BAC Sequence – LE_HBa0088L02

>C01HBa0088L02.2
TCTCAATGTCCAGTTTGCATAGGATGCCTGGTTTTCTTTTGACCCACTCAGAGTCTATTGCTTCATTTGCTATTAACACCGCATCCATGATTTGCCTTCC
TTCGATAAAAGCCATCTGTTGGGAGTCTACCAGCTTGTACATCACCCTTTTGATTCTTTCTGTTAAAACTTTAGACTAAAATTTATAGAAACTGCGTATC
AAGCTTATTAGTTTGAACTCTTCAAGTTCCTTTGCTCCTTTCTTCTTTGGGATTAAGGCAATATAGGTAGCATTGACACTCTTCTCAAACATTTCCTGCT
CATAGAAATTATGGAATGCTGCCATGATGTCATGCTAAAGAGTTTCCCAACATTTGATGAAAAAACCCATTGTGTAACCATCAGGTCCTGGGGCTTTGTC
AATGGCACATAACTTCAAGCATTTAATAACTTCCTGCTCCTCAAACTTTGCCTGTAGTTGTGATCTTTCTTCCTCTTATATTGAAGGACAATTCACTAAA
TTTCCATCAGGTCTCCATTTTTCTGTTTCAAAATACAGTTTCTCATAAAACTTAATGATTTCCTCCCTTACTCTGTCTCGTTCTGTGATGATCTTTCCCT
CTACTTCCAACTGGTCAATATGGTTGCTTCTTTTGTGGGCATTTGCATTGTGGAAGAATTTTATATTGTTGTCTCCTTCCTTCAACCACTAAATTCTAGC
CTTTGTCTCCAAACACATTCCTCATTTTTTATCAGTTCTTCGTACTCCATAAAGATCTCTACCTTCAAAGTAGCCTCTTCCTCTGCCAATGCTCTTTGGT
CACACCTTTTGTAATTTGGCATCTTCCTGATGCAGATTCAATGATAATCTCTATTAACTTTGTCAAACACTCTGATGAACCAATTTTTCAACTTTTCCCT
TTTTCATTAGTACCCAGAGTTTGAAACAAAAAGAGAAGTTAAAACTCATTCTATTCTCACACTATCACTCTGTTAGTACCCTTTTAGTCTACCAACAGTT
TTATGCATGGAATTTAAATCAGTAGCTATTAATTATGTTTTTCTGTATTCTCTGTAATAGTCCTCTATAGCAGTGTTTTCCCTGTAGCAGTTGTTTGTTG
TGTATTATGTGTCGTAGTTATTAGCAGTAAGGAGGTTATTCCTCCACTTTCTCATTTCAGTAGTAGGAAGTTACTTCCTTGTTATTAGGTGGGTGGTTAA
TCACCAACGTTGTCTTTAAGTTATTTGAATTCAATGGAAAGAGAAGCAAGAAAATTTGTACTTCAAACTCAAGAGATTGCAGGTTCTCTCTCAACAAACC
AGCACCATAGGTAGAAAAAAGAAAAATTTAGATTTTATCTTGCAGTGTCACGTAACTAGATCCATAACAGGGGATCATAACAACTTGGTATCAGAAAAGG
GAGTTACGGGAGACCAAATTCAACATCAACACAAGCACAATTAGTGAATTTGTTCCAAGAAGAACGTGCAGCCAATTTAGCCAGACATGAAGCAACAAAT
GCTCGCTTGGATGCACTCACACGGGATTTAGTAAATCCCAAGGTCGATTCTGATTCAACTGAACATATCAGTCACAATCGGGGTTGGAAAGGTAAAAAAA
AGAGTGTCAGGAGGGGAGGGTCAGGATCAGAAACATGTGGAAGTTTCATCATTTCTCGACATATAAAACTGGATTTCCCACGATTTAATGGCCAAGAGGA
CCTTTTGGGATGGTTGAACAGGTGTGAACACTTCTTTCAACACCAACGAACTCTGGAAGAAGAAAAGGTTGGACTTGCTTCTTTTCATTTGGAGGGCAGT
GCACAACTTTGGTTTCTTCAATTAGAGACAGATCTGCCTCAATTGACTTGGGATGACTTCAAACATCATTGTAACCTTCGTTTTGGGCCACCAATCAGTA
GTCAGAAAGTGAGAGAATCGGCTCAGCTACGCCAAATCGGGTCTTTGGCAGATTTCCAAGAAACATTTGAGCAGTTAATTTCGCGGGCTGGTACACTTAC
ACAATCACAAAAAAACTGAACTTTATATCGGCAGTCTTACTGATTATATAGGAATTGAGGTCGAGTTACATATTTTTCTAGATTTGGCTACGGCGATGAA
TTTATACCGACTTTAGGAACGCAAGGAACAACCTACTTGTTCGCAATTGTTAGATGCTTTTAAATCAAAGACAACAGATTTCTCACCTCAACAACATGTC
AGATTCGTGAAGAAACTGACCAATTCTGAAATGATGAAGAAGTTATTCTGGATTGATTTGATTAACGATGAAGAAGAATTACTTGACAAACTTTGTGCTT
TAGGACAAGCGTGATTTGAAGGATTAGAGTACTGTTAGTACCTTTTAATCTACCAGTACTTTTATGCACGGTAATTAAATCAGTAGCTATTAATTATGCT
TTTCTGTTTTCACTGTAATAGGTCTTCTGTAACAGTGTTTTCCCTGAGTTGTTTTCTGTGTATTCTGTGTAGTAGTTATTAGCAGTAAGGAGGTTATTCC
TCCGCTTTCTCATTTTAGTAGCAGCAGGAAGTTATTTCCTTGTTATTAGGTGGGTGGTTAATCACCAATGTTGTATTTTGGTCAAGTTTTTGAGTATTTC
AAACTCAAGAGATCGCAAGTTCTCTCTTAACGAACCAGCAGCACCATAGGTAGAAAAAATAACTTCAGATTTATCTTGCAGCGTCCCGTAACTAGATCCA
TAACAGGGGACCAGAACACAATCTTATCCAATATCCTTGAGTGAGCGGAGAATCTTTAGACAACCACAATAAATAGGTGACAACTTTGTAGAAAAAGAAA
GAGTCACAGCCCGGTGCTTCATCCTGACACTTATATTAGCATGAGTAAAATGATTCAAGCTCAAGTTGATTAAAAGAATATTGGTTGATCTAGGAGAAAG
ACGATGCCAAAGAAATTCAGGAACCAGTAACAGAAAGAGAGGCATGTGGTAGACAAATACAGGAATCAGTCATGGAAAAGGAATAAAGAAAAAACTGCAG
AAATACACCAAAAATAAAAGTACGCAACATCAAATCCCTGCTGCTGTTTTAGGTTTTTCCAAGGAACCAGAAACAAAATGGAAGTAGAACCATTCAACAT
AACAGAAACAAGAAACAATCTGCTCTAAGCAGTGTGTTTAAGTTTCTTTATTGAATTAACCAATAAACATTTCAAGTGAGACAGGAAATAGTTCAAAAGA
AAACTCATAACCACCATTCCCAAAAGAGGAAGAAAGATATAACTTACAAGGATCTTGGACGAACTGCCTTTGTCCATTGTCATTCCAAGATGAAATAGCC
ATAATCGACCTGGGATGTTCACCACAAGGATGTAAAAAATGTTATACTTGGAATATTGAGAATAGGCATTTTGCAATCTGTCATCATGTTTTAGGCCAGG
TCCCATTTTTTTAGGTTCACTATCCCACTTAGCATATTTGGCCACAAGTTTATGTAAGCAGAAGTTTTTAGTCCTTTTGCTAAAAATGTTATATAATCAA
AAATGGAAATTTATCCCCAGCGCTTCCATCGATTTTCTCCTACCACGTGCCTGGGAGAGAAAGAGATCTTGGATGGCTGTAGAATATGATCCAATTATGT
TGGTTCTTTAAAAAAATGATCCAAAAGGTTGAATGGGGGGGAGTTGGCCAACAAGAGGAAAAAAATAGATTTTCCTGATACAAGGATGAAGTGAACAATC
CTTTGAATGTAAGCATGGAAAATCTGGGTCCTTGAGAATGCCTTACTTGTCTCTGTCAAGAAGAGTAGCTCCAGCCTCAAAGTAGTCAAAAAAATCAGCC
GCAATTTCCATATCATCTGCATGTCAGAAGCAAAAATATTGTGAGAAGAAAAAGTGCAGAGAATATGCAACATAGTGATTAAGATAGATCAGCGGTACCT
TCTAGTATGATAACACGGCTAAAATTATGCTTGTGAAACAGCTGATCCAATGCCCACTTGTAATGACCTAAGGAAAGAGTGGTCCAGTGGTTAATGCAAA
ACTAACACTAGTTGAAATAAAAATGAGCAAAGGAAAAAGTTGAAGGAGAAAAAGCAAAAAAAATCCTTACGTGCAATCTTGTAGTATGCAACCAGTTCCC
CTGGTCTTTCAGTATGCACAGGTTCAAAATCCAAGTGCTGTCGATTAAAAATCAAAAAAGGTCTTTTATTAAGAAAGTCAATAAAAACTGCCAAGAAGAG
TTTGATACAAAGATCAAACAGAAGCAATGCTTGTAACTACACTTTATAATGTAAGGCCAGAACTGTTATCACTAATCACCAAAAGATTAGATAAAGACTA
AAGTAACTACAGCTACCTTAAGCTAAACGAAAAGAAGCTAGCTTCATTCCCATGCAAGTAAAGCATTTATCAGAACAAAATTTAGCCAATTGATATGTTA
TAAAACTATGAACCTTGTAGATCAGTAGATGAGTATTTATACAAAACAGAAGTATGGCTAATCAAACAAAGAGAGAGAAGGAAATCATATATATGTATAT
ATATACATATATATCTTAAAAGAATAAATCAAACTACACATGCCTCTTCCACTTGTATAGCTAACGGGGGGGAGGGCAAATTGTCACACAATGAATGAAT
GAAGTATTAAAAGAGTTAAAATGATTAGGATAACATTTAGATGTCAAATATTGATTATGTATTTTTTCCCTTTCCATTTTTACTAGATAAAAACTCCTTA
TGGGTAATTTTTCTACTAACTTGTTTCACCAGTACACGATCTTGTTACTGGAATGACGATGATTGAGCATTGGAACAATGAATTCATATTCTTAAGTCTA
TACTTTTTCTCCAAGTAAGGATCAGCCTGATTTAAATTTGACAGATAGATATACCCCAAATAAATTTCATTTTCCCTTTCTCAAGCGATAGGAAAAGTAC
CTGCATATACGTCAGTTGATCATAGCTCAAAGCAAGCTTTCTAACATCAGGATTCGATCCATCCTGCCAAAGGGAAGTAGAACGAGAAGTAGGCTCAGCA
AGACAAAGAAGACAAGCATGCAATAGAAGGCTATGAGGGAAAATAAATGGGTACCTGGGATATGAAAAGAGGATATTTTGATGCAACAGATGTTTGGTAT
CTGATGACAACAATGGAAATACCGGGCTTATCAGCTGAGGCATCTAGTATGTCATGAGAAGCAGATAAAATTGTTTTGATAGAAAGCATACTTTAAGATG
GATTTTATAGTCTTCTCCAGGTAGTCAGAACGACTGCAAGCCATAACAACTACAGCTGCCACTGGCATCTAGTAAATATAGTAATTAGTTGATGAACAAA
GATTTGACAGAATTGAGGTCACCAGATGGTGGTAGCAAATGTATGACTGAAGATGTGGGAATGTATATAAACCTGCACATTTCCGATTAACTTTTTTATG
CCCTTACCTGTAACAGATAAATTAACAACATCAAATATATAAATAAGTTCAAATACTTGTAGGCATGAGTATATATTTATGTATTTAATGATAAGATAAG
ATTCCTTGTAGGCATGACTTAACTAGAATAGAATTTAGAGCTCACAACATTAATAAACTCAATGTATGAACTGACAAATTGACATTAACAGGTCTTTATT
TATCACATACAATGGGTATATATTTTGCAGGTGTACATTTCATACTACTGCGACTAAAAGCAGCGGCTTTTGACAAAAAGCTGAAAGAAGAAAGAGGAGT
TTATCGACTTACTTTCAAGATCCTGAACAAGAGCCCTTAATTGTCGGCACTCCTGGTCCTGGCGCTTCATTTGTTCTGAAATGTAGCAAGATAAAGATAA
GGGAAGTACAACTACCCATAACCCTTCATATAAAAAGTTAAAAAGCATTGTTTTTTTTCGATTGGTACAGAAATTATTTGAGATCTACATTATCACAGAA
AGAACAAGGAAAAATGCATTGAAAGAGAAACATGAAGAAACTGAACAGGTCTAATGCGCCAAGTTGCATCAAGGCCATTTACAAGGAGTCGAGCACGAGA
TCTCCAAGCATTACAAGGACAATTTATGAAGATGGAAGTGCTTGAGCATATTTTGATGTCATCCCAGGGATCTCATGTCATGAAGATAGCCTTAGAGGAC
AAAATAGGAGGGATCTATGACTAAACATATGGACTTTATCTCAACCATAAGTCAAGAACAGCCAGATGCGGCAGGTACAGAAGCGACATATGGCCCGCAG
AATTACTTATGCCCTGTACCTTGGACTGTATCTCAGAACTGGACACTGCCCAGATTCAGGCCTGAACCGCATGTCACGATTAGCAGAGCAATTTGGCTAA
TTTTACAATTTTCAAGGGATGTCACTTAAGGCGTTTTTTGTAATAATTAGCCTAAACTATAGATAGTTGAAACTATCTTGATAGACTTAGTCTTAATGAA
TATTGGTTTTCTTCTCTTTGAGAGATTTGAGAGCTTGGTTTTGTTGAACCTTTGTTTGAGAGGTGAGTTTCAAGGTGAATTCAACTCCCTTGAGGTTCAT
CTTAAAGCTTAGGTGTTTTTTTCGGATTCAACAATTGAAGGTTTTGGTTATCTTAGAACCATAATTGTCAATTAATTCCATACTTGTGTTCTATCTATTT
ATCTTTTACTTTCTTGTTCTTAGATTAGGGTTTCTTTTGGTTTCCGCATTGCATCAAGGTCCCATCCTCACTGCTCATCCATGAAGATATCTCGCAATAT
ACAACACAAAAACAATAATTGTTTAAAAAGAGAACAGATCTATACCATTTTTTCCACCACACTCGTATACAATAGGACGGAACTTACGTAAGATTTTCAA
GATATACGATTTCCAATAGATCCATTGTCGAATGGAGGATTACGAATGAAGGAAATAAATCCATTTCTAACATAGTTAGAAAGAGGACAAAAAAGAAAGA
AAAGATTACACCGGAGAACACAGTGCACCTTCAAGAGCCACTACTCTTCCTTGCTGCTGGCTAATCTTGTCAATAAGCAACCTAGTCTGACTTGTACAAT
GATTTTCTGCTTCAATCTGTGTCATTCACATGATTTGTACACATTATTAGCAATTAAAAGCTATTTTCTTCTTTCTTTAGCTACATCATTGACGTAGGAT
GCAGTTGTGTGTTGCTAAGAAAATGCAAAAGAAGATTAAGCAATCTCCTGTTGAGAAGAAAAGAGAGGATTTTCGGAATGAATATTTGAACTGTTGAAGG
ATACCTTCAAGTAGAGCATATGAAGCTTTTCGAAACGCTTGTTAAAAAAAAAGCTTTTAGAAACATTATGTTCATAATACATGACAAGAATTATAAATAC
ATAAACGATAGAACACAGGAAATATGTCTATGGTATTTAGATTCCATTCGGAAGGATGACTAGATGAGCCTAGATACTTACCGCAGCAGCAAGGCGGTCT
GCATATTCTGACTGTGTCACGAAAAGCCGCATCTGAGAAATGTAGCAAAAACAACCACTTAAAATATACCTACTTCGCCATTAAGCAAACAGTAATCCAG
TTAGGTAATTTCTTCTCATAACACCAATGTCAACAGAACCAAGTAACCTCATATGTAAAAATAAAGATAAAACAAGCTAATCATGCAAAGAAAGGATTGC
TTGGGGTAGTGGACAAGTTATGGCTTTACCTAAGCAATATAAACTTTTCTCTTTATAATAGTGATATCAAGGCTACCTTTTGTGAACCTCGACCAATCCA
CCAGGTACTTACTATCTTCTAGCAACACAAGTATTGAGTAACTACATCCACTAAGCTTAGGCAGATGCAAGGAATTTCTGTACTTTTTCCTCTGTTCGAA
TTCCAATCTTGGTTCCCAATTTCGCCACAGCAATTTCTCGGTCGCTAGGCCAGCCCCTTGTGACTTAAAATTCATATGTTGCTATTTTCTTTTGTTGGAA
ACATCATAAAGAGATAAAAGAGATACTAAAACCGAACCAATACAGTATGGTAACGTAAGTTATACGCATAAGTTGGCGCAGTATCGTCAGAATATATTTG
GGGAAACTTTCAATTTCATTACCTACAAGCTATAAGAATTTTCAATTGCATGGCTTCCGATAATTTTTGGACATTTGAATGTCAATTCTTTGCTAAGCAC
TGACTCTATCTCTGCCAAGGGGAATTGCAAGCCAAATCCTAAAAGAGAGACCAGTGGCCTAGCTAAGTTTGTTGAAGGAAGGTTCAAGTAAATCTCTTTA
GCGGAAATATCACATTGTACAAATAGGGTAAAAGCAGCTAGTTTTGTACAAATAATTTTTTGCATCCCCTTGATGGTTAAGCAATTCATTGGTTGTGCAA
GTTTGCATTTCTTTTTAGCCAAACCCCTCATTAGATGATTAATGTAGTTGACCCGGAGGAGCTCGGGATTTAAAGTTATAGTCGTTAGTGGAATTGTTCT
ATAGCTTCATAAGAGATTCTAACTCAACTGACAATTAGGTTCACTAAAGATACCAAATTGTGTTAAATTACAGAAAAAATCGCTGAGATGAAATGAATAA
TAGTTATATGCGTATAGATCTGAGAGGAGGCCAGAAGATAACCTGTATGTAGATGAAGGCGAGAGCAGCCACGACGAGAAGGTACCGTAAATCAAAGCAA
AACTTGTTTCCTCTCATCTCTGCCAAATGCGAAATTGAATTCTAAGGGTTTCTCAGTTCCGAGTGTTGCCTCACATAGGATCAAGTCAATAACGGTCTCT
TCCAATTACATCACAGACTCTAATTTGTTTATAGGCTTAAGAGGAAAGGATCAATAGTCCATTTTTCTCTGGGTTAAAAAGATTCAATTGATTCTTGAGT
TTTCACGTAAAGCATTAATAGTTTTTAAAAAAAAAAATTAGTATATTTTTTTTTCCAAAATTTTATTTATTTTTAGCATTAATTTTATTCATAATCTACG
TATAAAATGTTTAATCATAATTTATTTTGTTTAATAGAAATCGTAGTGCTCCATGTGAAAACTTAAAGATCACTTTTGAGTCTTAAACCAAAGGTGATGA
ATTATTTTGAGCCTTTCCTCGCTTAAGTAATATACAATGAGATTTGAACCTTAGTACAACAACACTAAAAGAGTCTTAAGTACTCATCCTAGAATCACTG
GGCCAACTATATGATTTATTCGTTGGGTGCTCTATGTTAATTTTATACAAATACCTATCGATTTCTACATAGATATATATATTTCGTAACGAAGTTAATG
GGTGCTCGAATATCCGGCGAACACCATGTGAATCCGTCCCTGTTTTAAAATATATTTTAATGATAAAAGTAAAATAAAATTTTGTATCCCGAAAAAATCC
ACCCACCCAAACCTTCAGGGTTGACGGTACCCATCAAATTTTAGGCCCCTCAGCGTGGTCTTTTTTACTTCTTCTTCTTCATCATAAATTAAAAATGGTA
AATTATTTAGACTAATTTTTTTAAAAAAAAAAAAAAACTTTAATAGTTACATTGTTGCCAATCAACTCAAATTCTTTTCTTTCTACCCCATTAGATCAAT
CACTCTTTTCTCCTTTATATAATAAACGGATCAACAATGGCGAAATATCCAATATCTTTCACTTTAATAGCATCAAAATTTCTACTTGTTACCTCTGTCT
TTTTTTCATTAGTAATCATTTATCACAATTATAATAGATAATAATAAACTTTTGCCTGATAAAACCAATTCATATTATTACCATCGGAATGAATCGATTT
TTGCCTAAATATTGAAGATATAACATCTACAACAAAAAAATTAGAAGAAGAAGAAGAACCGGAGAGGGTGAGAGACAGAGAGTGAGCAGGAGGGTGTGGG
GTGGGTTGTGCACTTGTGTACGAAAAATTATGGAGATGGTCAATATAAATAGTGCAGGGGTGCAATTTTGGGCGGGGAAAAAAAGAGTACATTTTCAAAA
AAAAAGTTAAATTCTTTTTATCCCTTTTCATTAGTTTTAGTATATAAGTTAGAAAAAAAAAAGTAATAATTTCAATAGTTTTATGCCCTTTTAGAGAGTG
TAGCACACGTTTTTTGACATGTCAATATTTTGTGTCTAATAAAAATAATTTTTGAACAAATATATTGTCCAATAGGCACAAACATAAGTTGAGACGTTTA
AATGAAATATTCAGACAACTTAAAGGGGCTCCATATGACTTAAGTCTTGTTAATAACATACTCCGCATCGGAAAATTGTTTATTAAGCATTGTAGTAAAA
TGTACGAAAAAATCGGATAGACACAAAACCAACAAAACGCGTGTGCAGTAAGGTATACCCGACAATACTCCAATCCAGCTCATCAAAATTTATGTTCCTT
GTGTCTCTAATCAATTAAGTTAAGAAAAAAATTATTGACGTAGTAGTTTATTATTTAATTCCTATTAATTATAAAGTAGATAAAATAAAAATTTAATATT
TTAAAAAAGTTATTGAAAACTGCGAATTGAAACGAAGCCTAGTTTAAGACACCTACATTATAACATTTTGCCTTAGAACGACCTACTGACAGTCCTGCAT
GTCCGTAGGTTCATGGTCTGTAGCTCCTAAGTTGGCTCTTGACCCACGACCATGAGCTACGGGAAGTAATTAAGGACAACTACAAAAGGAAAAAGTGAAT
AAGAATTAGGAATGTATTAAAAAGAAATATTTTTCTCTTTTCTTGATTATTATATTATTATTATTATTTGATTTATATTTTCTTATTTCATAAAACAAAT
TCTTTCTAAAACATACACCAGATATAATTCATATTATTTTCTTTGATAGTCGTTTAATATAAAATTATTTTATCTGCATTGTTGATTTTTGTGCAAATAA
AATCATAATATAAAATTATTAATTGTATCTATATTTAATGGGAAACTTTCACATATAGCTATGACTTGATAATTACAATTTGTAACTACATGTTATATGG
AGAAGAGCGGCGAGCGAGACTGGGAGAGAGAGGAGAGAGGCGAGAGAGGGGGAAAGGTAAATTGTATATGTATTCTGGTTAGATAATTGTATATCATACA
TATGTAATTGTATATATGGCAAGAGATTGGGAGAGGGAGGAGAGAGGCAGTCGAGACTGGGAGAGAGAGGAGAGAGGCGAGCGAGATCAAGAGACGCGTG
CGAGAGAGGGCAGAGAGTGGAAGAGCGGTGAATTGCATATGTATATAATTGTATATAATTGATATTATACATATACATTTTTATAAATGGCAAGCGAGAT
TGAGAGAGGGAACAGAGAGGCGAGCAAAGAGCGCTGAGAGTGGGAGAGAGGTGAATTGCATATGTATATAATTGTATATAACTGATATTATACATATACA
TTTTTGTAGTTCGTTGTCCTTTGTTTTCTTTTATTATTCTGGTAAAAATCTTCATCTCCAAATTAATTGGGACAAGAATTATTCCACTAAAATAACATAT
ATTTCTCTAATTCCTTAGGTTATGTCTAAGCCTCAATTGAAACGGACCTACTTATATTGAACTTCTATTATGTAATATATTTGTCATATGTCATCTGTGT
CAAATACAAACTTGTGCAATTGGTTGGCCTGAGGTCTACATATGCAGTAGAGTCGTTCAACAACCATCTTTCGAAATTAGCAGGTATTGTATCTATTAAC
TTTACTATTTACTCATTGAGATATACTTGCGTGATCATTCTCTTTTCATTGAGTCCATGACAAAATGATTGTTGGGCTGCCCAACCATCTAAGCTACTCA
TCAAACTGCAATTGCAGTGTTTTTTTTCTTTCTTTCTAATATTAGTAATTTTGTCTAAAAAATTAACATTGTATGATTGCCCTGCAAAGAAAGAAAGCTC
TATTAGTTCTAGCAACTCAATTGCAAAGATCATGAACAACAAAAGCACATAAATTATTACTTTCATGGTTATTTGCACTTGATAGATCTACTAATGATGC
AAATTAGGTAAAACCACCCAAACTTGTTATATGCATGGCATGGTATTTGACTTCTTCTCCATTCCACAATAATTTGACATAACTAACAATAAATTGTAAC
GACCTGTTTAGTCGTTTTGAGCAGCAGATTTTATTTCTGGAAAAACAGACTGAGGCGACGGACCCCACGACGGACCGTCATGGGCACGACGGACCGTCGC
AGGTTCTCGTTTCAAAACACTTAGAAAATCTAAAAATTGGGTGCTGAAATCGACTCTCTGAACTTCGTAACGAAATGGCAGGACGGACCGTCACAGACCC
TTGGTGGAAATTTGGGTCTCTGAACTTTGCGACGACCTGCAGGACGGACCGTCGCAGGCACGACGGCCCATCACAGGTTGCGCAATCCCAGTCCGGGTCG
GATTTCTTTATACGTTTTAAGGGACGTTTTTGACTATTCCTGCTTAAATTATAAAGTTAGGGGGTTAATGTTAATAAGTCTAATTACTTGGGGGTTAAAA
GAGGTAACCTTAAGTTAATTAGTGGGTTATTATTGCCATCTTTTACACTTGATTATATGTTAATTAGGGTAAAAGAAAGAGGGTTTGAATAAGAAAAATA
GAAAGAACAAAGAGAGACAGAAAAAGAAAGAGAACGAGTAGAGAGAGAGAAACGAAGAGGATAGCAAGGATTTTGAGAAGATAGCTTGTTGATCGCAATT
CTTCGGTGAAGGTAGGTTATGGTTTTCATACTATTCGTAGTAAACTCTTAATAGCGAATGATATGTATTGATAGTATTGTAAACCCTGCTATGTGCTTAA
TTGTATGCTTGCATGAACGTGATTATATAATTGTGATTATATTAAGCATGATGAAGCTATCGAATCCCAAATCTTGATAAAAACCTAATCTCTTTTTAAT
GATGATGCCTTTGTAAGGGATAAGGCTTGATGAACTAAAGTAATGAGATTGATGATGCCTTGGTAAGGGAGAAGGCTTGATGAATTGATAGAATGAGATT
AGGGGATCGGGTGTTACGAACCGACACGTAGAATTAGGGGACCGGGTGTCACGAACCGACACGTAGAATTAGGGGATCGGGTGTCACGAACCGACACGTA
GATTTAGGAGATCGGGTGTCACGAACCGACACGTAGAATTTAGGGGATCGGAGTGTCACGTTTCGACACATAGTAGTAGGGGATCGGAGTGTCACGTACC
GACACAAGAGGATTAATGAATATAAGGGAGCGGAGTGTCACGTACCGACACAAGAGAAATAAAGATAATGAATCTTAAAAGATGTTAATATACTCAATCT
AATGAACATAATTCCCAAATGAGTATGGTATTGAGGCTTGAGTCCTCATGTGTGAACTTGACGGAAATTGTTAATGATATAGTACTTGTTGTTGCTACAT
GTTGAGTATCATAGTTGAGTTTATGATATTACTTGGTATATACTGTTTTCTATTTTGAGTTGGCCGATGATATCTACTCAGTACCCGTGCTTTGTACTGA
CCCCTACTTTTATGTTTTCTTCTTTGTTATTTGTGGAGTGTAGCAAACGTGCCGTCGTCTTCGACTCAACAGTAATTCAAGCCAGTCTTACTACATCGGA
AATTCAGGGTGAGCTAATGCTTCTAGCTTGGACTGGAGCTTCTTCTTCAAGTCTTGATGCCTTGAACTTCCGGCATGGACTAGCTTCTTATGTATTTTTA
GCTTCTTAGGCATTTTTAGTTAGTAATTTGATCATAGATGTTCTTGTGATGATGACTTCCAAATTTTGGGGAATAATAGTTATTGATTTGGTTTTTTTTA
TAAACGAGTTTAAGTCTTCCGCATTATTTTCTGCTGATATTATATTGAAATGTTAAGGTTTAGATTGGTTGGTTCGCTCACATAGAAGGGTAAATGTGGG
TGCCAGTCGCGGCCCGAATTTGGGTCGTGACAAACTTGGTATCAGAGCATTAGGTTCGTTGGTCTCATCACACAAAAACGAGTCTAGTAGAGTCTTAAGG
AACGGTAGGGGGACGCCTTTACTTTTCTTTGAGAGGCTATAAGACTTTAGGAAAATTCCATTCTTTCATTCTTTCTTTTGTGCTACTACTTGAATCCAAT
TGGTATCTAGGTGATACAAATTGGTATCTGACCATCTTCACTCTCTTTCGCAGATGGTTAGAAATAGAGCAACAACTACGCCAACACCAACACCAGCACC
GGCAGGACAGGGTGCGTCTGAGCCAGCCACTGGGGTTGTAGCTCGAGGAAGAACAACGGCAAGAGGCCTTGGGAGAGGTCATGGGAGGACGTCCTCTAGA
GGAAGAGGACGAGCACCTAGCCCATCTGATACTAGGGAAGTGACTCCTCCACCGACTGAAGAAGTAGTAAGAAAGGGTGAGGAAGGGGAAACTGAACAAG
TACAGAATGAGGAATTGCCACCCCAACCTACCCCAGAGATGATCAATCAGGTTCTTGCTTATCTTAGCGGGTTATCTGATCAGGGTCAGGCACCTCCAGT
GTTTTCTGCACCAGCACCTCAGGCTCCGGAGGTACAACGTGCGGCTACTATGGCTCCTTGCATGGATGTTCCATTGGAAATAGGCACATTTCCTCGTCTG
ACTACAGGGCCTATAATGACAAGTGATCAACATGAACTTTTCAGTAAGTTCTTGAAATTGAAACCTCTAGTCTTTAAGGGTGCTGAATCTGAGGATGATT
ACGATTTTCTGGTTGACTGTCATGAGCTACTACACAAGATGGGTATAGTAGAACGGTTTGGTGTTGAGTTCGTGAGTTATCAGTTTCAAGGGAATGCCAA
AATGTGGTGGCGGTCACATGTTGAGTGTCAACCAACAGAGGCATCACCTATGACTTGGGCCTCATTCTCTAGCTTGTTTATGGAGAAGTATATCCCCCGA
ACTTTGAGGGATAGGAAAAGGGATGAGTTCTTGAGCCTAGAGAAAGGTAGGATGTTGGTCAATGCATATGAGGCTAAGTTTCATGCACTATCCAGATATG
CCACCCAACTTTGTTTCAGTCCACAAGAGCGGATTCGTCGTTTTGTGAAGGGGTTGAGGTCAGAGCTGCGGATTTCAGCCTTACAGGTAGCGGCTACGGC
AAAATCCTTCCAAGAAGTGGTAGATTTCGTGGTAGAGGTGGAAGGAGTGAAGCCAGATGAATTCACCATGGCATCGACATCAAAGAGGTTTCGAAAGGGA
GGTGAGTTTAATGGTTCTTACTTTAGAGGACAGGGTTCCGGAGGTTACTCAGTTCGACCAATTCAGTCTTCACTACAGACTGTAGTGGGGGTCCACCTCA
GACCGGCCAACACTTTTCTGAGAGACCTATGCTTGACTCTAGAGAGTGTTATGGATGTGGGGAGACTGGGCATATTAGGAGGAATTGTCCTAAACAGAGT
TATAGACCCCCAATAGCTAGAGGTAGAGGTGGTCATGGTAGAGGCCGTTATTCTGGAGGACGTGGTGGTCGAGGTAATGGTGGTCACCAAAACGGCAGAG
GTGATGGGAAAACTAGAGCCACTACACCACAACATGGTAAGGGCAACGGACAAACAAATGAAAGGGCCCATTGTTATGATTTCCCTGGGAGATCTGAGGT
GGAGACATCTGATGCTGTCATCACAGGTAATCTTTTGGTTTGTGATTGCATGGCTTCTGTATTGTTTGATCCCGGATCCACATTTTCTTATGTATCTTCC
TCATTTGCTAATGGTCTTAATTTACATTGTGAATTACTTGACATGCCTATTCGTGTTTCTACCCCGATGGGTGAGTCTGTGATAGTTGAAAAAGTGTATA
GGTCTTGTTTGGTGACTTTTGTAGGGAGTAACACTTATGTAGATTTGGTTATCTTAGAAATGGTTGACTTTGATGTAATTCTGCGTATGACTTGGCTTTC
TCCGAATTTTGCGATCTTGGATTGTAATGCTAAAATGGTGACGTTAGCCAAGCCTAGGACAGACCCGTTAGTGTGGGAGGGTGACTACACTTCCAATCCG
GTGCGTATCATCTCCTTTCTTCGTGCTAAGAAAATGGTTAGTAAAGGGTGTTTAGCTTTCTTGGCCCATCTCAAGGATGACACTACCCAAGTACCTTCGA
TTGAGTCGGTTTCGGTAGTCCGCGAGTTTTTGGATGTGTTCCCTGCAGATCTTCCTGGTATGCCACCAGATAGGGATATTGACTTCTGCATTGATCTTGA
ACCGGGCACTCGCCCCATTTCTATACCCCCTTATAGAATGGCTCCCGCGGAGTTGAGAGAGTTAAAGGCCCAACTTCAAGAGTTGTTGAACAAAGGCTTC
ATCAGACCAAGTGCATCTCCTTGGGGTGCTCCGGTTTTGTTTGTGAAGAAGAAGGATGGGAGTTTTCGGATGTGCATAGACTACAGACAACTGAATAAGG
TAACTATTAAGAACAAGTATCCTTTTCCTCGCATTGATGACTTGTTCAATCAATTACAAGGTGCTTGTGTCTTCTCTAAGATTGACTTGAGATCTGGTTA
TCATCAATTGAAAATACGGGCAACGGATGTGCCAAAGACTGCTTTTCGAACAAGGTATGGGCATTACGAATTTGTGGTGATGTCTTTTGGTCTTACGAAT
GCCCCTGCTGCATTCATGAGGTTGATAAACGGGATTTTTAAGCCATATTTGGACCTCTTCGTGATTGTATTTATTGATGATATATTGGTATACTCAAAGA
GCAAGAAGGAACATGAAGAGCATTTGAGAATGGTATTGGAAATGTTGAGGGAGAAAAAGCTTTATGCCAAGTTCTCTAAGTGTGAGTTTTGGCTAGATGC
AGTGTCCTTCTTGGGGCACGTGGTTTCTAAGGAAGGAGTGATGGTGGATCCTTCTAAGATTGAGACAGTGAAGAATTGGGTAAGACCCACTAATGTGTCA
GAAATAAGGAGCTTTGTTGGGTTAGCTAGCTACTACCGCTGATTTGTCAAAGGATTCTCTTCTATTGCTTCCCAATTGACGAACTTGACTAAGCAGAATG
TTCCATTTGTATGGTCGGACGAGTGTGAAGAAAGCTTTCAGAAGCTCAAGACTCTGTTGACTACTGCACCAATTCTCACCTTGCCAGTGGAAGGTAAGAA
TTTCATTGTTTATTGTGATGCATCCTATTCTGGGTTGGGTGCAGTGCTAATGCAAGAGAAGAGTGTAATTGTTTATGCTTCAAGACAATTAAAGGTGCAT
TAACGTAACTATCCAACTCATGATTTGGAATTGGCTGCGGTATTGTTTGCATTAAAGCAATGGAGACACTATTTATATGGGGTTAAGTGTGAGGTCTACA
CGGATCATCGTAGCCTACAGTATGTCTTTACTCAGAAAGATTTGAACTTGAGACAGAGGAGATGGATGGAACTACTGAAGAACTACGACATCACTATTTT
GTATCATCCGGGGAAGGCGAATGTTGTAGCGGATGCTTTAAGTAGAAAGGCGGGAAGCATGGGAAGTCTAGCTCACTTGCAAGCTTCTAGACGCCCATTG
GCTAGAGAAGTTCAGATTCTGGCTAACGACCTTATGAGATTAGAAGTAAATGAGAAGGGAGGACTTTTAGCTTGTGTGGAGGCAAGATCTTCCTTCCTTG
ACAAGATTAAGGGAAAGCAGTTTAATGATGAAAAATTGATCCGGATCCGAGATAAAGTGTTGCGAGGAGAGGCTAAAGAAGCGACGATCGATGAGGAAGG
TGTTTTGAGGATTAAGGGAAGGGTATGTGTACCCCGCGTCGATGATTTGATCAACTCCATTCTGACAAAGGCTCATAGTTCAAGGTATTCAATACATCCG
GGTGCAACCAAGATGTACCGTGACCTAAAGCAACACTTTTGGTGGAGTAGAATGAAGCGTGATATTGTAGATTTTATTGCCAAATGTCCAAACTGTCAAC
AAGTAAAGTATGAACACCAAAGGCCCGGAGGAACACTTCAGAGGATGCCCATTCCGGAATGGAAATGGGATAGAATCGCAATGGACTTCGTGGTTGGTCT
TCCAAAGACGATGGGTAAGTATGACTCCATTTGGGTGATTGTTGATAGGTTAACTAAGTCTGCTCATTTCGTTCCGGTTAAGGTGACTTACAATGCCGAG
AAGTTAGCCAAGATCTATATCTCAGAAATCGTTCGATTGCATGGGGTTCCACTATCCATCATATCAGATAGAGGTACGCAGTTTACTTCTAAGTTTTGGA
AAACATTGCATACAATTGGGTACTAGGTTGGACCTTAGTACTGCGTTCCATCCTCAGACCGATGGTCAGTCTGAGCGAACGATTCAAGTGTTGGAGGATA
TGCTTCGTGCATGTGTGATAGAGTTTGGTGGCCATTGGGATAGCTTTTTACCCTTAGCGGAGTTTTCATACAATAATAGCTATCACTCAAGTATTGATAT
GACCCCATTTGAAGCATTGTATGGGAGGAGATGTAGGTCTCCCATTGGTTGGTTTGATGCATTCGAGGTTAGACCTTGGGGTACTGACCTTTTGAGGGAT
TCGATAGAGAAAGTGAAGTCTATTCAAGAAAAACTTCTAGCGGCGCAAAGTAGACAAAAGAAATATGCAGATCAAAAGGTTAGAGACTTAGAGTTCATGG
AGGGTGAACAAGTCTTGTTGAAAGTTTCACCAATGAAAGGGGTGATGCGGTTTGGTAAAAGAGGTAAACTAAGCCCAAGGTATATTGGTCCATTTGAAGT
ACTTAAGCGAGTAGGGGAGGTGACTTATAAGTTAGCCTTGCCTCCAGGGCTGTCCGGAGTACATCCGGTATTCCATGTGTCGATGTTGAAAAGATACCAT
GGGGATGGAAACTATATTATTCGTTGGGATTCAGTCTTGCTTGATGAAAATTTGACTTATGAGGATGAGCCTGTTGCCATTCTAGATAGAGAAATTCGCA
AGTTGAGATCAAGGGAGATTGCATCCATCAAAGTTCAATGGAAGAATCGACCCGTTGAAGAAGCCACTTGGGAGAAGGAGGCAGATATGCGAGAAAGATA
CCCACATCTGTTTACAGATTCAGGTACTCCTTTTCGCCCTCGTTTTCCTTCTGGTGATCGTTCGGGGACGAACGATGGGTAAATTGGTATCTATTGTAAC
GACCTGTTTAGTCGTTTTGAGCAGCAGATTTTATTTCTGGAAAAACAGGCTGAGGCGACGGACCGTCATGGGCACGACGGACCGTCACAGGGTCTCGTTT
CAAAACACTTAGAAAATCTAAAAATTGGGTGCTGAAATCGACTCTCTGAACTTCGTAACGAAATGGCAGGACGGACCGTCACAGACCCTTGGTGGAAATT
TGGGTCTCTGAACTTTGCGACGACCTGCAGGACGGACCGTCGCAGGCACGACGGCCCATCACAGGTTGCGCAATCCCAGTCCGGGTCGGATTTCTTTATA
CGTTTTAAGGGACGTTTTTGACTATTCCTGCTTAAATTATAAAGTTAGGGGGTTAATGTTAATAAGTCTAATTACTTGGGGGTTAAAAGAGGTAACCTTA
AGTTAATTAGTGGGTTATTATTGCCATCTTTTACACTTGATTATATGTTAATTAGGGTAAAAGAAAGAGGGTTTGAATAAGAAAAATAGAAAGAACAAAG
AGAGACAGAAAAAGAAAGAGAACGAGTAGAGAGAGAGAAACGAAGAGGATAGCAAGGATTTTGAGAAGATAGCTTGTTGATCGCAATTCTTCGGTGAAGG
TAGGTTATGGTTTTCATACTATTCGTAGTAAACTCTTAATAGCGAATGATATGTATTGATAGTATTGTAAACCCTGCTATGTGCTTAATTGTATGCTTGC
ATGAACGTGATTATATAATTGTGATTATATTAAGCATGATGAAGCTATCGAATCCCAAATCTTGATAAAAACCTAATCTCTTTTTAATGATGATGCCTTT
GTAAGGGATAAGGCTTGATGAACTAAAGTAATGAGATTGATGATGCCTTGGTAAGGGAGAAGGCTTGATGAATTGATAGAATGAGATTAGGGGATCGGGT
GTTACGAACCGACACGTAGAATTAGGGGACCGGGTGTCACGAACCGACACGTAGAATTAGGGGATCGGGTGTCACGAACCGACACGTAGATTTAGGAGAT
CGGGTGTCACGAACCGACACGTAGAATTTAGGGGATCGGAGTATCACGTTTCGACACATAGTAGTAGGGGATCGGAGTGTCACGTACCGACACAAGAGGA
TTAATGAATATAAGGGAGCGGAGTGTCACGTACCGACACAAGAGAAATAAAGATAATGAATCTTAAAAGATGTTAATATACTCAATCTAATGAACATAAT
TCCCAAATGAGTATGGTATTGAGGCTTGAGTCCTCATGTGTGAACTTGACGGAAATTGTTAATGTTATAGTACTTGTTGTTGCTACATGTTGAGTATCAT
AGTTGAGTTTATGATATTACTTGGTATATACTGTTTTCTATTTTGAGTTGGCCGATGATATCTACTCAGTACCCGTGCTTTATACTGACCCCTACTTTTA
TGTTTTCTTCTTTGTTATTTTTGGAGTGTAGCAAACGTGCCGTCGTCTTCGACTCAACAGTAATTCAAGCCAGTCTTACTACATCGGAAATTCAGGGTGA
GCTAATGCTTCTAGCTTGGACTGGAGCTTCTTCTTCAAGTCTTGATGCCTTGAACTTCCGGCATGGACTAGCTTCTTATGTATTTTTAGCTTCTTAGACA
TTTTTAGTTAGTAATTTGATCATAGATGTTCTTGTGATGATGACTTCCAGATTTTGGGGAATAATAGTTATTGATTTGGTTTTTTTTATAAACGAGTTTA
AGTCTTCCGCATTATTTTCTGCTGATATTATATTGAAATGTTAAGGTTTAGATTGGTTGGTTCGCTCACATAGAAGGGTAAATATGGGTGCCAGTCCCGG
CCAGGATTTGGGTCGTGACATAAATTGATGCTCATATGCTAAGAAAATGTGTGAATAATTGATTATCCTAATTTTTAGAGATGAACAAATAAAGTATATG
GATTGTTAGTGACAAGTATAATATGCTTTCTTGCCACTTAAATGTACAACAAACAGGACAAGCTTCTATTTACGTTTACACACTAATAGTTGTGCTCAGT
AGTACTTTATTTGTTCTTATTACCTAGCTAATGTGGTTGAAGTTAATAATTATCTTTACTCTACGAAAGAAAAATCTACTGACTATTTCGTTGTGTTCAA
AATATATTGGTGATTGAAAACAACAAAATAAAGTCGAGGAAATTATCTTTTTCATACTTTTGTCAATTGGATTTTTCGAATTTAAATGGCTTATCTCCAA
AGTGATGTGTTATTTTATGTGCAATTTAAAATTTTAGACGCCTCACTCCTTCAATTCATTTTCAGATAATAAATATTTTAACCTGAAAAAAAAACACTAC
TTTTGTTGAGAGAGGAGTTCAGTTTGGCATTTCCTAGAAGCTCATGTATAACATTTCACAGAATATATATAACATACGATAAAGTGTGTTATGTGATATT
TATTTTAAGGGAAAAGGCTTAAATATGTCATCGAACTAAGAAAAAACTCATTTATGCCATCAGTTAAAAGTTTGGCTCATTTATGCTATTACTGTTAAAG
AAAATGCTCATTCATGCCATTATTTTTTAACAATGATTTTACAAAACCATTTTTGACACGTGACAAATTATAATTCGGATACGTCATCAATTTTTTTAAT
TCAATTTTTATTCAAAATTTTGATCTTTTTTTATTAAAAAAAATGATGACGTAGCTGATTATGATTTTTTAATTAAAAAAATTAATGAAGTTTCCGAATT
ATAATTGGCCACATGTCAAAAATGGTTTGCAAAATAATTGTTAAGAAAAATGACATGAATGAGCCTTTTCGTTAACGGTAATGACATAAATAAGTCAAAA
CTGTAACTGATGACATAAATGAACCTTTTTTGAAAGTTCAATGACATTTAAGCCTTTTCTCTTATTTTAATCATGTTGCATATTTGAACGTCTTTCTGTA
CAATTGCTTTGCTTTTATTTCCGTAATATGCATGTGCGTTGCACGGGCACCCTTTATCTTGTATGTGTTACAATTCGATTTGGAAAACTAAAATTTTGAA
ATCAATTTCACAACTTTGAAAATTTTTGAATTTTTTTTATAATTTTGGAGTTCCCACTTAATTTTTAGGAAAAATTAAGATAACCATTTAAGGAAAAAAA
ATTTAAAACAAAACGTTTTGAATAAAATCAGAGTCGGGTACAGTTTCAAATAATTCTCTCAGGGTTTAAGCATCTTAAAGGATCCGCTAACACACGGTTG
ACAATGGATTTAAATGTTTGACCAATTTATAAGGAAAATTTGAATTACTTGAGAAAATTTATAAGTTGAAAATGAGAAATCTTTTGATACTTACACATTC
GTATTATCTCAAATAATGAAATAATTCAAATATCAAAGTGTCTAAATAAAATTTAAACTTAACAATTTACCTGAGTCAAATGATCAAAATAATTACTTGG
GCCTGAATTTAAAAGTTAATTACTAACTATGAAAATATATGAATAATCTCAAGTTAGTCTCGAAGCCCGAGTCGTTTAAGTCGAAGCAAAGTTGACAATT
TAAATACTTAAGCAAATGAAAAACACAATAATAAATGAAAGTCTCCCAAGGATTCATCTAAGTTAGAGAGTTAAATTAAATTTAAACAGAAAACAACTAA
AATTTGAGTTAAAACATATTAAAATATACAACTAAATGAGCAAAGAGAAGAAGGAAATTGGGCCCAAGCCTGGTTGCTGTTCGTCTGGGCCAGTGCTTGG
GCCTTTCAACTACTGAGTTCTCGGGGCTTTTGATCCATTTGCTTAAATTTTAGGAAAATTTTCATACATAGCCACTTCAAAATAATTAATTACTCTTGTA
GCTACATGTTATTTGAAGGAGAGAGGCAAACAAGACTATAGAGAGGAGAGATGAGAGAGAGAGAGGGGGGGAAAAGAGTGGAAGAAAGGTGAATTATATA
TATATATATAGGTTAGATAATTGTATAGTACACATATGTAATTGTATATACGGCAAGAGAGATCGGGAGAGGGAGGAGATTGGAGAGCGAGACCGGAGAG
AGAGGAGAGAGGCGAGCGAGAAAGGACAAAGAATGGGAGAGAGGTGAATTGTATAAGTATATAATTGTATATAACTGTATATTATACATATACATTGTAT
AAATGGCAAGCGAGATTGGGAGAGGGAGGAGGGCTTCAATTGATAAGTGAGAAAATTCATATCTATGTAATAAGATAATATGTAAGCTTATATATACTAC
TTTAAGTTATAGAATTTAAAATAGAATATCGAAAAATGAATTCTTAAAACTGTGTATAATAATTATTTTTTGCACAATGAACATACATACTACATGTATA
TATGTTAATTAAATATAACCGCAGACAATAATTTTGCAGAAACATAAACAACAGAGTTTAAAACGTGTACTCAAAACCAACAATTAAATTCATAAGCATA
TATTAATGACTATAAGAAAAACATACCACTATATGTAAAAATAGAATGAAATAGAAAGGAAAAAATCGAGTTCACGGAATGCACATGTCACCTTAAGAAA
ACTATTCCCCTCTAATACCAGAGATTTAAAGAATTGCATCCTCTCAGGATGGAACTATTTTATTCAACAATTTATTGATACAAAAATAGTGATGTCAGTA
AGTCACTCAAAAGGAGAACAATATACAAATATTTAAGAGGACCTTAAACTTGGCTTCAAATTTAAATTTGACCACCAACTTTCATAATGCACAAACAGAC
ACTTTAACTATTCAACTTTTAAATAAATAAACACATGAGTCCTACATGAAACAATACACGTAGGACACCATGTAGGATAAAAAAATGACATATAAGATGA
CATGTAGGACATGTGTGTCTATTTGTTCAACTTTATATAAGTTTAAGTGTCTATTTGAGCACATCCAAAGTTGAAAAGGATAAATGTGATTTGAAGCCAA
GTTAAAGGGCACATTTATGTATTATCCCTTTTAAAATCAAAGGAAATCTCTCTATTTATAAAAAACAAAATGTAGTGTGAACATATGTTTATTGTGTCTT
ATTAGAAAGGTTACAACTATTTGGAAAAGGTGCAATCCTTCAGAAATTTCACAATCTTTCTTAAAAAGTCGAAACTTTTCATAAAGTCCCAATTTTTTAT
TGAAGTCGCAACTTTTCATAAAAGTCACAACTTTTCATAAAAGCCGAAAATCTTCATTAAAGTCACAATTTTTCATAAAAGTGACAACTTTTAGTAAAAG
TCGCAACTCTTCACTAAAGTCACAACTTTTCTGTAACGATCCAATTTTTTTATATAAATAAGAATAAATAGGTATTTAAGGGCATAATGGTCCTTTCACG
TTCTAAATGAATAAATAAATAAATAAAAACAGATTTGTATTTATTTATTTTAAATTTTATTTGACTAATTCTTGAATTAGTCTCCTAATCCTAATAGTTC
TCTCTCTCACGCTTTATCAACAGTTCTTCATGCTTGAAGAACTCACATAAAATTTTAAGAAAGCAATCAAAAAAATATTAAGGCGAAGAGGAGTTGTTCG
TTGAGTGGTGTGGACGTTGAAGTAACTTGGACTGACTTTTGGAGACAATTTTGGGTAGCGAATTCTTCGTTTGAATATCAATAAAGGTATGGGTTTCTCT
CATGGAATTCTTTCTCCAAGAGTAATTTCTTTCGAACGTTTCTTAAACTCTTGAAACTAAGGTTGTTCCCCTTCGTATGTCCTTGTCCTTAGCTCTCTAA
CGAATTTTTTTGGATGGGTATGTTGTGCTGCTAGATTTTTGCATGAATGATGTGTTTAAATTAAATATGAATGTGTTTATGTGCGGGAAATCACGATAAT
GATCATCCAAATATGACCGAAAAAATTAATGTATAGGTGTGTATAGGGCAGTGTTTTAGTCACTGTTTTAGGGTGTATAAGTTGTGTATTTGTTGTGCAT
TTTATGTGTATAATGGGTGTACAATGTGATGTTCATTATGATGAAGTATATATAGTAATTGATTAACAATCTTTTAGCCAAACAAACCCATGAAAGATGC
ACTTAAAATGTGTTAAAATACTCTACGAATTTTCTTAGGAATTCAAGTGAAAATATTGATAAAAACGAATTGAAAAATGACCAAAAATTCCAGCAACAAT
GCAACTTTAATTTAGACTAAAGTTTAATGAAGGAAATCTGGAAATTTATTAAATTTTAAAGGAATGAGGCCACCAGGATTCGAACCTGGGACCTCACCCG
TGAGGCAGCAGTAATTCGCGTAAAAAAAATAGCTGGGGGCAGGGATCGAACACGCGACCTGGGGAAGGAGAAGGAGAACACTTAATAAACAATTAAATGG
GAGGCGTGGGGATCGAACCCATGACCTCCCAGTTCGCGAATGGAAAAGAAAAAAAAGGGAAGCGAGGTGAGGAAATCGAACCCACGACCTCAGCGCTGAA
GGAAATGCGAAAATAATAAAGTGAGGCTGTGGGGATTCGATCCCACAACCTCACCGCCACTCCCCTATTTAATAAAAAAAAATAGAGGGGATGTGGGGGT
TCGAACCCACCACCTCATAAGCCTCCTCTTCAGCGAAAAAGAGAGGAAAATAAGGGGGTTGTGGGGGTTCGAACCCACAACCTCCCTAATGAGGCGATTT
TTAAATATATAAAAAAAGATTTGAATTAAAATTCTAATTAAAATAGAAAATTAATTCTTTCATGTAAATATTGAGATTTAAATTAGAATTCTAATTAAAA
ATAGAAATTTTTTCTTTCATGTAAATGATTGAAATTTAATTTAGAATTCTAATTAAAATAGAAAATTTATTATGTCATGAAAATGTCGAAATTTAATTCA
GAGTTCTAAAGTTATGAATATTAGAAATAAAATCGATGAAAAATATAACTGATATCCAAATAATTCAAGATTTGGGTTCCCCTGCCCAAACCTCCGTATT
GATACATAAGTCATACCTGAGTAAAATATTCAAGAATCATGCCATCTACTTAGATCAAAAATCAAGATCTTGGTATATATACAAGATACATAAGTCTTGT
AATATAGAATCTTAGGAAAATAAGAATCACTTATCGAATTATAAATGAAGCTCCATGGCTTGTATGTGTAGACACATAAGTTGAACATACGTTCAAAAAT
AAGTGAACCTAAGATATACGTAATGAAATGAAGAATGTGGTGACAACCATGATGTGAGGCTAATGTATATGATGAGAGCAATCTCAAATGAGCCTAAGTA
AATGTTACCAATACGTACTCACCAATGAGAGTGTAAGATAATCAATAGATCAGTCTCGATGAACACTCTAATGAAAACATTGAGTTTAAAACACTTAATA
CTAATGATGAGATGAGAAATCATCTATTGAGCTATTATGTCCTCATACTAGAAGCCAAATTCCATGATGTATGAGTTGAATGTAATAGAACTTTATACCG
AGCACAGATAGGCTAGCTATGAGCGGTGATGCCATCTTTCGGGAAGGGCGGAGTTTCACGTAACTCTCATTAGATGAGACTGTCCGGTTTGCCGGGTATG
GGTCTCCATACATCTCCTAGTCTTTGAACATATATTGCCATTATAGGGATCTGGCGGGGTTAAATTCCCATATACGCTAGCATGTTATTGAATCGCTTTG
GCCGGTGATTCCACCTCTTTTCGGTGTGGGGGAGACACTGGATTTCATGATACTCACATGATCTATGTCGGTTAAAGTTAAAGTTCCCAATGAATGAATG
AGGTCAGCCTCAAATGAATCATATAAAGAAATGAATGATACCAAATGTGTTGGGATAGGATAATCAAGAGGTGAGCTAGATTAAGGTAATGACATTAGGT
TATTCCTGATCATTGCACAACAAACCCGATGAAAGCCTTAAACTACATCCTAGGTATAGCTGGTGTTCTCACTAGCCTATGAATGAATTGAAATGAAATA
CGTATGAAGAAATGAAGCAGACTCTGTGTTTGCTAAAGAAGGCTCCCTAGTTGAGGTCCCATATGTTGAGCCCTCATTTTGGAAAGTCTTAAGGTTAAGT
CTATGATAATAAGGTCTCATGGTATATGAATCAATAATATGAAAGAAACTATGTGTTATATGTTATGTGCTATACGATAATTATAATGATGTATGTCACT
CTCATAACTTTCTCAATCTCAATTTAGCAAGTCCACTGACTTGACTTCCAAACATCATGTTGTTAGGAAAGAGCTCTTCTTCCTCATGCATGTCCCTGGT
GTGTGCTTGCATATACCCATACTTAGTACAAGTGTGTACTAATTCCATACAAACATCTACATTTAGGTGTAGGCACAGGTGTACGGTAGAGCTACAGGTT
CGTTGTTGCAGCTATCCGGACGTCAGCATTCATCCGGAGTTTGGTAGGTCCTCATGCCTTCGAGGATGCTACTGTTTTACATTCTAGCGTAGTTTAGAGT
TGAGCTAGTGGAGCATGTTCCACTAGCGTTTCTTTCCTGTTTTGGTTCAGACTTTGTATTGGGGTTATTTTGACCGATATACAATTAATACTTAATGAAT
TATTTCTTTCAGTTGCTTATCTCTTAATTGTTAGATGGTTGATGATGAACGATTACGAAATATAAAGAATGTTTAACAAGTATGATTAATGAATCAAAAA
TTTTAAATTTTCCGCTAAAATAAACCTATGTAAAGTAAGAATGACGTAAGTAGGCTTGTTTGCGGCCTCTGAGAGGTCAACGACGCCGGTCTTGTCTGGG
GTCTAGATTCCAGTCGTGACATTTTCATAAAAGTCACATCTTTTTCATAAAAGAGGAAGGCTAGTTTTGAAAATAAATTAATTTCATAAAAGTCACAACT
ATTGATAAAAGTCACAATTCTTCATTAAAATCATAATTATTGATAAAAATCGCAACTCTTCATTAAAATCACAACTTTTCATTAAAGTAACATCTTTTCA
TCAAAGAGGAAGACTAGTTTTGGATAAATTAATTTTAAAGGAATTCTTGTTTGTGATGGCGCCACGTAGACGAGCCGAGGGTTCTCTTTTATATAAATAT
ATGATCTTATCCCTAATTTAAAATTTGTAAATAGTAAATTACATTTTGTCCTACATTTTTTTATTACAATAATTCCTTAAAATTTGTACCTTTCTGATAC
ATAAACCACCATCCTGATACATTAGTTCACCATCCAGATACATTAATTATAATGCAAGAAAAAACCTTTTTGTTGAGCTAAAAAGGAATAAAATCTGAAA
ATTAATTAAATTTCATAAGTTACGCTTATGTTTCTTCTTACTCTCAATCATATAGAGGCAAATCCTAATAGAATGAAGAAATTCAAAATGTTAACCCCCC
CTCGATCGACGAGGAAGCCTTTCAAATTTGATTCAAAAAAATTTTGTCAAAATTTTGGATAAGCGAGGTGAATTATGAAGGATACAAAAGTGATGGAATT
GTTGTTGGAACAATTTCCTTTTGAATCTTCAAGTTCATCGAAGATCCTTTCAATTTTTATTCAAGATTATCAAAAAAAATGAAATTCAATATTTTTTCTT
CCTTCAGTTCTACGAAGATCCTTTCAAGTTTGATTCAAAATTGTTGGAAAATTTGAGAAGATACATCATGAATATCTTTGCTATTTATCATTTTGTTATT
TATGTTTCTTGTTTAAATTGATAAGTATTGTATTTATACTAGATACATTAAATAAATAATGTTTTCCATAAAATTTTGGATTTGAGATTGACACATTATT
GTGCGGTAGTTACTATGTAATTGATACGTTTAGTATAAATTTGAATTTACATATCATATATAAAAAAGATAGTGCATGATATATTATTATTTATGTATCT
CGTTAAGAAAGTGAGTTTTGGTCATTTTCAAACGGTCCTAGGTTCTAACTCAGGATGATTTAGAGGTAGTTCTTGATATGGTTGGAAATCCCTTTAAGAG
ATCTTTCCAACGCCGTCGGGTTTGTGCATTTTCAATATCGTATGAGGGAGATATGTCTATCGAAAGTTGGGTTGTTGAAGTACGGAAAGTCCCAAATTCG
AAATTAAAGGACAAATTAATCTTTTCACAAATTAATTTCCTATTTCATTTTATGGGATTATTGGAGTAAAAACTAAGTTTAGTTCAGTTTTGGAAAAAAT
TAAATCACGATTAGGGCTTGGAGAAGAGAGAAAAGAAGAAGGAAAGAGAAAAAAGTCAAGAATTTGCCAAGAACGTCAAGATTTGCGAGTAATATTTGTC
GGGGGTGATCCCTATCAAGGTATGTGAGATTTTTCGTGTTGGGTTAGTTCACCCACACACCAACTTGTTTAAATTCAGCAATTTTGAGTTGGTTGAATGA
TAAAAAGTGAAGTTTTTGGAGAACATTGTTGAATTCTTGTTGGTTGAGTTGTTGCATGCCTAGTGTTGATTTGATTTGTGTTTTCTGGTTTTTCGAGTCA
AATATATGGATATTGAGGGTACTAATTAATGATCCTAAGTGTTTGGGACAAGAACCATGAAAGTTTAGAGGGTTTAGAAATGAAAAACGGAGAAGAAAAG
TCGAAACGCCTGTCCATAGGACCTTGAAGCGCCGCGCCTCCCATAGCCCCACAGGACAATCTCTGTCGGGCCTTGGGGCCCGCTCCATCCAGAGCGCCCC
AACTTGGCTTCTGAAGTTTGTAAAACGCCAAGGACGTCAGTTTTCCCCATTCATTTTCCATCTTTTCGTCCTAGTTCCTAAGTAATGTACCCACGTTTTT
AGTTGATTCCAACACTCTAAGGTACATCTAAACATCATGAAATCATCTATACACATGAGATCATGAACCTTGAATCCATAATCTAATTCGAGGAAAGTTA
TGATCAAAGCTAAGGAGTTAAATGTTAAGTCTAGAAGTTAAGAAGCAAGTTAAAGTAAAGTTTATTAAAGTTTTCAAGAGTCTCTAATAAACATTTTAAC
TTTATTTTAAGACTCAAGTTTCAAGATATGCAAAGAGTAAAAAAATTTAATTTCTTCCTTCAAATAAATGGGAACTAAGTATTCCTAAGAGTTGATTTAA
GGCTCAAGTATCAAGTTAAAAAAAGAGTAAAGAGTTGAATTCATTTCTCAAAACAGTTATAATGGAACTAAGTATCCCCTAAGAGTTTATAAATATTTTC
ACATTTAAGATAAGAGGAAACTAAGATTTCCAAAAGAGTTTTGAAGAAGAAAAGGGAACATCGATCCCAAAGGAGCCTTTGGGCTAAGCATTGAGTAATT
ATCTCAAACTAAAGAAAAAAAGTTGCTTTAAACACATGAGCTAAAGTATTTTGCGAGTAGTATTGAATACCGATGGGGGATGAGAGTTCATATTAACTCA
AGCCTCCATGAAAATCATGTATCATCATGGGTATTAACGGGTCATACTTTTTAGATGATCACGTAAGTTAAGCTAGTGGATCCACTAAGTTAAGTAGTTC
TATGCAACGGAAAAGTATAGGACAGTTCTAACAATGTTGGCAAGACGTTGTATCACCACTTAGGCTCATAGTGGTGGTTGTCGGTTAGAGAATTTCCCAT
AAAAACTATACTACTTCAAGGTTGAGTTTGTTATTGCATTTTCTTTAACGAACTAAGTATTTACATTGTTTTACAAGCTTTTATATATTGTATATGTCTT
GTTTCTTTACATTAAGTCAAGTTATTCATGAGTTGATTAGAGCCAATGTAAGTGTTTCTTCTTACTCTCTATCAAACTTAAGTTGTTATTATCATTCCAA
CTCGCATACTCGTACATTCAATGTATTTATGCCAATTGGCTTGCATCATATTATGATGCAGACGCAGATAACCAGGATTAATATCATTCAGCGCCTCGTT
GATCCAACTAAGCACTCGGAGTCAGTGGTGAGCCTCCTCGCATCCTGGAGGACAAATATTTCTTGCTTTCAGTCTTTCTTTTAATAGGATTTTATGGGGT
CTGTCCCAACATCCATTTTAGTATTATAGAGGCTTCATAGACAGTCAAACAGTTTAGTTTCAAGTCTCTTCTTTGTATTATAGATGTTTTCCTATGAGAC
TTATGTGTCATTTTGGCCAAGCTATTTAATTCAAGTTATTTTATTAGAATGTTTTCTTGTATTGAGTTAAGTCTTCCGTTGAGTTAAGTAAGTCAGGCCA
AGAGTACTCTCAAGGTCAACAATGGTCATTGAGTGTCGGCCACGTCCAGGGGTAGGCTCGGGGCATGACAAATATATCCAACAAATTAAGCACTTAGATG
CATGAGTATCAAGTACATCATATGTATCATATAAATATCTAGTATTTATTATATGTATCTAGTATTAATTTAATGAATATATTTATATGACCTAATATTA
ATTTCATGTATTTATTTATATAATCTAATTTTAAATTTATGTATCTTTATGTATCTAATATTAATTTGATGTATCAATTATCAATTTCATACATTATATT
CAAAAAAATGTATCTCAAATACACCGTAAGCATATACATATAATTATGTGTATCTAAATATAAAATGTAATTGGAACACACAAATTTAGGAATAAATCAC
AAGTATGTATTATTTGTCTTATCATTATTAAAAAAAAGTAAAAAAACAAAATTCTTCCCATTTTTTTAGCATTTGAATTTTTCTCATAGATATATATATG
GTAAAACCTCTATAAATTGATTTAGGTGGAACCATGATATATTATTATTATTATGGAGATATTATTTAATCAATAAATTGATATTTATTAATTTAAAAAC
TGTTTGTGAAAACGTCATTTATGAACTTGAAGTCATGGTTAGTGATCTCGATTACCACAAAAAGTTGGCGTTAATATCATTTTGAATTATCCGGATGGAA
GTGCTACATGCTCAGAGGATCATTACTTAGAAGAAATTGTGGATACCATAAAAAATAATAATGTTAATGATGAAGTTAAAGATGACATAGTACTATTGCA
ACTAGCTACGCTTGAGAAAACACTTATCACATCTAGAATTCTTTACAATTTTATGGTGCAGTTCGAAAAGACAACACCAGAATTTTTTGATGGAATAAGA
AAAGTTAGAAATGAACTTCAACTAGATTCAAATTTTAACAAAAAAACACTACAGAATCATATTTAACTTGTCTTAGATATATTTGTACTTTTAAAGAATT
ATTAATTTATAATATTGTTGGGACCATATATTTATACAACAGTCTTCTAAAAATATATTATTTTATCATTTTATCAGAATTAGTGAATTTTTCCACTGGC
CCAAGTCGAGATCGGAAGAAAATATTAACTTAGAGAGATTATTAATTTATTGAGTATTAATTTAGTGATGTTTTACTGTAATTTTTACTTAGATACAAGC
AGTTTTAACTAGATATATATACACCTGAGATGTATTCAATATTGTTGCACTTGGTGTATATTTAATGATGTATTTGTTTTGTTAATTAAAAGTTGACGTA
ATTTTTCCATCTTGATTGAGTCGTTCCTACATTCAGATAATTCTTGGTTTGAATGTTGACAGATGAAGAGTTCGTCCCTGTAAGAAGAAATTTATGAGTG
AAAATAAACAAATAAAAGTTATTTAATTTAGTACAACATTGTTAATGCGTAGTACCTTTAACAAGAATCATTCGATTTCGAGAACGCTTAGCCACTAAAG
TGTTGTGAAACAACAAAATTAAAAATATAAAACTTAATTTGTTAAAACTTTTTAAAATTACATTTCAAAACATTATGAACTTCAATTCAAGTACAAAATA
AAGATAAATGAAAATAATAAAACAAGGGAAAAATGACAAATATATCCAGAACTATCATAAATAATTTACAGATATCCTCCGTTTTATTTTTGGGACATTG
GTGCCCCAGCAGTCCAAAAATTAGAGCGTATATTCCCTTCACTCATACGGAAGACTAAATAGGAATACGTGACGCAATCTTATCCATCGAGTCAATCTTA
TCCATGAGTCTGATGTCGACTCGATGGATAAGATTATGACACGTGTATGTCTGTTAGTATGAAGGGTATATATACTTTAGTTTTTGAACGACAGTGATAC
CAATATCCCTAAAGTATAATGAAAAATATCTACATATTAAGAGAATATTTACATACTATTTACAAATACTTTAGGAATATATTTATCTTTTTTTCCTATA
AATTAATAAAAATAAACTTATATATTTAATGGTGATTTGAATATATAAATATGTATTGAGATGAAGGAAGAAAAAGGGTTAAGTGGGGGCAATGACAGAT
GGAAGAAAGATAGATTAGAAAGAAAGGGTGGGGTACATCGGCAGATGGAAGAAAGAGGGAGAAAGAAAGAGTGCTGGTGGACCGTTTGGGGAGGGTTCGT
TTGACTTGTGAATATATCATTAATTAATGAGTTTAAGATAATTATTTAATGTTATATTTAGATTTTGATTAAATTTTATATGGCATAAATATTAAAAATA
ATAATATATATAATTATTTTAAATTAGGAATAAACATAGTATATATAATAGTGATATATGTGTAATTAGATAATGACATAATATATAAATGTGCTTTGAA
TTATATTTATGCCTTTTAATTTTGGGTGTGCATAAATAAATATTTAAACTTAGGCCTAAGTCATCTGCGGCCCCTTAAAGTTGTCCACATAATTCACTTA
GACACCTCAACTAAAGTTTGTACCTATTGAACACCTATGCCCCTTAAAACTAATACCCATTGGACATTTTTTTGTTAATCAGCAAAAAAACTGAAATGTG
TGTAATACACTCGCTATGACATGGCGATGGCATGACATAATGACAAATTGAATGATGACACGTGGTATTTGAGTCCAAAAAGTTATTTAAAAAATAAAAC
TTTAAAAGACAACTATTTTAATCTATTTAACTAATTAAAAAATTAAAAAGAATTCTAAAAAAAAAATCCACCCATCCATGGCAATTCTTTCTTTTCCTCC
ATCGTCATTCCAACTTTAACATCCCTCAATGTATTTTCAACATTAACATTCTTTTCCGTTTAATGAGAAGAATGTCAAGATAATGAGAAGAGTACCAATT
GATAGATCAATTGATGTAGGTTTTAGGGTTTTAATAGGACATCTTCACTTGAACACCAACAAGTCCAACGAACTTCTCTTAAAAATTAAACGCAAAAATC
GACTTCTTAAATTACAGCATGTGAAAGAGTTGTTGAGTTCGAATATAAAGATTTTTCGATGGATGGCCGCCGGTAGCATAAAACTTCCGACTCTTTTTGA
ATAGGCAAAAAATGGTGGGTTGAAGCCTGAAGGAAGATGAGCGTGAGTTTTTTTTTCTTTTTTTAATGATTTACAAGATTTTAAATTAATTTTTTTTATA
TATTTAATCAATGCATGCCAAGTGTCAACAAAGTAGGTATAAATATTTTAAAAAAAATTTAAAAAAATGCATTCATGTGCTCAGCAGTAGTGAGATACAC
TTATTTTGCCACATCAGCGTTTTGTGTTTAATAAGCACATTTCTTGATAATTTAGGTGTTCAATAGGTATAAGTCCTAGTTTAGGTGTCTAAGTGAATTA
TGTGGACAACTTTAAGGGGCCGCAGATGACTTAAGCCTTAAACTTGTATAAAGTTGAACAAATAGATGCACATATTCTACATGTCTATCTTTTGTACTAT
GTGTATTGTATCATGTAGGACTCATGTGTTTATTTATTTAAAAATTAAATAGTTAAAATATTTACTTGTGTATTATAAAAAATAAAAGGTTAAAATTAAA
ATTTAAAATCAAGTATACGTATTATGCCTGAGATAATTATTCTTATTTTGATGATTAATAATAGAAGAAAGGGCGGACAAAATATGTGTGTAAAATGAGA
ATGAAAATTCCAAAATGAGCTAAGTCATTCCTCCTCGGTTTTCCACCAAATAATGAGTGTGGTTGCTTTAAAAAGAAAAATGTAAACTTGTTTTCAGCAG
TAGTAAATAAAATACAAAAAAAAGAAGTAGATTTTGATAAAATAAAAAATTGCAAGTAGGATAGGAGAGTAGATCGCTGTTGGAGTTGACCTGTATGTAT
TGTATCATCTTCTCCTTCTTCTTCCCATCAAATTCATGTCTTATTAGATCTATCAATATCAATATTCTTGAAGAAAACAAGTGCTACTAGTATTGGATGA
GGAAACTGAGCTGAGTGCTGGGGATTTTGATTGTTTGATGGGCAACGCATGCCGTGGATCTTTCGGAGGCAAAACTTTTCAGGGCTACCCTCAGCCTCAA
GATCACTCAGAATCCAATTCCAATCCCAAACATAATTCCGATTCCCCCAACCCAAAAAAAGAACAACAACCCCTCGTCACCATGAATCGTACAAGCACTA
ACCAGTCCTATTACGTCCTCGGTCATAAGACCCCTAACATTCGTGATCTATACACCCTCGGCCGCAAACTAGGACAAGGCCAGTTTGGCACCACTTACTT
ATGCACCGAATTGTCTTCCGGTATCGACTACGCATGTAAATCTATTGCCAAGAGAAAACTCATCTCTAAGGAGGATGTAGAAGATGTCAGGAGGGAAATT
CAGATAATGCACCATTTGGCTGGTCACAAAAACATCGTTTCCATCAAGGGTGCTTATGAGGATCCTTTGTATGTTCATATTGTCATGGAACTTTGTGGTG
GCGGTGAATTGTTTGACCGCATAATTCAAAGAGGACACTACACCGAGAGAAAGGCTGCCGATTTGACTAAAATTATTGTGGGTGTTGTTGAGGCATGCCA
TTCACTTGGAGTTATGCATAGAGATCTCAAACCTGAGAATTTCTTGTTGGTTAACAAGGATGATGATTTCTCTCTCAAGGCCATTGATTTTGGACTCTCT
GTATTCTTTAAGCCAGGTAAATCTCTTACTTTCTTCTGTTTTTTTACATTCTAGCTTCTAGTGCAGCTAGACGGACATATTACGGCTCTGTGTAGTTGTT
CATGCTCATGCTGGTAGGCTACTACTAATGAAGTATGATCTTGGAGATTCTTTTTATGCACCAACTCTCTATCTAGATGAATAGTTAGCTACTTTTAACA
TTGATTTGGTGGCTCCTTAAATTGGTATGTTGGTTTGATGGATTTTGTTGCTTGCTTCTTCAGGCCAAATTTTCACAGATGTTGTTGGGAGTCCATACTA
CGTTGCTCCTGAGGTGCTTTTGAAGCATTATGGTCCAGAAGCAGATGTTTGGACAGCAGGGGTCATACTCTATATCCTGCTAAGTGGAGTTCCACCATTC
TGGGCTGGTATGTTTATAATTTTATGCAGTATAGCTGTAACTTTTCTGATTTTTGTCTTTTTAACTTACCATCTAAATTGTTCAGAAACACAGCAGGGGA
TATTTGATGCAGTTCTGAAAGGGCACATTGATTTTGACTCAGATCCTTGGCCTCTAATATCAGAGAGTGCAAAGGATCTCATCCGGAAGATGTTATGCAT
GCGACCCCCAGAGCGGTTAACTGCTCATGAAGTATTATGTAAGTTTATTTACCTTATAAGTCATATTGACCTAACATTTTTACTGGTTACTGAATGGATC
ATTTTTTTCTCCCATGATATAAATATGGTTTTGCTTGTTTAATAGTTGTTATATCAAGAGATACTGTGTTGTGACAGTGTTGATGTTCTGTCAGACTTAT
AAGAACCCTCTTAACTTTTTTCTGGACTGTGCTTCTGGTGGCAGAACATTGAGAACCTTATTGACTACTAATTTATGTAAAAAACTGTTAGTTTAGCAGT
AGAGAGGAGTTTCTCATGCTTGAACTATAACTTGTTAGGTTATCTATGAGCCCTTTGGAAATATCAGGTTTATTTTCTGTATTTCTGGTTTAAAAAATAA
ATTTGGATTGACTACAAGCTGTAATAGATCAATTTGCACTGCATAAAGTGGATCAAGTCATTGTATTTCTCAAATTTCAATTGTATTGTCTATCTATGCC
TGCTTGTATGGTGTCTTTCATGTAACCAGCTGCTGTTCTGGTGTTATGGTTTCCTCTAAAATTCTGCAGGTCATCCTTGGATTTGTGAAAATGGTGTTGC
TCCTGATAGAGCACTTGATCCTGCTGTACTTTCTCGCCTCAAACACTTTTCTGCAATGAACAAATTAAAAAAGATGGCTCTGCGGGTATGCATATATATA
TGTGTGTGTATATATATCTAGGCATAACTTTTTTGCCCAAGTCTGTTAATTATGGTTCTTCAGTGTCCATAAACCTCATTATTAAAGTTACACAAGAAAA
TGCTGATTATGTCCTTTGGGCTAAGTTGTGTGGACTCTTCAGTTTCGATGGCGCACCAGTGTCGGATTCTCCAAAAATACACTCCTTATGGAGAAGCCGA
CACACACCCATTGACATTTTTGAAGCGTCCAAGCAACATAGCTTCTTGGAGGTGTGTAACCAAATGATGCAATTATTGATGTTTTCATACTTAATATGCA
TTTAGGTGATTGCTGAAAGTTTGTCAGAGGAGGAGATTGCCGGTCTTAAGGAGATGTTTAAGGCCATGGATACTGATAACAGTGGTGCAATTACATTCGA
TGAACTAAAAGCTGGTTTGAGAAAATATGGCTCTACTCTGAAGGATATAGAGATACGGGAACTTATGGATGCGGTAAGAAAATCTAGACTGCAAACTGAT
TCTGTTTATTTTGTGCATCTGGTGATGTGACTCTACACAAAGGTTCATAGGAGCAGAAAAATGTAAAATGACATAAGATCACTAACTAATGGTCAAATCT
CAAGGTTATTTGATGTGCAAATACTAGAGTCAGATTGGGATTTGGCACTTTACTTTGTTTAATTAATTATGTACATTCATGAAGGAGCACTTAAAACTCA
ATGTAGTTGCTAAAACTTCACTGGAAAGGTGCCCAATTTTTTTTTTTTGTGTATGTGTATGATAAGTTTCTGATAACTGAGGAGGTAGTGCAGGCTTACC
AAGTAGTTGGCACCACATATATGCTTCATCAGAAACAACTTTCTGTTAATGGTTCTAGTTGTATCTTTAATTAGGCCCGTGATAATCTTTGTATTTCTCC
CTAAACATGTCTGTCTATGAGGTACATGCGGAAGTGCTTATCTAACTCTTTAAGGCCATTGATGTAATATTACTGTTTTCAGGCTGATGTGGACAATAGT
GGAACTATTGACTATGGAGAATTCATAGCAGCAACAATTCACCTTAACAAATTGGACCGCGAGGAACATCTCATGGCAGCATTTCAGTATTTTGACAAGG
ATGGAAGTGGTTATATTACAGTAGATGAGCTCCAGCAGGCCTGTGCAGATCATAACATTACAGATGTATTCTTTGAGGATATTATCAGAGAAGTTGATCA
GGATAACGTAAGTTAATTATATTGAGGATAAAGTTGAAGTATTATTGGAACTTATCAATAAAAAAGTGGACACAAATTAGTAGATTAAATTTCTTCATGT
TTTGCAGTTCTACTGATTTATCTCTCTACTACTCATAATTTTTTTGCAACAAAAACTATTTTTTTTTATAAAAAAGCACTTTAATATGAAACACTTTTTG
TGCAACAAAAACGAAAATTAAAAAAATATAGCACTTTAAGATTTCATATGAATCTTTTCCTTGAGATAAAATGTTATTGACAATGTAGTGTATGTATGGA
AAATACGGATATTACTAAATGATCATATGTGAGCTTAATAATATAGTTAATTTACCTCTCTCTCTCTATATATATAAAGAGAACCCTAGGCTGCCTAAGT
GGCGCCACCACAAATCAGGATTCCCTTTTAATTTATTTATTTCCAAAATTAGCCTTCCCTTTCATCAAAAGTTGTGACTTATGAAACTTTGCGACTTTTA
CAAAGAGTTGTAACTTTTATGAAAGTTGTAACTTTTATGAAAGTTGTAACTTTTATGTAGAGTTGTGACTTTTCCAAAGGATTATTACATTTCCGATAAG
ACACCATAACCATTTATTCACACTATCCTTTTGTTGTCTATAAATAGAGGAATTTTCTTTCATTTTAAAACGACGAAAATTCTAAATTTTTTCTTCTGCT
TATGCACAATTAAATATTTGTGTACTTTGCTCCTGTTGAGTGGTTCACTGACATCATTGTTTTTGAATCTATACAACGGTGAATATAATCGTTCTATCCT
AAAAGTATCTATTCATTCTTTTGTTACAAATCTTGGTATGTTTTTTACGCTCATTTATGCTTATGTTATTAGTTGTTTTTGAGTACATGTTTTAAACTTT
GTTGTTTATGTTTATGTTTATGTTGAAATAAAGATATGTTAATCAAGAATTTGATGTAGTGATGTCATGTAGATTAAAATTCTTGAACTTATAAAATAAA
TGACTTTGATCTTTATAGAGTTTTAGTGGCTAAAAGATTCATGGGATGTTCAAGAAGAAACTTTTGAGTGTTCAAAAGTTATGGTGGTTCTACTCTACCA
TGGAGTTTAGTTATTCAACTTTCTATCTTATCTAGACATTCAATCGATTAGTGACATTCAAAAAATAAAGGAAAATGTAGCGGGATGGTAAGTATTATAC
TCAACCTTAATTAAAAGTTTGGGATTCAAATATTTGATTGGAGTCAATGAATTACCCCCTTAGGATGAATCTACATTAATCAATTATTAAAGAAATAATT
ATCTCCTTATAAACATTAGATTAAAAGTTGCAAAAAGATTAAAGCTTTAACCATATTGATCGGAACATAAACAACAAAATATGCATTTTGGGTATCAAAG
TAGTGTCATACATAATGATTTGAATAAGGGTCTTGCCAAGACATCATTTAATCCGAATTATTTGAGTGACTTGCCTTATTTCATTGAAATTCCAAGAGAT
GTTTTTTAAAATTTTAATTAACTTATCAAGCACACAACTAATTATATAAAATGTATAATATTTAGATTTTGTATGTAGAGGGAGGCCTTGAATAAGAGAA
GAACTCTCGCAATTGATGAATAAAATGTTTGTACCACTTTTGGAAAATACAAATATAGACAATGAAACAATTACCTATCTTTTCTAAAGATTTGGTGATG
AATAACTACAGTAAAATGAAGAATCAATAACTAAATCCATAAACACGTAGAATCAAATCGTTTTAAGTTTAAAAAAATATTTTATTTTGTCTTTGGATAA
AATATTCTTGACAATTTATTGTTGGGTTGTACCCATTCGAAAACACTTATATTATCAAATGTTCAGAAGTAGATTATTACCGTAGTTTACCACCGCGCGA
AAAGCATGCAATTTACCTTGTTAAATTACAAGTGCTCAGATGCAATGATATGCTTTGAAAATTATTTTTGAAGAACTTCTCGTAGTTCTGTTTGGTCTGA
CTGCATTCGTGCCAGCTACTCACTTTTTGGCGTCACTTCATAATCTAAGTAGTTTTGTGTATTCAAAGGCATAATGAGAAGACAAAGCTGACATAATTGT
CCAAAGAAAAGAAAAAAGACAAAGAAATTGTAGCATAATAAACAGGAATGGGTACCGTTACAGACATTTCTGTCTTTCTTCAAATCAAACAAAATTTGTT
GTATTTTGATTAGTTTTCTGGAGCCTCAGTATTGGATTAGGGCCTCAGCTGCAGCCGTGATACAGGCAAATTGTTATGCTTTAGGAGATCTGTATTTTAA
ATGGATGGAATGATTCTTTTGGAATCTCTACATCTCTTGATGCTTCATTTGACTAGCTATTTAGTTGATCTTCTGGTGGATTCCCTTTTCAGGATGGACG
TATTGATTATGGAGAATTTGTTGCTATGATGCAAAAAGGAAATCCATGCATAGGAAGACGAACAATGCGAAATAGTCTGAATTTCAGCATGAGAGATGCG
CCCGGAGCTCATTAGCTTTTTGAATGGACACATGATGTAGGTATTTCCCCTTTTTTATTTTTGTAACCGTTTCTTTGGCAATGAATTTGAAGAAATCTTT
CCTTGTTCTGTCCTTGAGAAATTGGATTGGTTGGAGTATATTTGTTTAACATTAAGAGTTTCTTTTTCCCTCTTGAGGATAATAAAATTTTATAAATAAC
AGCATGAGTGTTTGCTGTAAAACTCTACAGGTGCAGCAAAAAAAATTACATTCAGCAAAAGTATATCCCATCTTATCCTGTTGGTACACTAGCATGTCAC
AGATAGATTCAGCTTCCTCCCCAATCCTCCATTTTACACCATTAACAAAAATAAATTTCAGATACAGAGTTCTCTTTCATTCCCATCTTTTATATAATGC
TGGTTTCTTTTCTTTTGGTAAAATTTTGATGTATCAAATTTGACGATTGTCCGACATGGCTATGTGAGGAACTTTCCTAAGGGAGCACTAAGGGTGTCAA
ATGTGTGGGTGGAGGCAGTGGGGGACTGAAATTGAAGAGGTTAAAATGGGCTGAGCTAAAAGTCATGTTGGATCATAACCCACTCAAACTTACTTTGGGC
TAACATGGGCTAGAATCTTGATTGGGTTATGACCTATCCAATTTGACCTGCTTAATCTAAACTAAACTATATTAAACACTTGCTATAATTTATGACAGAT
GTCATTCAACCCATAGAATCGTACAGATCTGTACTAACTTTTCATTTAGGAGCATCTCCTTGTAGAGTAAATTGATGTAGACTTTATAGTATGGGACCAA
CTTCATAATTTTGCAACTCATTTAATAGTGTATTTATGAGAATTATTGAAAAGAATATTATTGAATTGTGTGTCTACATTATTACATTGAGACTTTATTT
ATAGACACTATATTATACTCCTTTTCCAACTAGGACACTACAATACCATCCTTTTCTAAGTAGGATTCTATATACTATTTCTATTCCTATTCCTATTCTA
AGTAGAATGGTATATATTATTCTTGTTCCTTTTTTGATTCTAACACTCCCCCTCAAGCTGGTGCATACAAGTTATATATACTTTGCTTGTTACAAATGTA
ATTAATATGAGGACCAATGAGAGGCTTGATGAAGATATCTGCAAGTTGATCACTTGACTCACAAATTTTGTAACAATATCTCCCGACTTCCCAGACCAAG
CTTGAGAAGAACGTTTCATATCATCGAGTGACTTGCACAATCAACATATAAGGCTGCTAGACTCCCTCGGAGCAATAAGACCAAGTGGTTGCTCCATATA
TACTTCTCCATCGAGATCCCAGCCCAAATATGTAAGTATATCCTTTTGGATAAAGTGAATCTAAAACAAAGAGAATATTGCTTGAAAACTTGGATTTTTT
TGGGAACTCGGATATGTTGGACTTTGCACAACATTGACAAAGTTGAAACTATTTAAATCAGACCTAAGGAGTCACCGAAAAGACGTACGGTGCTTCGAAA
ATTAGATATGAGAAAGTAGTCACCAAAAAGACGCATGATGTTGTGCAAATTAGATATGAGAAAGTAGTCACCAAGAAGATGAGACAGTGCTACATAAATT
AAATATGAAAAAGTAGTCACTGATAAGATGGCACGGTGCTACACAAATTAAATATGAAAAAGTAGTCATCAAAAAGATGGTGCGATGCTACACAAAAGTA
AATAGTCACCGGAATGATGACATGATGCTACAAAAATGAAATATGAGAGTAGTCACCTGAAGGATGACACAGTGCCACATAAATTGAACATAAAAAAATA
GTCACCAGAAACATGATGCGGTGCTACACAAATTAAGAGCCTGTTTGGCTCAGCTTAAAAGCTGGTCAAACTGACTTAAAATCTGATTTTTGACTTATTT
AACTGTTTGACAATACTCAAAATAGCTTATTTTAAGTTAAAAAAAACTTATTTTAAGCCAAAAGTTAAAAGGTGGGGTAGGGGTGCTTTTTTTTTTTAGC
TTATAAGCTGTTTTAAGTTGACCATATTTTTATGTTTTTTCCCTTAATATTTTTATACAATCTCCAAATTATCCATATAACCCTAACATCTCTTTCTTCT
ATTTTTCCCTTTTCACGTTTGGCATAACAACTTCAGCACTTTTATCCAAACGCATAACTGCTTATTTTAAAAATAAGTTTCAGCACTTTCAAAAGTACTT
TTTTAAAGCTGCTTTTATTAAGCCCATCCAAACGGGCTCTAAATATATAAATAATAGTCACCGGAAGATGACACACTGCTACAAATCAAATTTAAGAAAG
TAGTCACCGAAATGATAGCACAGTGCCACACAAATTAGATATGAGAAAGTAGTCGCCATGACAACCCTAGAAAGTCGTGCATATATCAGTGACCCTAATT
TGGTTAACATTACCAATGGCAAGAGGGGAGATAGATATGAGTCATAGCCGCCCTACACCGACGAAATCTTTTTTTGATTTTCTACCGAGATCGTAGGAGC
TTTGATACCATGTGGAAATATTGAAAAAGAACATTGTTGAATTGGTCTCTAGATTATAACATCGAGACCTATTAATAGGGCACTACCTTAGACTCAAATT
CCAACTAGGACACTACCATACAATCCTATTCTAAGTAGTATTTTATGTACTATTTTTATTCCTATTACTAGTATTTTATGTACTATTTTTATTCCTGTTA
CTATTCTAAGTATGATGGTATATATTATTCTTGTTCATATTCCTATTCAAACAGTAATAATTTGACATATAGAATGTAGGCAATTATTTTTTAATATGAC
ATGGCATGCAAAATAATGTGTTGTTAAAGAATCAAATAACAATAATCAAGTGACTTTAGAATTCCAAAAGAGAGACCATGATAGATCATTATCATATTAG
GTAATAAAAAATAAGGATTCGGTAACAAAATGCAAGAAGGTGAAATGAATTTTTAAGATATTTCAGTTTGCCAAAAATAAGCATATTAGGTTAGTATATG
AGGAAAAAAAACAGTTTTATTCGAATTGGTTAAACTCAGTTCTCATTTTCATATCAAGTGAAAAGGTCAATATAAACTAAAGAGATGATGATTGTCCCAT
CTTTGCACATGTAGTCCGGTTAGAATGGGGATTGAATTGACATAGAACTTGGGCTAAGTGGGTTATAATTATACGGGTTAAGACGTAGCACATTATTAAA
TTATCATGAGCTCAACCCATAAATTTTGGGCTCCTAATATCTGAGCTTCATTTGACACCCCAAGTAAGGAGTGCCACGCACGAGCATGGCAAAAAGCAAG
GGGAACTTTTCTTTTTGGGAGAAATCATTTGATTGCATATTGAATACATAAAGCACATTCCAACAAATTCAAATTTTAGAAGTTTCATATGGTGACTACA
TTTTAGCTTCCCGTCAATTACCCCAACCTTCTTCATTTATCCAGATGTGGGACGGACACGGTGAAGCTCACATAGATTGAGTTAGGTAAAATATTTATCT
GTGGAGAAAAATATTACCCCCTGTTCCATTTTGTGTGACAAGTTGAAAAATATGTGTGGTTAAATTGACTAATTTTCTGAGTGAATTTGAACATTGATAT
TCATTTTCTAAAAATAAAGTTTTACATCTTTAAAAACTATATAAAAAGTATTGTAAGTCACAATAGTTTACAATTCAAAATATTAAAGAAGTATTTTAAA
AAAAACATGGTCAAAGAAAAACTTATTTTACACTCCAGATAGTTATAGGTTACATAAAGTGGAGCAAAGTACTCTTATCAATACTCTTAACCATAGGTCT
GGAATTCGAGTACCCATAGAATAGAGTTCCTTTTGTTAGGGAGCGGGTGGGAACCAAAAAAAAAAGTGGAACAAAGGGAGTACTAAAGTATACTTATGGA
AGTTAATATAAAATCTGAAGATAAGCGTTAAAAACATACCTAAACTATCCTTTTTTTTTTAGTTTCATACTTGAAGTATTGAGTGTGAGTTTTCTACCTA
AACTATCACTTATTAATTTGAGAAACACATCTTTCTTTTATTATACTCTATCATGGTGTGTAATACACTCCTTTTATTTAAAAATTGTTATATTACAATC
CACATGGACAAAACGTTTCACCTTGACAAAAAATAAATAATTAGTATTAGTTAAAGTTAAGTATTAAAGTATTGCTATCCCCCCCCCCTCCCCCAAAAAA
AAAATTATAAAATAAAATGTAAAATATTTTTTTTACCCAACTCCAATCTTTCCTCTCAACGTACTCCCCCATCCCAAATTTTTAGTTTATTTTGTTCAAA
AAAAATAAATCCCTTCGAATAATAATTTAGATATAGTTAAATTTATTTTATTTCTTGAAAAAAAATTCTACCCTAACATAACTCCCCTCTTCCATTTTTT
TTCTCGTTTTGTATTAGATATGTATTTTCTTTTCTAAAAAAGTATTTTTTAACTTGCCGCAAGACTTTTCATAAAATAAAACTTTTATTTCTGTTAATTT
GGTATGCAAGTAGAAAAGAATGTTTTCCTAAAAATATATGTACACATCTAACACAAAACTAGAAAAATGTATAAAATTAAATTAGGAGCGGAGGGTTAGA
TGGGGTGGGGTAGAATATTATTTTATTTTACTTTTTTTTTAAAAAATAATATCAAAATTATTTTTAGGAAGGAGTGGGGGAGGGGGTGACGCCTAAATTT
CAAAAAATAATTTTAGAAATAATAGGACGTGGGGTTGTCCGGGGATGAGGGTTGAGATGATGGAGTGGGGTAAGAAATATTTTAATTTTTTAAAAAATGG
TAATACTTTAATCTTTAGTTTTTAGCTAATATTAATAGTTTTTTAATTTTTGTCAAGTTGGAATAATTTATCCATGTGCAATGCCATGAGGCAAGGTTTT
TGCAAATAAATGAGAAAAGTGTATTAGACACCACTGAGGTGTGTTTTTCAAACTAATAAGTGATAGTTTAGGTATGAAAATTCAAAAAAAAAAAAGAAAA
GAAATAGTTTAGGTGTGTTTTGACACTTATGTCTAATCTGAAAGATATTATTAGTTGTACAAGTGTGAAAAAACACCCCAGGATGTTCCCAAGTGAACAA
ATAGAAAGTGGGGTCGAAATGGGAAATATACCATCAGTTGTCAATGAAGTTGAAATAAAATCATGAGAGAGTTCCAATCCTAGTAGAAGCAAAAAGAAAT
TAGCCGATTTCTTCCAATATGTCTTAAGTTTCAGCTGTCAAGATTACTGCCTGGTACCTTTGGGTGGAGGATACATGCACCTAGTGGAATAGTCAAGATA
CATGCATGTTGGGTTGAAGGCACCTTAGTCTTATAGAATTGTCAAATCAGAATATTTAGTATGATGTATCATGTGTTCTTGAACACTCGTAGAACTAATT
CTGTTTTCCAACCATTAGTTGACTCTATCAAAAGAATATCAAGTTGAAGCTAGTTGAGATGTAGGTAGAATATCTATTAACCAACTTATCTCCATGTAGT
TCTATTCAGTTCCATTTCATCCAATATTGTATAATTTACCTTAAAACTACAAGTCCGATGTGTTCCACACTTTCAGGAATATAAAAGTCTAACACTGTGC
CTATTATCAGCTAACAAGTAACAACTCTCTATTTCAAATAGCTGGCATTGCCTACATGGATCATTTACTTTTGTTAGGTTACGGTCTTAGTTAAGTTCTA
CCAGAGATATTGCACGTCCTTTAGGATAACTCATCTCCTTGTGATTTTAGGTGTACTTTGCTTATTTGAAATGATGCAAGGTTTTATTACTTTTTTTTTC
TAAGAGATTTTCATTGTATATGTATCCACCAAAAGAATAATACGAAGAAAAAAAATGAGAGAGGAAGAAACAGATCTGCTTCCAAGTTGTGACATAATTT
TATCGAAAAGAAAAAGAATATTCAGAGGCCCAGGTGCCACTGAGTTAACTCGCCATTCTTCTCTTCTTTAGACAAGCCTGATAAGGAAAGCTGATTCTTA
ACAATGTGTTGGGCATCAAAGGTTTTCTTTTGTTCTCCTTCAAAATGCACATAGGTAAGGTACTTATTCATAGTACAATTATTTGGCATATATTGTAGTT
ACACACGTGCTTGTGTACTTGTTCTACTAAAATGTTGTTATGACTTTGTAAGCTAGGTTAAATATCACAGAACATGGTGCATCTTTCATTTGGAGCATGA
ACTTGTGTTTCACTCTTGGTCAAGTTATGTGTAAAAGGTATTCTGACATTCATGTCAGCTAGTTTGCAGGTTTTTACAGATAATAGAGCAGAGGCAATGA
AACTGCCGTAACAATGTCTGGTACTCTTTTCTAAAAGTAGTATGCCATGCTCTCAAGTATAACTAGAAGTGCTTGTAGACTGTGCCTCAACAAAATGTGA
AATCTCTGTCGTGTGTGAAATCATTTCAGCTACCTAGTGTTCTTTAGTTGAGGCTTCATGCTTGCTTCAGTTAGAAGGTGGTTCACCTTGAGGTGTATCC
TTGTCAATTACATAATTATGTATTTTACCCATTGGTTTTTCTCTATCGGGAGATTGTTTTTAAGGAAAAGAACACGATTTGTTGTAACAATTTACGCAAG
CTATATTTGCAGAACATGGTCAGTCATTTATGATGACGTGCTTAATTATTCTCAACATATTCTGAGACTCTCCTTTTCAGCTTAAGTTGATGGCTTCTTT
TATGTCAAAACATGATTGAAGGACATGAGTGGCCTTTGAATTCAGTTTTTGGGAATTCGATTTTGAAGAAAAGTTGCATGTTCCAATTACTTTTTGAGAA
ACCTAGTTTATGTTTTTTGTTAAAAAAAAAAACCAATTTTGCTGGATTTTACTTTTTAGAAAGAAAAACTAGGTTTGATATTTGAAAAAAGAAATGTTGC
GCTTATTTTCTTGCTAGTGCAATAGTAATAATAACTAATAAGGCAGAGAGATACGAGGGAGTGTAGAAAGTAAAAAAAAAATTCAATTCAATTAGGCCTC
CAAAAATATTTTAAAGGGAATTGCATTACATGATGTTTGGCTGGATGAGAGAAATAAATAGTGGTTAAAAGACAAAAACGCATATTCGGGCAGCGACTGC
AGCAAAATAGCTGTCGGTGAGCGAGTTCCAGTTGGTCACCCCATGTGCCGACATCTTCAATTTTGTTATGGTCATAGCTCATACATACAACACGTTTAAA
CCACAATAATTAGGCAAATTTATAGCAGTAGTGCTTATGCATAAAAATCAAATACACTCGAGAATGGTAAAAAGAATTACACGAGGGGAAAATAATAATA
CAACGTAATGGACTGGACTGACTGACTATATGATGAAGATAAAAGTAATTCACTTTATACATTTACGTACGTACTCCATGTGAACTCCGATCTATTATTA
ATATATAAAAACAAAACGACTCAAATCAATCAATGAATTAACCAACATCACAGTGGGAATAGTAGAGTAATAATACATCAGTTGTTCCTGATTAAGTTGT
CATCGAAGTTCCTGGAGTAGTCATACCGGAAGGTTTGAGGTAGACCCATATTGTTGCCGGAGCCGGTGAACCTCCGCAGCTCCGACCTTATTTTGAAAAA
TACGTGCCTCCAGCTGCCCTTGCTGTTGCATCCCAATACGGCTTTCTCCTCTTCATTCATTTCCAGATCGTTGGCAAAGGCTGGCTTCTTGGACATGATC
CAGCCCAATCCCCAATCCCACCATTTCCTAATGGAATTACCAGTGTATTCGGACAAGGATTTGGATCGGCGAAATGCCCATGAGGATGAGGAGGTAGAGG
AGTAGAATGAGAGGATGGGTTGTTGTTGTTGACAAGTAGACCTCATGCGCATGTTCATCCTTAGAGAGAGAGAAGACAGCCTTTTGCGCACGCCAAGTCC
TTCTCCTCTTTCTTCTTCTGTAGGTTGCGACATGGGCAGAGCTTCTTTGCTCTGAAAACTTTGAAGAAGAGAGCTCATATTCGTGTCGGTGAAGAGAAAG
AACGCAAAACTTGGGGGCATATAGTATAGTATTGGTAATAGCCTAATTACTTTACTAATAAACAAGGTGAGTGGTCATCACTCATTCACCGTCACCCGCA
CATTCCTACGTTTCCATCGACAGCCTGTTATATTCTCCTATGACTCTTTTGCCCCTCCCTGGCCCCAGGCTGTTCAGGGAATAATTGTATATCTATTTAC
CATGAGTATTAACGTTATTGTCGAAACATTATTCCCAAGTCATCTTTGACACCTAATTCTGTTCCATTTCAACTTGTACACCCAAAGTCACATTACGATA
CATGAGTCCCAAACAGAACAACTAAGCTTCAATATTATCTCTCCTGCTGTTATTGTTCTAACAAATGGAAAGACCAACAATTTTCCCTGTGCCCCGACTA
AATTCCTTCCCCATTCCAACATAATATGTTTGCTGACATAGACCAAATGATGCCCCTTGTATTGATGAAAATCTGCCAAAGTTTCTTACAGTGTAAAAAG
AGATCATTTATGGTCTCTGCCTCACATTCACAAAAAAACATCTACAGCACAAATGGAGGCCCTTCTTCATACGGTTATCCTGTGTGAGAACAACCTGTTT
TGCTAATAGCCAAGTAAAACAGGCCACCTTAATTTTCCAGATCATTTTTCATGGCCAGTAGCTTGGTTGAGTGTGTGTCCTCTGGGAGTTTCTGTAAGAT
GCTCCAACTGAGAATCTCCCATGTTTATCTAGAGCCCATAATAGTTTGTTTTCACTGTTATTGAGTTCCTTGCATCATTCCAGGATATTCAGAAATTCAA
CCATGCTATTCACCTACCAATCGTTTAAAGGTCTCCTGAACCTTAAGTTCCAACCCTGAGCATCTCTCATTTCTTTGACAGTGACCACTTTCTGTAGACT
TAAGCTGAATAGGTCAAGGAAACTAACTTTGAATGAAGCCTGTCCCACCCAAAACAAAGTTTTCCCACCATATCCTATCTTAAATTATGCACTTGTTTAT
AAGTTGTGGCCATAGATTCCTAATTGTCCTCCACACTCCGGTGCCATATGGTTGTGTTGCTATGTTGTTGATCCACCTTGTATCCATTCCATACCTGACC
TTAATGGTATCTGTCCACAGCATTTGTTCTTGTGATGAAAATCTCCTCAGCCATTTCATTAGCAAGTTGTAGTTTTGTAATTTCAGATTCCTTGTTCCTA
GTCCCCCTTTTTTTGTTGACAAACTTCATCCCGCTTGACCAAGTGAAACTTGTGTTTATTAGGATTACAGTTTCCTTGCCAAAGAAAATTTCTTCTAATG
CCATCTAATCTGTCTCTTACACTTGCTGGCATAGGGTACACAGACATCATGTAGGTAGGCAAAGCATTAAGAACACAGTTGATGAGAGTAACTCTGCCAC
CCATGGATAAATAGTTGGCAAGCTTCTTCTCACATTTCTCTAGTATATTATTCTATATGCCTTTTGATTTGCTCTGATCTCCCAGAGGCATTCCCAAATA
TATTGTGGGCAGCTCCATGTCTTTCATCCCAAAATATTTGCCAGACTGTCAATCCCAGGTACCTCATTCACTGGATAGATGAAACTGCCCCAATTGATGT
GTACACTTGAGGTTGCTTCAAACAACTTCAGTATTGTTCTTAAAAACTTCAGTTGGTTGATGTCTGCATCACGCAATATTAGAGTGTCATCTACATATTG
GAGATGTGAGATGTGTAGACTCTGTCTATCCTCCATGTGTTTGTTTGGGCTGTTCTTACTATATCATTCAGACCCTCCATTGCCCAGATAAAGAGAGAAG
GAGATAATGGATCCCCTTTGTCTCAGGCCTCTCTCAGATGAGAAGAAACTTGTGGGAGAGTCATTAATTAAAACTGAAAATTTCACTATACTGGTGCAAG
ATTTGATCCAGTTTATCCATCTTTCCCCAAAACCCATGTTTTCCAAATTCTTCCATAGGAAACCCCAATTTAAGTGGTCATAGGCTTTCTCTCTATCCAT
CTTACAAAGAATGCCTAGGACCTTGCTAATTTGCCTCACATCTACACATTCGTTGGCAATCACAATAGCATCCATGATCTCCCTACCCTAAATAAATTCC
ATCGGATGCGTATCTACTAGTTTTGAAACGACTTCTTTTCAGCCTCTCAGTAAACACTTTTGAGATGATCTTACATATGCTGCCTATTAAGCTATGAAGG
TGGCATTGAAGCTTCTTTCAAAAATGTTCTGATTATGTAAGTTCTGAACTGCTGCCACTAGTTTGCTTACTATTTCCCAGCAATTGGTGAAAAATGTCAT
GGTGAAACCATCCAGTCCAGGTGCCATCACATATTCTTTGATCTCACCTCACTAAATTAACATTGTATCATTAAATTGTCTTCTTCACTGATAACCGCAC
CTCATTTATGGTCAGGGGAGGATCTAGGAAGGCTCGTGGGGGTGCCACGCCACCCACAACCTATGACGGAAACATTCTCTATATATATATATATTGTTCC
CTATTTCTTTATAGAATTTGTGGAATATGGATTTTATTATTTATTTTCTTTATAATTGATAAAAATTCTCTTGTTAAGACCCTATGAATCGATTAAAACC
ACAGATTCATACTAGAACAACGATGATTCAATAAAGAATCCTCGGATCATCACTTATTTCCTGAATAAATAGAATCACTAAAAATTCAAAGAAAGATTTT
GCTTTTGGTCAAAATATAAATAGGAGTTGAAAGAAAAGAATCTTTCGACTTAGAAATTAAATTTTTTTGATATATATATATATATATAAGTTACTAACAT
GCCACCTAGACATATAAATTACCAACATGCCACCTAGTGGAACAAAAAACTATGTGGTGCCAGTGGCATAGGATCAAACATTGTACGCGATGGTCTTTGA
TTCCTAACTCAAGACCTCCCAACATCCGTTTGAATAGTTATCCTACTTCCAAAAATCAGATTTCTACCACCCTGCTCATCTTTCAACAATTAATAAGCAA
AAATACATGTTCATTAAACCTGAAGTAGGTAAAATTGAAAGCATCAAAAATTGAATAACATTTCTACCACCTTAGATATTATCTTTACCAACTCAGGGTA
AGTAACATCGTTAATAGAACGCAAGTCATTAGCTGCCAAAATAACCTACAAAGACGGAAAAAAAAAATTTCCAACGTCATTACTAGAGGAGAGCTTAATT
GAGTTGCGAGAACTCAAATACACCCAATGTCTAATCCAATCTGACGCACCTTCATATAATTATCAAGTCTATGAATATGAAAACTGCTAACTTATGATGA
AGCTTTATTCATACTTAATATCTGGTTTATCGAATTTTTAACTATATGGCTATAGCCTCAGAGTTTGTGTCCTGTAACTTCTTAGCCTCATTGGATTGAG
GGAATAGAAATAAGAAAATAATGATAGCCTCAAGGCGCTAAATTTCTTTATATACATTTGGAATATGAAACACCTATGAGATTATTATAGATAACTAGGT
AATTTTTCCGTACTTAGCGGAGTCATAAATAATAAGTGCATTTGAACTTGCAAATAATTTTTTTCTAATATTCATCTACTAAAATAATGGAAAATAGGTT
CATAAAATATATTAGCAATAATTCAACATGGATTGAATTATTTGTCGTTATCACATAACTCAAGAACCTCTAATGAATTAATTATTCACAAAATAAGAAT
ATGTATGCAAAGACATTTCGTGATAAAAAGAAACATATAAATTGCATAGATTATACAATTGTTATATATGTCTTAGGAGAAAAGTAAAAAATTGGTTAAT
ATATTTAAAAAAATAAATTACTCTTGAACATGAAAACAATTATAACTTTTGAATTTGCAAATTTCTTCAATTGATAAGTAAGAAATTTTATATCAATGTA
AAAATAGATAATATGTAAGTTTATAGATAGTATTTTTAAGTTATATAATTTAATATAGAATATCAATACATGAATTCTTGAAAGTGAATACAATAATTAT
TTTCTGCACAATAAATATACGTAATATATAAGTATATGTTCAATCTAACCGGAGATAATAACTTTGCAAAAACATAAACAACAAAGTTTAGAATATATAC
TAAAAAACAACAATTAATATCATATGCATAATATATTGAGTGTAAAAAACATACCAGAAGAAAATAAAATTTTTTGTTGTTTAAAATGAGAGAAAATCTT
ACTATTCATAGACAAAGGGTAGTGTGGATTAATCTTTATTGTACCTTATGAGAAATGTTACAACTATTTGGAAAAGTTATAACCCTTCGTAAAGTTCACA
ATCTTACATAAAAATCGCAACTTTTCATTAAGTCACAACTCTTCATTAAAACTGCAACTTTTGATAAAAGTCGTCACTTTTAATAAAAGTCGCAACTCTT
CATTAAAATTTCAACTTTTCATAAAAGTCATATCTTTTCGTGAAAGAGAAAGCTAGTTTTGGAAATAAATAAATTTAAAACGAAATTCTTGTTTGTGGTG
GCGCTACGTAGGCGGGCATAAGATTCTATTTTATATAAATATAGGATTGAATACTCTATTACTCTTCGTAGGTAATTGCATTTTTGTGTAGATTCTTTAC
TTTATGATGAACCACTTCTACGAGGCTCCCTAAATTTATCAATACAAATTATTACCTTATGAAGAAGAAAAAAAGTGCCACAAGTACAATTGAGGCATAA
GAGTATATCACAGAACACCTATTCACCTAATGTTTTACTGATAAATAAACCACATCCCTTTGACTGAATGCAGCTAAGAAAAGAGCATTAGAAGAGGATA
AATTAACTCTCTTAGATACAGAAAACAGCATGTTAAAATATTTAGTGTTGTTAACTATAATCAATATCTACAGAACTGAGGATAATAAAGATGCCTGTAA
AATGGCAACTTTACTACTATAAAAAAAAATGCCTATAAAATGGCGTTTTAAACTTGCAATGTAATTAAAATAGATTATGTAATCTATCTTTTCTATTTCA
GTTTAGTGAACACTGAACTCTAGAAAATTTCTATTTTATGTGCAAGAGAGAAACAAGACTCCCAAGTAACCTGTGTCCCATGACGAAGTAAATCTCTCGT
AAATGGCAGAATGCCCAGAATAATATCTGCACCAGAATTATCCAAAGATTACAGTCTGTGTAGTAAGCAAGTTAGTGAACCAGCATACATCAAACGCATG
GGCGGAGCCAGAAATTTCACAAAGGGTGTCCAGAAATAGAACAATATAAGCACTTTTCAAAAAAAGAACTAGTTAAATTCGAACACACAAGAACTTCCTC
TTTCCAAGAAGGTGAAACCACTGGGTTATAACAGTTTGATATGTTAAAGGGTGTCTAAAATATGTTATTTATTCATTTTGTGTATCATATTACTGGTATA
TACCATATTTTTTTCCGACGAAGGGTGTCCTACCACCATAAACACATCGGGATATTTGTCATAAACAAGTAAAACATAAAGCTCAGTGGAAAACATAAGT
TTCACATATGGTTGACTACTAACTAGCCTTTTTCATGATTTTCTGCTCCATTTGTTATGAAAGAATATTTGTCTAAACAAATAAAAGCATAAAGCCCAGG
GGAAAAGATAACTCTCACATATGGTTTTAGCTACTAACCTTTTTCCATGATTCTCTGCTACATTTTGTTATGAAAGTATCCAAGTCATCAATAACCCAAG
GTCGAGGAATGAGGTTTTGGCAACTAGCTAAAAAAAAATGCCATCCCTTGAGAATAGCTCCGCAAGCTTCAAAAAACCATTAATTAAGAACAATTGATTC
AACCTTGAAAATATTCATTTTCTAAATGCTAGTTGTGATTTAAGCAAGATTAAGGGGTATCAATCTATCAAAGGGCATGGCATACCTCAGCATAGTCATG
GCAAGTCAGAGGTACAATTTAATGTTAAGTACATATAAATTTCTTTATATATGAGTCATCTTTGAAACATTGCCTAGCTGTGCCGAGCCAAGATCAAATA
GGTTACCAGCAAAAATCCCTTTGACCAAGTTCTCCATACGCTTAGCTTCATCCTCGATAGCATCATTTAGCTGTACTACATCCTCAAATAAGGATATAGC
CTTTGCATTTTCTTCGTCCTAGTTAATTTACATAAGCCCATCAACAAAAAACAGTCAAATCTTTTACATTTTGGTTCATGTTGGTTAACAGGTTAAAAAA
CAACAAAATTATTTTCAAATGAGCAATGAACTTATTGATTTGACCTAAAAGTTGATCCGAGAAAATTCTTACAGGAAATTGGGTTTGGTTATTTGAACAA
TAAGGGATGCTCACATCAACAACTGAGACCAAAGTGTGTGTTGCATAGTCATACATGAAGTGCTGGTTTATGGACAGAGATACTTTCCTTGAAAAAATAT
CTAAATAATGTTTGGTTATAAATTGGAACAATTTTTTGGTTAGTTTTTGAAGATGCTTTTGTGTGCTTGGAGAACTGATTTGACCTCTTTTTCAGTAAAT
TTTTTGGTTAGTTTTTGAAGATGCGTTTGTGTGCTTGGAGAACTGTGTGTGTGTGTGTGTGTTGCCTACCCAATGTTTTTTCTCGTCATTACTTGCATAT
TACATGGAACTGTTCTTCAATGATTATGAAATATCCATGTTGTTTATTCGTACAGCAGAAAGATGTTGCAGAGATTTCCAACTGCTCTGCGGCCTTCACT
TATATATACAATACTACAAGACAAGACGAGCTCAAGGTTGCTTCAATACAACTTGCTCACAATTCCTCTCTCGAAGCATCATCTCTTTGATACTGAATAT
AAGATGCATATGTTTTGATTATTGATTCATAAACATCAATACCTTTCAGATACTCATCCTTGTTCAAGAACTGCAGCAAAAGAGAATGCATATTAACCAT
AGGCCAAAGTCAGGATTTCCACCACATAAAACAAAACTATTTAAACAAGTGAACAAAATTTACAAGTCGAATCAAATTTACATCATTTCTACGGTCAAGC
AAGACTTTAGCCTCCTCTAAGTGTTTGCTTATATTCACCAAACAGTTGATCCGGTAAACAGTAACCATTGCTGTAGCATTGCACTCTGCTTCCTTTCTTT
TGGAGTTCTCAACTTATTCTTTTGATTTTCTCATATTAATAGTATATTTAATAGGTTTAGAAGACTCTGGGTGTATGCACACACAAAACTACCATGTGGC
ACCAAATAAGCGAATATTAAGTAATGCTCACCTCATTGTGGTCGTGAAGAAGAATGGGAGTGTTTGCCATCGGAGAAAATCCTATTGCTGGCAGGCCTCG
CTCTCGAAAATAGCGTGCATCTGTTGATGCAGGAAATATTTCTGGTTTTCCAAGTCTGGCATTAGCTTTGATGATAGCTTCTTCAAACAGTGCCCACCAG
ATATTGGAACTGTCAACAGCTGTAACAGCTGGCCTTCCTAACTTGTCGTTCACACTCACCTTTTGTTTGAACTGTCCAAGAGCAAGGGCATTGTATAATC
TCTTAAATTAGTAATGTATTGCACTTCAAAATATTGTTCAAATAGACTGGTGATACGAAGTTAAACAATAACCAGTGGGAATTCTATCAAATAGTACAAC
TAAAGATGACTTGGGAGTATTATTATCCACCTACAGAATTCAAAGTGTTCAATAAAAAAAACATATAGAAAAGAAGATACTTACAGAGATCTTAATAAAT
CTACAAACTGATCTATATCCTCGAAACCTACTTCTTTACACCAAAAGTAGAAAGATATTTTACAATTCCATTTAACTTTCTAGATGGAATTGGATCTATC
TTCATAATACCTCCTGAGACCCTCTCTCCGAACTGTCCATCAGATGCATTAAATATGTGAAAGGTTCTGAGTCTAGGATGATAAAGTTGTAGATTGTATC
AAGAATCTTGGATTAAAGTTGACTGGGAAAGTGCATCAAGACATGCCAACTAGATGGAATTACACTTTTCTTATGCTTGAGAGTGCTATTCCATATCGTT
GGGCTTTTTTTTTTACTTCAAGTTAATTGATGCAGATTTTAAATGTTGTCCTTCATAAATAGATTGGAACAAGGCAAAAACAATAGCCAAATTACTAAAG
CCTTTTGATGAAATCTATTTTCAGGAAATCAATATCCAACAGCCAACTTGTTTTTTCATTGTGGAAAATTCACTTGTTGATAATGGTAAATAAAAATAGT
CAACACTCTGATAGTAAAGAAATGGCAGAGGAAATGGAAAAGAAATTTACAAAGTATTGGGAAGAGTATACTCAAGTTTTGTCTTGGGCAGTCATTCTTG
ACACTCAGTTTAAGTTAAAGTTTATGAAATTTTGCTTTTCAAAACTTGACTCTTTGACTTGCAAATATAGGGTGAAGGTTGTTGAAGATAATTTGCATCG
ACTGTTTGAGGAGTACATGAAATCTTCAGCATCTAATAGAGCATCGGTGGGAAGTACTCTTGATGAATCTGATGCTGAGATGAGAAATAAAATGGATGAA
TTTAAATTGTTAGCAAGTCGGACAGAACTTAATTCGGATGGAAGACAGACTCAATCAAAGATTCAGTAAACTGCTGGTCAATATGCTACTATACAAACAC
TTCATGCCAAATTGGAAGAGGAAAATGAAGGCATGAGACAATTTTCTTTGGCATATACACCACTTCTCCTCACCCAACAAAAAGAGAACAGTTAAATGTA
ATTATTGTTCTAGGCAATTTTCTCTTTGGAAAAGGACTGAGGTATAGCAAACAGGATTACAGGTTCTTTATCTCTAAAAGAAGAAACGATGGATTATTAT
TATTTCTAGTACCTCAAAAGTCATGTTACGCGAAGCAGGTGCCCATTCATCAGCTATTAGCCTCTCCAAGGATGCCTGATCTGCAGTTGGTGGTACTCTG
ATGTCAAATCCTGCTTGGGCTTCAGATGGCTGCAGGTTCATGACAAAACCCTGCCACAGAAATAAAGAAGTCCATGTTTTAAACTTTATCTCAATTCTGA
TTCTAAGTGTAGGGAAACGGGCCATTGTTTTACAAGAAAGGATTGTTCGGTAAAACACCCTATATCTGCTACGCCATCACTTCAAATATTCGTTTTCACT
TGACTACATTAATAATTCTGAAACATTTAAGCTCTTCAAACATTTAAACTCTAATCTGAATAATTGGTAAACACTATCAAATAGTGTTTAAGGTTATAAC
CCAGCACATTGGATGAATAAGCTCAATCAAAGACTCCTAGAATTCCTCAGAAGAAAAATGGTCACAATATGCAGGAAGCAGTGGTCAGAGTCAAATAGCT
AGACTGACTTACAGAGGGTGAAGGGGTGCCAGCTTTCAAGAAGACCATATTAACAGAAATGACTTCGCCTTCAGCTTTCTGTCCTGCCTTAACTAGATCA
AACTGCGCTGCCCTGAATCTCCTTATAATTTCGATACTTTTAAGTAAATTCTCCATGGCAGTATTATCATAGAGCTTAGCCCCATGTCCAGGAGCACCTA
CAGCCTTAACGACCAGCCACCAGGGGGACCTCTCTCCATAGAATGCACGATAATTGTCAGTGGGAGAGGCCAAGCCCTCGTCAAGAACAATCCCAACATT
CATCTTGGCAAAGACATCTGAATCAACAAACTTTCTGGCACCATCATTTCCACCGATCTCCTCGTCGGGGAGGAAGGAGAGGTAGAGAGTGCGCAGGGGG
CGGAAGCCATAAGATTTGAGTTTGCGAATGGCCTCGAGGTACTGCAAGCCGACGCATTTCATATCCTGAGAACCTCGGGCGAAGATGTTGCCGGTAGTGG
AATCTAAGTGGGCAGAGAAAGGTGGGTGAGTCCACTTGTGATGCTCGGAAGGGACAACATCGGTATGTGAGTTAAGGAGGATGGAAGGGAGGGTAGGGTC
TTTGCCTGGCCATTTGAGGAGAATTAGAGGTTTGCCCTTGACGAACTCAAGGGTCTGGGACTCGAGGGATAGTAACTTGGCCTGTGATATTATAAATTCG
GCAGCTTCATAGTAGTTGGGGTGAGGTTGGGCTGTATTGATCTGAAGGTACTGCTGGAATCTTGATAGGATTGTTGACGGATCTTTAGCGGCCGTCCTAG
TTGTGATTATGAGTATGAGTGTGACCAGAAACACACGCAAATCAAGATAATAGCCGGTCTTGCTCATCACTGCTTTTCACTCCAGATGAATTAAAATCAA
TAGAACAGGTTATAAATTTTCGTTTGGAGCCGATCAACCTAAACACAAAGTTCAAATTCCACTTTATTTTGAGTTATCTAAATTAAAAAAAAATCCAAAT
TTATTTGAAAGGGTAACTGTGTAATATTTCTGCCTTTGTTAATCACGAGTGGAACTTACTTATATCAATAATTTTGTTTATTAAATTAAATAAACATACA
AAAAAGAGGTGTGCGTATATATACGGCTATAATTGATTTCATAAGAAATTTTATGGTTAGTGAACACTATAATTCAACAAAGTCATAAGTTACTATTTTG
AACTAATAGAAATTATAAAATTAGGACATTTAAATATTCATATAAAATAAATAGAAATTATAAAGAAAAAATAACATAAAATAAAATAATGTAACATTAT
TTTTAAGATCTTAACCATTGTAAAATAAAAGTAAAACACCACGAAAGTTATACACATTCCTATGAGTTTTTGTTCACATCCATTCACATAAACGATCACC
ATTCAATAGTCGTTATTTTATTTTTCAAGTTAAACTAAAGCACGAATATAAAAAATATAATAACTTAAAAGATTAATTTAATTATTTCTATGAAGTCTTA
AAATATCAACACTTATAAGACTAAAATATCAAATAATGTCATGAGTATGAGTATTGTTAAATTATTTTAGAGGTTATGTGTAACGATCCAGAAAAAAGTA
AATAAATAAATAAAATAATAGGTACTTAAGGTGATTTATTATTAATTAAAAATCTGAAATTTTAAGGGCATAATGGTCTTTTCGCGTTTTAATTAAAATA
AAAATCAGATTTGTATTAATTTATTTTAAATTCTATTTGACTAATTCTTGAATTAGTCTCCTAATCCTAATAGTTCTCTCTCTCACGTTCTCCATCTTTC
TCACGTTATTCTGCCAAATATCAACAGTTCTTCACGCTTGAAGAACTCACATGAAATTTTAAGAGAAAAAAACAAAGCAACCAAAAAATAATATAAAGGC
GAAGAGAAGTTGTTCGTTGAGTGGTGTGTACGTTAAGGTAACTTGGACTGATTTTTGGAGAGAGTTTTGGGTAGCAAATTCTTCGTTTGAACACCAATAA
AGGTATGAGTTTTCTTCTCTCTTGGCTCCTTTCCCAAGAGGCCCCTTACGATTCAAACTATTCATCTTGAAACTGAGGTTGTTCCCCGTTGCATGCCCCT
GTTACTAGCTCCCTATGATCTTAGGTTGGGTATTCTTGTTGGTAGAATTTAGGGATACTTGTTTGTGGTGATGATCTCGTTTCGAATATGTGTTCATGAT
GATGTGATTATATTTTGTGTCTTTCGAAAAATATGAATGTATATACGTATGTATTTGTGCAAGATTTTGATCATGACTTTGAGTATTTCTTTAGCATGTT
AATAGATTAGAGATTACTCGTGTTTTATGTGCAATTAGAGGCTCTTAAAAATCTTGATGTGCACATGGTTGAAATGCTAGAAATTCTAGTTAAACAAATG
ACCAAATCATACTTTTAACTTGTCTTAAGAATCCTAACGAACGACTAATAAAGAGGTGCTTAACAGTCCTGTAAATCGCTTCATAAAAATGTGTAACAAA
GTTCCAGAATCTGGAAATTCTTACAGGTGAATTCTGAAAATTTTGGGTGTCACAAAAATAAAATAAAAAATAGGTGAGGTCTGCAGGGATCGAACCCAGG
ACCTCACCAACGCATGTTTAAGAAGAAAAAAAAAGGTGTCAGGCGGGGCTCGAACCGGGGGCTGGGGGCTGGTGAAATTCGCAAAGAAAAAAAATGGGGT
AGTGGGAGTCGAACACGCGACCTGGGGGGGAGAGAAGAAGGAAAAAGGAAATGGGAGGCGTGGGATTCGAACTCACGACCTCCCGATACACGCGAAAAGG
AAAGAAGAAGGAGGAAAAAAAAAAAGAGGGGCTGTGGGGAATCGATCCCACAACCCCTCGATCAACCAGTAGCGAAAATGAGAAGCCAAGGAAGGGGAAA
TTAATTAAGGGAAAAGAATGGGGTCGGGGGAAATCGATCCCACGCCCCTCAGTAGCTGCCAAGATGGAAGGTAAAAAGAAAAATAAGGAGGCTGTGGGGG
CTCGAACCCCCAATCCTTCGGTTAATTAATAGTAAAATTAAAATAGAAAAATTTATCCCTTTATGTAAATATGGAGATTTAATTTAGAATTCTAATTAAA
ATAGAAAATTAATTCTTTTATGTAAACATTGAGATTTAATTTAGAAAATTAAAATAGAAAATTAATTCTTTCATGTAAATATAGAGATTTGATTTAGAAT
TCTAATTAAAATAGAAAATTTATTATTTTATGAAAATGTTGAGATTTAATTTAGAGTTCTAATGTTATGAATATTAGAAATAAAGTCAATGAAAAATATA
AATGATATCCAAATGATTCAAGAGTGGGATTCCCGTGCCCAAACCGTGCCCAAACCTCCGTATTGATACATAAGTCATACGTGAGTAAAATATTCAAGAA
TAATGTCATCTACTTTGATCAAAAATCAAGATCTTGGTATATATACAAGATACATAAGTCTTGTAAAACATAATCTTATGAAAGGAAGAATCACTTAACG
AACTATGAATGAAGCCCCATGGCTTGTATGTATAGACACATAAATCTAACATACGTTCAAAAATTAAGTGAACCTAAGATGTACGTAATGAAATGATGAC
TCATTATGAGGGTTAAGTACGAATGTAAGATACGTTAAATGGTCAAGTGCATTGACATATGATGAGATGAACTATGAAATGAAAAAATGAACACTCACAT
AATAAGAGGTGAGTAACTATGAAAAATAAAGGTGCTAATAATGAAGAATGTGGTGACAATCATGATGTGAGACTAATGTATATGATGAGAGCAATCTCAA
ATGAGCCTAAGTAAATGTTACCAATACGTACTCACCAATGAGAGTGTAAAATAATGAAGAGATCAGTCTCTATGAACACTCTAATGAAAATATTGAGTTT
AAAACACTTAATACTAATGATGAGATGAGAAATCATCTATTGAGCTATGATGTCCTCATACTAGAAGCCAGCTTCCATGATGTATGAGTTGAATGTAATG
GAACTTTATGCTAAGCACCGATAGGCTAGCTATGAGCGGTGATACCTTCTTTCGGGAAGGACGGAGGTTCACGTAACTCTCATGAGATGAGACTGTCCGG
CTTGCCGGATATGGGTCTCCATACATCTCCTAGTCTTTGAACCTATATTGCCACTATAAGGATCTGGCGGGGTTAAATTCCCATATACGCTAGCATGTTA
TTGAGTCACTTTGGCCGGTGATTCCACCACTTTTCGGTGTGGGGGAGACACTGGATTTCATGATGCTCACATGATCTATGTCGGTTAAAGTTAAAGTTCC
CAATGAATGAATGAGGCCAACCTCAAATGAATCATATAAAGAAATGAATGATACCGAAGGTGTTAGGATAGGATAATCAAGAGGTGAGCTAGATTCAGGT
AATGACATTAGATTATTCTTGATCATTGCACAACAAACCCGATGAAAGTCTTAAACTACATCCTAGGTATAGCTGGTGTTCGCACTGACCTATGAATGAA
TTGAAATGAAATCGGTATAAATGAATGAAGCAGACTCCGTGTTTGCTAAAGAAGGCTCCCTAGTTGAGGTCCCATATGTTGAGCCCTCATTTTGGGAAGT
CTTAAGGTCAAGTCCATGATAACAAGGTCTCATGGCATATGAATGAATAATATGAAAGAAACTACGTGTTATATGTTATGTGCTATATGAAGATGTTATG
TGTTGTGTGTAGTACGATAATTATAACGATGCATGTCACTCTCATGGCATAAGCAAGTCCACTGACTGACTTCCAAAAATCATGTTGTTAGGAAAGAGCG
ATTCTTTCTCATGTATGTCCCTGGTGTGTGCTTGCATATACCCATACTTAGTACAAGTGTGTACTAATTCCATACAAACATCTACTTTTAGGTGCAGACA
CAGGTGGGCGGTAGAGCTACAGGTTCGTTGTTGCAGCTATTCGGACGTTAACATTCATCCGGAGTTTGGTAGGTCCTCATGCTTTCGAAGATGCTACTGT
TTTACATTCTAGCGTAGTTTTAGAGTTGAGCTAGTGGAGCATGTTCCACTAGCGTTTCTTTCCTGTTTTGGTTCAGACTTTGTATTGGTGCTACTTTGGC
CGATATACAATTAATACTTAATGAATTGTTTATTTCAGTTGTTTATCTCTTAAATGTTAGATGGTTGATGATGAACGATTACGAAATATTAAGAATTTTT
AGCAAGTATGATTAAAGAATCAAAAATTTCAAATTTTCCGCTAAAATTAACCTATGTAAAGTAAGAATGACGCAAGTAGGCTTGTTTGTGACCTCTGAGA
GGTCAACGACGCCGTTCTCGTCTGGGGTCTAGATTCTGTTCGTGACATTATGATGATAAAAAGTTGTGAGGGAATTAAAATTAACGGGGAAATAGCCTTA
AATATCCTTAAACTATCGGATATCGTACAAAAACACCCTTTATTCACCTTTTGATTCTATAATGCCTTTGACGTCAACCTATTTGCCTTGAATACACCCC
TATATTTGACATATACATTTGACCATAGAATTAAATTTCTCATTAGTGTATTTTACAATTAAATTAAACTAAATAACCAATGTATATACATTTCAACACT
CTTGTTAAGCAAAAATATAGATACTTTATACAAACGAGCAAAAAAGATACAATATGTGGGTATCAAACTGTACAAGTATGGATACATTAGATAAACGAGC
AAAAAAAATACAATTTGTGGGTATTAAACTGTATAAATATGGGATAAATATGTAATTAATAAGTACGTGATGGATACAGATCACAAAAATCGCTCTTGCA
GTTATGTAAAGTATCTTGAATATGAATGAATTCAGGGGAGGTGGCAGAAAACATGTAATGTATGCCATAATTATTTAGACATTCAATTATAATTACTTTC
CTATCTAAGATTTATTTATTATACTAAATATATAAAGAAATTATTTGCATAGAATTAACTTTGCTATTTATAGTCTAATTATATCTATATAATATGAAAA
AAATAAAACATAGCTATTTTTCAAAAGTATTTGCCATATTCTGAATTTTTTCTAAAATTTACTCTATTTAAATATGTAGTTAATTCCGCTTGCAAAAATT
TAGAATCGGGTTTGCAGCCTTACAGACGGATTGGGCCGGGCCAAGTAGTCGGGTTAAAGGTTGACGAGACCCAAAAAGGCAGTGCACAAGGATTCGTACT
CCCAAGCGTCTCGAAAGCGTTATCCTGACATTGAATTGAAGATTGAATAGAAAGCTTGAAATCTGTCTTTTGGCGGCTGCGTCGAAGTTGAGCGAAGAAT
GGCGACGGTGGCGGCGGCGCCGTGGTTTAGAGCAAGGTTGATCCCGGAGTTAAAGAGTCGCCAGTCACTACTGTATTGTCGCAACGGCCCCCGCAGGTAT
CCGCAAAGTCTCTGTTTCCGGAGAAGAAGTTTCTCAATTTATGCTTCAGCAGGAGATGAAGGGGCTGTCCGAGTTCGTTTTGCACCGTCTCCTACCGGTA
ATCTCCATGTGGGAGGCGCTAGAACTGCACTCTTTAACTACTTATATGCGCGGTCCGTCCCGATTCTTTGTCTTTTCATCCAATTTACTTATTTCTTCAT
CATAGTTGACGACTATACTTGATTAATACCATTGACACGGCGGCTAATGGCACTTCTGTTTAGTTGTTTTTCTCTGTTAACAGTTATGTTACTATGACAG
GTCGAAAGGTGGGAAATTTGTACTCCGGATTGAAGACACAGACCTGGAAAGATCCACAAGGGAGTCCGAGGAGGCCGTGCTTCGTGACCTTTCTTGGCTT
GGTCTTGCTTGGGACGAAGGTTCCATCAATCACCACCATTTCTTTATTATAGCTAAATTGCAAAATTCTACTCTTAATTTTTGTTTTATGTGCTAATTGA
ATATGCTAAAGTTGACGTAATTGAACGCATAAAAGCCTTGTTCAAAACTGAATACAAGCTTATAAACCTCCAAAAGCATGGACAAGTTTATTTTGCTCCG
CAGAACTAAAGGTTTGACCTCAGCTTATATCTAATATAAGCCATACTAGATACAAAAATATTATTATTAATCCCCAAATCAGCAGCAATATTATGTAAAC
AACAGCTATGTCTTAGTCTTGAACAAGTTGGGATCAATAAGATCAACATCAATATTATTAAAAAAAAAAAGGAGATGTTTTAGTAATTCGTTTTTGTCAG
TTAGTGACTTTATAGCTTTCTTCTTGAATTTGGTTTTATTTAGAAGAGTTCCGTGTTTTTATCTGATGGGATCTTTTTATCTACTAATAGAAGCTTAGTT
CATCAGAAAGTTAAATAGTTATTGCTTTCACTTCTGGACCAATCGAGTGCGGTTCATACATCTACTATTATATCGATACAAAGTAGGACACATGCTAAAC
CCACATTTGATCAATAAAGGGGACAAAACTAGGATGACCAAAGAAGACAACGATTCATTAATTGATTTTGTTGGTGAAAATTTCATCATTTAGCCTTGCT
TGTTCAGCCATATCTTTTTAGGTTTGGAAGAGCATCGACATTGTGGAGTGGCTTACCAGCTTGCATAATACCATTTTAGGATGTCTAGAATACTCATAGA
AGGGAGGTTTGTACAATGGTCCCGTTGTATAAGAACAAGGTGATATTTAAAATTGTACTCCCTCTGTTTCATTTTATGTGACACCATTTAATTTGACATG
GTGTTTAAGAAAAAAAGATTTTTGAAACTTATTGTCTAAAAATAATTCTTAGATATTTGTTTGGTTTTAAATCATTTTACAAGGGCAAAAGAAAAATTTT
AAAGTTATTTTTTCTAATTATATTAAAGTGACGTTTTTTTGGGACAAAGGAAAAAGGAAAAGGTGCCACATAAAATAGGATGAAGGGTCTAACAACTATA
AGGGTATTAAGTTGCTAAGCCATGCTTGAAGATTTGGAAGAGGGTGATGAGGGGTGTGTCTATTACCGAGGACCCTTGAATTCATGCCAGGGCCTTCTAG
TAAAAAGGCCATTCATCTCGTAAGGAGATTGGTGGAGCAATATGGGGATATGAAGTGGCACTTAGATATGCTACACATTGTATTGGAGTGGGGTGGATGA
AATGGAGCTTGCATCGGGCGTCTTATGTGATAAGAATGTTCCACCAAGATTTAAAGGTAAATTCTATAAAGTGGTGGTTAGACTAGCTATATTGTATGCG
GCAGTGTGTTGGCCAGTCAAGAGTTTGTATGTCTAAAATATGAAAGTAGTGGAAATAAGAATGCTGCGATAGATGTGTGGGCATACTAGAAGAGATGGGG
TTAGGAACGAGGTGTATTCTGGACAAGGTGTGATTGAACCCTGTAGTGGACAAGATGTGATTGAACCCTGTAGTGGACAAGATGAAGAAGGCAGAGAAGA
TGAGGAAGGCAACACTGAGATGGTTCATACATGTGAAAAGAAGATGCTTAGAGGTCCTAGTAACAAGATGTGAGAGGTAGGATATAGTGGCTTGGTAAAG
GTAGAGTAGGGGTGTGCAAAAACACTGTCTTATCCCCTTTAGACAGATGAACATCCTCCATAATTGTTTTGTCCATGTACAATGCAAAAAAAGATAGTTA
ATTGTCTTAGCATGTTCTCCACGTAAAGTACATCTCGAAGCCAAAAAATAGCCTCTTTTCTTTAGATTTTCATGTGTCAAAACTGCTTCTCAGTAGTTAC
TAACTTTATCCTTTAGCCTTCAATTCATACTTCAAAGTGATTTTTAGTTCATAACTTCACATTATACAAAACATCAAAATCTAAAGTAAGAACCTTATTC
CTCTTAATTTCTCTTCGTTTAACACTTTGTGTAGTTTTTTCATTACATTATTGTGTTGTTGCGTCAAATTTATTAGAGAAGTCATATATCTATTTTATAA
GTGTTCTCTTATTGGTTAAATCGAAAGGACCAATACCGATGAATTGAAATTCGATAAATTTTTTCTTATTGGTTTGGTTATTGGTTTAACGTATTTAAAA
ATCAAAAACCCATAAACCAATCCGATAATACATAAAATCGAACCAAACCATTGATACACACCTCTAAGGTAGAGATAGTCAGCACTAGTATTGGATAGAG
GTGACTAGGTGACATGACATGACATACATGCAACTTGCCTAGTACGTGACCTTCAATGAGAGCATATGGGTTCAAGGATTAGAATAAAAGTTTGATATGT
AGTTGATCATTGTCTAGTTTTCCCTATCAATAGTATTATTATTACTCTCTTACTATCTTATTCTTCAATTTTTTATTATGTGTATTTTTTATTACCTTTG
CTTAGTTTATCGTATTTTTGTTACTGCTTTTGTTCGTTTACCATCATTTTCAACATAACTTCTTCACTATTGTATTTTATTTTTAATTCTTTTTTATATG
TGGTTACTTGAGCCAAGGTCCTTCGGAAACAACCTCTCTACTTTCACGAGGTAGGGGTAGGGTTGCATAGATACTACCCTCCCCAAACCTGACTTGTGGG
AGTACACTGGGTATGTTGTTGTAGTGGGATGAAAAGCTCATGGTTTATTCTCAATGAAGATTTGACAGAAAGCTATATCCAATAGGTATGCAACCAACTC
CATTACAATGTGATTCTACTCGAACCCCATTTAAAGTATTTTCTCTTTATAATAGGCTTGTGAAGTAGTCAAGCCTAATGTGACGTCCCGCCACAATTTC
AGCCTGATTTGGCATCTGAATGGGGCAGAAGGATCTAGAGTTGTGAAGAGGTTTGCAGAGAACTCTAGACCCTTCTAGATCTCTGGAGAAGACTAGAGAA
TTCCCTAGAATTCTCTAGAATACTTTGGATCCTTTTGGAAGAGTTTAGCATATTCTAGAGAGTGTAGAATTCTTTAGAATAAAGACTAAAGTGTAATTAC
TTTAGGGACTTGTAGAATAATATTTATTTACTCTTAGGCCCTTAAGAAGTAGTATAAATAGGAGGACCTCTCATTTGTAATCCATCCAACAATCCAACCA
AGAGTTGTAATCAAATCTTCCAAGCTTAATACAAGCCCTCTTCCAAAGTTCTTTCTAAGTCTTTCTTTACATTCTCTTAGCGTTCTGAGTCTTAAAGGCT
TACTTGAGCTTACAAGATCCTGAAAGATTCGTGAGTAAGTTGTCGAGTGCCGCACGGAGTCTTAGCAAATACTCCAAGTACGTGACACTAAGCTGAGTAA
GCTCAGGTAGGTGCAATTTTGCTGGTCTTTTAGCACCCCTTAGAATGGAACATTTAGATGGGTCTTTTGATCGTTATGTAATAAATTCTTGTTTGTGCTA
GAATTCACCTAGTGTCAAATGCCAGTGCAAGTGGAATTTAATATTCTGCATATACAAAACTCTCGAAGTTCAGTAGCTAAATTCAGTGTCATAAGTTGAT
CTAATGAAGATGAAACATTTTCTGGCTTATTAAATGCTGAAGTCAAAAGGTCATAGGGCTAGTTAGCATTAAGGGACCGTTTGGAAAGTCACCTAGTAAT
TGTAATTGGTGTAACTACTAGAATAGTAATTACAAGCCTAACACACCTAGTAATTATGCTTCCTATTTGCCACCGTGTATGTATTTTTGGATGCACAATT
GCAATTATAAGATTATATCAAGTCTTAAAATAAAAGTTAATTATTTAAATGTATATTAGAAAAATAAGAAACTTTATTAATGATATTTAATTAAATATTT
AAGATATATATTATATTTTGAAAATGTATTAATTAATAAGCATATGTTCTTTAACTAATATTATGAAAAAATAATTGATTTATATTTTTCAAATTTAGTG
TATTTCAGTTGTATTGATCATAAAAACTGAAAGTACAACCCTTCGGATGGCCCACTGGTTTGAACTTGGGACTTCTGTGTTAGAGGTCTCAAGTTCAAAA
CCCTTTTGCCAGCGAAAGCAAGGGGTTTGCCTTCTGGGCAGAGCTCGTCGCACCAGACTTGCCTAGTGGGTTACCTCTCTTATGTGGTTTGCGAGCTATT
ACATAGGAGGCGGGGTTTTACCCTGTATGCACCCAAAGGGTAGCGGCTGTAAAAATTAGTAGTACAAGATTTCTATGAACATCGTTTGACAAAAAGATTA
CTATTATAATTAAATTTCATAAATTATTAAAATATTTGATAAAAAGATAATTTATCAAGTCTAACAAAAAGATAAATGACTTGCAATCACACCAGATTGA
ATATGTGACTTTTGATTCAAACTGATCTTCTTCTTTTACTTTATGACCTGTTAAGTGCTTGTTGCCTTTATAATATCCTGTTTGTAAGTTTTCAATCAGG
AGAATCTTACAACTTGCTAGTAGAAAATACTATCTCACGAGACCTATAATGAAGGCGAGGAATTCTCGTCACTTGTCATTGTGAAGTGAGCCAGTACTTA
AAGTCTGTGTTAGTTTTCAATTTTTTTCCTTAAGACGTAACTCTAAGTAATCACCTGTAGTGATGATATTCTTTTACCTATCAAAAAAATAAATATGAAA
TGATGACATTTTTTGTTTTTTATCAAGGTCCTGGAATTGGTGGGAACTATGGCCCATACAGGCAGTCTGAGAGGAATGCCCTTTACAAGGAATTTGCTGA
AAAACTTTTACAATCCGGTCATGTTTATCGATGTTTTTGCTCAAATGAGGTGATTGTATTTAATTTTGATTTCTCTCCTTTGGTCTCTCCGAGTTTTGCA
GTGAGAATTTTGAGAGTAAAAATCTGTACATCTAGAATGTACTTTGACAGAAGCAGATATTCGTGCTGCAGAATTCTTTTAGATTCCACCTATTAGACTA
GTTTCAGAAGCATGATGCTCTCAAGTTTGATGCCATCTAAAACTGCTCCACTGCTATTTGCTTGATGGGTCAAAACATTTGTCCACTTTGTGGTTTTAGT
ATATTTTTTGAATGATTGTGTAATACAGTAACCATTTTCTGTTGTTTAGGAATTAGAAAAGATGAAAGAGATGGCAAAATTGAAGCAGTTGCCTCCCGTG
TACACTGGGAGGTGGGCCAGTGCTACAGAGCAGGAAGTTCTAGAAGAGCTGACAAAGGGGACCCCATACACATATCGGTTTCGAGTACCAAAAGAAGGGA
GTTTAAAAATTGATGACCTCATTCGTGGTGAAGTTAGTGATATTTCTCTACTGTTTTTTACAAGTAAATTTATTTACCCATTTAGGCTGGTGGTTTTCCT
CTTTTTATTGTCATAATTGCAGTCTAGACTATAATGTTGTACTGCCAACAGGTGAATAAATTGAAGAAGTTTTTTTTAGTCCAACCTAACAATGACAAGT
TTATTGCTTAAAACATTGTGTTTGATGTTATGCTTGGTTCTTCTAGAAGATTAGAAATAAAAGAAGAAAAAGAGGGAGAGGGGGGGTTACCTTCTCAAGG
AAAAATGAAGGAAGAAGGGTGGTGGTTCTGAGTAGTTTCTTGGCAGGGAACAATTATCTTAGGATGGATTTAATATGATTTTAAGTTGCTGACTATCTAT
TTCTTAAAAGTAAGAGCTATGATTACACAATTTTATTACCTTGCTTAGATAGGAGGACTAACTTCTCTAGGTTATCAATTGGTAGCTTCAAACTCAGTAA
ATGCTGTGTAGTAATATGGTGATTATAATGCTTTAGTGATTGAGTTTAAGCTACTGTTGCTTGGGGGTTTGAACCTTATCAACCTTATATAGCTTGTTTT
CATTTCATAAAATCTTGTATTTTTACAATCATTTAATTGAATTTCACAGAAAACTGAAAGGTGGTTGTTTATTATGTCTTTTGAAACTCTCTTCATTTCA
TGTCAATATCTTTTGTACTATTCATCTACTATTAAACATCACTCATGTTATGGTTCTCCCAATTTTTTTTCAATTTTCATGAAATGGAACTTTTGTTGTT
GACATACTTTTGAACACTTTCAAATATCTATTATGGGAAATCGCAAGTGGGCCACTTTTATAGTAGAGATTAGGTGTGTCAAATGGGCGGGTTGGGTTGA
AAATGAGAATATTAAAATGGGTTGAATAAAAGTCGGGTTGGGTCTTGACCCGCCCAAGTTTACTTTGGGCTCAAATGGGCTTAAAAACGGGTTGGGTCTT
GACCCACCCAATTAGACCCGATTAATCTCAATAATTTAACATATTGATATTTAACTTTTTATAATCACAATTTGAATTTTAGCTCAAGAATTTTTATAAA
AAGTAACAAATGGATAGATAAACCCTAAAAGATTGAAGTATTTTCTAGATATTCAGGTTGCTAGTTTAGATCATGTATTGGTATTTCTCAACGCAAGTAT
GCCTTAGACATTCTTGAGGGGACGGGAATGATGAGATGTAGACCTATTGACACTTCTATGGATCCAAATGTTAAACTCCTTCCGGGACGGGGGATCCACT
TAGTAATCCTGACAGGTATAGACGGCTCATTGGAAAATTGAATTATCTCACCGTAACTAGACCTGACATCTCTTTTCCAGTGAGTGTTCTAAGTCAGTTT
ATGACTTCCCCTTGTAATAGTCATTGGGAAACAATTGTTTGTATCCTGCAATATATAAAGTCAGCTCCTGATAAAGGACTACTCTATGAGGATCAAGGCC
ATGAGCATATCATTGGAGCTGATTGGACAGGCTCTGATAGACGTTCGACATCCGAATATTGTGTTTTAATAGAAGGTAATTTGGTGTTGTGGAAGAGTAA
GACACAAAGTGTGGTTGCTTGATTTAGTGCAGAATCAGAATATCGAGCAATCGCGGCGGCAGCAACTTGTGAGCTAGGTTTGGATCAAACCGTTGTTGGG
AGAACTAAAATTTGACAAAATTGTGTGACAATCAAGCAACTCTTCATATCACATCAAATCCAGTGTTTCATGAAAGGACTAAGAACATTGAGATTGACTG
TCACTTTTTCAGGGAAAAGATACACTCAGGAGATATTGTTACGAAATTTGTGAAGTCAAATGATCAGCTTGCAGATTCTTCACCAAGTCCATCACAAGTC
CTCGTATTAATTACATTTGTAACAAGCTAGGTAAATATGATTTGTATGCACCAGCTCGAGGGGGAGTGTTAGAATAGTAATATGTATATATATTCCTACT
TAGAATCGAAATAGGAATCCTACTTAGAAAAGGATTTCAATGTATTGTCTATAAATAGGGTCTAATGCAACAATTTAGATACACAATTCAATAATATTTT
TCTCATATAAGTCTGATAAGTCTCAAAGTGTAATCAAATCTACTCTAATGACTTTGTCTCTATCATTGATGTTTTAGACTCATTATAGGGATAGGACGAG
AGAGTGCCTTTAGAGTTCATTTTGTGAATATGGTTTTCAGTACAACCCATGTATTGATTTACAGAAATAGAAACAGTTAGCAATCTCAAAAAATTATAAT
TTCAATAATATTGTTACACCAACAAAAAACTATGTGTATAGAGTGGAGATGCCGCGCACTATGAAATAATCAATGGGTAGTTGAGTATTTAAAAGGCAGA
AGAGAAGACTTACCGCATGGGATATTGCTTTTTAAGGACTCATGTGGACTATACGGAGAGAGAAGTAGGAGAGCTTCCAAGGGCGTAGTGCAAGATTTTG
TACACTTGATGAATAGCCTCTTTTTCTCTTGTTGGTGCACCCTCTAGGTTCCTATTTGTAAAATGATTGTGTTGTTCGTAGAAAATCATGTCTTGTTGTG
AGTTTTCTATTTTGATTTACTCCTTGTATACATGCACTTTTTTGCAATAAAATTTGTTAGTTTATACAAAAACACCTTCGTACTATATATTTTTGGGTTA
GGAAGAACCAAGTAGGAGTAGAATATGTACTCATTTAATTGAGAAGTCCTATAATTTCTGCAAAACAGTAGTGTAATAGTAGCTGCTTGGTACTTGGTAA
TGGACTAAAATTTTGCATATCTTTGAAAAAGAGTTAATGACTGAAATGATATAACTGTAGGTTTTCAATCTTTGACAAGAAAGTAACTAAATGCTGGGAA
TCTCCTGTGCAATGCACGGGCAAAATACTAGTACATCTTGGTAATTATGGAGGACTGACTCTGTTACACTTTCATGAAGGTCAGTTGGAACTTCGACACT
CTTGGAGACTTTGTGATCATGAGAAGTAATGGACAACCCGTTTACAATTTTTGTGTCACAGTTGATGATGCTACTATGGCTATCTCCCATGTCATAAGGT
AATAGATTAATCTAATTATAATACTGTATGACCCCCCCCCCAAAATATACTGTATGACCCCCCCAAAAATACTGTATGATGAGCCTGATGCTCCAGAGGC
CAAGGACATTGTAGATTCCCACTGAGAAGTTGAGGTGACAGTGAAGAGGGTTATATAGTTATATGATCTATTAGTTATTAAAATGAAACATCAGTCATGA
TGTAACTATGTGTTTAAAATGTAGTTCTCACTGTTGTGGCGTTTACTAGATGATGATTATCAAAATTTATTCCACTTGACAATGGATTCAGATTGGTGGT
AGTGAGGTCCTGAAATGTCAAGGAATGACTATTATAGATTCTAACATGTGCAAGAACAATTTTGTTTCCTTTTCAGTTGTCTCTATCTTACACGGACTCA
TCCATTTGTCTTGATATACCATTGTCTAATGGGTATGACACGGTTACCTTGAAAATGTACTGAAAACTTGCCAAAAATCGAGCTTACCCATGCCATAATT
TGTACTTGAGGGATGAGACTATGACTCCATGTAACATAGTTTATATCATTTTGTTTTCTGCACATGGATACTGCCACCTTTTACATATGTAGCATGTATT
TTTGAATTGATTATTTGGTACTCAAGTACTGATGAAATGTTGATGCTTCAGAGCGGAGGAACATTTGCCGAATACTCTAAGGCAAGCATTAATATACAAG
GTACTGCTTTCCTAGTACCCCCCACCCCCCACCCCCAAAAAAGGGGGGGGGGGAAATAGAGTAGAGAAAACGGAAAAAGAAGAAAAGAATCACGAGGTAG
TTTTGTATATGATTTCTCTCTTAGAAGCTTATGGGGAAAAATCTTTGTTACCTTGCTGCAGGCACTAGGTTTTCCAATGCCTCACTTTGCGCATGTTTCT
TTAATTCTTGCCCCTGATAGAAGCAAGCTCTCGAAACGGCATGGTGCAACTTCAGTTGGTCAGGTAAATACAGACACACGATTGCATGCTTTCCTTGTGA
AACAGTTTTAGGGGTATACTTGTCTGAGACATGAGTTATTCCTTTGCTTCAATGTTATCTACCCTTTCCTTTTGAGCTGGTGAAGTGAGAAATCTTAGTG
TTTTCCTTTTGCTGACAGTTCAGGGACATGGGCTATTTGCCTCAGGCAATGGTGAACTATCTAGCTCTCTTGGGATGGGGCGATGGTACAGAAAATGAGT
TTTTCTCCCTTGAGCAGCTTGGTAAGTGATTGCCTCTATGCTGATGTTGACATGTCTAATGCTAACTTGCAGTCATTACTATTTATTCACATTCCAACAG
TGATAGCTTCTCATTTCATTTGCAGTTGAAAAGTTCACAATTGAACGTGTAAACAAAAGTGGTGCCATATTTGATTCGACCAAGTTAAGGTATTGTGTGT
GTGTATATATATATCAATTTCTTTTTGATTGGTGAGAGAGTAGCTCCTATTGATATATGCACAGCCAAAAGATAATGCTGGAGGGTTACAACCAGAAACA
ATAACCATCACAGGTTGTGTAAATTGTAAATCACTAATCAAGTCAATCATGACACCAAAAACATTTACATCTGCCATGCTACAGCAAAAACTAAATAAAA
AAATACATATGCATTTAACTTGTATATCAGAACATTTTGTCTTCAAACTTCCTGATGTTTCCTTCATTCCATAAGCTCCACCAAACGGTGGAGATGCAGC
AAGAAACCCAAAAACAATTCCAATTTACATATGATTGAAAGCTTTCTCATTTTCCAATTTGCAAAGATACCCTGGAATACTTCGTCTCCTCCTCGAATCA
ATACATTGCTATATTTTCTTCTGCTACATGGATAGGCTTGGTTACCAAGACATTATGAAATTGAATTATATGTCTTGATTGTTGTTTAAAATATGGTTAT
GAACTTCAGGTGGATGAATGGTCAGCATTTGAGATCACTTCCATCTGAAGAGTTGAACCAAATCATTGGTGAAAGGTGGAAGGATGCAGACATCGTTACA
GAATCACAAGGAGTTTTTGTACAGGTAGAAATTTTCCCCTCTCTTTCATTTCTCAACCACATTGTTACTACAAGATTTTTCTTAATCATCTTTGTGGAGA
TCTAACAACGAGATTTTGGAGGATTTTTCTTAATAATCTTTCCCGAATGGCTGTTGCATAGATGCTTGTCATTAAATATCAATTCAAAAAATTGTTGCTC
AATGTACTTTGGAGTTATGGTTCTTATACCTGTTAAATTTTCTGTATATATAGGATGCTGTTCTACTCCTCAAAGATGGGATTGACTTGATACCAGATTC
AGAGAAAGCACTTTCAAGTTTGCTATCTTATCCTTTATATGAAACTTTGACAAGGTGATCCATGAAATTATGTTTTAAAACTATACCTATGTGACGCTAA
AAGATGAAAACATGGAGGTTTCAATTTGGTCCATTCATTAAGGCGGGAATGAGAATATTTGTTGATTAATGAGTTCAATTTTGTTATAAATAAAGGTAAC
TAATTATATCCCATTTACTCCATTACCAAGTGAACACAAAAGACGAGTTCCACAACAAACATTGGTTCTTTGTAAAGGCAACCAATTGTCTATGGAAAAG
GGTCGTATTTGCCCCTCTACTATCAAAAAATAAGCTATATTTACCCTCCGTTATACCTTTTCAACAAATATCCTCCTATAGTCATAATATAGAGCTATGT
TTCTCACCCGTGAAAACTTCACTTTCAGCTTTTAAAAGCCATGTGTTATTCTCTTATTGAACCAAATAATCAGCCTCACTTTTGCCCGCACCCAAATCAC
TCTCATTTCTCTCTATCCGGAAGGTGTACTTGAGCCTGCAAAATCAATAGTTGGTCCAAAGCTCCCTAATCTTTCTTCTCCCCAATTCCATCATCTCATT
CTTATGCAACAAAACCAAGTCTTATTAGTTATAATTTACTTAATAAGTACAAGGTATAATTTAAAAAATTGTTCCTATTTATTAAATGCTTTTTGAGAAT
TGAGTAGTACTAAAAAGAACTACTTTAATGTTAAGGGTGTGGTGATAACAATTGTCAACTTTAATCTTGAATTCCTAAAGCGACAATTATTTTGAGCTAA
AATGATAGCAGAAAATGATGAATAACTATATTTGTTGTGAGGCGGGTGATATCTATGTTGAACTTTGTATTTTTTTGTAAATTAAATAAAAAAGGTTATA
TTAAAAATAGAGAAATTAAATCTCATGTAATGTTCTGTTATATAATTACCATTTGGGCAGGATTTAAAATAGAATATAGTGGATTGCTTTACTTTTAATT
CTGGATTTTGTCCAAAAAGCATGGTAGTTTTAACATTACTAGTTTTTTTCAAAAAGCATGCCATTTTCCCAGAAAGAAAATTAATTTCTGGTAACAATTT
TTTCCATTTTCAATGTTCTATTATAAATCAATTTACATTTTAGAGTGAGGGGTAAATATAGCCTGGTGTTTAATAGTGAACTCTATAAAAATGAGGCTGA
TTTTTCTTTCAATAAGAGCATGCCATGTGACTGTCTAAAGCTGAAAATGAAGTTTTAACGGGTGGGGTAAATATAGCTAGTTTGAACGGGTGAAGGGTAA
ATATAACTAGTTTTAACAGGCAGGGGTAAAATTGTAGGGGTGTATATTCATTGAAAGTGTAGAATATAGGGCAAATATAGCTTATTTTTAATAGTAAAGG
GGCAATTATCCTTTTCTGAATTAACTATTCCATCTGGAGCATCATTTATCATGCAGCTGTAATTAAAATGTTCTCTAGCTGAAACAATATAGCGAGCATT
GAATATTAACAGGAGGTGGAAAGCTAATTCAACACTTTGCTCTTGCATATCAGCAACTGTTATAAGCCAAATAATTTTATATAAGTGGGAAAAAAATCTT
GTATGCAAGCAATGCATAAAAAGCTAAAGAACCTACATTGAATATGCCTTTTCTAGAGTTCATTTTTTTTATCAATTAAAAAAAATAGTTCTCTAGAGAA
GATACAAATCTCCCATACAAACAGGGACCTCATGGGTGCTTGAAAAATTAACGACGAACAATAGACCATTCCTTAAATGTGCATAATCTATCTCCTCAAA
ACCCTTTTTGTTCTTCTCTCCACAGGACCCACATGAAAGCAAAGGGGTAACATTCCGTGCATTATGCTGCCATGAGAATTATGGCATCATTTAATTTAAC
CCAAGCCAATTCAATACCACTCAAAATCTTGTTGATATACACCATTTTTCTCTTTTGTTTTCAATTTTTTGTCACCGTCCTTGCTGCCCATTAAAAATAG
CACATTTCTGGGTACTTTGGGTAAGTGGAGAAAGTCCAACTCGTCCTTCAATATAAGCCTGTGATAGTATCACTTGACTGAGAACACTCCCTCTCTCTTC
ACTCTTTACCTCTATAAGTCCTTGCTAGCATGTGTTGTGTTCTATTAGAGTATATCAAGCAAACTTAAATTCAACAATCTTCCAGTCTTGTAAATTCTTT
CCTGTCCCAGGAGGATAGCCTCGAATGCCATCTCTGCCTATTTGCCCCAGCCTTTTCATTTCCATAATGTACAACATAAGAGATAACAAGTTTCCTTGTT
ACAGATCCCTCAAGCTACCAAAAAATCTGCATGTGTTCGACTTACTAGGATCCAGTACTTGACCATGAGATGTAAACTTGATCCACTTCCTCAACTTATT
CCAAATCCTATATTCGTTATGATAAAATGCAGCAACTTTTAATTCACATGGTTGTAACTTCCAGAGGGCCAATTTGCATAAGATTCCTCTCCCTTCTTTT
CTTGTTGGGTCGGCAACTTTTTTTGCCACCAAAACCATGTCTAGAATCTCTCCTCCTTTCATGAACTCTTTCGGGGAGACGATGTCTTGTCTAACACCTT
TGTAATTTATAAGGTCTTAGTCATTGATATTCACTAATCCCGCTGGAGGCAAAAGCACTAGGTGCCTGGTGGTATCTTCCCTCCACCTATGCTGATGGGA
GGTAGAAGGTACCCCGTGAAATTAGTCGAGGTGCGTGCAGCTGGCCCTGATACCACAATTATAAAAAAGTACTTAATATTCAATTACTCATTGCCTAATC
AGCGAAATCACAATAAAATATGTGTCAAAGGCTTGTCTCAAACTTCCTAATTTCTTGAAATGCAACTGTACTCCATCACCGCCCCTTGATCTGCTCCAGC
ATTGTTGAAAGAAAGTTAACATGAAATTGTCCAAACTAGGGGCCTTGTATACTACAAGTCTCCAGGGAAAAGAGATGCATGCCAAATAATTTTCAGACTC
CTAGAAAGAGAAAGGGATGCACAAGAGAAAGAGTGGGTGTAGAGAAATGGTGGTTTTTGAAACTATTTGTTACATCATAAGCTAAAATCTTGAAGTATGA
TGTTAAGCACAGATTCTAATTTCCTCGAAGGATCATTAAGCCAAACAGTGTAAGAAGTGCAAGCAGTCGGGAAAATATTCCTCGTATAATATCTCCAAAC
AGTGTTAGGAGTGGAAGCTTAAATGTATTGCCAATTAGAAACACCCTGAAATGATGCTAAAAGAAGAAAGCTTATAGTATGTGTGACACTATTTATGGTA
TTCCATTTGCAGCACGGAAGGAAAACTGATCTTAGAAGATGGAGTCTCTGAAGTTGCTAAGAGCTTGTTAGCAGCCTACGACAGTGGTGAGCTCTGTGGT
GCACTTGCAGAAGGCCAACCTGGATGGAGAAACTGGGTGAAGAAGTTCGGTAAATTGCTGAAGCGCAAGGTTCGATCTGAGTATTTTCTTTTTCGCTGAA
AGTTTTTTTTTCAGTATTTATTGAGGTTGCTTTATGTACCAGGGAAAATCTCTCTTCATGCCCCTTCGGGTGTTGCTAACAGGAAAGCTTCATGGACCTG
ATATTGGGGCCACCACAGTATTACTCTATAAAGCTGGAACATCTGGTTCTGTAGCACCCCAAGCTGGGTTTGTTACATTTGATGAAAGATTTAAGATATT
GAGAGAAGTTCAATGGGAGTCGTTCAGCTCAAATGTGCCTTTGTCTGCTGGTGTTGTAACGCATTGAGATTGTGGCGATATTCTGTTTTGATTATCCATT
ATATGACTTCTATCTCCACCATTCCCAGTAGAAACAAAGAGAAGCTGCGAGCACAAGGGGGGTTTTCTTGTGTTTGCATCTCGTCTGGAATCAAAGAGGG
CTACCATCTCTAGCGGGATTCCTTTTCTGTATCTTCCCCCTCCCCCTCCCCCTCCCCCTCCCCCTCCCCCTCCACGGGGTAAGGCTGTGCTGATTGTGAC
ACTACGTTTATTTTTCACCGAACAATGGTAGAATAGTTAAAAAGGGGATTGCAGCTCCAACCCGGGTTTCATTGCATAAACAATGGACTAACAAAGATAT
ACCTAAACTTTTACTTTTTAGTTTGAGTCGTGTGTAATACACCCTTTTATTTGAAAAAAAAATATTGACACAATATGACATTCTACATAGAAAAATATTT
CACCTTGATAAAATTAAATAATAAATTATTAACATTAGTTAAGAATTAAAGATTAATGTATAACTATTAATAAAATTTAAATTATTTTTCATACCCCCAC
TCAACTACCTCTTCCACGTAATCCTCCACCCCAAAAAAAGATGTTATTTTATTTTTTCAAAATAAATTTTTTATCCAGTCCCATTTAGCCGTCGCTCCAA
TTTTTATTTCCCTCCTTTTTCTTATTGTTAGATATATACGTACATATATTTTTTAGAATAATTTTTTTTTAATAGTTCACTGAATATAACATAAATAAAT
AAATAAATAAAATTAAAAAAAGTCTTGTGGCAATAAGGAAATTTTTTTTTATTGGTATGTATATATCCGGGCCCAAAAAGAGAAAAAAAATTAGAGGAGG
AGGGTTAAATGAGGTGAGTAGAATTATATTATTTTAATAAAATAAAATCTAAATTAGTATTTCAATAGGGGGTGGAGGTGGAGTGAAATAAAAAAAAATT
AAAATTCTTTTATAACAAAAATTTAAACAAAAAAAAAAAACTTTAAAATGGCTGGGGTGGGCGGAAGTGAAGGAGTGGGGTAAACACAATATTTTATAAA
AGAAATATTATTTTTTTGAATAATAATTTTTAGTTTTTAATTTAATTAATATTAATAATTTATTTAATTTTTGTCAAGATTAAATATTTTGTTTATGTGA
AGTGTGCTGTGATAATTTTTTAAAATAAAAGAGAGTGTATTATACATATCATGATGAGAGTGATATAAAAGAGAAATATGTATATCAAATTAAAAAATAA
TAATTTAGATATGAGACTCAATAATTTATATTATATATGAAACTAAAAAATTTGATATGTGTTTTTGAAACTTATTTCTATTCAATGAGAGAGAGATAGA
TTAATGGAAAACCTGGGATTTGAGTATTTTACTTTGAAAAATAGAAGTCATCCACAAAAGAAAATATTAATTAAAAGATTTGAAATGAATGTGGGATTTT
AAAAAAAAGTTGAAGTTGTGATGCAGCAATATTGTAAATAAATAAAATAAATAAATAATGGTGTTTGATTTATTCTTTGTTTCACAAAGTTATTGAGACA
TGAAATAATGATGGTGGCATTGTCGACGACTAGTTGCAGTCCTAATTCGTGGTTGAATTCCATATCCTGTCGCTGTAACAACGATAAAGCTCCATTCTGG
CAGTCTGGCCCTCGATTTGGTCGTCATCAATCACGAATACGTTTTTCAAGTTGCTGGCGTTGGGCTCGACCGTCTCTTCCTCCCGGACACGGACGCTCCT
CTGCTGAAAAGTGCGACGATAGTGATAGTGGTATCCAGATGAATGCACAAGGCAACACGGCAATAATCTCCGCTTGCTTTGTTGGCCTCTTCACCGGTAT
CAGTGTCGTGCTTTTCAACGCCGCGGTGCGTCATAGGTTTTCTATTTTTTTTTTTTCGTCTTATCCTCCGAATATTCATATAATAACTGACATCTCCTTT
GGTTAGGTTCATGAAATACGCGATTTATGTTGGGATGGGATTCCGTCTCGAGGTGCCTCGTGGTTAAGGGAGGAGCCTATTGGAGTAATTTGGCAACGTG
TAATCTTAGTACCAGCTTCTGGGGGTTTGCTAGTCAGTTTTTTGAACACTTTCCGAGCCACACTGGACGTCTCAACGCAAGGAAATTGGACATCATCTGT
TAAATCTGTCTTGAGACCAGTTTTGAAGACAATTGCTGCTTGTATCACTTTAGGAACTGGAAATTCCTTAGGACCAGAAGGCCCAAGTGTTGAAATTGGT
ACTTCAGTTGCCAAGGGAATTGGAGCTTTACTCGATAAAGGTGCTCATAGAAAGCTATCTCTCAAGGCTGCTGGATCAGCTGCTGGAATATCATCTGGTT
TGTTCCCACATTATTCTTGGTTCTGATTTAAATATGGTACATTTTTCTTATACTTACGTGTAGCCTGTAAATACGAACATGTTTGCATCTCGCAAACCAA
ATAAACTGTACAAAGGATGAACCCCCTGAGCAAGCAGAAGCACTACAAAACCAACTATAAGTCAGCTTGCTTCTCGATTTCGAGGGGAGATGCAATATCG
GCTATAATTTTTTTTAATAACAAAGGAAACCCGCAGCCGCTACCCTTTGGGTGCACACTGGGTAAAACCCGATTCCTATGCAATAATTAGAACATCAATT
TCCAGTGCCTACATTCTGCTTAGTACTATGATATATTTCTGAAGGTTTGTTTAACCAGTTCCTTGCTCTATATGTTCAAACTGTTGGCTGTCAATAAGGT
TGAGCCAGACAACTTCTTGGTTCCTGCAAGCTAATACTTTTTCCAGGCTTATTATATAGTAAAAGTAAAACTTTCCCCCCAAATCATTGACCTTGAGCTG
GAAATGAAAATGAACTCAAAGTGTCATATTAGGCAACTGTCAATGCAAAATACTCAAACTGAAGTTTAGGTAAGGAAAGTGAATGTACATTGATTGATGT
ATTCTTCCTTAGGACCTAAACTTACCATTGAACTTTTCACATTGTATCAAAAGTTCAGCAAACAGAAAAAACTGACATGTCCTAAAATGTTATTTCATGT
CTATATGCACAAGGTTCAATCTTACCATACGTGTGCTATTTGGTCTTTGTCTTTTAAATTCATCAGATATAATCAATCATGTTATAGGTTCTTATAATGT
ATATGATTATCTTTATCTCTACTGATAAATGACATTTACCCCAACCACATACTGTAGTTATGTTGCTTGAGGTCTCTTTCAGTTATGTATAGTAGAGTAT
TGAGATTGGATGATTTAATAGATGACTTTTGTCTCCCTTCAAGTTGAATTAACAAAAGCAATGCTTCTTGCTAGCTGTTGATAGCTACACAAGGAAAACT
CCAATTTACTTTTATGTATAGCAATCTTAAGCTCGAGTAGCAAGTTGGAATGGAATTACATTTAAAAAAATTGGAATTATTTGGTTTGAGCCTTCTACTT
GTTTTCCCCAATATTCTCAGTATCTAATTGAACGTGCGTAAAATAATTCTTGGGGAGCCTCAATACAAGGCATGTGCAATATAAAACAACAACAAAACCA
TTAAACCCAATGTGATCCCACAAGTGGGCTCTGGTATGGTGGGGTGTATGTAGACCTTACCCTATCTTTGTGGGTCGCTTTTTTCCGATAGATCCTCGAC
TCATGAAAAATATTTTAAAGAGTAGTTTCGAAAAGTACAAGAATGAAGAAGCTATGATGAAAATATTGAAGATAAGAAAAATATAGACAACAGAGATAGT
AAAGATAATCGAAGTAAGAAACAACATTGGCACTACAATTAACGAATAAGTTAATGATGGAATAACAATAACAATACCAGTAAGGAGAAGAGAGAGCAAA
TAAGGTGCTTTAAACTAGGACTATGCCCCCCTCCCCAACCAAAAAGAGAAAAATCGCTCTACTGTCCTCTAACCTTCTATCCTAATCCTCAATTTTCATG
CTCTCATATTTAGGGTCATGTATTCGGTGAGTTGAATGTATGTCTTGTCTAATCATCTTTCTCCAATTCTTCCTCGGTCTACCTCTACCTTTACCTCTCA
TTAGCCTGCCACTTACAACTTTTTTGCACCTCCTCACATGGGCATTTGCGCTCCTCTCCATATGCTTGAATCATCTCATCTTTAGTTTCACCTCCCCCAT
CTTGTACACCGCGGAGGCTAGTCACGCCTTGCCTTGTATATTCTTGTTTTTAATCTTGTCTTTCCTAGTATGCATGCACATGTCTTAGCAACCTCATTTT
TGCTAGTTTCTTCTCCAGGACGTGTGAGTTCTCGATTGGTTCACAAGTGTACCTTGTACAACATAGTTGTTTTTACCACCATTCTATAAAATTTATCTTG
AATGTTCTTATCACAAAGGACACTAAATATGAGTCTCCATTTCATCTATCCCGCTCCGATATACTGTGTAACATCATCACAAATCTCCCCATTCCTTTGG
ATTATTTTTTCTTGAAACTAGTAACTTTCCCATCCCTTTGGATTATTGATCCAAGATACTTGAAATTCCTTATCTTAGGGAGAACTTGTGTATCAATCAT
CATTTCCACATCAGATTTCTGTGATGCATCATTGAACTTGCACTCTGTATTTGTCTTGCTCAATTCGAAACCTTTAGACTCTCTAGAGTGTATCTCCGAA
TCTTCGGTCTATTGTTAACTCTTTCGCTCGTCAAACAATATCATGTCATTTGGAAATAACACACACCATGGTACCGCTCCTTAAATATGCCATGTCAAAT
CATCCATCACCTATGCTATAAACGGCTAAAAGTTGATCCCTAATGCAACCCATCTTAACTATGAAGTGTTTGAAGTCTCCTCCCATTGTTCTCACTTAGG
TCTTGGCTCCATTGTACATGTCCTTTACTTCGCTAACGTATGCCACATGTATCCTCTAGACCCCAAGCATCTCCATAAAACCTCCCTTAAGACTTTGACG
TATGCCTTTTCTAAGTCGATTAACATCGTATTCAAGTCTCTTTTCCTATCCCTCAATTGTTTCAACCATCTCCTTAAAAGAAAAATGATTCCGTAGTCGA
TGGCCTTAACATGAATCTGAATTGATTCTTAGATATAGACACATCCCTCCTTATCCTTATTTCTACCATCTCTCCCTAACTTCAGTAATGTGGCGTAGTA
GTTTGAATTTTTTTTATTGTATAACAAGATCTTTACACTCCACCTCCATGCTTCAAGCATTTTAATCGTACCAAAAGTGGCATTAAACAACCCAGTTAGC
TATCATATACCTACTTTGGTTGTACTCTTCAAAATTCCATCGAAATCTCATTTAGTTATGTCGCTTTCTCATGTCATCTTACTATTTGGTCTCTTAACCC
CCCCAAACTTTATAACCTACAATATCCAAAATCTCGAAGGCTTTCGGAATGCTCTAAAGAACCCAACACAACATTCATGTCTCCTCTTTATTTAAGAGTT
TATGGAAGTTTGCCAGTCATTTTCATTTTATGTGTTTTTCTTCTACCAATACTTTGCCATCCTTGTCTTTTAATGCATCTTAATTGGTCTAGGTCGCTAG
TCCTCCTTTCTCGTGCCTTCTTTTCCCCACCTCTGTTCTCTAGTTCTTCATACAAGGGTTCTAATGTTGTCATTTTAGCCGCCGCGACCACTGTCCTTAC
TTCGTTCTTCATAGCCTTATACGTCTCCCTATTTGGCTTCTTCTTTTTCTCATTTTTTCTCTGTGGTAACTAGTAACTTCATGGAAGCAACCTTTTTTGT
CTAAAGCTTTCCTTTGGACCTCTCTATTCCACCACCAGTCCTCCCTATGTCCACCAATATTACCCTTCGAGAGCCCTAACACCTCTTTAGCTGCTTCCCT
AATACACTTAGTTGTCCTAATCCACATATGTTTTGTCCCCGTTACTCTCTTAGGCCCCGATACGGAGTGGTGGACCTAGAATTTTCAAAAAGTGGGTTCA
AGATATAACATAAAACGAGAATGTAGCTGCAGGGATTCAAACTCGGGTTGGCTGGGAAAATTAAACCCTCTTGACCACTCGGCCAAGGGTCACACTTGTG
TTAAGTGGGGTCAGAATTTAATAAATACATATATATTTTTTTAAAACTGATTAAATATGCATATATATACGATGCTATTTTTCAACGAAGTGGGTTCATA
TATATATATGAACCCATTTGACCCACTGTAGGTCTGCCCCTGCCGATTCCCATCAACTTCTTCCCCAACTCCTGAATTTAATTATAAGTCAAGCCCCCAG
CTTAATCCTTGGTTGGTCAGACAACCCTCTTTTCCCTCTTTTAATCACTAGATCCATTACTGAGAGCTTGTGTTGTGTTGGGTTGTAAGGTTCTCACTTG
GGATAGCCTTATAATCCTTGCTTAACCTTTATCACTCTTCGTAAGGAGTAGGTAATTGATTGGAGTCTTTGCCACCGAATTACAAAAGTGACCAAGTGCT
CCTCATTCTGAAATCGCGAGTTAGCTATCACCAAATCAAAGACTCTTGCAATATAGAAAATGCATCTCCTCATTCATTTGACAACTGAGTAAAAAAAAAC
TAGGCATTTGCAGTCTGGAAGTCCATGAAGGGGCACATACTCTATAGAGATAGTCTTGTCATTATTTTCAGGGTTGGACTAGTGTTTAGAGGATTTCCCA
GATTTTATTATTTCCAAAATTCTGCCAGGTCCTTTTTTTGTTGAAGTACTTGAAGTTAAATAAAATCAAACTTTAATTTGTTAAATATCTTCGGGAAGCC
ATTTACAAAATGTAAGTCTATGTTTGAATTATGGACTGTCACTTCATATGCAACTGCTTTTGGGTTCAGATGTTGCTGAAACTGACATAGATGGGCTTTG
TATGGTTCCTGCAATTTAATTGCTAACATGGATCAGTTTGTATGGTTTATGTGGAATGGTAAATAGAGTCGAAGAGACAAGAAGGGGCTAGAAAGAATAG
ATGGTTCATATGTAAGTTGACTACTCTATTTGCTACGGGATATGATGTTCGTATTCCACTTCTTTGTAGTTTCCCCTTATTGTACAGGGTTCAAAGCATC
AAGGGAAATTCACTTACTTTTGACTGAATAATGCTAGTTTCAGTAGTACCGTTTATTATATGAACCATTTAATTTCATTGACTAGATAGAATAGACTGCT
CATCGACTAGTTGCTATGTAATGATAACTCCACCATCTTTGATAAGTCACCTAATGAACTTGTTCCTCAATTTATAGAACACTTTTTGAATATTTCTACG
GTATGCTCCATGCCTTCATGGTTATATCACTTCTACTTTGCACTGTGAGAACTTGAACTTGGTGAGCGGGGATTCCGTATGAATGAGATCTTGATGGAAG
ACGACCATTTCTGTCACTGTATTAGATAATGCTTCTTGTATTGCCATTAAGATATTATCCTTTAATAAACATTTGCCATTTTTCTGGAACAATACAGGGA
TGTATCTAGCTGGTGATTTCACATCAATAGTCCAAATTAAATGAAATGGTTTGCAATTGTTGATTCCTAAAGGATGATTTGTGGAATATGATCTCAAACG
ATTTGTTACAAGGAAGATAAATACCAAATGTCTTCTGTGTTTAATGGAAGACAAAAAATCCTTTAACAGGCAATGATTTTATGAACTTAATTCAGAATAT
TTGTGGCCATTGCTGAGAAAGATAAAAAAGAATGGAAATTGATTGAGTTTAGTATCAAAAAAAAAAAAGGAACAGAATGTCATCCAATGCAGTTTCATCT
TAGGAAACTTTGCAGGGAAAGAGCAAGAGTGATAATAATTGTGAACTATTTCGTTTTTCTGTATCAGTTATTGTGACCTATTTCTTTGTCATTCTTCATT
GCTAACAAGCTAATGTAGCTCCTCTTCTATAGTTGTTTTGATTTGTCGGTGGATGTTCAATGAACATTTTCTTCTTTCTATCTGCTGTCAGCATCTTCTG
CCTTGTAGGAGTTCATTTTCTGGAAATATTTTACTTCTTGTTTTGCTAATAATTTCCTGTAATTTTCTCTTCATGATTAATCTGTTTGTCACTTTGAAAC
TCTTCTTGTTTTCTACTTAAAGGATTTAATGCTGCTGTTGCGGGTTGTTTCTTTGCTGTGGAATCTGTGTTATGGCCATCACCTGCAGAGTCTTTGTCCT
TGACAAATACAACTTCAATGGTTATTTTGAGTGCTGTTATAGCTTCTGTTGTCTCAGAAATTGGTCTTGGCTCAGAACCTGCATTTGCAGTCCCGGCATA
TGATTTTCGTACACCTACGGGTAATTTTGAACTTGTTCCCTCAAGTTTGCATCTTAAATATATTTGAATAACTTACAGCAACATCAACCAGTGTTGGTAA
AAGTCATATTCGCTGCATAAGGGAGATGCAAAGAGTGGGGTGATCACTTCATAAGTGAAACCATGTGCTTCAAAGAAATCTGTGCTTCAAACAATGACGC
ACACACACTGATCCAAACAAGAAGCGGTCGAAATTTTTTAAATGTAAACTTTGAGGACTTGGACTCATGTCTGCATTATTGTATATTATATGCTGGAATT
AGTTTTCCCAATTGCAATTTGATTCCTATAGTTCAAAATTCATATATGTTTGACATCTATGTGTTCACTTCGAAGAAGTATGTGCTTACTTCTTGTTTTA
TGCCTCACGGACCTTGTCATTTTTTGCGCCTTATTTTCTCTTAAAAACACTGACAACAAATGCATCTCAATAACAATCTAGTTATGATTGGCTATACAAA
TCATCACTATTCATTTTACTCCATTTAGTGGTAGCCCTATTTAATTCGAATATTAATACTTGGTAGTATGCCGAGGTTCTCTGCATTTTCTACTTAGATA
TAAAGAACATACATAGTGTAATTCTACATTTGGTGTTTGGGAAGAGTGGTGTTTATGTAGCCTTACTCCTACCTTGTGAAGGTAGAGAAGTTATTTTCAA
TGGACATACGAATCTTTAAATAGACTAAAGCATAATGTAAATGTACCTTCATGAGTAAACCTTTGTCCAGATAGTCAGGTTTGTTTGTAAGGAGCTTTAC
CTTTTAGTTTTCTATTTTTCCGTTAAGTTCTATTGATTCCAAGAATCTACAGGATAAATTCATTTAACGCCTTAATGCAATTTGACCTTTATACATACCT
ATAACTTCCATTGCTTTCTGAATGCAATTTTACTTTTCTATAAAAGTAGAATCATGCAATGCTTCAAGAACTGCATTTCCATAAGTTTGGTAGCCTGAGA
TGAATGGCTATGGTACATCTATTTAATAGAATACACGCCCTCTTATTGCTATCATTTTTATCCTATTATTTCAAGAAAATATTAAAGGAAATGATGGAAA
TTGGAAAAAATAAAGAATAGTTTCCTTAGAGTCCAAAAAGGAGGGGATTGCACTACTATCTTGGAATTCAACAATAGTATCCATCAAATTAGTTTTGACT
GTGGAGAAATGGAGAAAAGAATCAATTATTGCATCTCTTCGGTGAGATACTCAATTTTGGTGAATAGAAATCCATGTGGTTTCTTTGGTTGTTTGAGGGG
ATCGAGGCAGGGAGATCCTTTATCACCTATGCTCTTTATTTTGGTGACAGAGGCTTTGAGCAGAATAATGGATAAAATTGGTTTAGGCAGACATATCTAG
GGTTTCAAGGCCACAGTTGGTGGTGACAATTCTGTATTGGATGCACATTTTTTATTTACAAAAGATACTTTGGTGTTATGTGATGCAGATGGGATCTAGT
TGAACTACATTGGACAAGTTTTGACTTGATTCTAGGTGGTATTAGGACTAAAAATCAACCTCAGAATAGTGTGAGATCGTATTGATTTGGGGAAATTGGT
AACATTGATTTGTTGGCTCAAGTGTTGCATTGTTGGTGAAGATACCTATTACCTATCTTGGGCTTCCTCAGGCGCATCAAGTCACAACGTCTGAAATCTG
GTCATCCAGATGGTAGAGAAATGGCTGGCAGACTGACAAAAAAGGTACTTGTCCAAAAGAGGGGGAAGGAAATGCTGATGAATTACACTTTGTTCAGTAT
CCCCTACTTATTTATGTCCTTGTTAAATGCTCTTACCAGTGTGATAGGTAAGATAGAAGGTTGGAAAGAATTTCCTTTGGGGTGCGATGGCTAGGGAAAA
GATGTGTCAGTTTTCACTTAGTGCAGTGGGAGATTGTGACGTATCCTAAACGGTGGGGACGACTTGAAGGTCTTCCACTAAGCAATTTCGGGCAAATGGT
TATGGAGATTCATGGTCTTGGAGAAGCATTATGAAGAGGGGTAGTAGCGGGTAAATATGGTGTTATGGAAGGGGGATGTAGAACATACGTGATTAGTATG
TGTTTCCTCTATGGCCACCCAACCTTCACATAAGTTTCCAATTTCTTGAAATACTCTCTTTGACCAGAGATGGGGGGGATTCTGTAATATCTCGCAAATT
GAAATAACTAGTAAGGAGTTAATAATTGGAAATAGTCGTTTTTGGAAAGAGTGAAAATTTGGAAATTTTGTTAAGTTAGAATAAGTTGAGTTTTTGGTCA
ACTTTAAACGACCATAACTCCTAGCTTAGGATGAGTTAGGCGTGTTTCCAGATATTGTAGGAAAGATCTTGGAATAATCTTTCCAACGTTTTCGAGTTTG
CGTGATTTCTGAGTTTGTATGAGTGAGTTATGCCTATTGAAAGTTGGGTTGTTCAAATAAGGAGAGTCTAATTTGGATTTTGGAAGGGTATTATGATCTT
TTCCATACCCTATTATTTTGTTTTGATTTTTTTGGAGTTAATTAGAGTCAAATCAGAATTAGATCAATTTAGTCAATTGGAAATTTCACTCTAGGGCTTG
GAGAAAAGAGAAAAAGGAGAAAGGAGAAGAAAAGCTCAAGATTCGCCAAGATTGTGTGATTGGATTGTGGATTTCGCCAAGGAATTAATCCTACAAGGTA
TGTGGGACTTTCATAGCATTGGGTTCGTTCACCCACGCGCTAAACTGTTTAGTTTAGGGAAATTCATTCTAAAAAGGTTGAAGGTTTGACGTTCTTGACA
TGTATTCTTGAATTTGATGTCATTCTTTAATTGGGCTGAATTGAGAATTTTCAGAGATCTTTATGTCGAGTTTTAGAGTTGTTTTGAGTTAGGCTCTTGG
GTACGTTGGCTGGGCATCATGTTTAGGCGAATTGGGACTGAAAACGAAGAAGGAAAAAGTCAGGTGAATTTGGGCAGTGGGGCCGCGTCGCGGACCTGCT
TCTCAGATTTGAGAAAAAGTTATTTGCGAAGCGGAGCGGTCACAGACCGTTCGACCTCAAAAGTTTTCAAAAGTCTTTCACAAATGGTTTTAGCTTTGTT
TTGAGACTTAAGTTTGAGTTCACTAAAGAGTAAGTGTAAGAATTCATTTCTTCAAAATGGGTTCTTCAAAGTTATAAGGGAACTAAGTATTCCCAAAGAG
TTATAATGTTTTCATCATTTGAGCAAGAAAGGGAAACACCGATTTCGAAGAGAGCTTTTAAGCTAAGTTTTGAGTAATTATCTCAAACCAAAGAAAGAGT
AAAGAGTTTTGTTTTAAAAATGTATGAGCTAAGTACATTTTGGGAGTAGCATTGAGCTGCGATATAGGGATGCAAGTTCAGATAACTCAAGTCTCCATAA
ATCATGTAGCCATCATGGGTAGTATATTACTTTATTATACTATTATATAGGTAAAGTTGAGTTTGTTATTGCATTTTTTTAACGAACTAAGTTAGTTGTG
TCCACTATTTTTACAAGCTTTCTATATATTGCATATGTTTTATTGTTTTATATTGAGTTAAGTTATTTAGGATTTGAGTAAAGCTAAGGTAAGTGTTCCT
TTCAGATTTTTTTCAAGCATATGTTATGTTTAGCATTTCAACTCGCATACTCGTACATTTAATGTACTGATTGATATCAGTTGGCCTGCATCGTCTTATG
ATGCATACATAGGTAACTTGAATCAGCACCTAGCGCCTCGTTGATCTAGTTGAGCACTCTGTCAGTTGTGAGCCTCCTTGTATTCCGGAGGGCCCCTTTT
ATTTTGCTTTCAGTATTTCATTGATCGGGGGTCGTGTCCCTACATTCCTCTTTATTTTAAAGGCTCGCGTTTAGTAGTTTAGTTGTCTTTACAATTGGGC
CAAGTTGAATGTCGACTTTTAAACATTCTAAGATATTTTATTAAGCAGCTGAGTAAAGTGCATTTGGTCATTGTAATAATGCTTAGAGTCCTCTGCTGAT
TAAGTAAGCCAGACCAAGGGTTCGCTTGGGGCCAACAATGGTTCTCGAGTGCCTGCCACGTCCAAGGTGTAGGCTCGAGGGGTGACATAGTCCAACAGTT
CTAATCCATGTGTCCTTGTTCAGAGTATTATTGGGGAGACAACCCACCATTGAATTCCACCATTCTAGATTGAATCCGTGATTCTTCCAGTTCCACTGCC
CTTGGAGGGTCTGTTCTGCCATGTTTATGTTAGGAACTCGAACAGAAACGTACCTCCATGCATTTCATTGATGTTAACTCCAAATGCCTTTTTCCGAAGT
GTTGACGACCATCTTCATATCTCAAGCAAAGTTGGCTTTTCCTTCATCTGTCCTTCCAAATGACCTACTAGGCATCTCTCTGGAAGCCCATTCTCTTGGT
CTTCAACCTGTGTGTGAGGACTTAAATAATGCTAACATTGTTCGTAATCTCTGCCTCCTTTATAGTTTCTGATTGCCATTTACTATCCTTAACTGCTTTT
GCATAAGGGTAGTTGGCTTTGGTTATTCTAGGAGGTCCTGGCACTTCCATTCTTTCAGAGCATTTGATGAACCTTTCAATTTTAAATGCTATATCATGCC
ATCCCGCATTCAACGCTAATTCTGGGATGACCAGTATGGACCTACCCCCATTATTGATGGAAATGATACTTATATCTTCCATGTTCATTATGTTTCCTAG
TACACAAATGCTCCAGCTATCTTTCTGCAGTTTTCTATCTTCTGATCGCTGGAAGCTTCTCTAAGAGTGAAGCAGATCCATTCCATGGTTTTGCGGCTCA
TGGAAGATCTCCTCATCATCATTGATCTTTCTACTCCTCTCAACCCATTCGAAGCACACAGAGCTGCCAGTGCTCCATTTAGTGATGTAGAAAGACTTAA
AACCCACATTGAAATAAATCCTATTGTCAGCCATTGCAAAGTCTGAAAGAAGGATCTGAATCTCGAAAAACTTTTGTCACGTATAGGTAATAGTTAAGAA
AGGTAAGGAAAGGGAAGGAATGGAAATAAAGGTTCGGCGCAAGAGTGCCGGAAAGAGAGACCCTCCCCCAGGAAGTAGGGAAGAGAGTTACCTCGGGACA
GGTGCCTGGGAGCATTTGTTATTACGTTCCTTAATTTATCATATAGGTAGAACTCGTTAATAAATGTTACATATTTGCATTTTTGGCTCTTTGATATGAA
TGTTGTATATATTCGAGAATTTGTGGACTAAAAATGACCTAAAAGAAGATAGAAATGAAAACATGCTTTTTTTTTCCCTCTCACGTGAAAATCTTGATAA
CCCTTGTGATAGAATTTGTCTATCCAATCTAATACTTTTAAGGCAATGGGTGGATTAGCCATGTCCATTTGAACTCCACTGGAGACCTTACACAACTGAT
GACGAAAGTCCAGCATTATCCAACACCCTTCGACTCATGTTACCCAGTTCTAGGGTTTACAGGTGGATTTGATTTATCTTTTTTTTTTTTGTGTCGTTTT
GTTTAAAGTAGAGAAAGAGGAGGCTCAACAAAATTGGGTCTGATGTAAAGGGAGATAGATTAGGCTCAATAGGCTACTGATTGAACTTATATGCTACAAC
AATGTTAGTGGCTCAATAGGCTTGATTGAGAGAGAGACAAGCCTAGAGTAGTTCCACAAGTTTATTTGATAAAGAGAAGCCTAGAGCGATAAAACGTGAG
GAGAGAAAGTAGTTGCACTAACGATTTAACCAAAGGTTGGCTCTGGTACCATGTAAACCAATTTAAGTATCTAACCCAAAACCTTAAAGCAAAGGATGGA
GTAGCCCAAGACCATTTAAACTACTTTGGAAACCCTTACAAACCAATACGGTAACTTTCTATAACAAGCCTATCTTCTTATAAGTCGGTGCTTATAACTT
GACTATGGCTTGTTCCACTAATTTAGCTTAAATCAAAGTGAAATGATCTATGAAGAAATCCATAGGAAGCCTCTGCTGAAGTAAATAACTGACAATATAT
AAGGAACATTAATTCTCCCAAATATCTGGAATGTTCCCGAAACACAATAAATTAGTCTCAGGACTTATCATTAACATGTTTCTGTCTTATTTTGGGTGAT
ATGGAAGGTTAATCAAGGTATAATTTTTTTCAAGTGGTTAAAACTTCAGCTGAACATATAACTCTTTCTAAGTACTTATTCAGAATTATTTATCTAATGA
AGTATCAGATCACTGGTGAACAAAACAGGAAAATATATTTTTTACAGCATAACCATACCTTACTAGAGGGAGACGAGCATTTTTTTCCTTTTATTATTGT
CCCTGGGGGTCTGCAGGCTTCTTCCCTGTGATATCACCTTAGACTCACATTTCTGTCATTGGTATTACTTACTGTGGTAAGTTCAAATGTGTTTTGAACT
CTTTTTTGGCACGTACAATTGTGTTAATTGTTCGTCTCCGTTTCAGAATTGCCGCTTTATCTTCTGCTGGGTATCTTTTGCGGGTTAGTTTCAGTGGCAC
TATCAAGCTGTACATCATTTATGCTGCAAATAGTGGAAGATATCCAAACAGCCATCGGCGCGCCAAAATCAGCTTTCCCTGTGCTGGGTGGTCTTCTGGT
TGGGCTGGTAGCTTTAGCATATCCTGAAGTCCTTTACTGGGGTTTTGAGAATGTTGATATTTTGCTAGAATCTCGGCCGCTAGTGAAAGGCCTCTCTGCT
GATCTGTTGCTCCAGCTTGTAGCTGTCAAAATAGTAACAACCTCATTATGCCGAGCCTCTGGATTGGTTGGAGGCTACTATGCTCCATCTCTATTTATTG
GTGCTGCTACTGGAACTGCATATGGGAAAATTGTTAGCTACATTATCTCTCATGCTGATCCAATCTTTCATCTCTCCATCTTGGAAGTTGCATCCCCACA
AGCATATGGTCTGGTATGAATTTGCCTTTATTTCGAAGTAGTACTACATGTCTGGATAAGTGAGTGTTTATTATTGAAAAGTAATTAGAGAAGTGCAAGG
GAATCTAGCACGCAATTCTACTTATTTCCCTCGTCCATCTTTTCTTCTGAAATTCGAGGTCACTTTTCTCTACCTTGCATCACCATCTCAAACATATTTC
ATACCTCTCAGAGTTATTGGAGATGTCCTGAATTTACCTTGCCGGAAGTTTATATTTCACCGATCACCCCCCACCTCGCGCGCCTGCATTCCTTACCATT
ACATCCACAATTACACCCCCATTTTTTCATACCCACCTAGAAGATGGCAGTTTAACTCAGGTGTTTCATTCCCCTTACATTCCATGATATGATCTTGCTA
TAGATTCATGATTCAAGAGGATGCTTTAACTGTAGATGACCATGTGAGCCTTTTGATATGACTTAATCCAAAGTTAATGTTCAAAAATTATTTGAACGAC
AACATTGCATAAAATTCCTAGAAAACATCCATTTGAAAATGGGTTCATCTCCAATCAAGAAAGCATCTAAAATCTATCGCCCTTGAATTAATACATCAAA
TCTGAATTAGAGCACCCCGGGGAAAAAAAATTCTAATGTTACCAACTAGAGTAATTAATTTGAACTGCCTTCTTATCAGAATAATGTGTGAAGAGTTTAA
GTTCTACCAAAGGTGGCAGCAGGGGTGTAAAATTACATTGTATATATAGGTCGAAATTTGGTTTAATAAATATATATACAAGTGTTGGCACCTTTTGATA
CATGTTGAAGGTTTAGTGTAGTGGTTAAGGGGTTGCAAATATTGCTTGAGGTTGTGTATTCTGTCCCTGATAGCAGCCGCTTGTACATTTTACTTTATAT
TTCAAAAATCCTTGATAAAAATTCTGGCTCCACCACTGGGTGGCAGAACCTCAAGTCACTTCACCATGATATCTCTTTCAAATAGTACTCTAGCATCCAT
AGAAGAATTCCGCCGTAAAGCCATCTGAACCCAGTGGTTTATCATTTATTTCCACAAGATTTAAGTACATAGGAACTAGATGGTTTAAAGTTGTTGTGGA
TTGAGGTTATGTTATCTTTCTCCTCTCTTGGGTTAATCAAACTAGGAAATTCTGGACTCTATCACTTATAAATACACATGAGTAATCTTTGTCAATAAAT
AAATAAATATGAGTAATAATAGCTAGGAATCATCTGTATAGGACAGCCGTAGAGGTCAGCTTGTTTAGAAAAGTTTTAGTATGCGTTTGAGGTGAGCTTA
ATATGATATGCTACCTACATGGGCATGCTCAACACCCATCAACGTTCTTATGTAATGTTATTCTTTTTCATGTTCTGGTTGGATGATCATTTACATACTC
ATGCCAATCTTATCCTACTATTACACCTCAGATTTTTCAGTTTATGATGGAAATTTTGAGTAAATGAGCAAGGGTGGAGCTAAGTTGGGGCAAGGATGGT
CAATCGACTACCCTTTGTTAGGAAATTACATTCTATATATAGGTCAAATATTGCGTTTTGAACACCCTTGACTCAACAAAGAGATGTAGGTTAGCGGACA
ATGTTGTTTAGAAAATCGTAAGATGCCAGGTTCGATTCCCCATAGTTGCATTTTGTTATATAATTTTGTGCTCCCTACTTTTTCTTTATAACTGGCCTAA
GCCTAACTATTTTTCTAAAACAAATAGGGAAAAAAAGGCCATGTTTTAATTATTTTTTAAATAAAGCGTCATGTTAAATTAAACATTGTTATAAAGAGTC
ATGTCATGTAATTATTTTTTAAATAAAGAGTCATGTTATCGAAGATGACATCACACATCGTATTGGTGTGGCGTGTATGAAGTGGAGGCTAGCATCTAGA
GTCTTGTGTGATAAAAAGGTACCATCGAAGCTCAGGAGAGTTTTATAGAGTGATGATTAGACCAACTTCGTTGTATGGCGCGAAGTGTTGGCCAATCAAA
AACTCCTATATCCAGAAGATACATGTTCTGGAGATCGGGATATTAAGGTGGATGTGTGCCCAAACTAAAAGCAAGAAGATTAAGAATGAGTATATTCAGG
ATAAGGTGGGAGTGACCTCGATGATGGATAAGTTGAGGGAATCGTAACTGAGATGGTTTGGACATGGTAAGAGGAGATGCATAGACGTACCAGTGAGGAG
GTGTGAGAGTTGGTTTAGAGGGTACGAGGAGGGGGACAGCTAGGTCGAAGAAGTATTGGCGAGAGGTGGTAATACAAGATATGATGCAGCTTCAGGTTAC
CGAGGACGTGACCTTAGATAGGAAGGAGTGTAGGGTTGTCTTGCTTAGGATAGTTGGTGTTTGCCATTCTAATAGTTGTTTTATTATAGTTCTTGTTTTT
TCCATATAATATTGCTTATTCTTGTTTTCTGTAATCTTTCCTAGTATGTTGTTTATTAATTATCGCACTATTTTGTTGTTGTCTTTGCTCCCTTGTGGTA
GACTTTGCACCATTTTCTTGTTGCTTACTATCTTTCTTCACTGTCGCCTTTTTATTCATTTGAGCCGAGGATCTTTCAGAAACAGTCTCTCTACCTCCAC
CGGAAATGAGCCTATCTTCAAGTTATGGTTTAGCAATAGTGGACCTTCCAGTAACAAAGAACATTGGTTAAAGATTAGCGGCTAAAGAAATGTTTTGGAA
AATCTGAGAAGAATTTGTCTAGATGGAAGACGGGTATTTGTCTCTGGTAGGCAGTCTCTCCTTTATTAATGCAGTTCTTGATGCTCTTCCAACATACATG
TTATCTCTATTCCCCATTCCCTCTCGTGTAGTCCAGAGATGGGACAAACTCAGAAGGTCCTTCTTTTGGCAAGGTTTTCATTTTGTCAAATCGAAAATCT
GATAACTAGTAAAAACAATGTGGTCTTGGCATCAAAAAATTGAAGAATCAAAGTAGGGCCTTAAAACTGAAGTGCTTGTGGTGGTATGCTCAGGAATCAG
TCATAATGGGAAAAGGTAATCAAATTGAAGTACGGGAAGATGGATTTTTGGGCTACCAAGGATGGTGCACACCCCCTATGGAGTAACTGTTTAGAGATCT
ATTATGTGAGAAATATTGAAGGAGAATGTTATTAGATTGTTGTTTTAATTATTACATACAGAACCCTATTTGTTTATAGACACTATATTACAATTCCTTA
CCAAATAGGAGACTATAAACTATTCCTATTCTGTGTAGGATTGTGTACGCCTATTCTATTCTAACAAGAACATGGTGGCCTTTTTTAAAGAGCCAATCTG
TCATCAGAGTTTATAGTGGTAACTAAACAAGTGAGGATAAATGGTTAGTTAGAAGTCTGGAAGAGATATTCCCTGACATGTTTGTTATAGCTCAACATCA
AAACAAAATTGTGGTTGAAATGTGGTCATTGAGAGTTGATGTTCAAGAAAATGTTGAATGACTGCAAATTCCTAGACTAGTTGATCTCTATAAACTTCTT
GAATCATTCCAAGTGCTGAAGGATGCGATGGACTGCTTGTGGTGGACTGGGCATAATAAGGGCACTACAAAGTGACCTCAGGATATAAGATCATGAACAT
GACTGGGCCACGGTCCACAGAACTCTAACTGGCCATGGAAACAAATCTGGAAAGCTAAGATACCTCATAAGGTGGCTTGCTTTACATGGTTTGCTAGCAA
AGCAGGTTGTGGTGACACATGAAAAGTTGAGAAAGAGAGAAATTATAATGGTTACACTCTTGTGTGGGGATGCAGCTGAGACAGTTGAACATCTATTTTT
ACATTGCAGAATCACTGACCAACTATGGAAGATTTTTATCTATCTTAGAGGCATATATTGGACAATGCCTAGCAAGATTATTGACACTCTTTCAAGCTGG
GAAGAGGATGGGATTGGGGCAAGAAATAGAAGTGACTGGAGGATCATCCCAGCTTGCATATGGTGGACTCTTTGGAAAGGAATTCCAGATGTTTTGAGGA
TAGAAGTAGTAGCTTACATGAAGTTATCATTTTCCAAAAAAAAGAAGTAGCTTAAACAAGATCAAATCAGACTATATTTTGCTATTTGATTTTTGGTGTA
CAAAGAACTTCAAGCTTCCATGTAGATGCAGAATCAATCCTAGAAGTTTTAGACTCTTGTTAGGATTGTTTTTTTTTTTTTTAGCCTTTTAGTGTTCATG
CTTTCTTTTGTCAAGGAGGATTTTAGTACTACCCAAGTACTGGTCTATTATACAAAGTTGTTACCTATTCAGAAAAAGAACTTGAGATTGCTAAAGGAAC
CACATTAACTCTTGGATTCGCCTCTATCTATACTTCAAATTTAGGAGCATAAAAACTTAAGCACCTTCCTACCTAAAGAGGTGCATGGGCACATAAGAGA
TAATAGACTTTACCTGTCTTATTTGCCATATCTTAGGTATTTACAGTTGTATCCCGATAATGATCTGTTTTGTGGATCTAGGCTGAATCGAGATTCAGTC
ACTTTTGGTTGAAAGGTGCTGCTAGAGTTCCTTAGTTTACATCATTCTGGTTCTTATTCCATAAGTTCTTCCCCTCTCAACCACTTTCTTCTTTCTTCTT
AGGTTATTTGCCTCTAGCCCTCATATAAATTTCTCAGAATATCACTTACCTTGAGTTGGTCAAAGCATTACCAAACCATGGGCACATTAGTCTTTGCGCG
AAATTTCATGGATGTTACTTACCTTTATCCTCTTGTGCTTATGTAGCGTCTGTCTTGGTTAATCTTTCCTAATGTCGATGTGTATTTCTTTGTTTCAACA
TGAATTGTATCATTAATATTACTGTTTGACCTCAATTTTGGGTTCTTTTTAATTTTGGAAGACATTAAATCACAGGTTGGCATGGCTGCTACTCTTGCTG
GTGTCTGTCAGGTGCCTCTCACTGCGGTTCTGCTTCTCTTTGAACTGACACAGGATTATCGAATAGTTCTGCCCCTCTTGGGAGCTGTGGGGATGTCATC
ATGGGTTACATCTGGACAAACAAGCAAAGGGGTGGTACAGGATAGGAAGAAATTAAAAGGTTCAAGAGCCCAGATGACGCAGTGGCAAGGAACTTCTTCC
TCCAACATTGAACTTCCTAGCTTAACTTATTCTTCAGGTGTGGAACCTTCACAAAAAGAGAGTAACCTCTGCAAACTTGAGAGTTCACTCTGTCTTTATG
AATCTGATGATGAAGAAAATGATTTCGCTAGGAAAGTTCTAGTTGCACAGGCAATGAGAACGCGATATGTGACAGTCCTAATGAGCACCTTGCTAATGGA
AACCATATCTCTCATGCTAGCTGAGAAGCAATCTTGTGCTATAATAGTTGATGAAAATAATTTTCTCATTGGTTTGCTGACACTTAGTGATATCCAGAAT
TACAGCAAATGGCCAAGAGCGGAAGGAAAATGCCAGGAGGTAGCTTCTTAGCACATATAAAACAGGGTTGGCTTTTGTTGGCTTTTTAGGATTTATATAT
ATATATATATATATATATATATATTGCTTTAAGTTGTGTAGGTTGTTTTCTGATGTGAGTTTTCACTTGGCAGAATCATAAGATAAAATGGAAGGTAATA
TAGTCAAATGTTATATGAAGGAATAAGTGACATTTAAAATCAATTTGGGAGTTTTGGAGTCAATAGTTACTTACGGAATCTTATAGGATGGTGTTATCAC
TCTTTCGTTATTCAATAGTTATTGCAGTAATTTCTCTCTAGTAGCAGTTATTTTCCTGTAAAAAATGCAGTTATTTTTCTGTAATAGTGCAGTCTTTCTT
TCTAGTTAAGTTAGGAAGTCATGTCCTAGTTTCTAGGGGTTGTTATTTTATAAGTATTGTATTTAAACTATCTGGTGACTAAGAAAATATAAGCAGAAAA
TTATTCAAGCCTTTGAGTGCTTCAAACTCATGAGATCGCAGGTTCTCTCTTAACGAACCAGCACCATAGATCGTAGGAAGAAAACATCAGATTTAATATT
ACAGTGTCCCATAACCAGATCCATAACTGGGGACCATAACAACTTGGTATCAGAGACGAATGTAATGGAAGATCTAATTCAACATCAACTGGCACAATTG
GTGAACTTATTTCAAGGATAACGTGCAGCCAATATAGTGAGACAGGAAGCAATAAATGCTGCTTAGATGCACTCACAGAGGATCTAGCGAATTCGAAGGT
TGATTTTGAATCAACTGATCATACCAGTCAGAATCGGGCTCGAAGGGTAAAAGTGGAGTGGCAGTATGGTCAAAATCAGATGCAGGAGGAAGTTCTTTCA
TTCCTAGGTATTCAAAGTTGGATTTTCCACGGTTTACTGGCCAAGGGGATCCTTTAGGATGGCTGAACAGATGTGACCACTTTTTTCAACACCAACAGAC
TCTAGATGAAGAAAAAGTTATCTTGCTTCTTTTCATTTAGAGGGTAATGCACAACTTTGGTTTCTTCAACTAAAGACAGATCTGCTTGAACCGTCTTGGG
ATGAGATCAAACGTTATTGTAACCTTCCTTTTGGGCCACCAATCAGAAGTCAGAAGTTAGGAGAATTGGCTAAGTTGCGCCAGATCGGGTTCGTGGCAGA
TTACCAAGAAAAATTTGAGCAATTAATTTAGCGTCCTGGTACACTCACACAATAAAAAAAATTGAACTTTATATCAGTGGTCTTGCTGATTATATAGCAA
TTGAGGTTGAGTTGCATAATCCTCCAGATTTGGCTACAGCGATGAGTTTAATCCGACTTTATGAACGCAAGGAACAATCTATTTGTTCGCAATCGTTAGA
TGCTTGCAAATCCAAAACAACAGATTTCTTACCTTAACATGCCAGATTTGTGAAGAAACTAACCAGACCTGAAATGGAGGAAAGGCGACTTAAGGGACTT
TGTGTCAATTGTGATGAACCATTCACCCGAGGTCATCAATGCAAAAAATTATTCTGGATTGACTTTATGGACGATGAGGAAGAATTTGCTGGAAAGGAGG
GAATACTAATTTCCGCACTTAGCGCTTGAGGACAAGCGCGATGTGAAGGAGGAGATTAATGTTATCACTCCTTAGTTATCCAATAGTTACTGTAGTAATT
TCTCACTAGTAGCAGTTATTTTCCTGTAATACTGCAGTCTTTCTTTCCAGTTAAGTTAGGAAGTCATGTCCTAATTTCTAAGGGTAATTATTTTATAAGT
ATTGTATTTAAACTATCTGGTAACTTAGAAATATATAAGCAAAAAATTATTCAAGTCTTTGAGTACTTCAAACTCAAGAGATTGCAGGTTCTCTCTTAAC
GAACCAGCACCATAAGTCATAGGAAGAAAACATCAGATTTAATATTACAGTGCTGCATAACCAGATCCATAACCGGGGACCATAACAGATGGAGAGGAGA
GTTTTCACAGGAAGAAAGAAATTGGATCTGATTTTAATTATGTATAGTTGATATATATAATTTTGCTATCTGAATTCCCATTACTCAAACAATCAACCAA
AGGGAGAATATGTAATGATTTTTCTCTATATTTCACTGAAGCCCTGTTGATCTAGAAACTTGAACTTTCTTATGGCCTGCTTCATTCGATTGATGCATTT
TTGTAGTGCCAATAGAAACTTACCTGGCAGTTAACATAAAAGTTTTGGCTGGCCCCTCCCTTAATCAATTTCCATAGATCGCCTCCTTGCTGATGCTTCC
ACCTGGTAGAACTACTATTACCCATCCAATTTCTGTCCCTTTACTATGAATACAAATGTAATGGTCCCCCAAAATGACTTGTTGGCCATTGGACTAGTTT
CAACAACTTTGATAGTTCTTTTGATTATTGAGTACGTCTCTATTTATGTTCTTCTTTTGCCAATTTTAGTCTTGATTTTGTTCAGAAGTAAGAAAATAGT
ATAGCAACGCGAAAAGAGTACAACTCACAGGAGATCTTGTTGAAGAGCCCCACATCAGGCTCTTACAAGATGAGTATCTCTTTATATGGCTTGGGTAATC
CTCACCTTTTAGCTAGCTTTTAGGGTTGAGTTGGGTCCAATGTCCATTTCTTTAACATGGTACTAGAGCTATAATGAGAAACATTCAGGACGGAGAAATC
AGTCATTGTGCCTTCTTTCCAGTGACTTTCAGATCTGATTGCGTCACCTTTCTTTTTCTTCCAGCATTTTTCCAGAACTAACACCGCCAAAGGTCCAATA
ACTCTCAGCAGCCAAAGTCGTCACCGGCAGCAGGCCCCTCAAGCATGGCTAAATCTAAGGTTCCTGCGCGCGTCTGTCACATGCGCCAATGCGTGTGAGG
TGTTCGACCAGATTCCAACAGCTGTGGTGTTCAGCTCAAGTTTCCAACCTGACTACCTCATTTCCAGCCACTTCTGACGGTGCCAGCAGCTTTAACCAAT
TCGGGCGACTAGATTTTCTGAGAAGTCTCGCCTGAAGCTGCTGCATACTCAATGCAGCTCCTTTTTTGCACTTTTTGGCAATCTGAGTTATATTTTGTGA
TCATTTGCTTAGACTCTCTTCAATCCAACCATGTCTGGTGGGCTATTTGGAGACAAAAAAGATGGTGGTCTATAGTACGTGCTTGTGTCTGGTGGGCTAT
TTGGAGAGAGAAATATTAGGTGTCATGAGAATATTACTAACACTATGCAGAAAGTCAAAGAAAATTGCATTAACATGTTGTTTTTTTGGTGTAAAGAAGA
GGGTATAGAAGTAGTAGAACAGTTGGTAGATTTCCTAGGATCAATGTAATTATGGTTTTAGCTTGTAACTTTTTGGAGGTAGCCAAAATACCTTTAATAC
TGAAGATACAACTTTAACTTTATAAAAAAAATGCTATTTCAAGTTGTAGGAAGATGCGAAGGATGGTGGTAGATAAAAATATAAGAAAATGCAAAGGGCA
GAGATGATTTTATGATTTTAGTACACAATATTAGAATAATGGGCATTAAACTACATTATATTAAATAAAAGGGTAATTTATACAAAATATTAGCCCATAT
ACTTACCATTTTTTAAACCCAATTTTTAATAATTACTTGTGGTCACTTTAATTTCCAAAAAAATGGCCGCTTCTATTTTCTCTGTTGTGTCTTCTTCCAT
GTTCTTCATTTTCTTCTTCTTTTGCTGCTACTTTATCCTCCTCCTCCTCCTTCGTTCTTCTTCTCCTTTCTCCTTCTACTTCTCTTTTAAAGAAAGATCG
ACATACCGCAACATAAAACTTTTTGAGCGAATTATATATCAAAAAATCTGAAACAATGAGAGGATACTCATGTCTAAAGTTGGGACTGTTTAGAGGTGAT
TTCGAGTTGATCGAGATTGAATTAATCGGTGTATATTTCATGGATAGTCAGTGTATACTTTATGTATAGTTATACTATATTCGGCTTAATTAGTGTATCA
TATGTATAGTTAGTGTGTAGTTTATGTATATAGTTCATGTATAGATAAGCTATAGTGTATAGTCAGTGTACGTTTTCTAGGACTTTGGCTATTTTTATGT
ATATGAAACATGAATTTATTTGTAAATCAATTAGTTTATTGTAAATATTTGAAACTAATCCTAAATAAAATTCTTAAATTGGGCTGCTAGACAACAGGAC
AGATTTGAATCACACTATTTATTGACATGGATTTTGTATTGTAATATTAAATTAAAAAGATTGGCTTTGCTATTTTATCATCATGAATAACAAATACATT
TCTTTTAACTGTATGTATGCAGGAACTTGTAGTAGCTGATGTGTGCTCTTCAAATGGCAATAAGTGCCGGGTACCATGCACAGTGACTCCAAATACAGAT
CTCCTTTCTGCTCTAACTATTATGGAGAAACATGGTTTGAGTCAGCTACCTGTTATACTAAGGCACGTGGAGGATGAAGGCATACATCCTGTGGGCATTT
TGGACAGAGAGTGCATCAATGTAGCTTGCAGGTTCTTGATATTCAACTTTTCTTCAAAATATAATGCTTTCTGGAACCATTGACGATAAAATATGCAAGA
AATTTGTGCAGTAGTCACACTTTACTATTGATGATAAAATATGCAAGAAAACTTGTGCAGAAGTCACACTTTACCATTGAATAAACTTTGCAAGAAACTT
GTGCATAAGTCACACTTTACGATTGATTACCAGATAATCTATAATTAAGATGTCAAAAGTATTTGACAAAATTATCTCTTATATGCAAGTCCAAGAAGCG
AACATACCTTTAACACACTTTGACCGGACACTAAGAAGAAAATCGCTAAAGTAGGGGTGAGAATTGGTTTGATAGGTAAATCACCTTTTATGCTTTAAAA
GAGATGTGAATTTGAAGTCTTAAAGCTTGTGATAGTCATAAAAAATATTTATATTCTAAGTATGTCAAGCAGTCCATGCAAAAGTAGAAAATAACTTCAC
TTGTACTATAAAGAAAGGAAAACCTGTCATACTAGTTTGGGGTGGGTGGTGGTAGCATTCCACTCAGGTTTTTCATTTAGTTTTTCAATTAATGCAGGCA
AAGCAGACGAAAGCCTTGATTAGAACTTAATTATCAGCAAACCTTAGTGGCTCTTGAAATAGAACATGAAGCCTTAAGCAAATATCATTGACAATGAGAT
GTTGACTTTTTAGGCAGTGGTATTTTGTTCGGCTTTTCAAGGACTAAGAAGAACTTAATATGATTAATTTTCTCCATTCCATCCTCTCTCTCTTGTATCA
TGATATCAGAGCCAATAAGAGTTTGGTAAGCCCTAATTAGCTTTTTTCGCTTGTCTACTTATTTTTTTTATTTTTTTTTTGTGTTTTGTGTCCTTTTAAT
ATTCCATAACTTTTGATTGACTGTTCTGGAGGGCACCACTTCACTATTCTTATCATTTTTGCTGCAGTGTTACACCGCTATTATGGCCCATGTTTGTTCC
ACACCTTTTTTAAATTTCAGCCAGCTCCTTTTGTTTCGCCTTACAAAATCTTCTGGCTAACTCAAAACTAGTCCTCCTTTTCCGATCGTAACTTGTTCTC
TATTTTCTCTTGATTTTGTTCTATTAACTCTATAGTTGACTACCATCAAAGGTATAGGATCTAATCAAGTAGATCTCATTAGTATGTTAGTTTCTGAGAC
TCCATTCAGTATTGAAGGTCTGTAATCTGGTCGAGCAAACTCTTAACAGATAGAGCAAGCGAAGTTATGGCCCCTACTGTGTATCAAAGGTTTGCAATCT
GGTCAAGTAAAATTATTTACCAAGTGCCTGCAATCCTGTCTGTTTGCTGTCTATGTGATGCTTGAATGTGCCACCTCGGCAAGAGGAATAAAGAAACACA
CTTTGGTTTGCAGTCTTTATCTGTTTAGACACAACAACAAACCATGTGTAATCCCACAAGTGGGGTCTAGGGAGGATAGAATGTAAGCAGCCCTTATCTA
TTAAGACCCTCCATTGAAACAATTAAGAGCAAACAGAAAGTGGATCCCCTTTTATAAGGAGAAAAGCCTTCAGTAGAGCCATTAATGAGAATGGGAAACC
TGACCTTGCAAAAACAATGAGAGGTTCATTTAATCCATTTCCTCCAAAAAATCATATCCCTTAGAACTTCAATGAGAAAATTCCATTTAACATTGTCTTG
TGCTTTTCCAATATCCAGTTTACATAAAATTCTGTGTTTGTCCCCCACTCTAGTATCCACAGATTCTTTGGTAATCAAGTATGCATTCATTATCTGTCTT
TCTCTAATAAATGTCATATGGTGCTTGTCAACTAGCTCGTCCACCACCTTTTTGAGTCTGTCAGTCAATAGCTTGGAGATAATCTTGTATACACACCCTA
TCAGACTAATAGGTCTGAAGTCTCAACTCCTTGGCTACATTATTTTTAGGAATCAACGCCACATATGCTGCATTTCAGGCTTTTTTAAACTGTTCCTGGG
TGTGGTTTTCCACTGTCTTCATATTTTACTCTTTCAGAACATCCAAACATGAACGAAAGAAATCTGTTGTATACCTGGTGCTTTGTTAATTGCACATATT
TTACATCTTGCTCCTTAAAGGTCATTTGATACCATGCCGCTGCCTCCTCTGTAATTCTAGGACAGTTCTGCAGTTAATCCGAGGCTCCAAGCTTCTGCAT
ACAAGTTCTGATAAAAAGAAAGGATTTCTCTCTCCTAATATTCATAGGATCAGTTTCTATTTCTCCATTTGATCTCCAGATTGTCAATAATATTGGACCT
CTTGAATAAGACTTTGATCCTAACTCAACCTCAAAAGTTAGCTAATGACTAATGAGGTTAGATTGCCTAAGATTACGGATGGCAGAATGGGTAATTTATA
TCGGTATCCCATAAAAATTACCCATCTTAAATGAGTTGGAACTCATTTAAAATGGGTAAGAAACCGGTCAAACTCATATTATCCATTTAAAAGTGGGTAG
TTTAATGTGTAAAATGGGTTTAAAAAAAGATTTATTTATAAAAGAGAGAAAAATGACATCAATATTTTTTTTGAGGTGTAGGTGATCGGGGTAGGAGGTA
CGGATGGGTGGGATAAAGGAAGAAAATTAAATTTGATGATAGATTATGGAAGTTATGGGCTAAAGACTGTGGAAGGAGACAACCATGCAGATTCTCAACC
ACTATGACACACTTCATCTTTGAGTGATTTCTTGATGTTATTGAAATGTCTCTAGAAATATTGCCTCTCTTCTGAAAAAGCACGTGTTCCATTTGAAATT
CCCCTTAACATTTTCCATATTTTCTTTCTTTGGGGAACAGAGCATTAGCAACTCGAGAACAGCTTAGCTGGTTCTCCACGAAGTAAAGGCTAATTGAAGG
TTGCATAACCCGTTTGCAATAAGTTCTTCCTTGTCAAAGCATGCTGAGGGTTATTGTCTCTGAGTAATCCATCCTCGCTCTGTCTTACAACAGGGTTGAA
CAAGTAAGATAAACAATTGGATTTACAGTGATTTATCCAATAATTACTGCTATGCTGACTTCTTGTTCAAATTTTGGACTACCATCTCCAGTTCAATGGT
AAATAATGAGAATGATGTTAGCACAGGCAGAGGAGACCGTACAACCAGGTAGCAGGATTTACTGCTGAAGCTGAAGGTTTGTTCTAGCTGCTTCTTAAAT
TAGGCACTGGAGGAGCGCACTGCGTAACTACACTGACTCGTCATCCAATTCCAATCATTCACTTCCGTGGTATGGAACTTGAACAGGATTGAGTTACACA
TGTCAAAATTAAGTCTACTCTGCTGTCATTGCCTGAATAATATTTCTTCATGCTGCTTTTGTCAACTGTTAATGACTTTTCAAACAACCCCATTCTCCAC
CATTGTTTCCCGAACTGCCCTTTCCTGATGTTTTGTCGTTGCTGCAATGTGCTTGTTCGTAATTAAGTCGTCATACTATTTCTCTGGCCCATGTTATACA
TGATATGATTTGAGTTGGTAGAATTTGACGAGGTATGACAAAGTATTTTGATAAAATTTTGATAATAATTGAAATACTATTGTTTTTAAGTGCTAAATAT
TGTGGAATAACCAAAAAAAACTGCAATACAAATTGAGATGAAGTTGTCTACTCGCAGATGGCACTTATCACAAATTTTTAGACTACACTTTTGTTCTCTG
AAACTAGAATCGTCAATATGGCTAGGTCCGTTGGGTCGGCCTGAATTAACCCCTGATTTGATTGGGTTAAGTTACGATATTTGGAGCTCATTTAAGAAAA
GGACATTTTAGTCTGGTCTAAATAAGCCGATAGATTTGTGGGGTTTGAGAAATATGAATAGGGCCAGATCGTGGTTTAAATAAAAATTAATTAAAAATAA
AATAGAGTAATAAAAATGTAATAAAAATAACAACAGTCAATATTCAAATTTTTTTAAAGTTTGAAATATTACAATATAAATATAAGTTATGTTTATAAAA
ATTTATTTAATACATAAAATAAAAATTTACTAAAATTTTCAGGTTTCACTACATAGGTCACATAACCTATGGAATATTATCATATTTTTTGTGTTTTATT
ATGATCATTAGAAAACAATTAGGTTAATTTGTATTTTTACTTGAAATTAAACTTAATAAGTATGGAGTATAAAGATAATTTTATTTATGAATTTGATTAA
CAAGTAGGCATACTAACACCATGCAATATTATCTTGTCAATATTTATGATAATATTTTTAATTATAATTTAATTTTAAAAAATATATTTTTAAGAAAAGA
GAATGTTGCCCACATATGTGTAGGCTGGGTCGATCATTTCCTAGCCCACACCGAAAACGGGATAGCACGATCTGACTCGATAAATTTCAAAGCATGTATG
GATTAGCTCGAATGGGGCAGGTTAACCCATATTGACAGTTCTGTCTGAAATATACCACTTCTGGTAATAATTATTTTGCATAAAATAATAAAGGGAAAAA
ATTGATTAGCGCTTCTGAGGTGAAATTAGAATCTTAATGTTTCAGAATGGGTAATTACGACTTCCTTCATTTCAAGTTGTTAGTTCGTTTTAGAAAAAAA
ATGTGTTTCCTTTTTCAACTCTTTAATTTCAACGATCCGTTGGAGCATGTTCAAGACGAAAAGATTTAAAGAATATTTTAATAAATTTTTTGTTTCTTTG
ATTTAATTATGTACTTCCTTTGAATATATTTTTTCTATCAGTAACAGAAACTAAAAAAATAGAGGGATTGATCAACTGATTGCTAAATCAACAATATCAG
AAAACTATCAAGTCTCATCTTTCTCTTTCTCCAATGCTTCTTTTTGTGACAAAAAAGGGCTCATAATGGATGGATCGTCTCAATCTATGACTTTAACTAA
AGAAGACTATAATGACTATCTTCAATGTCAAACATCAAGGCAACAGTCAGCAACTGCTTGCACAATACACTGGTAACTCCTTTCATTATGTCGCATTGTC
TTAGTCTCAAGATTAATGGATTCTTGATTCTGGTGCTTCTGGTAACAAAAAATTTTCTCTACTCTTACTACCCCTTCTACTCTCTTTTGTAACTTTGATG
AATGAATCAAAGATGATTGTAAAAGTGATATGTATAGCTCATCCTCTGCCTTCCATACCTTCTAAATAAGTCTTTTTTACACCTAAATGTCCATATAATC
TTGTTTTCATTATCAAATTAACAAAGAATTTGAAATGCGATGTAACCTTCTTTAATTATTCTGTTCTTGTGTAGGACCGAAGTACTGGACAGGTGATTGG
AAAAGGATATATGTCACATCGTTTGTACCTACTCTCCATCCCAAAATCACATGTTGCTTTCACTTAGGTTGTTTCTTCTGAATTGCTCCATAGTCAATTG
GGTCATCAAAGTCTCCTAAAATTGCAAAAAATGGTCCCATTTTATCTTTGTTAGAATGTGAGTCGTGCCAGTTTGGTAAGCACACTCGTTCTGCTTTCTC
AAAATGCATCAATAATAAGGTCACCTATATGTTTGAAATCGTTCATTCGGATATATGGGGTCCAAGTCGTGTCAATCCTTCTTTAGGATTTCATTATTTT
GTTACTTTTATTGATGACTATTCTCGGTGCACGTGGTTATTTTTAATAAAAAAAAATAGATCTGAGTTATTATCTATCTTTCAGAAACATTATGTTGTAA
TTCGCAATCAATTTGGCAATTTCATTAAGAAGTTAATCGGTGATAATGCCCAAGAATACTTCTTTACTTCTTTCTCTTCTTTTACGTCATCCCATGGCAT
ATTGCATTTGTCTTCTTGTGCACATACTCCTCTACAAAATAAAGTTGTTGAGCGAAAGAACAGACATCTAATGGAACAACTCGAACATTGTTTGTTCACA
ATCATGTCCCTTTTACGTTTTTGGGGTGATGATGTTATTACTGCTTGCTAGTTAATCAATTGCATGCCTTCATCTATTTTGCAGTACTTGAATCCTCACT
CAATCCTTTATCGGATAAAATTTTTATTTCCTTCTCCTCCACGTGTATTTGGTTGCACTTATTTTGTTCAAAACCTTACCCCGGAAAAAATAAACTTCAT
CACAAGGCTTTTAAATGTGTCTTTCTTGGGTATTCTCCTCTACAAAAAGGTTACAAAAGTTTTGATCCCTCTTCCAAATAAGTACTTTGATCTCTGCAGA
TGTTACTTTTTGAGACTTTTTCATATTTTTCTCCTAATACGAAAAATCAAAAGGCCATAGCAATCCTTCCCGCTCCAACTATTTCAACCCCCATCTCCAC
TTCCAACTCTTAAGGTTTGTTCCTGACGACCTCAACATCCTATTGAACTTGCTAATTCAATTGGTATTTCTAACTCAGATATAGGTGCACAAAGCAATCT
TGGTGACTCATTACCTGCTCCAACAATGTCTTTTACTTCGGTCGAGCACTTATCTGATAATCTTTCTACTACTCTTGCAAAGGTACAAGTATGACTGTCA
ATCAAACTCCCGTTTATTCTTATTTAAGTTTCATTGTTTGTCACCTTCATATCATGCCTTCTTTATTAGCTTATCATCGGTTAAAGTTCTAAGACTGTGA
GAAGCATTGGTTCATCCAGGTTGACGTCAAGCTATGATTGAAGAGATGATTGTTTTGCATGATAATGGTACTTGGGAGCTTGTTCCTTTACCTGAAGGCA
AAATCACAATTAGTTGTCGTTGGATATTCATAGTTAAGGTAGGTTCGGATGGAGCTATTGATCGTCTCAAAGCAAGACTGGTTACTAAGGGACACACTCA
GATTTATGGCATCGATTATGGAGATACTTTCTCACCAGTTGCCAAGATGACTTTTGTTCGTCTTCTCATCTCTATGGAAACAATGAATCATTGGCCCATT
TGCTAAAGAGGTAGATATCAGGGGGAGTCTAGACTAGTTTGTAAACTTCGTCGATCCCTTTATGGTCTCAAGCAGCCTCCCAGAGCATGGTTTGGTTGAT
TTCGAGCTATTTTCCAACAATTTGGAATGATTCGAACATAAGAGAATCACTCTTATACTATAGGCATTCATCTAATGACAAACATATCTTTTAATTGTTT
GTGTTGATGATATTGTTATTACAGGAGATGATTAGGAGGTATTGTTCAACTCAAACAACACTTCTCAAGTCACTTTCATACCAAGGATTTGGGCAAGTTG
AAATACTTTCTGGGCATTGAAGTGGCACAATTTGTCCATGGTATTGCTATTTCTTAAAGGAAATATGTCTTACACATTTTGAAAGATGCTGGTAGGTTGG
ATTGCAAACATGTGGGCAGTCTAATATATCCACTACT