTGTTAAGGTAAATCTTCACCTTGTTCTTCTCAGCTTGTGCATTAGCTAGCAAT
TGTGCACAAAAACTCCTCGTAGCAGGACGAGTGACCTGCGTTTTAGGCTTCCCTTCAACAGCAGGAGCAATCACAAGGTTGCCTATGTCTCCGAGCACAC
GCCTATTTTTCCCAGCAACTTGTCCAATTTTCTGTTTACCACCCATATCTCCTCCTATACAGATCAGTAGAACTCACATGAGACAAATGATCATGTTCTT
GCCACATAAAATTTTGTCAATCAAATCAGCATCAATGTCAAAAGAAAATCAGCTACGAAATCGACTTTTCATCAGTAAAAGAATACATCATCAGTCATCA
AACAAAGAAACAATATCAAGCATTTCAAGAACTCCACCATAAACACACAGAAAAAGAACACTTATTTCGTCTTTACACGAAAAAACCCAATCTATCATGC
TCAGTTCATACTGATTTCAAATATTTCAAGAACCCCACCATAACCACAGAGAGAAAGAACACTTTTTCATCTTAACACCAAAAAACAAACAAACCATATA
TCACTATTTCCCTCCGATATAAAAAATTTCAAGAACCCCAGTATAAACACAAAGAAAAAGAAAATTGTTTTCGCCTTAATTCGAAAAGCCCAGATGACGT
ATCACATTACCCGGATTTTCATTCAAAACCCACAATAACCACACCAAAAAAGAGCAATTTTATCATCTAAATACGAAAAACTCAAAACTCAGATGAAATT
CAATAGAAACTCAGTCAAAAAAGGAAGAAAAAAACAGGGTAAGCTAATAAATTAAGCGGAATTTCGGAATTTCATTCAAATTTCTGGTTAAAGAACAATT
TTGCTATCTAAATACGTAAAACCCAGATGAAATTCAATCGAAACTAAGTCAAAAATGGAAGAAAACTACACAAAGAAGCTAACAAATACTGGCGGAATTT
CGAAATTTCATTCAAACTTCTGTGTAAAGAACAATTATTCTATCTAAATACTTAAAACCCAGATGAAATTCAATTGAAACTAAGTCAAAATAGGAAGAAA
ACTACACAAAGAAGCTAAAAAAAGGGGGCAAAAAATTCATACAAACCTCTAGGTAAATTATGAGGAACAACAGCTTTATTATGATGATCCATTTCAAATT
CTTCTTCCTCTTCTTCTTCCACCTGATTATTAATCTGTCCAAAAACTCCACCAATACTCGTCAAAATCGATGACAGAAACGAATGGAGACGACTATTCCC
CGCCTCTCCTCCTTCTGTACTTTGATTCGCCACTATTTCTCCCCTTTCGTAAACAATTCTTGTGAATTTTCGAAGATCTTTCAAGTTTTTTTCACAGATT
TGTGAGTTAACAAAGAGAAAATATGAAGAAACTATTTGAGATTTATACAGAGAAACAAAAATGGCGAAAGGAGCGTTTTCTTTGACTTTTTAACGGTCAT
ATTTTTGGCCTTTTGAATTTGGACCGTTAGATTGAAACTAATCGGACGGTTGAGATTTGTTTTAGTAACATAAAAAGCTCTTTTTTTTACTAGCCGTTAT
AGAAGGTGTATATTAGTATGTGAGAAGACACTGGGATTTGTTACCGTTTGGTTAAAAAAAAGGAAAATTTAATGGCAAAAGGGCAAAATAGGTATTTATT
TTGAATTTTTCAATTTTTTAAAAATAATTTTATCGGAATGTTACACAAATCTTATATAGTGTTGAAGAGCTAATTATATCATATCACGACTCTTTTTCAA
ATTACAAAGATCCCTTAAATTTGGTGGAATTTGGGTACATCTCAAAACATTCTAGTACGTTGCATCTCAGTTTTAGATACGTCGCTCAACGTCCTGATAC
ATCGCGTCTGAGTTTCGACGTCCCAATACAAATCCTTTAAATTTGGTGGAATTCAGAAACATTTCAGAACGTTCTAATACATCGCGTCTCGGTTTCAAAT
ACGTCGTTCAACGTCTTGATACATCGCGTTTGAGTTTTGGTGTCCCAATACATCGTGTATGTCCGAGTACATCGCGTAAAATGATGTAACGGAAAATAGG
AAAGAGTAGATATTTTTATATTATTTAATGGTAAATTTTTTAGAGAATATGATAAAATAAATTGTGTAATTAGGTAATTTTTCGTGATTTTGTACCATTT
AAGAGTTAGTTTGATATTTAGATCAAATGATCTTCCATATCAATTAGTGATCCTATAACAATATTATACTCGATGTAATCCCACAAATTGAGGTATCGAG
AGAGTAAAGTGTACGCTGATATTACTACTTAGTACTCACTATTGTAGAGATAGAAATTCTATTTCTGACATCGACTCAGTTGACGGAAAAAAAAATACAG
AGCAATATAGAATCTTTTTTAAAACTAAAATGAAGAAACTTCATGGCAAAATACTATAGACAACCTAACAAATCATCTTAAGCAATAATTATTATAAATA
AACGATAATCCAAATATAAAAGAAATCTTAGACAATATCCGAACTCAAAGGACAAACAACTACAAAACTAATATTATAAATAATAGTACAATATAAAATA
ACATGAATTTTCACTTGAAAAAATTATAAATTCGGGGAATAAATTACTATTTTATATGTTCAAATCAATTAGAATAATATACAAAGTATAATCCTAAAAA
GTGAGATGTGATATCCTATCGGATCGTTTTGTCAAATTTTAACTATGTATTCGAAGTTGAAATGAAAAAAATAATAAATATTAAAAGAAATTGAAAAAAG
ACCAAATAATATAAATGAATATTTTTTTTTCATTTAATTTTGTGAACAAAAAAAATTAAATGATGAAAAATAATTTTTTTTAAAAAAGATTGGAGATGCG
GGGGATCGAACCCCGTGCCTCTCGCATGCAAAGCGAGCGTTCTACCATTTGAGCTACATCCCCATGTTAATATAGATATATATATATATATATTTTATTA
TTACAAATCATAGGCAAAATTTGCATTAGTTTAATAAAACAAACATTGGTTTCTTAAGATTTGGAGCTAATCGAAAAATGATATAATAATATATGTTCAA
AACTGTTTAGTAGGGTTATAAGACGGTTGCAAAGTTAAGGTGTATTTTTGAAAATCTGGGACAACTTCAATGGTGATTTTATGTCTTTTCTCGTCGCTAA
ACCGGCATACATAGTAAAGAAGACATCTCAAGTTTAACAATATTAATAGATTTTTATCTAACTAAATATCACATAAAGTCATGAATACTACATAAATAAT
GTGCGGACGAGATTTGTTGTAACAAGAAATTCGATGGAGAGTAGGAGATGGAGAAAATATTAAGGTTTGGACTTTGGAGTGATCCTTGGATTCCTAATTC
GATTGGTTATACTTGTATAATTCTTTTCATGTCAGCTATTATTGCTTTCATTTTATGAGCATTTGTACAATTACATTATTGTCTTTCGATGTAAAATTTA
TTAAAGAAGTCATGTATTTATTTTATAATTGGTTAAACTAACATCCAAATCGTTAATGATCAAAATCGATAAATCAAAAACCGATATAAAAAAATATCTT
ATTTTATTGATTTGATGAGAAAAATTAACATCTTCCGGCTGCATTAGTAAATTAGGGTTCACAAGTCCTAATCATTGAGTTTACTCATACTTTGTAGCAA
TCCCCTAGAAAGTGCCATTGATTTACTTTTTTATAACTATGGTGTGAAGACGTACACGCACTTAAACTAATTCCACGAGATATCTGTTATCTTTCATCAA
CAATACGTATCAAATAACCCTATCCACCAAGACTAATACAAACGAGAAGAAATCACCTATTCATTTTTTTTGTGTGTCTATTGGGTTTGAGCCTGAGCGA
CCATGATTTTCTTGATCATTAGACCACGCCATTGGGTTCGATGCTATTGATTATTGAAGATGTATTGTTGAGAAATTCTTAATGAACTCACTCTTAAAGC
TTTCATTACAAATAGAACACATACAAACATTGCCAAGTAGATGAATTGTTGATAAATTCTTATTTAAAGGTTCATTGCAAAGAGAATACGAGTACATAAA
ACACATACAAACATTACCAAGGAGATTGCTTTAACAAAATGTGCAGAAACAAATATTGAAGTTTGAGTAAACTGGAGAAGAGTACAAAACAACATATCCA
TAGTAATTCCAAATATTTTTACTGTGTAGTAATTTTACAACAAAGGGGTGTCGGTTGATACCCCTCAAAGTATATATGGAGTAGAGAGGTTGTTTCCAAT
CGGATTTGCAAATATATTGCCAGATAAATGCAGTGACAGCTAAAAAAATTCAGATTTTTGGAAAAAGGCCTGTCAAATGGCAAGTCATTGCAGAAAAACA
AAGAAGTCACAGACAGATGTATTCCGCGATTCTCTTGCTGGGGAATGGTAGCTTAGTTCTCTCTTGTAGTTGTACAAATTAAAATGTCGTGGACATTGTA
ACGAGCAGCAAAATGCTCTAGGACAAATCTCACCCCAGGAAAACAAAAGATAAGGGTGGAGCGTGAAAGGGGGAGCATCGTCCCCCAATTTATACAAAAG
GCGGAGTTGTTTGACTGAAATAGTAAATGTGAAGACTGAAAGATAGATAGATTACTGTGTTTTTGGTAACGGAAGCAAGCAGTCATATACCCGTTCCATC
CGCGATGTAATCCTGAGTTTATGTGCAGTTTGAAGATCTGGTTTCGCTAAGTCAATGATATCCTGCCTCAAACTGTTCACATGTAAATGTCATATTAGAG
TAATAAAATTTCAGAAAATCCATGGCAGACAGAGTATGGGTTAAGATAAGGACGAAGAGAAACAAACCTTATCCATTCACCAGTCGCCCTTGCATGTCCT
TCGACAGCACAGTACAAGCGATCCAGATAATATAATGCCAACCCCAACATGCATTGAGCATCTTTTTCCTGAGGCGTTCGGGGAAAAGACGAAAAAAGTG
AATAGGAGAACGAAAACAAGAACAACTCCAAGCTATGGCAGCATTACATGCAAGCACCAAGTTTTTATCTAATAAACGAACTGGAGAGCAAAAGATATTT
ATAGCACAACTGTCAGGGAGAAAATGAATAGGATTGAGTAAACGGTTCCACAATTTACTAGATGAAAATGGATTGCATGATAGTGGAAGAAACATGAGAT
TATCAAATGCACAAATACTATTGTACAAAGATTTAATAAATGAGCTGGTAAAGTTCAAAGGGCCTTACTTGTCCTTGCTCTTTGCAGCTTTCTAATTGCA
TAATCTTTCTCTCTACTTCCACAATTAGCAGTCGTCGTTGAATTCGGGCAACCCTTCCCCTGCCTTCTGCTTTCTTATCCTGATTATATTCAAGATTTCA
TGGTGTTATATCATTTCGCACAGCATGGCAAGACTCTTAAATGAGAGACCTCTATTAACCATCATATTATCATATATATCGACCAGTAAATGTTACTATT
TCCTTTCTTGGTTTTTTCAACTAGTACTCACTTTCTCATGTCAATAGCATTAGAAGGGGAAAAGAGAAAAGAAAACTCCTAAAATGACTTCTATTATCCA
TCATATATATCAGCCACTAAATATGTGAATACTATTTACTTTCTTCGTAGTTTCAACTAATAATCACTTACCTCATGTCAATAGCATTAGAAGGGGAAAA
GAGAAATGAAGAAAATATCCGCTGAAGTTGTTCTGAGCCAAAGTTGAGTCCACTTTTTAGGTTTAAAATCGAATCAAAAGTGCCCAATCCAGAGGATCTA
ACAATTGTGTACAATTATGAAGAATTTATCATTGTGTAATATCATAGTAACTGTTTCTGTGAATCGCATAACAAGCCTCCCTCATCAGAAAACTCCTACC
TCAATCTCTTTCCCCAGGGAACTCTTTCCGATCTTTTTCTTTGATGACATCAGAAGTAGGTTCCCTCATTGCCTCCCATAATCCAGTACTCTCTAACTCT
GAATTTATGACCAACATCTCCTTCAATAATCTTACAAACAGGATAAAAAAAGTAGAGGTAGTAGCCGAACCAGCTGATATAGCTCATCAAAAGTAGAGGC
TTCAAGAACTGCGTGAGGAGAGTGGGGGGGGGGGGGGGGGGCTTAATAAGTGTGGGAATAGAACCCTGTTCCTCCTCTTTGTCTCTCATGTGACAAATCC
TGATCCCTTTTACAATTATTTTTAATGGAATAATATATGACACAAATTGATTTTTAAACGAAAACAAGCTACTTTACCTGTTTAAGCCAAGCACGCACCA
ACATGATCACAATAAGAGAGAGGAAGAAAGCGGGCAGAGCAGCTAAAATAGCAAAATTGATTTCATTGGCCCTAAGAATTTGATCCAGCTCCAGCATAGC
CCTGTTTTAAAAATATGAAAATCCGAGAAGAAAACAATAAACACCTTTAACTCTCAGAAAGTTATGACTTCAGGACAAGAATATCAATTGCTCTCACTCA
CTCTTCAATGTCA