BAC Sequence – LE_HBa0052N09

>C06HBa0052N09.1
GGCACGGGAGGGACCATAGAATTTATTACTGAGGCTTCCTATTATGGAAATAATTCTAAATAATTAATTTAAATTATTCTTACCATAATAAATTACAAAC
CATTCCACTAAAAATTCGTAATTGAACTCCTCTATTTATTTCGAAATTCACCACTAAACACTTATTTGATTCCCCATGTTAAGATTACTGATACTAATCA
ATAAATTAAATTACTGATGAATTTAATTCAATGATTAAATTCTTTTAGAGCAATACTTAACTTGTTTCATGTGCCAGATTCATAAATCTACCAGCCGGGT
TTACACATGAAAACTTACAAGCTTCTCATAAAAGGTGTATCATCAATCTCTATACTGAGACATGGATTCCATCAACTAACTAATTATTTCACCAATATAT
ATTATTATCATCCAATTTACCAGGCATATTGACCCATCTCAGAATCTCATCTTTTAATAAATCTAAATGATAAATAATATATACAGATCATAATCGTTAT
ATCAAGATTAAGAATATAAGTACATTTAATAGTTTAGAGAATATGTTTTTATCAGTCAGTCTAAAACAACTATCTCTGCTTGGTCCCGTTCAATACATAC
CAAATGCACTAGCACGAGAAGTTAGAACTATGCCATTCTCATAATCAAGATAAATTACATTTAATCTCGTGCTACAATCTTTCTGATGATTTTGTCCAAA
TTTCCATCTATGATTGTGAACTATAAATTTTAACTTATAAGAACTGATGATTTAATCTTCTGTGTATAAGTTTAAACTCTATACACCAAATCATCTACTA
TATAAGTTAAGGACACATATATGACAATTGATCTATTTAATGTAACACTTTATTGAATTGAATAAATAAATAAACAATTGTTCAATATTAATACTATATC
AAAACGCATGGTTAATAGTATATCCTAACAATAGTACCAATTGAAGAAACTACTGATTCCTCTTCTTCCTGATTCAGTTTTGGGATCAAATTGATCAGCT
CCAAATGCTAAGTTACATGGCCTTATGCCAGAAGCACCAATTACTAGCAAACAAAAGCCTACTAGTAAAAATATCATTTGTCCTGGTGTTGGACCAACAC
ATATTGGTGCAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNAAGCTTGATCTAAGCAGAGAGCTAATCACCGATGAGGAGATCATCAACAATATCATATGAATATCCACTAATCTGTTGAGGTCTTTA
ATTTGGATTGAGTCACTGGAGGATTAACGGGAAAGTCAGTCTCATCAGGCAAGTTTAAGCCTTTGTTCTTGTTCCTTGACTTGCTGATGATTGCTGAATT
TGCAATTGATTTGGGGAAATGCAGACCTGGGAACTTGTTTTAGAAAGTTTCAGATCTCTGTAACTTGATGAATAATCAACCTGTTTTTTATCAGTAAACG
TCAACTCTCTTAAATAGAGGGCTGCAGTAGCAAAGTCCCAACAAATGAGAAATAACAAGCATCCTATAAATAGGAAATAACGTAAGTCCAAATCCACTCC
GGGAAGTTTTATTTCAAGTCAACAAAATAATTCAGAAAATATCAATCATTATCTTTCCTCTAGGCTGAACCTAAAGGATTGAAGACCTGTTTAGAATCCT
GGTAACGTTGCTTCACCGACAGTAGAGGAAAGTGACTTGCTCCAGTAACTCTTTAAGGAAGAAAAGGTTCTGAGAGTGATGCACTGTTGCCGACAAAGAT
CTTGATCTTGATGGTTATTCTGTGGGCTTATATTAGAAATCTTGGTCTGTGGTATTTGACCTATTTCTGGCTATAAATCACTTCCATATGCATGAGCAAC
TTCAAAGGAGTTACATTGCTTATTAGTGTTAGTGCAGTGTTATGTTTCTATTCTAATCCTCTCAAAGCTGCTTACTGAAGGGTTGAAAGGTGATTGGCAA
ACCTGTGGAAAATTTCTCAATGTATTTCAACCAAAGTAACTGATGCATCTGTTCTTCCAAATGAATGCCTAGATGCTAATGTCGAGTCTGGTGTCCCTTG
GATTTGCTAAATTTGTTCCTATGTAATCATCTTCCTTGAGCTTTCCTGGTATCACAATTGTCTTGTAGAGATGCCTGAAGTGATAACTCCTGACCTCTTC
ATGCCTGGTGCTTGTCTTGTTGTCATTCCGATGTCCTTGACTGTATCATGGATCAGCATTGCGAGTCCATATACCATCAATTACTAACCAAACAAAGGTT
TAAGGACTTTTTAAATATGTGTGGAATAGCCCTTATTAGTTGAAACTTCTAAATAAACCAAAGTAAACCTTATCAAAAAATATCCTTGTTCTTTAGCAAA
TATTGAAGCTAACATTACGTCAATCATTTTGTAATATTGTACAGATGCTATTTATAACTTTATGACCGATTGAAATTTGTTATGGAACTTGTATGATTGA
AACAAAGAGCTTGTATAGACGTGACCAACTAGTTGATAATAATGTAATCCACATAGAGTTTAAGGTTTAGGTAACTCCTACTTTTGAATTACAAATTATT
TAGTATTAGAACAAAATAAGTTTGAATAGAATGGAACAGATTCAGAGGTTTCATGTGGTTGACTCGGTCTGATTTGGTTGAGCTGTAGTTGATTGATCCG
ATTGAGGTTTCGGTTCCTAACTAGTCCAATGCCCAAGTTCTAATAGGAGGGAAGATCATTAATAATTTGAGCACGACTATTTGATGGAGTCCGGAGCCAA
AAGGGCAAAAAAATTGAGAGAAATTTCCGAAAAGGCAACAAAAAATAAGGTTCAAACCAGAAGGGCAATATTTAGATGGAAAGTGGGATGCCGTGAAATT
TATGGAGTAAGGCGCAGCCTGACATGCGCCTTACAGGACGCAACCAACATGATACTTGTAAGTCGCATGCCGGCTTGCGCCTTATAAGGGGCATTTCAGG
CTGCGCCTTACTCCTTAAATATAATAAAAAAATGTTTAGTCACTGTAGTCTATAGTGGTGCGAAAATTATTCATTAAGAGACTTTGGAGCTTATTAATTA
ATATTATTACTACTATTATCAACAATTTTAAGTTTAAAGAGTAGAAATAATTAAGAAATGGGAAGTAATGTTATAATGTATGAATTTACTTATAATAGTT
TTGAGATATCAATTGAATAAATGGGGAATTTGTAATCGCTTTTTGGTGAAATCAAAGGATTTATTGTTTTCCATTTGGATTGTATATGTGTATTTATTTG
GAAATAATCTAACTATACACTAAAGAATGAAAATATTCTTTTAAATCTATTTCTTAGTCCTTGCAGAACATTAGGAAAAGAAAGTGTAACCCCACCCCAC
CTCAACTACCCCCACCTCCTCATAATGGCCAGATGCCAACTCTACTTTTCCATAAAAATGAATATGGAAAATAGTTTAACGTAAAAGTGGGAATTAATAG
AGAATTAAACGATGGTGACTGCTCTTTAAGCAAAAGTTGATGTTCTGATTAAGTTGTTTGAGTGAAGTAAAAAGTTACACAACTCTACTAAATGTTTTTT
TAATTTTATTTTAAGGAGTAAGGCGCAGCCTGACATGCGCAAGCCGACAAGCAACTTACAAGTATCATGTTAGTTTGCGCCTTACTCCATCAATTTTTTT
TGAAACAGGTAACATTACTCTATATATCCACAGGTAAAAGTGTAGTTCCCCTTCAAGCTTACTCCGTAAATTTCACGGCATCCCCCTTCGGTCTAAATGT
TGCCTTTTTGGTTTGAACCTTACTTTTTGTTGCCCTTTTGGAAATTTTGCTCAATTTTTTTGCCCTTTTGGCTCCGGACTCCTGTTTGATGTATCAAAAA
TAAATTTGATAGATCCTATCTTATCAAAAAATAATAAATAAACATGATAGATCCTCCAGTAAACTACTGTGGTAAATCTCGTGGCTAAAGATATGCATAG
CTTTTCTGCCTTTTCAAGCATTGTTACATATATGCAGCCCAAATGTGGTGCCGATTCTTAACCACACATAAGTGTGTCAATAACAAAATAGGTACTATTT
TAACAAGAACACTCTATAACAAAATAGCTGCAATTGTCATTCTTCACTGCTGTATTAATAAAATCACATAAAAAACATTTGAAATCCTCTTACAATCTAT
GGGTATTGTTTACAGAACTGACTATTCTAAACTCGTCTTTTGTACCTTCAATTTGTTCACATCTCTAGGTGAATTTTGGAATTTCTTGGTTTAATTTTGT
GATGTGAACGGGCAACTTTGATATACTGCTCCCTTTTTCCTTCCTTAGCTGTGATATACATCTTTGTTTGCAACCATAATTTCTAACAAGTCTCGACTTT
CTGCTTGGATGTATTATTGTTCTTTCCAAATACTTAATATTTGCAATTTTTAGTCACAGAAATCCTTTAGACTCTTAAAATACACCTTATTTAATTAAGT
AACTTCTTTTAGAACCTTGTATAATTATTCGTTTATTCTCTATAACTTTATATTATGCACTCTTCCCTCATACACTAAGGGGTCGTTTGGTTGCTGAATT
ATAAACAAGTTATCCATGTATTTATTTTCATATAACTTATATGATGTTAGGTAGGTAGATATGAAATAGGTTATTCATGTATAACATTGATGCGGCGTTT
AGTTGACAATTTGGAAACCCGCATAATTAATACATGTATAAGTTAAGAGGGAATCTATCTATTACATTATGCAGGATAAAATATGGAATAACTAATTCAT
GTATAAACTAATCCCAATCCCTGCATAACTTGTACATGCATAAATAATTCATAGATTCACTCATTACTAATCTTTGCATTACTAATCCCTACAATATGCT
GAGATTATTTCTTATCCTCTGTCTGGTTTGGTGTATCAAAGACAATTCTATTTTTAACTTTTCCCATCCATGTATTACCTTGTATTGCTAATGTTATGAT
TTTCTGTATAAGTAACACCCTATAATATTAAGTAAGGTGTACAACTAATACATGTATTATTTATACATTGTAAATCCTACCAACCCAAGGATTAAATAAT
ACCACGTCTAATACATGTATTATTTATACATAGGCTGAAAATCTTTCAAAACAAAGTATGAAATAATAGCATGACTAATACATGTATTATTTTCTCTAAT
ACATCCTACCAAACGACCCTTAAGAGTGAAATGGTTCTTTATAAGAAATAGAACTCGGGCCTACCAAAAACCTAAAGCTAGCTTAAGAGGTAGTGAGTAT
TATCCGAAACCATAAAAGAAGACGACCCATTTCTTCCATTGATGTGGGACACTTAACACCCTCTCCCACACTTAGACATCTGGAGCATGGACAATATGAT
ATGGGGGCCAAGTATTGGGTAATCTGTTGTTCTCGGAGGTCTTTTACCTGAAGTCAGCAGAGGAAATTGAGATTATGAGATAAGAAATATGTGACTGTAT
GAAATGGTTTATGTTGCTTTGAATTTGGCTATGTGATCAGTATGAATATAAATTATTCGTTAAGTACTAAAGTCTCGGTTGGGCTTCTAATCTTTAATTA
TTAGCCAACATTTTTGGTGTGTAGATTAATGATGACGGTCCATCAAGAAATGAACTTCCCTTGTTGGAACATAATTTTTGTAATTCACCAAACCCTGTTT
TTGACATGAGCTGTTTGTATGTTATTTTTGTTTGTCATGTATACTTTAATTTATTTTGTATATCTTTCGACCTATAGAAAAGTTTGTTGACAACTTGACT
ACTATGTGCTATGTGATGACAATTTGACCATACATTCTGTAATTTCGTTTCCTTTAGGATGTTCATCAATATAATTGATAATAATATATTATCCAGATCA
TGTTTTACTTTGTTATAATATGTATATACTTCTTTTCGCAGGAAGCTTCGAACTCTGGAGGAGATATTGACCATTGATATTAAACCTGGTTGGAAGAAAG
GAACCAAGGTAACTTTTCCTGAAAAAGGAAATGAGGAACCTGGTGTCATTCCAGCAGATCTGGTGTTTGTAATAGAGGAAAAACCTCATCATGTCTATGT
GAGAGATGGTAATGACCTTACTGTCAATCAAGAGATTTCACTTCTTGAAGCTCTCACGGGGAAAACACTGGAACTGACAACACTGGATGGGAGAAACCTC
ATTATTCCATTGACCGACATTGTCAAACCAGGGCATGAGATAATAGTACCAAATGAAGGGATGCCAATCTCAAAAGAGCCTCGGAAAAAAGGAAATCTGA
GAATCAAGATAGATGTTAAGTATCCAACAAGGCTCACAGAAGCACAGAAATCTGACCTCAGGAGAGTTCTCGGCCAGGGGTGACCATATGAACATAGGTA
TTCAGATTACAAGGGGTGACTATATGAACACAGGTAGATAGAGCAGAATGCAGACGTTGGATGTAAATATAGGATATGCTTATTGCTTGCAACTGGAACT
GTGAATACTAGGAAGGTCTAGTAGCCTCAATGTTTTGGGGACAAAGGATTTTTGGGGGAGTTCGGATAGTGGTGGGATTAATTTTTTCATTGGTCGGGGA
CATATCCCTCCACATTATTTGATCGATAAAATATAGATGATGTTAATGCAAGCTCTTCTCTTCTGTTGCTTGTGATTTTAGGGGTCTGATCAAGACAAAA
ATGCACTAGGATCTTGCATTTGAGTTGGTTCAATGTTGAATTATGTCCATTATATGTTGACATAGAGCAAGATTTATGTTTTTCTCCCTTGAGAAAACCC
CCTGCTCTTTTCTTGGTCTCTTTTCTTCTTTTTCCTGCATCATGTACTGAAAAATGACAGCAGATCAGACATTCTTAAGTTGTTACAAAATCCATTGTTC
TTAAGCAGCACAATTTTGTGGTTGTTTTCCTATCATTTGGGTACTGCACTTAAACCTCTACAAGGTTTAGGACTGTCATAGTGAAGCGCTGTTATAATGT
ATATCGACATTTGATATTTAGATCTCATTTAGCTATATGCGAAATTAGAAAGATTAGTGTGTGAAAAAGACAAGCATCAATAGCCTTTCTTCGTGATGTT
ATGATCATAACTAATGGACATTATTTAAGTATAATTTTTCTTTTAGACATTCGTATTTAAAATTTACTATGTGCGTGATGATAACCAAAAGTATTTTAGG
ATTTTTTTATTTTATACTTAATATATTTTTTACAAGTAGTATACGATATTTGGTAGGGAAGGTTTAAGGGAGGCTAATAAGGCCTTTGCTTTACGCTCCT
GGAAATTTGTGCTTCCAAAGTTTTTAATTAATGAGTTATTTTTACTTTTACTTAAATAAGTAAATTTAGATTTTTTTTTATATATAAAAAAAATTATAAT
AAAATTGTCCACTCTTTATATTGGATATAATATTTTTTAATTTTAAATCAAACTATTTACATCTTTATATTAGTAAGTGAAATTTTATATAGCATGATCT
AGACAGATTAAATTGCAAACAAATGGACAATATCTATTAACTTGAATTAATTCTTATTAGTATAATTATTAGTAATTGTTATTAGGTGAAGTTACACCGC
TGCCTTAAATTTAAAATAAAATTTTTGATGGAATGTGCAAGATCATAATGAAATAGAAAATGATGATGAATTAATTGTCAATGTGTAGTTAATGATATTG
CTTAATTGCTTCAAAGTTATTATGTTTATGTGTCAATGTGTGATTTGAAGGTTCTTACGTATTGAGCTTTGAAATGGTATGATGAGTATGTCTAAAGTTG
GAGAAGATAGTTCCTCCATAAATGAAATATGAAATAAAGATGATGAGATATGTGTCCACGTTGTATTTTGGAAATAGTTTCAAATCCGCTTGTGTTGCTT
GAAAATGATTAAGAATATGAAATTGGTGTTCTTCGTAAGTTTGATGCATTGACTGTGACGGATTATGTCCATGATTACATGTGTTGTGAGCTACAGTTGA
GTGCTTAATGTTCTGAAGAGACCTCGTAATGAAATATGAAGATCATCGAATATTTAAGCCATCAAAATAAAAGTTCAAAAAAATTGATTAAAATGTTAAA
ACGGTATACATATTATTATTAAATAGACAATGATAAAGGAATCTGCCAGCCATAAAAATCTTTTAATATAAGAATTTAAATGCTTTTTAATAATATTTTG
TATAAATAGTAATTCTTTTCAAACAAAAGTACTATGCATATTGATACTTACATTTATCTCAAAATTTAAATTTAAATAAATGAGATTGTTGCTTAATTAG
TTGTAATGGTTTTACAAAATGATTTTGCTACATCAAAACACTCGATAGAGTTTTACCTGATTATATTTTTAAAAAAAACTTGAAAGCAACCTAATACTGT
AATTATACCTTACCAGTTTTAAATGATTATTACTGTCATCTTTTTTCTAAATTTTTTAATAATCTAATACCCCTCTACCACCTTCGGATCACTACCCTCC
AAATTATTCGTTGCAGTAACTATTGATTTTCACTTGTGATTCTAGTTGTTTGGTAGTCTTCATCAGTTCTATGCTACAATTAGCAGTTGTGGTAACATTA
GTGGGTTGAAATGACTTAATCTGTGCTTTTCGTGAATTGTTCATTGGACGGGTCAAAATAACTTAACATGTAATAAATCTATTTAGATTGGTCTAGTCTC
AAATGCGAGATAGTCTTATCGTTCTAAAATAAAAGCGAGATGAATAATGTTCAAATTCAATATGAATCTATGATATTATGTGAATCTCAATGACGATGTG
TCACTCTTTATACAAGTTGAAGAATGGTGTAAATGTGATGTGCTGATGCTAATGGCTAATTAAGATTGCAAGTTTCATGTCTAACGTGTTGTTTAGTATT
TGCTTAGTTATTTAGTGATTGTATACTTGATCTTACATCTATCGACTTAAATTAATTTTTAAATCTGTCCTTACATAAAACGAACTTCATTAATACCCCT
CCAAATGAATATTGAATAGTTCCAAAGGTGCAATCAAATCTTAGAGATGTGAAAAGTAGACCATCAAATCTCTTTATGACATTCCACTAACTAATTGTAA
ATATTGGTCCCAAACCGTGTTTACGTGAATATTGAATAGTAACAACGTACCCAACTTCTTATCTAAAAATTTTCAAATATCATTTGGTGTATATTTCTAA
GGTCCATAAAAACTAATCTAAGAAAAAAAGTATGGATCTCACTTGTCATTCCATGGATAGTAGTCAAGGGTGGACCCGCGTGGGATTCAGCGGTTCACCT
GAATTTCCTCAATAAAAAATTATCCGGTATATATAAGGTAAATTTTACGTATATCTGTAGATATGCAAAATTTTGAACCCCTTAATGATAAAGAGAAGAT
GATGTCGCAGTGGCAAGTTCCCCAGCAATTTAGCTTCACACCTTGAACAAAAATTTCGAGTCTGCCACTGATAGTAATAATAATTTGGTTGAAGTTGAAA
AAAAATATTTGAAAAGGTTGTGTCGATCATGAATTTTAATTTACTCGAAAAAAATGAAGTTTCATGAATAAAAAAAATACAATTTCACTTGAAATACTCT
TTAAATGATTTTTTTCGACTTCAACTTGCAGATAATGACCTCAAACGATTCTATATATGATAGACTTCTTATGTTGATTATTTTTTCGCTTGTTTTTTGC
TCAGTGTATAATATCTATATTAAAATCATACTTGCATCGAATTGATAATTTAAAAAATCCTCTTTCTATAAAAGATATTTTTATACTCAAAACTCGTAAT
CGACATCAAGATGAAACGTAGGTTTGGGAAGTAGAACCACTCATTGAGTTGTGAAAATGACAATAAATGAATGAATGGTAGTGAGCTACAATAAATAGAA
TAGACATACTGTTGAGAAATTAAAAGCAATAGCATGTGTTTCTGATTCCAACCAATTATTTCTATCTCCATGTTTCATAGCATGGCTGACCCCCTCTCCA
TGTGGATATATACATCCCCCAATCTACTCTTTTTTTAAAAAAATAAAATAAAAAATAAATATTCTATAAGTTTTATTTTAGGTATGATATCATAATAATA
TTTTCACAATTAGATAATTTACAAATAAATTTTTATAGAATAATTAATAGCCAGAGGACACGTTGGAAGTAATAACCAACCTGCTACATATATTTAGTAA
TATATGATGTATATCCACACTAACTTATAAACTCTTTTTTAAAAAAAATAAAATAAAATTGTATATTATAGCAAATTATTAATTTCAAATTAAATGTGTT
AAATATAGTTTGATTTAACTGTACCATATAGTAATATACTGTTATTTTCGTCTCCCTTTGTGGTGGAATCTCGCTTGCCACTCTCGTTTTTTGTGGCAGT
CTCGCTTGTCTCTCTTGTTTTTATACAAACACAAATGTACAAAATATGTTTGTGTTTGTGTAAAGCAAGAGAAAATTATATATATACATATATTTTTGTT
CCCTTCTCCCAGATCTCGCTCGCCGCTCTCACTTTATACAAACACAAATGAATACATATGCTTTTTGTTTGTATAAAGCGATAGGAAATTCTATACACGA
ATACAAGTGCCTATATTTCTGCACTATACATTTTATGATTATACAAATACAAGCTTCATCTGCCCAGTTTTCTTTTGTATTTCTCTCTTTATATAAACAC
ATATTATACACTTGATCTTTTGTATATGTATAACGAAATAAATTATACAACTGTTTTCTTTTGTATATGTGTAGCGAATTATGCAACTGTTTTCTTTGTG
TGTGTATATATATATAGCGAAGTATACATATTTATGTTTCCTATGGAGCGCAATTATGCAAACTATAACTATAGCATACAAATATGACTTTTATGTTTGC
TACATGTGAAAGTTGTTCTTTTTTTAGCGGGTGTCCAGAGTCCACATTAGAGCATTGATCAAATCTGGATCACGCATTGCAAGGCTTATTCGAGGTGGCG
CTCCCAATGAAATTTTTTTCACGCCCTGAGCTCGAACTCGAAACCTTTAATTAAGAGTGAAACAGTCTCACTGCTGCACCACAAGTACTCAACAACCCAT
GCTGGTATAACTGTACATTTGAAATTGTAACTAACTTCTTGTATCATATTTAAATGTCATGTTTCGCTTTTTTAGAGGACGAACTCAATGTTTCAATTTT
TTTACAAGTAAAACTTATGTATTAAAAATTATATGAAAAATACTATAAGTTATAATTTTTCCGACCAAAAAAAATACATTTTAATATATTTTTGTAAGTT
GTGCATGTGATGAATGATATATAGCCGACTGGATATCACTAAGTAGCAAGTGAATAAAAAGATGGTGTTGCTGGCCATACAGCTCTTTGTCCACTGAATA
AAACAAATAAATGACAAAGCATAGTCCACTTGCATGATTGAAATGGATGAAATTAAACAAATGAAAATAAAAAAAATATAATATAATGTATATATTTACG
AAAATTCTATATTTCATATACAAGTTGTATGGTTTTTAGCTTTTGTTTTTATTTAATTTTAGGACTTCTCGTTGAGATTCTCGATGATGAATAATTGTTT
CTAGTACTTATGGAAAAACATATATTTCCAAATAAATCAAAATCGCATATATGCACGTACTCTCTTCGTCCATGATTAATGGTCATCGTTTCTTTTTTAT
TAAAATTATAAAAACTTTAATTAATATTTTAAAATGTATTTTTTATTATATTTTGATATGGAAAAAATTGTAATTTATAATATTTTTCATTTTTTAATAT
CTAAATTTCTTGTTAAAAAATATCAAATTAATGTAATCTAATTTAACTTTTAAAATTAATTAAATTAATTTTCGTAAAGTAAAAATGACAAATAAAAATA
GACGAAGGGAGTATTTTTTCTTTTGTAAGATTCAACTTGCTAGGAGGATGGAATAAATAAATTTATTCAAAATATAACAAATGTAGCAAACTTATAACTC
TTAGTTTTATCAAATAAAGAAAAAAGAAATGAGTACTCTCGGATTACAAATATTTCTTCTTTTTTATTACCCCTTTTAATTTTAATAATAAGTGTACTTT
TTAAGAATTACACCTTTAGAGGTGGTTTGATAGGATGTATTTAAAAAAATAATGTGTTAATCTTTTATATTTACATACTTTAATGAAGGAGTATTTGATA
GATAAAACCTGTGATCTTTTATCTTTCCGGAAATTATAATATTTTGGTCACACTTCGCACATTTTTATTTATTTACTATACTATTTTTGAATGTTCAATA
ACAATAATTTTTCGATTTATATATAGTGACGGGGTTAAATTTTCAATAAAATGATTCAAAATCTAAAAAAATAGACACAAGAAATATAATTGAAAGGAGC
TCAACATCTACTATTTATATCTAAAAAATTATTTTAACCATATATAAATCATATAATTTTCTATCGAAGGGGATAATCCCCTCATAGTAAAGTGGCTCTG
CCATTATTTATACAACAACTGAATAAGTTATCATGTTATGTCTATTTTATATTAAATACTAGTATTTTTTTTTTAATGTTTGAATGTCTTATATTTAATA
AAAATGATTTGATAAAATTACTTTTATCATTTACTCTTTTTTTTAAAAAAAAATAAAAAATAATTGAATTAATAATGAATCACTATTATTGACATGCGAT
TAGTGGAATTTACATAGCAATTTCTTTAATTATATAATTGACTTTGTAACGGATGAATAATCGTAAACTTTTAAGGGATAATGTAAATAATAGCAAATTA
ATAATCTAAAATAAATGGAGTAGCTACTGTTTGATTTAATTGTGCCCCATAGCAAATGTTTGCCAAAGTTTGTCGGTCACCTCTCTCCCAAAACTCTCGC
TCGCCACTCTCTCATTCTCGCTCGCCACTCTCCCTCTGCTCGCCTCTCTCGCTTTATACAACAGAAGTGTATAAATTGTGTTTCCGTTTTGTATAAAGCG
AGAGAAAATTGTATATACACATGCAAAAATATATATCTTCGTGCTATACACTTAATTATACAATTTACAAACATTTTACTTCGATTCAATTGTATACAAA
TGCAAATTTTATACAAATACTGCAGCGAAAAAGGCCAGTGAATTATACAATTGTGAATTATACAGTTACAGTGAAATACAATTTTCTCTCGCTTTATACA
ACAGAAGTTTATAAATCGTGTTTCTGTTTTTGTATAAAACGAGAGAAAAACATATATTTTCTTCCTATACATTTATAATTATACAATTGCGCATTGTACA
ATTGCAGTGAAATAGGCCAGCAAATCATACAATTGTATATGTATAGCGAGGTCAGTGAATTATAAAATTTAGGCCAGCGAATTATACAGTTGTATATGTA
TATCAAATTATACAGTTATATATTTGCTATGCAAACTTTGTTAGAGCATACAAATATAAATTTTTATTTGATATATATAAAAGTTAGCTCATTTTTTAAT
CCTTTTTGTCACACCTACATACAATCACCTTAGATTCATCCGTAAATTACTTCAATAAAAAACAATATAAAAAACAACCAAGTATTATGGATAAAAATAT
GTATATGTGTGCACCTAGAAAATACTAAACCAAAATCAAATACTATCAATTTTTATTAATTTAACATCCCCTAAGCAAATCAGTAAGTCAAAGAATACGT
CGTCAGCCTTTTATATTAACTTTTATTTAATTTCGATTCGATTTGATTTTTTATATTTCTTTTAACACCCTAGCCATCACTTCTGTCTCAACTATATACT
TGCTGAAAATGAACATCAAAGAATAAGAACAAGTCTATTGCTAGTTGTAAAATATACTGTTTGAAAAGTTCAATCAATAAAACATTTAAAGATTACAAAA
ACTCTTATAATAAAATGTTTTTGGCCATATATATGATTCTTAATTTATAAGTAATTATTAAAGTATATATGAGGTGTTACGGTATAGTACGGATGGTACC
ATTTCTTGGGAAATGGGACATGTCATCATGTGATATGTTTTTTTTTTCTTATATGAAGGTTTGGTGTTTGAATTATTACATACCTAGTTTGATATCAATA
TTATTAAAATTTGATTAAATTTAGATCTGAATAGAAAATTTAAAGAGTAAATTATGATTTCTAATAAAAATAATTTTAAGCATTAAAATTAAAGCTAAAA
TTTTAATTTATAAATGAAAGATTACTTAACGCTCTGCTACTACGAAATTGTATTTATTGAATTATGGCCTTTGGTTATGAGAAAAAGTCAGCCAAATAGC
ATATAGGTTTGTGAATTGATTAGGTACATGTGCCACATAACATGTCCTATGTCTTCTTTATTGTCTTTTAAACCCCATAATAACAACTTGGTCAAGAACT
TGTTTATTTTCTTTTTAAGTAATTTAAAGTTTGTGCCTTTTAGTTTTTTTGAAATATTCTATTTAATATTTGCATTCGTTTTCAATACTTCTTGCTCACC
TAATTACACAAAGAACAAAAAGTATATGAAAAAAGTAGTTGGGGAGGGTTGACGTGATCTCCATATAATTAATATTTCATTCGTCACATTTTATGCTTAA
TTAATTTGAATTTAATATTAAATTTAAGATTTTTAAACTTGTGATCTAAAATAAGTAACAGATATTTGTGTAATTATAAATCATTTTATTGAGAATAAAA
TATGTATTATATAAAATTAAGTTGTCTTTTTTAAACGGACTAAAAAAATAAATTATATAAATTGAGACAGAAGAAATACTATATGATCTACAAGTAATAT
GTTGAGTGTGTGTTACATATTGTTTGAGAATTGTTTATTATATATGTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTGATATGATCACACTTCCATCAAATTTATAAAAAATGTTGTGATTTAT
ACAAATGATGTCTGTAATTTATACAATCAAATGTTGCTTATGATTTTATACAAATCTGATGCTCCATAGTGAACATAATTTGCTATGGAGCGCAAATCAC
CAAACTGTAGTTATAAAACGCTAATTTGATTTTTATGTGTTGCTAAATTCAAAGTTTACTCATATTAATAAGGGATAATGAGGAACTAATTAAGTGATGA
ATGATATGTCTTTTATTCTTCTTTTATTTTTCAAATTGAATAAACTTGTAAAAATCAACATCTATTTTAAATATAGTCGACAAGTAAAAGTAAACAAAGT
ACTATCAACTCCTAATTAATTCAAACACGCCAAAACACTTTATTTGTTACATTTTTGTTTACACACCCTTAAAAAACTACGTGATTTGATTATAATGTCT
TTATTTATTATTTTTTAATTATTTAAAATGTTAATCTATCGAGTATCTTTTGGAAACAATTTTTTTATCTTTATGAAATAATAGTAAAGTCTGCATTTAT
AACTCTATCCTCCTACTCCCAAAACGTCACTAAGTGAGATTTACTAGGTATATACATTATTGTTGTATTTTAAATGTTAGAATTCGTATAAGTAATATTT
ATATAACGCTTACTAATAAACACATATTGTAAGTGATAAAAACTTTTGAAAATATGATTTTGAAAGTAATATAGATATATAGTTATTTACGTAGTTATAA
ATTGGCAAATTAAAAATAAAACTAAAAGTGTTTTTACATATAAAATATAATAATATACTCACTATTTTATATGGGACAAATATTATATAAATTAATACAT
ATGAAATATTAACTTTTTTTGAAAGAAATGTAACGCTATGGGTAGAGATAAAGTATACATTTGCCATCGTCAATTCACATTTAAGTTATAATTAAAGTTA
ATATAACTTACAAAAATAACTTTTGAGGTATGAATTTCAAAAAAAATTTAAAAATTCCGATATACACATATGAAGTTTGAATTGTATATCCGTTTTAAAT
ATCTAAAATTTGGTTCGTATTCTATGAATTTTGTTAATGTGATGTGTTTACCCTTATGGCTCTTCGTTGCTTTTAAAGATTAACAATTTGCTTTCGGATT
ATTGTATACCCTCCAGCTCATCACGATGTTTAAATAAAAGTCGTAATTAGTAAATGGTAATTAATAATCATTTAAGCTTTTTCCAATATAATTAATTGTT
TGATATTGTAATATAAATTTAATGACCACTAATCTGAAGTGTACATGTCTATTGCGTTACTTTGGATTTGGTCAATTCTTATTCGTTAGCAAGTCCGTCC
TAGCGAAGTAAAGTCTCTATACCTATCGCTTGATTAATCTGATCAGACTCTTACTCTTTCCTACTTTTAACAAAAGAATAAGAACTCAATTCATCCTTAG
TAGTATTCTATAATATCCTATATATCTCTTTATCTTGGCTAACTCTTTCATAAAAATGTCTTTATTTTTATTTATAAGAAATGACTAATAGCTTGTTTGG
TTAAGTTTTTTGAGTGATTAAAAATATTTATTTAAAAAGAATAGCGTTTTTGGTTAAGCTTTTGAAAGAAAATAAGTGGTCGGGTAGAGTAGCAAAGCTA
AAAACAAATATTCTTTCTAACAAAAAATACTTTTAAGTTTACAAGTAATTTTAGAAAGCTTGATCAAACCGCTCAAACGTTGATTGTTATCCAAAAGTAT
TTTTAAATTATCGATCAAACACAAATGGCTTCTCACTAATTTTATCTTTTTTTTAAAAAAACATTTTAAAAAGTAGGTTAATTTTAGAAGTTTATTAAAA
CAAGTTATAAGAAATAAATAAAAATTTATTATATTTTAAAAAGAAAAAACTTATTCGCTAATTCGCGTATCATGATATCAATCCCCTATCACCAAATCAA
TCACTCCTTGTCTACTCCACCCGCCACCGCGATCCCAAGGCCCCAACGGTCTTGCTACCTCACCGTATTTTCTATATTATATATAAATATTTTTAAGAAT
ATGTATTTTTATTTATTTACTAAACACTAAAAAATAATAGAATAATCACTAATTTTACAAAACTTATTTCTTCATATTTACAAATTTTAAATTTTTCATG
TCGCTCTTATTTTATTTTGTGAGATTCAATGTATTAGTAGAGTCTTAAATCTTAATTAATCTGCATTCAAGCAAATGGACCAATATAGGGCCGTTTGGAT
CAGCTTAATAAAAACAGCTTTAAAAAAGTACTTTTGAAAGTGCTGAAACTTATTTTTAAAATAAGCAGTTATGCGTTTGGATAAAAGTGCTGAAGTTGTT
ATGCCAAAGGAAAAATGGAAGAAAGAGATGTTAGGGTATATGGGCAATTTGGAGATTGTATAAAAATATTATGGGCAAAAAGATAAAAATGTGGTCAATT
TAAAACAACCTATAAGCTAAAAAAAAAAAAGCACCCCTACCCAGCTTTGAACTTTTGACTTAAAATAAGTTTTTTTTAACTTAAAATAAGTTATTTTGAA
TAATACCAAACAGTTAAATAAGTCAAAAATCAGTTTTTAAGTCAGTTTGACCAGCTTTTAAGCTGAGCCAAACAGGCTCATAGTCTTTCAGTATTAGTAC
AATAAAGCTGTAATTAGAGAACATTTCAAAGCATGGATTATAAAATAAAATCTCAGTCATTAATTAAAAATAATCCCACTTAAGTATAGTTGGTGTTTAA
ATTAATTAGATGCCAACAAAAACCGTTGACCTTAATTATAAATATGTACCACCTCTCAACTTAAATAGCCAAGAATCTAGCAAAAAGTCTTGGTGCTGTG
ATTTTTTTTAATTATAATTAATTCCCTGTTAATCAATTATACATGGCTGCCACAATTCATGACTTAATTTATTAATTTGTTTCTCTATTATCTTAATTTG
TTTGTATGACTGGCGAGAAACCAAGTCCTATATTGTACTATAAATTTATTTAGTTTTATTATTATTAGTTCTTAGATCATGTTTGAAGAATTAAGAAAAG
CAAATTGATAAAATATCTGCATGATGGAACGGATGACATGAAGGCTACAATGTGTCAAAATAATACAATAATAATAAAGAAAAAAAATTCATTGACCTAA
TTAGCATTTTAATTATTACTCTAATAAAAATTGAGGTATTGTTGCTTACATGTTTGGTATAACAACTGCCCTCCCCCCCCCCCCCCCCCCCACACACACA
AAATCCAAATTGAGATAATAAAAAAAAATTGTCAGACACCAAAAAGAAAAATTAAATTAAATTCATTTAGTTATGATCCACAATGTCTTTCATGAGTTAA
ATTTTTTATATATGGATAATAAATAAAATTTTAATACACAATCAAATCATTAGGTTATAAGTAATCATCTTGGATAAATTTGTAATTTAGAGAGGGAAAA
TTAGTGACTACAGTTTTGATGCTGAATTATTCGAAATAGAATAATTTAATTGTAGATTTAATTATTTTTTAATCAAAAAATTCTATCGCTAGCAAAATAG
CTCAACAATGGCCTTCCGACTAAATGTTATTTGTATTTGAATGAAAAGGGCTGATTTTGTCCTTCGTCTACACGTCAAAATGATATCATCCCAAACAAAT
TGGAGTCAATGAAATTAATTAGATCTCTAGTAATTTAATCAAGTTTAGTATTACTTAATAGTTATCTCGGTTAAATTTACCATATAAATTATGGGTTGAA
GTCCATGAAAGTCAAAACTTTTGATGAATATAATTTCTGGTTATTATGATCCACAAAATATATAAAAGCTACAAGAAAGGATATGAATGTGGATGGGAGG
TTCTTCGATATCAAGAGTGTGTTAGGGAGATCAGTGAAGATGGACTGAATCTATGTATATTTTTTATTTTTATTTTTTTGGATAGGATTCTCATTATTAT
GATTATTTATTTGTTTAATTTGAAGCTACCTCTCCAAATGATTTTTAATTGGGGTCATTTGGAATCCTTAATGTAATTATATGATTTAAGGAATTAAAGG
AATAACTCATTAAAAGCAAGCTTAGCTAAGCTTATGGAAAACTAAAAGTAATGTTTATTTCTTTTTAAAGAAAATCTTATTTTAACTTTGCTTTCCGCAA
CTTAAATTGTTTGGTCTTCCTATTCGCTTTGGATTGAGGTGTTTAACAAATTTTTTGAGGAACACTTTTGATATCTTGAGCAATCATAAATTGTTGTTCC
AATATTAAAAAAAATATTTTTCAAACAAGCTAGCAAAAAATTCAAACGATTAGTATCATAATATAAGAGATTTTGAAAATTTAGTCAAATAAACTATATA
AAGTCTCTTTTAATAACATCCTCCTCAATCCACACATCACCTCGAGGCATATTTTTTTGACGTGCTAGTAGAGTTAAGTTCTTTGTTTTGACTTTTGAGA
GGAAATGAATAGTTGAATACAATGTATATAAATTGGAAAAACAATAAAATACAATGTATTTAAATGGAAAATAACCACATCGACGAAGAGCCTGTAGCAA
GTTGCACTTAATTAGAGAAGATGTGCCTATCTAATTTAATATGAAAATTTTAAGGAGGATTTAATTTTAATTTTTGTAAAAAGGCTCTAAGCCATTTTTA
GATTTTTAAAAGTTAAATCCTTTATAATATCTGTTAGATTAGCAAATATGAAAAGCACGCAAAAATCAATATTACGCTAAACAAATGAATTTTAGATCAA
TTTTTTTTGAGTTTTAACATAGGTCATATAAAGAGATTATCTATCTCATATCGGTATAAGTGTAATTTGTGAGACTTTTTTAACATCTTCTTATATTTAG
AATTAAATGTCTGGAGCGTATAACAATTTTAATATAAGTCATGTTCAATATCATGAATCAAAGATTTTAAGGGTCTTTTTTCGACTCCAATCTAATAACT
AGCTTAAAATGTGAGAATTGTTCAATTCATATAAAAAGTCCACTCAATATTTCATAATTAATCGGTGTGAGGCTTTTTCAACCGTTGNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTCAATTTTTAA
TTGTCATGTTGTGCTTTTTAAAAATCAATTTTGACTAATTTTTAAAATTATGTTAATTCTATATTTTAAACAAAAGTTTAGATATTAAAAAATTATACAA
AAATCACCGTAAATTGAATTTCTTTAATATTAATATGATTAAAAAACAATTAAAATTTTTATAGTTAAAACAATTACAATTAAAAGTGATTAGAGGAAAT
AATATATTTCAATAACTAATTATATATGAATATATATATATAAAACAAATAATGCATTATATTTGTAACTTTAACCAACTGTCAAACAATTCATTAAAAT
TTTTATGAATCTAATATATGGAAAAAGCCTGAGCTTTTTATGTTTTTAAATCTCAAATTATATAGCATATATTTTTTTAATCAGGAAAAAAATTACTTTT
AAAATATATATTTTGTTATAAAATAATTTATTACAATACAAAATATTTATTTATTTATTTTAATTCAAATATATATATTTTTAAATTAAACTATATCACA
TAAATTTGTCGAAAGCTTAAAATATGAGATGGCGATGGGAACGAGTAGCCAATCCAATTAATTTGATATTTACGAAGTATCTTCTCCTAATAATATTCGA
CTCCATTACAATTTCCACATACTTTCTTCTTCATCAAGTCTCTTTCCTCCATAGACTTATCCCCAAATATATAAACTCACCCATCTTAACTATCGAAATA
CCCATTTCGATTCTTCACTCCTTCGCTAGCTTTGTTGCTTCGGTATGTTTATGTACATATGCACATACTTTATACAATTTCAATTTTTCTATTTGTTCTT
ATAGTTTAATCGTTTTTGTGTTAAGACCTAATGTGTGAAGGAAGACTTGCTTGCTAGTTTGATCTAGGTCAACTCTGTATACTTTCAAATTAAAATTTTG
ATATTTCGAAAAATGTCACATGAATTGGGGAGGGGACAGTAGTTATAAGCAGAAAAGTGTTGTTCTAGTTTCTTTAATGCCATGAAATTTAGTTTATAGC
CTTGTTGGATTGGGTGTTGGATTATGGGTTTGATAAGGTAAAGTGGGTTGAGAAATTTGACAGCAGAATTTAACTTTGCCTTTTATAGATGAATATTGAA
AACAACAATTGAACTGGTGATATTGTCATTTAATCTTTTCTTAGTTAACTGGGAGAGTTTATTGCTGATGTTCAGTAACTTTGTAAAAGAAACTAGAGTA
GCAGTTGCTCCCTAAAGTGTGACTTAACAGTTTGTAATCTTTAGTTCCAGGGAGAAGTTCGAGAATATTACCCTTTTTGGATTTGTGAACTTGAGGTGTC
CCAAGTGTAATTTGTAAAGTGTAAACTAACTATTGTGTTCTTTTCGTTTTAGAATTTGTTACTCGTTTAAATTGCTCCTTTATAATGACAGGTTCTGATG
GTGTAATATATCATTTTTTGAGTTTGTTTTATGGGTGACTTCTGTGAATAATCTTCCTTTTCATGCAATCGTTGCAGAGTATGGGCAATCTATTGGGCTG
TGTACAAGTTGATCAATCCACCGTCGCAATTACAGAGCAGTTTGGCAAGTATCAAGATGTGCTTCAGCCAGGTTGCCACTGCCTGCCTTGGTGCTTCGGA
TTCCAGTTAGCTGGCCATCTCTCCCTCAGGGTGCAACAATTGGATGTTCGCTGCGAGACAAAGACAAAGGTCTATTCTTTATTCCGAAACAGTAATTCCA
TTGTTTTGACACAAGCTGTGTTGGTTCGCAGCCAAATCATCAAAGTCAACCACAATTTGCACTTTAACAAACATAACTAGGTGATGATTTTTCAGTATTT
ATGCATATTAATGACTTAATACATATTGCAACAAATGTGCAGGATAATGTGTTTGTCAATGTTGTGGCATCAATTCAGTACCGTGCCCTGGCAGACAAAG
CAAATGATGCTTTCTACAAACTAAGCAACACTAAGGGTCAAATTCAGGCCTATGTTTTTGATGGTAGATATTTAATCTGTCTGTTTATATACTATTTCTG
AGAATAAATTGATTTCAATGGGTAATGCTAACTTACACAAATCTATGTTTATATTTTGTCAGTCATTAGAGCAAGTGTTCCAAAACTCAATCTTGATGAT
GTTTTCGAGCAGAAAAATGAAATTGCCAAGGCTGTCGAGGATGAACTTGAGAAGGTAAGCCGATTCTTCAATGTTTTCTTAATTGATACAGGCAATTTGA
ATTTTTCATTGGATCTCATATGTATGTCATTATGATCCTTTATAGGCTATGTCGGCTTATGGATATGAAATTGTTCAAACACTTATAGTTGATATAGAAC
CAGATGAGAATGTGAAGAGAGCTATGAATGAAATCAATGCTGGTATGGCTAAAATCTCATCTCTTTAGTTAAGCCTGATGCCTGCTGGTTCTCAACTGCT
CTGACTAGTTAGTACTTTGTCCAAGAGGACTATATACATCAGTTGATGGAGGGGGCTACAGTGGGATTCGAACCCACCATCACTAGTGTGAAGGTGTGGG
CAGCTCCCCAACTGAGCTACAAGCCACACTATAAAAGAGTATCTTTTCATGTCCTAATTGTTTTCAATTCTACAGCTGCTCGGCTGAGGGTGGCTGCTAA
TGAGAAAGCAGAGGCGGAGAAGATTTTGCAAATTAAGAGGGCTGAAGGAGAGGCAGAATCAAAGTATCTTTCAGGGTTAGGTATTGCACGACAGCGTCAA
GCGATTGTGGATGGTTTGAGAGACAGCGTGCTCGGATTCTCAGTGAATGTGCCTGGAACCTCAGCAAAAGATGTAATGGACATGGTCCTTTTAACCCAGT
ACTTTGACACCATGAAAGAAATTGGCGCTTCCAGTAAATCATCTGCTGTCTTCCTTCCTCATGGGCCTGGTGCTGTAAGAGATGTGGCAAGCCAGATCCG
CGATGGACTCCTTCAAGCTTCTGTGAACCATTAAATGTTTCTACTATATCAGAAATGTTAATTGTGTTTCACTTGAAGCAGCCTTTTTCATTTTGTGTTT
ACTTTCTGTTAGTGTGGATATGTTTGGCGAGTTTGACTTTGTATTTGTGAATGCCTCTAGTATCTTATATTGTAAAGAATTTAATATCCCAGACCTTTGA
AGAATTATATACTATTAATAGATGGATGTGATATTTCTCCTCGTTAATTGTACCTGTTTATTTGTTCCTTTTACCCATTCTTCATCCTTGATGATTGATC
TTTTATTGTTTTACTAGCTATGATACCTAGACTCTTCAAAAATGTCAATGATTGTGTGTTAAAGTCGTCAATAGTAATGTATTTTTGGAGAATGACATGA
TGTAACATTGAACCTGAAGAATCTGTGCAACTTAGCTTATTGGTGTGTAGTACAGGGTCATATTTTTGTTGTGTGCTATGCTAAAGGAAGGTGATTGATC
CCTCAAAATAACAGGAAAAATTCCAAAGGGAGGTTGTATCAATATTCTTGCTTGTTTTGGCATACACCTATTGGGCATTTCACCTGCTAGTTTAAGCGAG
TCAAAAAGTTGATTAACATTTGTGAAGGGACTTCTTGTTCACTCACATAGCTTTAACTTTTGTTTCGATTTTCAAGTGAAATGCATATTTTAACATAACT
TTTAACGTTCAAAACACTATACAAATGCGAAGATTTATGGCCATCAAGGCCCTCCAATAAATCTATTGGAATTGGCTTTATATCAATGTAATATCATTAT
TCATACGTAATAAATTTTTGGATACCCTTTAAGAAATTTCTGACTCTACTTATAGAAAAGAAAATAAATTTATAGATGAAATTAAATATGCAATATTTTA
TATACGAAAATATTCTATACCTTTAAAAAAAATTATGACATGAAAAACACGCTCTTCTCTTACAGGAGGCTTCCCTCATCTTTCACGTGCCTTCAAACAT
TATTTTCCTCGATATATAGCCGTAAAATCATAAATGCATTCAATAATATATTTTTAAAAAATACATCAATTGTATGAAATATATAATTTGAAATAATAAT
GAAAAACCCAAGTAAATGACCAATATGATTATAAATAAAGAAAAAAGAAAAGGCAACTAAAAAGAGTAGTTCCATAGATCTTGTATAATACACCCATTCA
CAAAATTCCTCCTTCTTTACTGTTTTCCCCTTTGTCCTCTCTCTAAATTGTGTGTGCTCTTCTTGATCATCTGGTGTCCAGTTGAAGATTGTAGATGGAT
CATTCATGGCGTCCTCATCTTCCTCCACCACCAATTCAAGGTAGAATCTGTCCATCTTGTTCAATCTCACACTTCCCCTTTTGCCCCCCTCCAATCCCTT
TCCCTTCAAACCCTAGTTTCCGATATCCACCACCACATCCCAATCAACCCCTCTCCCGCCCTCCACTTCCTCCTCATGAGGCCGCTTACGACCCCTTCAT
CGATCATCGTGGTGGACCCCCTATGCCCCCTCCTCATCGTCCCACTGTTGATGGCTACGAGCATCATCCCCGCCCCTCAGATGTGTATGGAAATATGAAA
CCTACTTATGATTCACCTGGTGCTTTCAATGTTGGAGTGAAGAGAATGAGAGTTGATGATTCATCGGGTACTTTTACGAATGAAAAGTTGACTAGTTTAG
CTAGGTTTTCAACTGATAATGAGAGGAGATTGCAGCTGATTAACGAATTTGGTGGGGCAGCTTACGAATTAGACAAAGGGCGTGGAAGTTTTGATGGTGA
AGAATATGGAAAATTTGATGGATTTTTAGGTGGAAAAAATAGCAATAGCAGTTATGTAGATCAAGGTTATGGTAATATGGATAGAAATCAAACATTTTGT
GACCAAGAACGTTTTGAGAGACAGCAATATCCACCGAGGGAAGGGAATGTACAGTTTGGACAATTAGGATATGACAAGAATTTGCCAGAGAGAAATGGTT
ACAAATATGGTAGTCCTCGAGCTGATACTCACCACAATGTAGAACACAACCAACAGAATTGTGAAGGATCAAGGTACAGCTCAAAACTTGGAGGTGGTTA
TCTTCCAAGGCATGGAGTTTCAGGGATGAATAAACTGTACAATGAACAGACAAGCCATTTGCCCGTGGATGGTCACAGTTACAACCATCATTATTCGCAG
GCTTATGCAATGTCAAATCATGTGGATTCAAAATCAAATCATTATGGTTCCCCACATGACCAGAGGATTAATTCAGCTGACCGTAGTGGCACAAGCTTAT
ATTCGGCACAGGGTTGTAAGACATACGCTAGCCAGCCGCCACTTCCAGCTTCTCCTCCACCCCCTCTTCCATTGGAACCCCCTTTGCATGAACGTCTTGT
CTCATCTTCACCTCCTAGAACTTCGGCCTCATTGTTTCCAGGTTCTGTTGGTTCTTCAGCTCCTTTGTCATCATATTATCCTCCACTTCCGGAAGAGAAG
TCCATGTCACGTTATCAGCCCAATTTACATTTGTCATCTTGCACTACTATTGAGGTACTCCTTCAATTCTTTGTGGGATTTGTTTATGTTCTTCACTTTG
CAGTCTGTTATTAAGTGGCTCACAAGATAATATTATATAATAAAGGCCTAACCCATTGGTGGCCCCTAAAGTAGACACCTTAACTAAGTCATGCTTATTT
TAGACACCTCATGTAGAATCATGTAGAATCTCGCTGTGTCATTTTGACTCTTTTTGCTTACATGGAATAGTGAGTGTGATACACTCATCGAGCGTGTGAA
AAGGTTGTTTAGTTAATTTTTGAATTATTTTTTTCTTCTTCTTCCCCATTTTTTGTCACTATTTTGTCCAAGTTAAATTTCAATACATTGTGAATGAAGG
TTTCAACAAAAATGACGGAAAATGCTTCTAAAATTTAAGAATAAACCCATTCATAAAATTCTTTCTTAGAAAAATTTAATATTTGCATGGAAGTGAATTT
AAGAAGATCGATAAAAGCTTATTTCGATAATTTGTGGGCTTGCAAAAAAAAAATAGAGGTATTTGGAGAAGGCAATTTTTTTTTTTGTAGAAAGGTATCT
GGATGAGAAAGTCATTTGAGGGGGGGGGGTTGGAGAGGACTATCAAAGGGGTTCGTTTGGTTGGGGTGCGGGGTTTAGAGAAGGTGATTGTCCGGGGGCC
AAGTCAAGCTTTAAAAAAGAATCTTTCTGGATGTTTTGATAATCTTAATCATATCCAAAAGTAAGTAAGCCAAGCAAGGGAAATCGCCAATTGATTTCCT
GATCAAATTAAGAACAAAACAACACGCCCACAGGCTCGGCCTTAATCGAGTCGCCCAGGCCGCAAGCGATAAACAGGTAGATTCTCACACTAAAGAAGCA
GTGGCTACTAGCTGCCATTGCTGAAGTCCAACATTAGGAACAACCTCAACCTGGTGGCCCAACCCAAGAAGCTGCTGCTGAGCGTGTAGAGGCTGGAGCC
AAGCCTAGAAGGATTAATCAAGGAACTCAATGGGGTTTGGAAAGGACATCGGGGTAGGGTGAGGACGTGGGCTTTAGAGAAGACGATCGGGGTGGGGTGG
GGATTTGGAGCAGGTGGCATTGACTTTTTTTAGTTCGTTCAAATTTTGTTTTATTTTGTAATTGTTTGGGGGAAACTATCATGTGTCACTTTTATTTTTA
CTCAACATTTATTTTTGAAAAATTACTTTTAACACAAATGAAAAATGTCATTGTTTAATTTGTCACTTTACACGTTATTTGCGAGTGTAACACACGTGAT
ATGTTTTTGCTCATATGAAAAAGGGTCAAAATGACAGAATGGGACCTTACATAAAGTGTCGAAAATGAGCATCTCTCAGTTATAGTTATGGTGTCTAAGT
AAAGCATCGTGCCAACTTTAGGGGGTCACTGATGGTTAAGCCTATAATTAACGTTGAAAACGTTATCTAATTATCACACAAACATTGGAACACTAGCTAT
AAAAGTTTCAAGGTCACTACCTAGTTGACAATGAAGCGGGTTGAGAACCATGAGGTCGCAGGTTCAAACCTCAGTTGAGCTGAAAATACTAGGTGATTTT
TTTCATTTGTCTAAACCATGACGGATAGAGTTACCCTGTATACCCGTGTTGGTGGGAGGTAGCAAGTAACCCAGGGTTAGTCGAGGTGCATCCAAGCTTG
CATGTATATTACAGATATAAAATATTTTCAAGATTAAATTTTTAAGTAGTGAAATTGTTCGTGCTTCACGTGTGCTACGTGGAAATATAATAAATTATAT
ATATATTTATGAATATGAATCTCTATGAATTGTTAATTTCTTATTTAATAACGTAATTATGTAAAATTTATATTCAAGTTAGTATCAGATAAGACAACAT
TGATATTTCTCTTCATTTGCTTCATGATATGTTTTTCATCCTGTTTCAATAAACAAAATTGAAATTATGTGCATTCTTTTAAGTACAAACTATTCATATG
TATATAGTAGAATAAAACATCTATAGTGGTGAAGTTAATCGAATAATATGTTGTATTACGTGTAAATGTTACTATGTATTTTAATTTCCTCTCATCTTTT
ATAGTAGCTCTGGAGTCTCTATACAAATTCTGATTTCTTAAAAGACTTTTAAACTGCTTTATTTTTTCTTTATTATTACTTTGTTTATTTTAATATTAAA
TATAGTTAATAACTATTGTAATGGAAACACAAAAGTTAGGAATAGTGTTTAAGAACAGAAGGTATAAGTAACAATATGAGATTTGAGTTATGAATAATTT
GAATATATAATTTTATTAGACATTAAACAAATAATAACTATGCATTGATTTTAAAATAAATAAATAAATGAATGGTGAAAATAAGAAAGGGGGAGTCAAA
AGATGAATAAAATAAATAAATGATTGGTGGCTACATTGAGCCGTGTCATAATACTATTTTGAAAACCACAAGTGTTTTTTACGAAGTAAGTAGATTCATT
TAAAGGCATCAAGAAGATGCAAGCTTTATAAGGATTTCTTAGTTGTTGTTAGGACATATCTAAAAATACTATACACTATCATATTCACAACGTAATTTAA
ATGAAAAGGAAAATTATAATACTTCTCAAACAAAAAAAATAACGATAAAAACAGATTGTTACATATCACATCATACAATTAAGGGAAAATGCTCAAATAT
GCCATCAAACTTCGAGAAAAGGCTTATCTATGCCAATTCCTATTTGAGAAAAGGCTCATCCATGCCATTATTTGTTAACAGGAAACATTTTTGATTTTGC
AATAAAATATTTGTTATTTGCAATAAAGTAAGTAATTCACTTTTTCAATAAAATAATTATGATTTAAACAAAAAAACCCACCCCCACCCCACCCAAAAAA
TTAAAAAAATATAGCATTTGTGATACAACAAGTTTAAAATACCATAAAAATATTCCAATATATTTATTTCAGTAGTTACTTGTAAGTAGTTCTTAATTTT
TTTTTTATGGAGAACTGACATTCTTTTTTAATTCTTTTTTTTCTGATTTTCACTAATGCTGCTTTGCTAGTTTGCCATTTCCTTTGATAAGGAATTTACC
ATTTATACCTATGTTGTGAGTATTTGTTTAGTCCCATCCGTCCCAATTTATATGGCTAATTGTTGTGGTGTCATACTATAGTAATTTGACCTTTTCTGGA
ATATCTTGTTGATATGCGATTCCTATGTATTTTTTAGTTATGTTCTAATTCTTGCAAGATGGCTCACAATGAGGATTACACTTCACATGACGTTTATTTG
GATAATCTCCCAATTGACGACTATGAATTTCACATCCTATTCCATTCCTAATGAATAACCCCCAATACATATATATTTTTTTACACTAACCCCCAACACT
TCTTTAAGCTAAGTTTGTGTGATATTGGGGGTATATCAAGCATTTGTATCCTTTTTTTAAAAAAATAGATATCTGTCTGTTTTCACCTTAAAGAGGTACA
TATGTGTGTCTTTAGCTCTCTTCCTTCTTGACAAATTTGAGATCCTTTTTATGTGGAAAATATGGTAAAACATGCCTAATATAACTGATTTTTATGGTTT
CACCAGCAAGTTCATATGCATCGTTATACTTCATCATCTATACGCTCCAGAGGAAGTGAACATCCTCTGCTAGAGGTACCTTCAGATAAGTCAAAGGCAA
TTGATGCTATACACATTCTAAAGCATCCATACCGAGCTACCCGGCCTGATCATCTTGTTGTTATTCTTCGGGGACTTCCAGGTGCTTCTTTCTTTCCAAG
AGCTATCTCATTTAGTTATGTAGTTGTCCGTTTGCTTTTAGTTGATATCCACTTTGAATGAAAATTATTTACCTTTATATTACTTGGTATGGAGACTTAA
CACCTTCCCCACTTTCAATAGACTCCATTAGCCCCCCCCCCCCCCTCCCCCCCTCTTCCTCCCCAGGGAAAAAAAGGAAAGAAAAAGTGAGCCCTTCTTG
TTATTAAGAAAAGAAAGGCGATTTTTTTATTGTGTTAAGTCTGCTGGAGACATATTTAAGGTAATAGTTTTCTGATTAGGTATTTAAAATTAACGTTGAA
AGGTATGTCATAACAATTGGAGAGTTCTATTAATTAGTAGCATTCATATCAGTTCTTCATTTTTGAGATGGTGACATTTATGACTTAGAGATTCAGTGGT
CCATGTAAAAAGATGAGATGGATGGTTTACCGCATATCATTTAGAAAACAAATTGGGGCACTTTGATCGTTAACTTCTTGCTTGCACACCTCCACATATA
TTGTTATTCGTTAGATATTGTAGATCGGTTGGTTTGATTTGGTATGATGTGGGTATGTTTAGTTGGCATTTGGAGAACGTCTGGATGAAATTGAAAAAAA
TAGAGGAGAATTTGAAGTATTTGGAATAAAATTTCATTTGGAAAAGAAGGTTTGAAGTTTTGGGCGTGAATCCATTATTTCACTTGAAACTAGTTTTCTT
CCTACTAAAATAATACTGCATTGCGAAACAGATATTGATTTAGACAATAAAATAGAATTTATGGCCAAAAGGGGAGACATGTCACTGGATCATGACCATT
AGAATCCTACTGTTAGGTATTTTAGGCTTTCCAGGCCACTTAATGGCAGGCAGTCATGTTATTTGTCCTTTTGTGACTTCATTTCCTGCATTCTTATATG
AAAATTTTCTTAAAAAGGAAAGTTCACTGTGCCCAAAGAATTTGGATCTCTGCAAGTATTCTTCTTTTATTATCAGCTTTTTGTTATCTTTTTCAGGGAG
TGGAAAGAGCTATTTGGCAAAGATGTTACGTGACCTTGAGGTTGAAAACGGTGGCACTGCCCCTCGTATTCACTCAATGGATGAGTACTTCATGACTGAA
GTTGACAAGGTCTTATCTTGCTATCTTACTTGAAGTTCTTTTGATCGTCAATATCTCCCGCTTTTCTTCGTTTCACATTTTCAAGCCTCATATTAATTCC
AGTTACTAGTTATTTCAAGTCCTCTCCTAAAAATATAAACAAGGTCTTTCAGACATGCAGGTTGAGGAGAGTGAGGTTTTGCGATCTTCTGGTTCTGTCA
GGGGCAAAAAGATGGTGACAAAGAAGGTTATCGAATACTGCTATGAACCTGAGATGGAGGAGGTAAAGCCATCTCTTCCTGAAATTACGAGATAACCGAA
CTTCCACAGAATTTGGAGCCTTTAGTTTTGAGATATTTATCTGCCTTTCTATTTGGTAGCTTTATTCTATTTGTCTGCAGTGTAGTAAAATCCATGTTTT
AGGAAGTTTATATCAGAGATGAACAAAGATACTGGGGATACAACCCTAAAAGGTTTGGTCAAACCAAAAGTGCTTAGAAATTGTAAAATGATAAGCTAGG
GTGACCAACTTATAACTTTTAACTGATTTTGGCTTATAATTACTTTTTGTGTTTACCAAATGGCCTAGATAAGACAAAAAATTACTACTCTCTCCGTTCA
AAAAGAGTGGCCTAATTTGACTTGGCACGGAGTTTAAGAAAATAATGAAGACTTTTAAATCTTGCGGTCCAAATTAAAGTTGTGTCAAATATACAAAATT
GTCCTTTAATATGCCACGTGTAAAGCTGAAAGTGAAATGTTACCAAAAAAGAAAAGAGATCATTCTTTTTGAAACAAACTAAAAAGGATAGGAGGTCATT
CTTTTTGAAACGGAGGGAGTACAAGATAGTTTGATCAACTTATATGCTTAGCCAGACACCCTCATAGTGTTAGCTATTTGTACAGAAGTTCAATATCTTA
CTAAAGGAATGATATTTTGTTGGTTGCACAAGTTTCTCTTTGCCTAGTATTTGTAAGGCTAAGATGACTTTAGAATTGTAAATTTACAACGTAGAATCAT
GCAGTATTCAGGGTAAGCAGTATTGATATTGAGTTCTCTTTGTCCAATTTTTTTTAAAAGTTTATTAAGGTTGCAATTTCTTTGTTTGCTACTGTTAGGT
TCACAAGTTCTTACTAATGTAATGCTAGGGAGAGTGTAATTAGTCCTAGTTAAGTTTCCTCTTTCCTTTGTTTGGGGGTGGGTGGGGTGCATAAGGATTG
GATTAGAGTGTTATGGACATAAAGTAAACAAGCAACTATGGTTTCTCTTTTTCTCCTCTTTTTTTTCACTGTGAAAAAGGTGGAGGGGGGGGGGGGGCGT
TGTGTAGTAGAAAAAGTTTTTCCTCCTCTAACCATGAGGTTGAGTGTTCGAGTCACCAACAATTTGAGAAAAAGTTTTGTTACTGGGATGGGGTTTTGAG
GGGGCCGAGTTCACCATATCAACAAAAAAAACATTTTCATATTTGCATGTTAAGGAAGCTATATCTTGAAACTACGAGGTAACTCGCTATGTACAGTGGT
TCAATTCTTTTTTAGAAGGATATTTCCAGTGATTTATTATATCTTTTGGTAACAGAAACATAGCATTAGAAACAGTTTGCGCGCCCATATGTGCATTTCT
TCTGTGAGTTTAATGTTGATGTAATTAGTATATTGTAGTTGCATTTTTCAAGAAGCTTGTCTCTTCTATACTGTATGCAATTTCTGGAATCAAATATGGT
ATAGAGGTCATCTTATGGCATTTCCAGTTGATTTTTATAGGTTTGATTTTACTAGTTTGCTTTTTCCAATTTTCTGCAATTTAGTGCCTTGTATATATTA
TTTCTATTGATATTTTCTCTCTTCTTCAGGCTTATCGTTCAAGCATGTTGAAGGCTTTCAAAAAGACCCTGGATGAGGGGGCTTTCTCCTTCGTAATTGG
TATGGTATTTTTGGGGCAAGATAGCTCTTACTCTGTAATTCCACATATCTTCTTTTTGTCCATAATCTCAGACTGACATGTGAAATGGTTTGCATCACTG
TTTCCTCTTTCAGCTGGATGTCTATTCTTTTGTTTATTGTGTCTGTGAGATTCTCCAAAATTTGCTAGTGAAATGATTACATGCTGCTGTCAGTTGTTTT
CTTGTGTCATCTGTTGCTCTCTATTGGAGCATATTTCTATAGAAAACCTCCATTTTGTTGGATTTAGGAAACTTGAAGGTAGGTAGCATCCCATAGGTTT
CTTGATAATAGCTAGCACATTGGTTCTTCAAGTCATGATAGATTGTCTAGTTAAAATGTCACCCATAGTTTAATTATAGATTAAGTGGTGATGCAGTGCC
TTGCACTGCCTTCAGTTTACTAACTACAGATGCAGTTTTGTTCGGCAATTGACCCATTTGTTGCTGGTATTTGTGCCTCATCTTAGTGGATGACCGCAAT
CTGCGGGTAGCTGATTTTGCTCAGTTTTGGGCATTTGCGAAGGTATACTCTCAGTTCTCTCTATTATGCAACCAGTTCAAGTGCTATACTCTAGTTCAAT
TATTTTCTAGGATACTTTGAATGTCTAAAAGTCTTAAACCTTTCGTGTGTATATATTTTGTTACTGCTTTATAGTTTGTCAGTTCTTTCAAGTTTTAAGT
ATTATAACCTTTGTTGATCTAGAGAACTTGTGGCCGCAACAGCTTTTCTGTTGTTGTCCAATGTGACTGGGTGGATACTGCGAGTTTGAAAACTCACTCC
ATCAAGTCCTAATATATTGTTATATTCGTATTGTAGTATCAGTTTTTGTTAGTTGCAATCTGTTTAATTCATTGTGTATTTTACCTCAGTTTCTATTTTT
TGTTGGTCCACTTAAAAGGACCATTTCTTGATGACTTGTAGATGAATTGTTTGTGAGTTTTAGCTCTTTCTTGACTGCTGGTGATGATTTGATATAGTTT
CATGCATTGTTGTAGAGTAGATTTACTAAATAAGAAAAAGCAATCGACCTGTCTTTCATTTTTGGTTATGTTTGGCTGAACATTGTCATCAATATTTTGG
TGGTGATTTTGTTTGCAATTCTCCATAGACATTATTGCCGTGTCTTGTTTTGCTCACACTAAGCTTGAAGTTTAGTATAACACAACAATGTGATAGGTAT
TGCCAAGGATATCTTTATCACATCTCCATTTGATTGAATAGGCTCCTGGATTTTGGAAAATATGAGTATACTAGTTCAAAGTTCGTTCAAGATTAGTTAT
GATGTTACCAAGAACAGTATATGGAGTAGTTCGGTTTGTGGTAGGATATTGAAATCTTCAGCAGATCATGTTTTTAATCTTGAGATAATTGCTAATCGAT
GAGCATAAAGCTTAATGCATCGACTTGGACAACTTCTAAAACTTAGCTTTTTATTACTAATTGCTAGGATAAAACTGGCATATATTTCAAAGTGCAGGAT
CATCAAGCTTGAAGCTTCAGACTAATTTAACCAAAGAACAATGCAGAATTATAAATTTTCAGTAAGCAAGCTCAATATTCATTTAGGATAGGGCTGAAAT
CCCCAGCTAAAGCAACAGAAAACTTGGATAAATGTTGGATTTAGCATCTCTTCCAAGTTCCAATCTACAACTTCTTAATAGAAACTATGGATCTGTAGAT
GACAAATGGCTTAAGTATTTGAAGACTTTTCTAGAGCTACCTGCTTCAGCACTTGCCTTCCAGTCGATGTATTATGTTGGTTATCTAAATACAGCTAAAC
AACTGTGTATTCAGAGTGCACAAATTTGTGTGTGACAACTGCATGTATGCATGCATGCATGCATGTATGTATGTATGTATCTCATAAAGAACTTTTAAGA
TCATGAAGGTTTGTTGAAGGATCTCTTATTGACAGATCATATAAGCTTAAATTTGTCTATTTTACTGTACCAAATTTTCCTTCTTTTGGGTTTAGGTTTG
GTTGTTTGGAATGAGGTGTTAAAAGAACTGATTTGATGGAAGTGGTTGAATATGTGAAGATTCCAAGCAACTAATTCAACCATACAATTGAGGTGGGTTT
ATGTTTTAGATTTTGTAGCCAAGGAGACTCGAGTCACTAGGTTTGTCCTGTAGTTATTTGTATTTATAGTATAGTCAGTTTCTGTTCTGGCTGGTTATTA
CATAAATTAGTTTAATAATTCTTAGCCAAGGTGGCTCGAAGTTATGAAATCGGTCAAGGTAGATACCTGGGTTTGTGGGAGGTAGCAGTACTCGGTGGAA
ATTGTCGAGGTGCATGCAAGTTGGACTGGACACCACTGTTATCAAAAGGAAAAATAAATAATTACTCTATGTCAGAGTTCTTGCTTTTTGGATAGGAGTG
GTGCTCCTTGCTTTCTAAATTTAATTGCTTGTTGCATTTTGTTCAGTGATGCATGCTGCTTCTGTTACTTTTGCAGTGTTATGGCTTCTCGAACTGCTGA
TTGTTTTTTTGATGACCGATTATCTTCTTCGATTGTTACCATCACATCTATTTAAGAAAAGCTGATTGCTGCCTCTATGATTGCCATGGTTGTTTTCTTT
GCTTATTTCCGTTGCTTATTATTTCAGAGATCTGGCTATGAAGTGTACTTGCTAGAAGCAGCTTATAAGGACCCAGCGGTAAGTTAGCTCATGTATTTCT
TTGTTAGCCACAATCTAACATTAAGCATTGTATATGTCTGTGCATTATCTGATACGCTGAAGATACTTTTTCAACTCATGTCCTTGTGGTTTCAGGGTTG
TGCAGCAAGGAACGTGCATGGTTTCATGCAGGATGATGTACAAAAGATGGCTGGCCAATGGGAGGAAGCTCCATCCATGTACTTGAAACTTGATGTTAAG
GTACTTTCTCCTTAAAACTATCTTGTTGCATAGTCAGTCAGGTTCTACTCGCCTGGACTCTCAAGTATAGCTGAGCAATTTAACTTATTCCAGCTAAGTA
GTTGTTAGTGTAGCCTGTTAGACCTTGTGTGAAAAAGTTAGTTTTATCAGCTTGTATGAGTTGGATGCTAATGTCATCTGTCCTTATGGTTTACTTTTAT
TTCAACAATGTGACAGTCATTACTTCATGGAGATGCTCTGGAGGAAGGTGGAATCCAAGAGGTATATTTTCTTAAAACCTTACCCTAGGTTCAGCATACT
CATGACCATGTGAGCACATAGACACTTGCATATGTTCAGAGTGTAAGGAATTGCTTTTTATCGGGAATGAGATAGACAATGTTATCCCATAAATCAGTTA
TGCCGCCACATATATGGGATAACTTGTCCTGTCATTGTAATGCAAATGGTGGGATAAACAATCCCGGGACTTGTACCCCTACCCCTACGCATGATAAATT
GATCGTGCTTTAATCTCGAGATAATTATTCCTTATCCTCATACCAAAAGTCCCCTAAATTTGTCCGGAGAGTTCTCTGGAGGCCCACCTGAAGTTGCGGA
TAGCAGGTATGGAATGAAGAGAGAACTCTGTGCAAGACGTCCACTCAATTAGAAGAGGTAGAGAATGGGATGGATAATGTTATCAAAAGCAAACAGCGCA
AAAAAGCTCTGTGGTCTGTTGGGGCTTTATGTGAAAATAAAGCGTGAGCTTTAATGGAAAAGGTGCAAAAGGAGAAAAAAGTACAAATATATATGTTTAG
TCTAAGTCTCCTAATTGTAAGCATGAATGTCAAATGTATAAACAACAATATTGAATTTTTTAAATGATAAAGTGAAATATCAATTGCTTAGTACCACATC
TTTAGAAGAGGCTCATTGGCATGGAGAAGTATGCCTTAGCGCCTTGATGATGACACTAAAGCGCACATTAAGTGAGGCGAAGCGCTCGACCATTTTGACC
CCCTTTCCCGGGCATAAGCGCGCCTTTGACAACAATACGCATGGGATGCCCCCACTGCCTACCTTTTAGATATGTTCTGGAGTATCTGGAAGGAGATAAA
AGTTTGGGCTTTTAGATATAAAAAGATAAAAGGAACATACTAGCCTATGCTAGTATTTGTCCATATTTCCAAATTTTTTTTGCAAATATTATTGGGGTGA
AATTACACCATGTCTTTGGCCATAATATTTGGGTACATATTTCACCTTTTTTAGAAAAAAATATGATTTATACCCACAAGTTATAAAACTATCAACACTA
ATCATATGTTTGTATTACAAGTCAATTGGATCTTCGTTGCAACATATTACAAGTAGTGTCTTTGAAAATATGGAAGGAGAGGAACCTTAGTGTCTTTGAG
AATATGGAGAATACTGTAGTTCATTTTGACTTTATGTTTTTGGTGTAACCACATATACTCTAATGATATTGTCTCTATCATTGATGGTCTTAGACTCATT
ATAAAGATAGAACAGTAGATTTTGGTTTCTTTTGAAATATGGTTTCACTACAACCCAAATACTGTGTTACAGAAATAGAAACATTTACCTATGTCAAAAA
AAGTTAAAAAAAACAAGTAGTGTCCATGACACTGGAGTAACGTGGTTGTTTGGATTGAGTGCAACAAGCATCATTCCAGGCATTGTGAAGCTTTGTTACC
TTGAGCCGATTGTTCATTATTTTCATCAACAACCATATCATCTCAATACAAGCGCAATCAACTACTATAGAGGGTGTTATTGTAAAAGATAAAAGTTTGG
TGTAGAATTTGAATTTTTAAAAGATCCCAAATAATGAAATTTAGTCCAAATACTAGTTTTTTCTACTATTTGGGAATTTGGGCTATTTGCCAAATAATGA
CAAATTATATGGACAAATAGTATTTTCGAAGTTTTCCCCCAAATTTTACTTGGGAAATCTATGGCCAAACGGGTCCTATGATTCTGTTGGAAATGCTACT
TGGGAAGTCCTAGTTTTATTTTATAAATTTTGGCTTAAAAAAATTCTCATAGCTTGTTAAGTTATACAAAAAATAAAATGAAATTAGTCCTGTAAATTTG
TATCATATAGCTTTTGAAAATATTTTCCTCTGTTGTCTTATAGCTTATTCGTTTTGTAAAGTGGCTTTCATTTACAGAACTAAAAATTAATATATGAATG
GACCAAGTGGCTTGGATGGTTTTTGTTCCTACTTGAAGTGCACAATGAACGGTCAGCATGTTCTAATTGCAGCGAAGGAAAGAAAAGAGATGTTGGCTGA
TAATGTTCCAAACAGCGTATTTCTGAAAATTAACAAATGAACAATAAATAAGTTACAAAAGTAATAATATACTAGGAATATCATGTGATGTCCACCAACT
TGTAATGTCTTCATTCACATCTTTTTCAGGATAGTACCGAACATGTGCAGCTTGTGTTACTCAGAGGTAGAAACTTCTAAATCATGAGTCTTATTTTGGA
TCTGCAGGTAGACATGGATATGGAAGATGATGACTCATTTGGAGTGCCTTCCACTTTAGAGGAAGAGAATATTGAGAAGTTTACAGTACCTCCCCAAGAG
GATATTCCAGCATGTGGTATGTCATGGATCTGTCCAAAGGGTCATTTGTATTTCTCATGCTGCTCCTGTATTGTCTCTCTTGTTGTATGTCCTAAGTTCT
AGTTAGTAAACATTTGTTGTGATTAGCAAAGCGGGAATTCAGTTATGGTGGTTCTCCCTAATCAATTTGTGATGATTCTGGTGTAGATGGCATAGTTTCC
TACCTTTGCAATAGATATCGCCAAATCAGTCCCTTCCTTTAAAATTTACATTTGTTGTAGTCACAGTAGGTCATGTGTTTGTTTTGAGGCTTAAAACAAG
GCTGAGCTGATTTTAGCGTTTAATAACACAAAGGACCCGGCTTTTGTGGTGGTTGAACTTGGCTGATTTCGAAGTTCAACCGCTAACCCTTAGCTTTGAC
CATTGGGTGGAACCTATTTTCTTTTTCAATGCTGGTTATTTCTCAACATCGATTGGATTCTGTCTAACATTATTATTGGATCTCTTCAACTTTATGCATA
CCATTCTGAAGTAGATACAAACAAATTTGTCCTTTCTTCATTGTCTTGGCTACAAAAAGCATCTGATCATACTTATTATGTAATTTGATATCAGGCGATG
TAAAGGATGATCAGGTTTTAGACCATGAGGAGGACCACCGAATAACTGAAGTAAAAGAATTGGCAAAGAGTAAATGGTCATCTGATTTGGATGAAGATAA
TACTCGAAGAAATAAAGATGCCACTAGAAACATAAATGCTCTCTCTGGGTTGATACAATCTTACAGCAAGGAAGGAAAGTTCGTACGTTGGGGTGACCAG
GTAACTTTTACGACGGACGATAGCTATTCGTAGTTCTATATTGATGTGTTTTCTTACTGAGGGATGATTGGTGAAACTTATGTCCGCTCTCTGTTCTCTG
CCTGCTTTCCCCTTTCTGCTTTTACTGATGTGCTCACCAGCAAAGGCTGACCTTTTTTCATTCGTCATATCTTTACTTTTTTCTCGTCCTGTCATCTCCT
GACACTTTACATTAGCAAAGGTCTGGTAGATGAATTGTTGGGAAGACTCTACCCTTCCATCCTCAATGTTTTTCTTTGAAAAAGTGAATTTTTTAAAGAA
TGTAAACCAGGAGTCCTACATCTTTTAGAATGGAAATAGGAGTCCGGATTTATTTTTAAATAAAGAATGAGTTTCTCAACACTATAGGTTGTTTCGGTGT
CTATATTCTCATATATCAGAAATGTAAATTGATTAAAAAAACTTGGAAGTGTACGGATTTTTATTCATTGGATTGGACATGTGGTATTTCAACAGTTCTT
CCCTTGACAATATTATTGTGAATCGGGATGCAGTATAGTTCCTAGATAGCTGATATTGGTAACTTTGGGATGGCATAAAAACCTTGTTGTAAAGGCTTGT
TTATTTTTCCAAGGGGAGGGAAGACTTGTAAGAATTCGATTAAGTGGCTCCATCTCGTTGCAAGGCTAAGTTGTTTTATGGGGGCAGATTTACTTATTAT
CAAATTACATTGGCACTAGGGGAGGGAAAAATCATTGGAGTGAAATAAGTGTTCCATCTCATTAAAAGCTGAAGTTGTTTGAAGGGGAAGTTCTCATTAG
GCGTTGGCCGTGAATCATATTTGCATGCCTATTTATCCGTTATTAAGGTTGGTTATTCAATGATTTTTTCAGATGTTGGCATGTAACTTGTTTCAGTGTA
CTAACCTTATCTATATCCGGCTACCAAAAACTATGTTGTATACGTCTTGGAGAGGAAGTTGAAATTACATGCAGCTACTAATCTGATAATTGTTTGTTCG
CCATCTGTTCTACTGTTCTTCTAAAAAGAGGCACTAGCTCAATTTCTTTGCCCCAAGTGTATGTTTGCTAGGGAAGGAAATTTCCCATTTTCGGTTAGTC
AAAAAATTTGGGGAACTTTTTCTCTGGGAAAACAAGTTCCTTTAGAATGAGGAAAATGATTTCCCTTGTTTTCCACAAAGTGCCTTTCCACATTAATTGT
GTCTTCTCCTCACCCTCCAACACACCTCATCTTCACTCCACAACCTTGTAGCTCCCATCCCACGCCCCAACCCTTACCTCCACCCTCACTTTTTGTATTT
GTCTAGATTATATATAAATGCTTTTAGAATAATACTTTTTTGTTTTCCAAGAATATAAGTGGGTTTATTACTTATTCTCTTGTGTTCAGTACATACACAC
CTAAACTTATGTTACTTATCCCAGGTAACCAAAAGAGGCTTTTCTATAGGGGCAGCAAAAGCAACCAATGTATCTTTAATAATTGGTCCTGGTGCAGGAT
ACAACTTGGTGAGATTCCTCATGCAACTATTGTTTAACTTGTTCGGCTCATCATTGTCTACATCTTGATGCTTATTGGCAATATTATGCTTGTAATTATG
CTGCTTACCTTTCTAGAGTTTTTGTTATTGTAATACAACATTTAGTTTTGTAAACTACTTAAAATGGGATTTTGCATATACTTGGAACCCATATTATAGC
TGGCCTATTGTCATTTTCAGAAGTCAAACCCTTTACCTGACGAAGAGAAGTTGACATCAACTCGACATAGTGGTGAACCAAAGAGGCAGAACATATTTCA
AGAGAGATTACGAGCAGAGCACGAGTCGTTTAGGGCTGTTTTCGAGTCCTTCAGAACTGGTTCTGACAAGAGGCGGCCGCGGATATCTGGGCTTAATGCT
GAAGATGAATAGTGCATCTGTAGATAGGGGTTTAAAATTGCATATTTGCTATTTTATGTTTTGCTAATCCTTTGCCATAGAGGATGACTGCCCAGTGTCT
TACGCTGGGGGAGGGTTTAGCCATTTCTATTGTAATATAGTGTAATTCGTGTAGCAAAATAGGTAGTTGATGGCCTTGACTGGAGGGCTATATGCTATGG
GTCCATTGCCTCTGTACTACTGGAAATTTTGGTAATGAAGGTTTTCAATGATAGAAGTGGTTCATTAAGCAATAAATGGATGTATGGAAGACAAATATCT
TGTAATCATTGGCTTGGCTCATGAAAACAATTTTGATTCGGGATGTTTAAGAGCCCGTTTGGACTAGCTTAAAAGTTGGTCAAAGTTACTTTTAATTTTG
TTTTTATTTCTGGAAGTGTTCGGTAAATATGAAACATAATTTAAAGAAGTGTTTGACAAAGTAAAAAATGACTTAAAATAATTCAGAAATCAAAGTAGGT
CTCCTGTTACTTCTTTTTTGATCTAAAAGTTATTTCAGTTTAACTTTTTTATTTTTTATCTTAAAAGCAATTTTTTTAAAGTCAATTCAAACGGGCGCTT
TTTTTATTTGTCTATGTTTGACTTTATACATGTCTTGAGAAAGTAACTAATTAAAATTTTAAGTTTACTATAACACTGTTGGAATATATTAAATTCTATA
CGTGTCTTGAGAAAGTAACTAATTAAAATTTTAAGTTTTCACTCATGTCATTAAATATGGATGGAGAACGTATTAAGTAGAGGAAGAGATGAGATGGCAC
ACAAGGACAATAGAGTTTTCACTCCTCCCATCTATTTGTGGTCTTGGAATTCAACTTTATAGCGGCTAAGATGTGTAATGGTGGCCCATTTCTTACATCA
TCTATGGCAAATAATAAACTTCTGCGTATATAAAGTAAAGACCATACTTGTTTATTGGGTTTAATTTTGGGTGTACAAATTGGTTACATTCAAATTAAAA
ACAATATCGATTCCCAAACTTCCATCTTAATGGCTGTAGGTGTAAGGCACTGCACCATAAGGTTCATGGAACTTGAATCATCATCACTAATGAAATGTTT
GCTCTTGTCTTCACCTCTATATAGAAAGCAATCAGTTCACTTCTCCAACTCTTCTACTCAAGTAAGATATAACGAATCGATTCTACAATTTGTGTGCTCT
GTTTTTTTTTTTGGGGGGTCTTTTATCTTTTAACTTGTAACAGAGATATAATCAATGTTGTTCATTGTCGATGAATGGATGCCAAGGCGATTCAAGAGCT
CCTATTGGAATCGTTGAAACTCGAACTTTGCCTGCAGTTTCTAGCCCTGCATTGGCCATGGAACGTCTCAATTCTGCCATCTCCGATATGATTAAGTCCG
ATCCTCCGCCTTACGATTCCGGCATTATTCGCCTTGAGGTAAATCCCCCAAATTTATCTGTGTATTTTATCGCTCACGTTTATGTGCATCCATCAGAGGG
AAACGGAACAGAATACTAATCATACTCTTTTTTTTTTTTTAATTTTCTATCTATATTCGATATTCAAAGTCGGACTAAATCTAAATTCACGTTAAAACTT
TTTTAAAAACTTCCTACTATAGAATATAAATTCACGTCGACTAGGAATACCCTTCGGTAGGAATCCTATTATCTAGTGTATATATGACACGTGGTTGGCT
CAGATTGGCCTATAGAATTCCTGATCTTAGTCTTATCTACCTCCAAAAAAAACTGCTTCCAAAGTCCAAATGATTAATTTTCTACACACTACGAATAATA
GCTCGTTAGGCTATATTTTATTAATAAAGTCTTATCTACTTCCTTCCTTTATTTTTTAAAAATAAGAGGTGCCTTAATTTTATGAAGATGATTTTAAAAA
TAAAAATAGAGTGTTTGGAATTTGAATTAGGTGATGAACTTGAACCTCTTGGACTGTGCAGTAAATTTTTATTTTATGTTTAGGAGATTCAAAATTATAT
GTTAAAATTTTAAAGGAAATTTTTTTTTATCTTACTTTGTGTGATATTTTTTATTTCGAGAGTTAAATAATTAAATTTTAACTGTGAATTCGTGCATAGA
ATTTTTAAAAAAATTAATTTTTTTTATATATTTGAAAACTACGTAAAAGTACTGCAAATTACAATAATTGATAATTTTAAATATTTGAAATAAATATAAA
AAATTTACGATAAAAAAAAATTGTTTGAATTCGAAGGTCGAAAGATGTCATAGGGGTGGAAGGAATACCTTATATGTATAGTGTATTTTATTGCTGAGAG
GTTCGGATTAACACCATCACCTAGATTTGCTTTCGATCAAGAAGACATTAGTACAGTTCTAAAATTATATTTTTTTATTTTTTTGGAATGAATAATTTCT
TTAAGGGGTGTATTTATTTGAGCTAAAACTCCATCTATTTTTGAATGTTTCTTTTTAAGGAAAGGCTTTTTTTAATTATTTTTTTGGTATTTGACCAAGC
TTTTAATAAAACAAATAAATATTTCAAAGAAATCATAGAACTTGTTTTTTTATAAATTTTAAAAGGGAGCTTTTCTCCATAATATTCTATAAATCAAAGG
GGTATTTCAAATAGTCAGATGGGAAGTATTCTTCAACTTCAATAGTAATTCTTTGATTTCAAGTTATCAAAAGAAGTATAGAGGTGAGAACTCCTACATA
GGAAAAACAAATTAAAAAAATATGACTTTCAAAATTATGATCGAATATAAATGACTAATCTAATATAGGTGAATATAATTTTTATTGATTAGGCTAATCT
TTAAAAAATGTTTTTTTCAAAAAAAAAAAATATATATCTAACAAATATACTTTTTCAAATAACCTTATTTTGCTAGTATAAATATTTATAATTTATTTTA
TATGAAGTTCAAAACCAATCCTCATTGTTGCTTTCATAAGATAAAAATGAATAGACATTTTTATCTTAATCCAGATGATTCATATAATCATCAAAAAAAA
ATTTATTTTATTTAGCTTTTACTAGGTTATTTTGTTTTTAATAAAAGTTATGGTAGTAGCAATAATCATATAAATAGGGACTAGTGATATTTTGTTTTAA
AATCATTCTAACTTATCTAAAATTATAATGTGCTGATGCTTTCCATTTTTGATAGTGTTTAAGAAATTAAAAAAAGAACTTAAAGTTTAAAAGTTTAAGA
ACTTTACGAATAAATGTGAACACTTAAAAGTAAATTAATTTCGAAAATAATGTAATATGAGACGGGAGGAAGTAGTTGTTATGCCATAAGTACAATTTTG
TTTGAAATACTGATTTTGATATCTGAAAATATGATAACAAATTTGTGAAAATTCAGGTGCCAATTGAAGAGCAGATTGAATCACTTGAGTGGCTTCATGC
CCAGAACCATCTCCTCCTCCCTCGCTGCTTCTTCTCCGGTCGAAGAGTTGCTTCTGAAATGTGCATCAATGGAGCTTCTTCTCATTCTAAATTGGTCAGT
GTAGCTGGTGTCGGTTCAGCTGTCTTCTTTACTCATTTACGTCCCTTCTCATTAGACGATTGGCGTGCTATAAGAAGGTAACTTCATGCCTGACTCCACT
TACTAAAATATGCACAATTCCCTTTTTTTTTTGTTTGCATTGTGCTCCCCAATGCATGCAGAAATTTTGTTTTGTTTGTGCCCTAGCTTTGGGTTGGTGG
TTTGCTTAGACTTGGCCAATACAATACTCCCCTCATGGCTAGCTTTTAAAGTCATGTGTATCAGAGCCAGGAACATCCTTGTTTGGGGTTCCGCTTCATG
CTTCAGTTGGGTCTGGGTGTGATGGGATATCATTTTGATTTTTACTTTGTGTTGCCATATGATGTGAGTTGATGATTTCGCTAGGGCTAAGTTTATATTT
GCTTAGCTTGTTTTATTTTTATAAGCATTACTGTGCATGGTTAATGATGTTTCATGCTATGTTAGTTTTACTAATTACAATTGAAAATTTGGAGCTGCTA
AACTTCACGAATAACTATAAACTGGACTCGCTATGTAGTTTAATTTAGTATCATAATCAGATTGTTGGAGCTGCTAAACTTGACGAATAATTATAAACTC
GACTTGCAATGTAGTTTAATTTAGTATCATAATCAGATTGTTGGAGCTGCTAAACTTCACAAATAATTATAACTGGACTTGAAATGTGGTTTAATTTAGT
GTCCTGATCAGATTGTGGGAGCTAAACCTCGGAAAAAAAGAGAACCAAGCATGCTTAAGGATTGTTTTTCAGCTTAGCAGAAGACTTTAGTTGAACTCAT
TGTTAATTTTCTGAACTATAGCATCGTTTTATCTCTGCCAAAGGTTCCTCTCCAAGAAATGTCCACTAATTCGTGCTTATGGGGCAATCCGATTTGATGC
AACAGCCAATATAGCTTCTGAATGGAGTGCTTTTGGCTCATTTTATTTCATGGTTCCTCAGGTAAATGAATCGACTTTCATCTCTTCATTGCTTGGGAGT
CTTTTTTTTAGACATATCGCCTCTTGAATATAATCCATCCACTGCTAGATGCTAAATGATAGGTTGAGTTTGATGAGCTTGAAGGAAGTTCAATTATTGC
TGCAACTATTGCATGGGACAATGCTGCCTCATGGACATACCAGAGGGCAATAGATGCACTTCAGGCCACAATATGGCAGGTCTCCCCTTCTCACTTCATT
TAATCATTTTGGTTTGGTTATGCTATTTTATTCTAATTTTTCTCCATTCCTCATTAACTTTTCCTTTTAACTCCATGTTTATGAAAATGCAGCTTTCCTC
CGTTCTTATAACAGTGCAGAAGAAAAATCCCCATTCGCATATACTTGCCAATACACATGTGCCGGGTAAAGCGTCTTGGGACCATGCGGTTAACCGTGCT
TTGCAAATAATAAGCAGAAATGACCCTGTACTGATCAAGGTTGTCAACCGCTTGTGTTTTCTAATCACTTATGCTCTTCACCTTTGACCTTATATTATAC
CAAAATATTGTTGTTTTACTGTAAAATAAAGTATTCCTGCTTGTTATGGAGGACTACAGAAGTAGCCAAAGTAAAATGAGATAATCTGATGCACACTTTA
AGATATAGGTTCATAAAAAGTAAGTTTAGGTGGTTTTGACACGCATACCTTTTCTTAAAACAGGTGGTACTTGCTCGTAGCACCAGAGTTGTGACAGCTG
CAGATATTGATCCACTAACATGGCTGGCTTGCTTAAAGGTGTTCATTACCCACCTTATTTTTTTGAATACTTCACTAGCATATTTTCTCTTACTTTTGAT
AAAATATAGAGGGTTAAGTTTGCAGGTTGAAGGAGAAAATGCATATCAGTTCTGTTTGCAACCTCCCCATTCGCCGGCATTCATTGGAAACACTGTAAGT
CAGAAGACTTTCTCAATAACTAAATGGTGTCATGAAGCAATGTAAAAGGTGAAGTCCGTGTAGTCTGTTTTATGTTCTTCAATTGATAGATCACATTAAT
TCTTTGGTGTGCATCCTATCAAAGTAGTTGCTAGTTGCTCCAGGTGAAATGAAATTATTATCACATGAAGCAAAATACTTTTGAATTGTTATATATCGCA
GCTTCTGTTATATCATCAAATATATAAAGTGTTATTTTGACCAAAAATATAATTTCTGTGATGGTGTATCTGGTAAAAGTCAAAAAAGAAATATGTTAAT
TATGCTTAAACTTTAAAAATGTTCCAGTATGAAATCCTGAAGGTATGGTCTTTAATGTTGGAAGAATTCCAAGTCAAATTTCCTGACCAGTGGCCACTAT
CATTTTAAAGCCTGATCACAACCATTCCTAATGCGCTCAAGAATTTCAGAATAGACTCTTACTAAATATCTGACGACTGAGCTTTCTTAAAATTTGCTTT
GACTACAGCTGTTGTAAATACACATGGCAAGTCTGGCTGATAATTTATACTGGTGACAGCTGGATACTTGTGACGAATCATCTATAATAAGTTGAAGTAA
TCAGAACCCATACCCACCCCCTTCTATTGATCCGAAGCATCAAGCTCACTTTTGAAACTCTCTAGTGCCAATTATTAGCTGTGGTAGCAAAAACATCTGA
ATCTTTTGTACACTTATTAGAAACGGTGAGGACATAGAACAATTTTATTTATTACTTATGCTCTTTTTGAATAGCCAGAGCAGCTATTTCATCGGGACCG
CCTCAGCATTTGTAGTGAGGCTTTAGCTGGAACACGGGCTAGGGGTGGATCAGAGCTTCTGGATCTTAATATAGAACAGGATTTACTATCCAGGTTCATC
TTTCTGCTTTATGTTCTATAAAAAGCACTAGGTCACTATTATACTTATTTTTTTATTGGTGTATTGTTTACTATATTCTTATATTTTCTTACAGCGCTAA
GGACCATAATGAGTTTGCTATAGTACGGGAGTGCATAAGAAGAAGATTGGAGGTAAGCTTGGTTAAGAGGTTTCTGAACAGAATCTTAAGAAATTTCATA
AGGGAAAAAGAAATTTTGAGATCTCTAATTGGGGGATTGCACTTGTTCATTTTAGTTTGGTGACATGTACATTTAATTTGACTTTTTAATAATTTTGATG
TCAAACTTGAACTATTCCGGCCCTGGAATTTCTATAGTTCCTAATCCACTTTTAGGACATCTCAGGAACCCTTCATGTTGTATAAAACTAGTTGGCCTCT
CTTAACATTATTTCGTTTCATAGGCTGTGTGTTCAAGCGTTATAATTGAACCAAAGAAAGCAATAAGAAAATTTACAAGAGTTCAACATCTTTACGCTCG
ATTGAGGGGGAGACTCCAGGCTGAAGATGATGAGGTAAGTCTTGACGTCTTCTATCCCATTCATTACTTACCGAGTTTTAGTTGATGCAGGGCCTTATGA
GACTCTTTAATGTAGACAGGGAAAGTTTGCATGATAGCCTTGTTTATGGTTTCTTCAAACTTTTGTTGTTCCCCCTGATTGGGACTGGTGGAGTTGGTTT
TCATTGTTCTTGAGGGTTATCGTATGTTTTATGAGAACCAAAACTGAATGAAGCATCTATTAGCATTTCAACCGACATTCTTCTTGAATTAGTTCATAAT
TACTCCCTTTAGTTGGCAAAAACTATAATTCTGAATCTCTATTATCCATAAAGATGTGGTGATGATATGTATAGATCATTTTATTGCTTTTTCTGTTCCT
TCTATAAAGCACCACACTAAGCATCTACAGTTTTCCAGTTTAAGATATTGTCATCCGTGCACCCTACTCCAGCAGTTTGTGGGTATCCTACAGAAGATGC
ACGGGCTTTTATTTCAGAAACTGGTACGTGCTAGTTGGTATACCCTTGCATGTTTGACTTTATTCTTGAACTAGCTAGCTCTTTGTGCGCACCAATAATG
ATAGATAGCTACTTATCTTGGTTGAGAGATTAAAAAAAATGAAGAATGGACGTAGGCTTTTGTAGCTAAAGGATCACTTTGCCCACTCATTATTGCAAAC
CCCCTTATGGAAAGCCAGATTCCTCTTGCTACAAAATGCTTATAGGTATCGGCCCTAGGCTTCCATATGAGGCCTGGACTCTGGTACTTGGAAATGCTGT
GATTAGTCATACAATAAGACTTTAATTGATGCGTAAGAGAGTATTATCATTTTATGCAATGTCTTCATACAGACAGAATAATCAACTCAATGGCTTCTTG
AACCTTGTGTTCTGGTATATGAGTTCTAACCAGCTGATGTTTCCCAGAAATGTTTGACCGAGGAATGTATGCTGGTCCTGTTGGTTGGTTTGGAGGGGAA
GAGAGTGAATTTGCGGTTGGAATAAGGTCGGCTTTGGTTGAAAAGGTGAGGTTAATACTTCATAGCACTTCACCTTTCATTATAGAGTACATCTCTTGCA
ACTTTGCAAAACTAGTTTGCATGCATTGCTCCACAGTATAGTAAGAATTTGCTGTTGGAATTTTAAAAATATAAGTATTAAAAGGCATATGATGAATATT
TTTATGAGAGGCTAATTATTTAAGACTTAAGGTCTAACTGATCAAGGAAAGAGGCTCATCCACATAAAAACTTGTATGATAGTTTAGTTCTCTGTCCAAA
TTTATTTTATTATTAAGTATCGATAAACTAGATATATTTCATATTTTTAGTTACCTTTACCTCAAAAAGATAAAGATTAGTTCCATGTTTACTATTTTAT
ATGTTAGGGAAAAAACTAATATTATGTTCTAAACCAAATTTTATTGCACGCATATTTAATATAATCAAAATCTTACAAGATTAACATCAAATAATTTTTT
TGTAACATTTATGGAATCAATTTATATGCTTCTGACTTCATTTTTAGAATTCCTTTAGGAATCCAGCCTTACATGACTTTGGCACTTACAACAGATCTGA
GATTGGATATAGGCACAAAATGCATCATTTTGTTTACTTTCTGCATAAGCCTTTCCAGTGATACGTATTTTATATATTGCTGATGATGAAATGTAATAAT
TAGGGTCTTGGCGCACTAATTTATGCGGGAACTGGGATAGTGGAAGGAAGTGATTCATCTCTAGAATGGGAAGAGCTAGAGCTAAAGACTTCACAGGTAT
CCTTAACAATTCTTTTCTATGCTATTAGACATGTCTTTTATTATCTAGAGTGTGAAGAACTCCTCTACCCTCTGACAGCAATGACAACATAATATTTTTT
CTGCTGCATCTTTCTATTGTCTCCTGCAGTTCACCAAATTGATGAAACTTGAGGCACCTCTTTTGACTAGAGGACAAAGTAGGATTATCAATCAGAATCA
GAAAGGTTTGTCATGCCTGCCGCATCGTATTTAGTAGACATTTGTGAAAAGGAGAGGGGGGGAGAGAGAGAGAGAAAATTATACTGCCATCTTTTCATAT
TCTTTGTATGCAAATATCATCAACCTGTCATATGCAATTTTGGGGATGCAAAACTAATCCAAATATTTAAGATTTTACTCATTGTTTTGGATAATTCATT
TGCTTGAGCACTTTGATTTTGCAACTTACAAGCTACTCTAATTATTTTTGTGTGAGCAACTCTTTACAGATCTTACACTGATTGATTAACATTTTTGGCA
ATTTAGTGAGATGACATTTTCTTGGAGGAGAGATGACGTACGTCAATCATATGATATAATACCGTTATCTTCAGCTTTTGATAGCAAATCAGATAATATG
ATTTAGCTTCCATCTTTCGTTACCAAAATGCAAGAGAAATCAACACCCAAATTTTCATTCTTATTGTTTGTTCAATATTTATGTAATCAGTAATTGCCTT
AGCAAGCAATTATGCCCTTCGATTGACATAACACAAGAAGTAGAAAATTTGTATAAATGATTACCTTGTACAGATGTATATACTTTTTTTTGTTAGTGGA
ATATCTGATTCCAAAACTAGGGATATTGGTGACAAATTACAGAAACCTTCATGTTTGTGTTGTAGAAGAGTAATATCTATCTTTTACAAGAACACCTTCT
TGTTCCTAATGTGTGATCATGAAAAATAGCTATATCACTTCACATTGCAGTTTTATTTGATTTGTCACTTTTTTACATTGATTGAAGGAAAAAGGACATT
GTGTCAGGAATTTACAGAAGCACAGAGCATCAAAAACCTAAAAGTTTTTCCATCTTAGCTCACACTCATTCTCCCCTTCTACTTACCAGCATTGCATGTG
AGAGGAGAAAGGGAGCAAACTGACTTTCTATAGTTTCAAGTCCTATTTCTATTCGTAACTTGGTGCAGACAAGCTCTAACAAGGCTTCCCCTCAATGCAG
TTCAAAGAGCCTGAAAATCTTGTTAGCCTGCCTGCGTCTGATCCTGCCCTGGGGTGGATCATATCAGGACCCGTCGTGAATTTATGATTGGGATCTCCAG
ATTCCACGAAGAAGGCTCCGTTCATCATCAGATCTCCCTGTGATCTCCACACCCAATTCTTCCACACACTCTCAGGTGAATATTCCCTTTTGGTCACCTA
CAATAAAAGGTAAATGAGAATGAGCATGTATCTTCAACAAGAGTTAGTCACGTGTAGTATTCTTGATTTGTTCATTCTTTTCATAAACACAAGATTGTGA
TGCGACCTTGTTGGTTATAGATATCGTTTATCGTGTTTACCTCTTTAGCATTAGGGTTAGGCGGGGCGATGAAACGATTGCCCTGGCTGAGGATGGTAGG
TTGTTGACTACCACCAACGGCATACATTAGCCAGTGAGTATAGTCATTGTTGACAGCATGAACAAATCCCCATCTCACTCTTGGCATCCTCTGGATCAGC
CCTTGGCCAAAGTGATTAAAAGCAAGTGTTATTTGTAGGATTTCGTCCTGTTTGAAGCTGTCACTTGCCCCAAACAACATAACCTAAACAAAAACATATT
GCAGATATTAAAACATTCTGGTTGTTTGCAGTCTCTGGTAGAAAATGTTATCAGTATATAGAATTTAAGCATTAATCCAGTTTTGGAGCTAATTTACGTC
ATTATGATGGGTGAAATGGCAGTTGGAAATGGTAATAGCAGTTGAAGCCTGCACGGCATCAATGAGTCCATCGTCACAATTAGACATGGAAACATGATCA
ATCCAAATGTTTGTTGATCCATAGATTGAAATACCATCACCATCACTTTTTGTTCGAAAACCGTAATGATTGATCGAGTCTCTAATTAGTCCACCATTAC
CAGCCTTTATATCATGGATATGAAGACCATGAATAATCACATTGTTTATGTACTGTAACATCAAACTAGCACCACCAGTAATATGCACTTGTTGTCCTCT
GGCATCAATTGTCTTGTCGCCTGTCATAATAAGTTCTTGGTTTAGCTTAATGACCATGTGATGTGCAAATATGATCCATAGTGGCCCTGGCTGAATGACT
GCATGGCGCAGTGTCCCTTGCTTAGGATTCACCATATCGGTGTCCCCAGGGTCAGTTACTTCGTAGATTTTGCCACCTTTGCCACCAGTCGTATGATGGC
CAAATCCTAGAACACAATCTGCTAGCTTCTGGCGATTTTTAGCCCAATGTGGGTCACATCTCCAGCAACGATCAATAGGGTTTGTAGCCACGCATGGACC
ATTGTACTTGTGCAAGTCCCTTCTTGTGCTATTGCTACCTTCTTCCGACCTACAAATCAAAATAAGATGAAAATGTGATGGTTGACTGTACCATGAAAAA
ACTTGCCTAGGTGAATCCTTTTACTAGTGTGTGTGTGTATATATATATTATATATATATATATTGATTATTGAATCTCATGGACGTGTAACTAGCAGCAA
AAAGGTGTTCAAAAATACCTGTGAACATGTTTGTTGAAATTAGCTGCAACTTTTTCAGGATTAGGATTATAGGATTCTTTAGCATTTTTATTTGCTTGGG
TGGCTCGAGTCCTCCACACCTCATCAAACTCTCCAATATTAGCCTCAATGCTAAAAAATAGTGTGCACAAAATTACAAAGAAACTCGACCTATTTATGAG
AGTTACCATTTTTCAATTATGGGTTGCTATATTTGTAAGCACATTCTTCTCTCTCTTTACTTGAAATTTTTGTTTAAATAAAAGTAAAAAGGGAGAGGAA
ATGAGAATGAGAAACAACGAGGGAAAAGTGGGGAACCGTTTTCCCTCTTAACGGTCAACTGTTGGTCTACTGTTTTATCCAGAGATATTGGCCGGTGTTT
ACGTAGTTTTCATGGATTCTTTTATGTTGGTAATTTTCATATATCATATGAATAAGTGAAAGACAAAAATATATTTAAAATTCTTGTTTTAGTGCATCTG
TTTCACCGCAATCTGCGTTATTATATCCGAAAGAGAATATTTACAAGATTTTTTTGGAAAGAATTCGTTAAGGATAACAAAAATTTAGGTTAAAATATTA
CATGAAAGTGAAAGAAAATCTCAAAAACTATTTTGGGTTCATTACTAAACAAAGTTTGTTTTTTATGCAAGAGTTAAGTACATTTACCCCCCAAAAAAAA
TCAAGGTGCTTGGATTTACACATGTATTAAGAAAAGAATTAGCAATGACCAAGTTAATTAAAATCTACTGCAAAAACTAGTTTACAAATTGTCACCATGT
CAGTTGTCAACTGCAAACATGCATTCCAAAACGACAAAAAGGAAGTACGCTTTTTTTCGTTCTATTGAGTTTTTTCAATGCTATTTTTTAAAAACTAATC
AAAACAATATCCAAAGAGTCATAATCTAATCGAATGATATACTCTTAACTAGGCTTAGAGTACAGAAAACATGGGCAATAAATATATTATCGCGTATTAC
TTTAAATAAATGAAAAGGCATGTCTGCATTCTTTCTGTGGATCGTGTTGCAAAGCCAAGAGAATGGAAGCTCTGAATCAGTTTACTCATAACAAATGCAA
TCGACACCATAGGTCTCATTCACCCATTAGTCCAATAGAAAGAGACGCGGTTGATCTTGTCAGACTCTCCAACTGCATATTAAGCATAAACTGAAAACCA
GGAGATATCAACCTCATGCTGCATCGCCAGCCACACTGCAACATACATGAGTATCAAATAACTGCATTACTAACGAGCCAAAAGAATTGACCAATAGAGT
TATGCTTCATAATTTAAACAATGTGAATATCATTCGACCCCTTGGTAGGATGACTGGGTAAAAATAAGATAATGAACGAAGAAGATTATCCTATTCATGT
ATTGACGAGAGTCACACAGGAATAAATTTTTAGCATGACCAGAAAGACGAGATACCTATTTGCATAAATAGGGATCTTCATAATGTCAAAACATTACTTG
TATAACTAATAGAATAGTCAATAGGGTTCGGCTTCACTGAAACTTCAAAACTGAATTTAATTTGAAATAATGCATAAACTTGTCAACAGGAGAAAGAAAG
GAAATCTACCCAAACACATAACTCACAAAATAGCCATGAAAAAATTAACAGTCAATATCCTATTACCTATAAATTTACGATACAATAATAACGTGAATAG
TGACAGCTTTCATTCCCACAGAGGGGAAAGAGACTAAACCAACAATAGCCAAATTACCAAACCCAACTGCAAAAGCACAAGTCTGTTTCATCTTCCATTT
CACCACCTTCCATCAATATTATTCGTTTAGACCAAGTGTTAATACACATGGAGACGCACAGAAGGACACTTTACCCGGTGCTGGCCTAAAATAAACATTG
GTGGTACTTCCAAGCAGCACAGGCGAAAAGGAGTTAACACAGAGGGAGGAAAGGGAGATGGTGGTATTTGATAAGAGGAATGTCAACAGACATAACGATG
GCTGTAATACAACAGCTAAGCAGGCATATTTAAGTTGCCAGCAATAGTGGTTCCAGATTATATTTGATTGTCTTGATAGTACGATTACATAAAGTGATTG
GCTGTTGACTAACATTGCAGAATGGGGCTCTCCGGCATAGGCATTTCCCCTCCATTAATTTTTTTTTTTTTTGAAAATGGTAAACTTTAATTCCCCTCCA
TTAATTAAAAAAGGAAGAAAATTGGAATTTCAAGGTACTCCAGTATGTTATATACTTTAGAAGGATGGATAATTTCTCGACAACCTATAATTCATCAAAT
AAATAACCAAGAAATCCACGAGCACTATCGGCCCACCCCTCTATCTTTTTCCACTTGAATACCATACTTTATGCTGGCAAAAAAGGTCTCACACATGTGA
CTTGCACCTATTCCACGAAATACACATATAACTTATTGCGCTGCTCTTACCAATAGACCAAAACCCTGGGGCTTCATCAAATGACTTAATAAAGATATCA
AACATGAATAATCCTAAGGCGCAAGTACATTAAATACCATTGTGGTTCTATTTACTTTGGGTTGCATTTGAATTGCACGCATGCCCTATCTCTATCATAC
TCACTGATCTGTGTGATTCAATATGGCTATAGACCGTTCCAGATTTAAGTTCACATCATCCAAAGATTAGCAATTCCACCACTAAGCTATTCAATATCTA
TGAATGGTCAAGTTCTCAAAGATTAGCAATTTTACCATATTTCCGAGCTATTTTATGTCTATGAATGGTCAAGTTCACATCATCCAAATATTAGCAATTT
TACCACCTTTCCAAGCAATTCAATACCTATGAATGGACCAGAAACCACATCCAATATACCATGTTCTCTTTTTTGATTACTAAGTGAAACAGATGCTTAT
AAGGATATTAGCAGCAACAACTAATATTAACGCTATGTGATGTGAGTTTGCTACACAAATTTAAGAACGTAAAAACAGGTATACAGACCATTGAACATCC
TCCTGGAAAAATGAACTTAGAGATATGTTTAATACTTAAAGCTACTTTAGGACATTCCTAAAAATAAACTTTGGGATAACACAGATCAAATTTAAGAATT
AATTCCACGAAGAACATAGAACAAGAAAAATAAGTGATAATACAACAAGTTTCAAGTTCAATCACAAACCTTTGTGTTTTGCTTTTCAATGCCTCGGTCA
CATTTGACAAGATGCCACATATTTTTGCTTCTGCAGTTAAAGAATTGACAACTTCTTCTAAAGATTTCAATTCCTCGTGAAACTCTTTATGTAAAACCAA
AGAGGAGAAATGCTCATCAACAACCAAACCAATGCACTTGGCTACGTCCTCGAGTGAAGGAACCCATTCACAAGCCTTCAACCCCAATTCAACTGGTGCC
TTAGGACAAGGACACACCTGAGGAAACCTCTCATATTTATTCAACCACTTTTGCAAGTACCGAATCATAACCATTATCTCTGAACCAGTTAATTTACTAA
TACAAGCACCCATAATAACTTCATCCACATTCCTCGACGCAAGTAAATAATGCAAACACATTTCAGAAACTGAGAACCCATCATGTGCTAGCATAAGCAA
TAATGAAGCATCCCTAGCTATATCCATCCTAACCGGACCGAGGCTCACATCCTTTGCCTTCTCAATTGCAGACATTGCTTGACTCTCCCATTCCCTCCTC
ACATTAATCAAAGTAACATCCCCATTTTTCGAAAGGGAGAGAAAATACTTCAGCACACACATCATATCATAAGTTTGAATATCTAATACATGTTTTACAC
ACAAAACAACCAGCCAAGATTGCTTCTTTTCAATTAGGTTATTTATCAAACTTGATATGCCTGAATGATCAACAATCCCATTAACAATCATACACTCCAA
GATCTCCCAAGTCTCTAAAACAACACAAGCCTCTAAGACCAAACCCTTGACATCTCTACCCATAAAACTACCGAGCTTTTCAATCATTTTTACAATATTA
CCCTCATCCACCCTATCAGGACTAACTGAAATCCCAAATATATCCCAGATTCCCTTCATATAGGAAACCAACACCTCAAAGAATTCGTCTTTATTGAACG
TGTTGGGGTTCTTCATCATCTTCTTCAATTTTTTGAAGAATTTTTGTCCTGACTCCATCACTTCAGCATCAGTCGATAAAAGGCTCCACCCAGTCCCTCG
CTTGAGTAGAGAAATATCATCGTTATCCTCCTTTTCGGGTTTCAGTTGAAGCAGAACTGGTTCGGAGTTGAGAAGAATAGAGAAATCACCATCGGAGGTG
GTTGAGGAATTTCCAATGGAAGCTTTAGTGATAACTTCCAGTAAAGACATTGAGAAAAATGGATACTTTCTTCGACTGTAGAGAGGAAATTGCTGAGCAG
AGAAGGATAACAGGAGGTTGTTCAGAAAGGGCGGAGGAGAACGGAGAGAGGCAACGGCGGCTTTAGGGTAAGGCAGCGAAGCACTTCACAACATAACAAA
GTATAGTTAAGTAGAATTGTATTTTGGGAAAGACAAAATATATACTCGAAGGTATAGTTAAAGAAATTAAATTTAAAAAAGTATAGTTTATTAAATTTAA
TTTTAATTAATTAATATGTAGTTTGCTTTATTAAATTATATAATTATAAAAATTAAATTAGTGTGATATAAATATCGCGTACGAGTAAAAAAATTTTATA
TACTTAAGTTTTTATACAATGTTTAAAAAATTGCGAGTCTATTGTTTTATTATTTTTTATATACTTAAGTTTTTATACAATGTTTAAAAAATTGTGAGTC
TATATTGTTTTATTATTTATTTTTTAAAAATGGCGATCCGGATGGGGGAGGGAGGATATACCTGCACTATTTTTTTTTAAAACTATGATATATTCATTTT
AAATTGCCAAGTTAAAAAGAGTATATTTTTCTCTTTTTCCATGTAATATTATAATATATATAATTATTATTAATACAGAGTTGGACAATATATTTAGACT
GAATTGAACCTTCAAAGTTTCAGCATCATTACCACATAAACCTGATTATTGTACGATTGAAAACAATATCATATTCGTTAGTGAATGTATGATTGCCAAT
TTTTGTTTTTGTTACTTTCATAATTATATGTAAAAAATCAATTTGGCTAAAAAGTTATTTTCGATCGATCATTGTAAAAGGAAGTAGTCAAAACGGGATA
CTAGTATCATGCTCATCTACAGACTACAAGCAAAGATCCATCCATTGGCGATTTTGAATTTTAAGAACTTGAACTAGAGAGGGGCAACGAGATTCGAGTG
AGAGCAAATTATCCGAAATAACTAGCTTATTTATTAGATATGTAGTATAAGCTGGCTGCTCATATGTCTGCACAAACATATGCACTCAAATAGCATTCCA
CTTGATTTTGTGTTAACCAAACTAATTCTTCCATTATCCACAACTGGATTCTCTCCAAGGAATTCTAACGTTAGGCTCTTTGAACGCGATCCTCGAGTGC
TTTGAGTGGTAGCAGTTGGTTCCTCAAGTAGATGCAGGAACTTTCCATCCTAGTGGCATGGGACCAACATCATAGATGATTTCTCTGTGGCAAGACCATA
CAAGTTTAATAGCTTCTGGAGTACCTATTCCGGCTCCTCTGGGGTCCCCGGCAGGACCAAACCTACATTATGGGCATTGTTTAGGAGAGTTAATAAGCTA
AATAGGTGTATTTACAATAACAGATAGAAGATGATAAGAAGTTGCTGACCAGTGATTCTGGGGAGCCCCTGTTGTTCTTGCTCTCAATCCAGCATAAGTG
GTTCCATTAACTGAATTTCCAATCACTTTCTGAAAAGGGAATTTCACAATTGAAATAACTACATAATCATGTACATATAGGGGTATAGCTAATAAAGCTT
TTCAAATCTCAAGTCTTTTCATTTCTCTCGTTTTTTTCTTTTCGTGATAGAAATGCCAGCCATCTTAACAACAAAGCATAGCAACTTTATCATTATCACT
CAATGCTAAATTCTAAGTTCTAAATGATGCAAACAATTCAATAAGTCAAAATGTATTATAAAGGTTTAAGTTCCCAAGTCTGAATCTAAACTTCTTTTGT
TCAACGTGCCTTAATGTTATATACAGAAACTAATCTAAACAGCAGATTAGACAATTGATGGAGGTGATTCAGCCCTGAACCCCTGGCTAGTATAACGTAT
AGCAATATAGTTTGATTTTCTTTGGTACTGTGTCCTGATTCTATTTAGGACTATCCAAACTTTTGTATCTTCCTGAGGTTTTATAGATATGAGACTAGCA
AAATTTCGTCTCTTTCCCTTCTCTGTGGCTCTTCAATTCTACAGTAAGGTAAAATAGCAAACAGCATTACTACAAATGCTTCATGTAAGTTAACAGTGAA
CACTACACCTCTCTTCTCACCTTCCTTCCCTCCTCCTACACTGACTTTTGGGACATAATAGAAAATTCAACAGTTTTGATCTACAAATTTTCTTCGGTAG
GGAACGACAACTGATTTGGCATTGGCATCTTTCGTGCTGTTATTGCCTTTTCTATTCTAGATTCATCCGATGAAGTACAAAAAATAAGTTTATGTACAAA
TTCTGGATGCTTTCTAGAGAAAGAATTCGAGATATTTTCTGCTAGTTGCACGTGAAACATTTTAAGTTGTATATAGAGCAACAGATATTTCAATAGAAAC
GGGAACATTTTCTTACTTGCAGGAACAATATATCATTGGAAACCACAGCAGCTGTTAAATGTGCATGCATCTTTTCAAGGGCATCGAGGACCAGTGGAAG
CTGATTATCTTTGTACTCAGTCACAACCTAGGGGAAAAAAACAGCAAGATTTGATGAATCAGCGAGAAAATTACCCAACTTGACATTTAATTCAGAATAT
TCAATTACCTGGAATGGCCCAAAAATCTCTTTGGTCACGAGAGGATAATGTTCATCTTTGAGTATTTCTTCAAGAGGTACAAAAATAGCAGTGGGCTTAA
TGGCTCCATAAATTTTTGGGATCGAATGGTTCTGTAAGGCTTCACCACCAAAGAGCAATCTCGATCCAGGTATCTGAAGTAATTTCTTCGCATGGTCCAG
CATTGTTTCAGTTGTAACCTGCAGGAGCAAGACATAACAATTATCGCCAGGTATTTCTGACAAGATTGTTGGCATTACTTGACAATGTACTACAAAGAAT
GCGTAATTCAAGAAAGAAAATAACGGATAAATCATGTTAACAAAAGGTGAGCTCCTCCTTTATTATAAATATTCTGTTTATATCACACAAAGTCCCAGAT
TTCTGCACTTGTTTGAGTGAATAATATTCTGAACATCAAAAAGACTATCCAAAATAGATTCAAATTCAACGTATCGATACTTTCAAACTTCTAGTAAATT
GTATCAAATGATGGACACAGAATCTCCAAATTAACATTAGCATTAGGTATTCTTACCGTAAGGACAGGACCAATAGTTAAATCATCTAACTTTCTTCTTG
CAGCAAGCTCGGTCATTTTGTCTAAGAGAGAACTTTTACTCCAATTCTGCACCAAAATAAAAATGGTTAGAAAAGAGAGTTCTTTGAACGAAATTCAATG
AAACCATATTACATTACTTTTTCCAAAACTTATATAAACCACATAGATTTTGTATCTCAAAACATTTAACTTCCATGAAGAAAATAGAAGGACTAAGCAC
ACCTCATGCATGAACAATATTGATTCAGCTGAACACTTCTGACCACTACATGCATATGCATCTTGGTCACAAACCCATGCAACGTAATCCACCTGTCAAA
AGCCAACAATCACAATAAGTAAATAAAAAATCTTTAAAAAAGCCTTTCCAAAATGCAACAAACTCTGTCGATAACAGATTATGTAAACCTCATTGACATC
GGGCCCAAGGATCTTCCAGTCGAATCCAGCATCTTCTAGTTTGACTCGACCGCTTAGGTCATCAGCTAACTTCTCTGCCACCCTTGAGCTACCTGTGAAG
AGAGTCATGCGTGGTTTTGCCTAACGACACAATACGAAAGAGAACTATGTCAGGAAATAGGAATATTATCTTTAGTAGTTGGAAAAGTTGGTTAGAAAGA
ATCCGACAATTATTATAGACTCTAGAAAGTTAATTACTCCATATTAGTGCGAAAAGCCAACAATTCAACAAAGAAAATAGATTAAATTATTCTTGGGATT
CCTGAATTAGTTTAACATGGTTGAAGTGAAGGTTATTTGCACATAACATGAGGACAACAAAATTTTAATAGGATGGGAAGTTTTTGGACTAAAATTTGTA
ATTTTCAGTTGCCAATTCTTGTTCATAAGTGGCCAAAGGAGTCTAGTTTTAGAAATTAACCTCCACGAGTAGCTTGTTCATTGTCTTTCCATCTGAGTTT
ATGAAATCCACATCATCCACAGGTAACCCACACTCATGAAGTAGTCGAAGCATTTGTTCCATAACAATGCATACCTAACCAACAATGCAGGTCGAATTAT
AAAAACCACACTGGAAAAATATTTAGAGTTATTAACAGGAAAAAATAAACTAAACTAGGAACAAAATCTTCCAATTATCTGCACATTTTGTTAATTTGAC
AAAAAAAGTAAGGAGTTTGTAAAAATCAATAGCAAATTTTTCTTCTTTGATATATGATAGACAAGTTTGTTTCTAAGCTGGACCTTGTCCGATAAGTAAT
TTTGCACGTGAAAGAGTCTACAAAAATTTGCACAACCTTACCTTGCTATCAACTTTAAGTACTGGCTTATTTCCCATATACAACGCTCCCATCAGCTGAA
GCAAAGGAATCTCCAAAGGAAAATTAAAGGGAGCAATAACCGCTACCTATGAAATATAAAGTTAAAAATTGGGTAGTGTGAGAAATTTTAATAATTGAAA
TAAAAAATATCATTCAATCGCATAAGGAAGTCACAACAGGAAAACGTAAGAAACAAATTATGTTCTGTTAATTTACCACTTTGAGCACTATGGCCAAAAG
CAATGTATAACACAACTTAACACCATTCTGAAATTGTGAAGAATTTGTTTCCCCCGAAGCTAAGTGATTTTAGTTACATAACTAAACCTTCAGATCTCAG
TTTCAACGTGAAAGATTGTATCATAGGACTTTTTTGTTAACATGTTCCATTAAATATAGTCAACAACGGAAAGAACGGTGCCTTACAGGTCCATAAGGCC
ATCGGAAACCATGGCTCTGCTGCCCCAGATGATTTCCTGGTACTGCAAAAGATCTAGCTAGAAAGCGAACCTGCCAAATAAAATCAAGAGTTCAGCATTG
GATCGGACAGTCATGTATCATGTTAAAGAAAATGGAGAAATGATTCCCGTGTGAAATAAGTCCTTGTTCCTGAAACTGAAACCTATTAAGCTTTCAAATA
TTTCAGTGTCAAAAAAGCTACTAACAGTTAACAGAACAGCAAAAGGAAAAAAGAAACAACCAATCAGTAGACACAAAATTGTTGAAATAAAATAAAGCAG
CAAAAAAATCACATGGATGTGAAAGCTATGCTGCTGAATTGTTGCGCCACGATTTAAAACACATCTTTTTCTTAGCTAGTCCCTGTATAACGTTGAACAT
ACAAGGTAATAGTTTTAGAATCTACCTGATCACCACAGAAATTTTCCAGAAATTTCTGCGTCACGAGAACTTCAACAAGAGCTTGTTGGTAACTCTTAGG
AGACACCCTTTGTATTAGCTTCGCAAAGAAATCAGAAACCTGTAAGACCCAAAAAGAAAAAGAGAAGAAAAACATTAAGATGATAAGAATTAATTATGCA
TATCATAAACTGTTAGTCAAAAAGGTTTCGAGAACATCAGCATCCTTGCTTGAATATATATTACCTCAGGCAAGCCAAGCGCATGAGCTGCTTTTGTAGA
TACGTCTCCTAACATTAAGTACCTGCGAGAAGCGGTGTCATTCGGATTAAATTTTCTTAAGTCCTCATATCTTCCTTTGGAGAAAAATTCATAAGACAGT
AAATGCTCATCTAGACAACTTCATAAAAAAACAAGAAAAAGACCAAAAACATTAAAAGCATACCTTTCTGGTGCTTTGAATGGATTATGTAGACCATGTT
TCGGGCACTTGGACAAGCTCTCCACAAACGGCTGCACACCCAGCAATAGGACTTATAGAACCATGACAATCTTTGGTGTTAAAGAATTCATACTAGAAGG
GAAAAGTCTTTATGCGACTGAACTAGAGTTGGTCATAAAGTAACAAGTTAACTGTACAGAATAAACAGACTCTACTGTCGAAAGACTCATCTTGAAAGAT
ACAGTGCAAAGAATTATGATGCATCCAAATTATATATACCTGCAGTTCTGATTCATTTACTTCTGCAACTTTAATGAACGGCTGCCCATTCAAGGGATCC
AATATTGTATTCCAACTAGAAGATTTTGTCCACTTGCCCTGCACTGAATGGATGAAATTCACTAGTCAACTAGATGTAGCAGTAAACTAGAGCAATGACC
AGAGCTAGCTTCTCCCTTTTTTATAGGAGAAACACACTTGAATCTGATCGAAAGAAAAGTGGTGTACGGAAGTGATGTATTACTTCAATATCAATTGCTA
ACATGCATATGGTATACAGGGAGTTTAACATCATTCAAACTTACAAAATTATCTAAAGTCTATACAGTATATCTCACATCTATTCTTAGGCAAACGTTGG
AAAACTGCATATTAATGACCAATTTCAGCAGCTAGTCGTTATGTAAATGTACATACCCAAGTTGTGAACTTCAGCAGGTTGAGAGCCTGATACTTCTTCA
GCTTTTACAGTAGCAAAAGACAAAGTGTGGTTTGATCTGCATTATGAAAGATTAAATCACAATGTCTGAATGACTCTAAAACAACACCGTCCGCTTGGTC
CATACACGTCAATTGATTATCTCAAAACAGAAGGTTGAGACTACCCAGAACCGTAATTCAGTAGAAAAAGAAATACTAGTTAAGCAGCATTTACACTGAT
AACAAGAAGTCCATATCATGATAATGTAGACGCCCAATAAGGAAGAATCAAATACAAGAAATCATCCATCCATAACATAAAAAAGACGACATTTTTCGTT
TTGAATCCTTAGGGAATAAAATCTTAATAGCGAAAAAATAGTAGCACTAACTAAAAAAGATGGAAGGGACTTCAGGTTCTGTTAAAACAATTGGTTTAGA
AAAGAAAAAAAGATAGTCACACAACACATTGGTAGTCTCAAGCCCAGATAAAGGACGATATAATGAACCTTCGTAAAAACTACCAACGGATGGACTGGAA
TGAACAGAATTTAAACTAATAATTTCCAAAATGGTAGTTTTTAAAAAACTAAAGCTTAGATTTTATCGAAAACAACATCTCTGTCACCACAAAGATAAGG
TAAAGTTCTTTATACATCCTACCCTATGCACAAAATTTATCAAAGATTACAATAATCAAATTGTAAACGCTTCTAAAGAACAATTTTAACCTATTAAAAG
TGATTCCTTCAAAACACCATTACATTATTGTAACAAAACAACTGAAATTAGGTGGCGATCGCTTTGTAAAGTAGAATTATTAAACCTAGATTATTTACAG
AGCTTTTATTACTGAAAATGATGAGAATAAAAGAGTATACCTTCTAGAATCGAATAAAGTGATCCAATTGAGATGACTAGAAGAAGCTCTCTTCTGCAAT
TGCCTGTATGCGGAAAGTCGATACATCATTCTCTTCCAAACTTTTCGATAGCACTTTACCTAGGTTAAAAGATTTTTTTTAATTTATAGATACTCTGATT
CTCTACTTAAGATTTATAGGTAAAATAATATATTTGATTTGATGTTTTCTATTATATCTTCAATAAAATATANNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTGTTAGGGAAAAATCTTTTTGGCCA
GAAAATTTGATCATTCTTTCTATATAATTTAATTTTATAAATATTTTTACCCTTTTAGCTTTAATATCTTTTACTAAAAAATAAAAAAATAGTTTATTTT
AAAATTAAAAAATATTATAATTTTTTAAATTTTCTAATCAAATTCTAACTAAATTTTCTGACTATTTAACACTTGTCCATTCGTTAGTTTCCACGAAATA
ATGTTTTACTTGTGACATTGACGTTGTGACCCAATGTGTCAAAAATTAAATTTCCATTAGTGATTGACTCTACCACCTAACTTAATTTGGACGGAAACTT
TTATTTTTTCTTCAAGTTAGAATTTATAAGGATTTTAAGAAATATTAATGCATCATTGAATTATACATACATTTAGTATAAGAAAAGGAGAAAATTGAAT
TAAATGTCACTATCAATTGTTATAATTATAGAAATCTTATTATAAAACAAATAAAAATAACTAAAATGCGTATAATGTAATCCTTATCAATATTTCAAAA
AAGAAGAAGGAATTGCTCTCTTTATGGGAAACTTGCAAGAAGAAGATTGCTCTTTAAATGGGAATTTGAAAGGCAAATATCAAAAAATTGTTCTTCCTTG
ATTAATTACTTCTCCTTTTCAAATAACAGAAGAGGAGAATCAAGTTTAAATTAGAATGTTAGGTGATTATTTTTTACGTATTAAAATTATCATGAGACAT
GTTGGTAGACCTCAATAATATTATTATTATTATTAATATAATATTGTTCATAATAAAAAAAATAAAAATTGAAATCAACATTAATATCAACTAATTAAAC
ACCTAAATTATACAACTCAAAGTTGGTAATTGCTGCTATCATCACTGATGGATGCTAACGATTTTTTTAAAGAAAGCTTAAATTACCTAAAACTTCTCTA
AGACAGAAATTACGCTAAAGAAATTTTAGACCTTCAAACAAATTTAAAATATAAAAATATAAGTTTTTAAAACTATACTTGGACATATACTTTATTAGGA
AAAAAGATTAAAGTCTAATGAATTAGTCAAACAGACTTTTTAAAGACAAATTTTTAAAATTTAATCCAAAACTGATGATGCTAAGACAACAAAAGCAAAA
GACAAGAAATCGTGGTCAGGGGCATTTTAGACTTTCAAGCAAGGGTATTTTTGGTATTAAGAAAACCTGTAAAAGAACCTTGCAAATGGCTTCAGTCATC
GGTAAAGACGAAACACAAAAATGTACTTATTAGTTACATCTATGAACAGTTGTTTCTTCTTGTTTTTAAGTAGCGATAATTTTTTTCTATTTTTCATCTT
CCTGAAGAAGAAAAAAAAAACGTAAAAGTTGTTTCATCAATGGCTCATTTTTGGAACCAAACTAATGCTCTGTTCCGGAAGAATCTCGTGTATCACGTTA
GTTCAAAAAATTCTGTTTCTGTTTTCAATTTTGATTTTATTTTTGTTAAATTTCATGGATTTGATTTTGAATTTTTGAGTTTTGCAGAGACGGCATGCGA
GATCACACTTGAAGGTGATTTTGTTTCCAGCAATTCTGTTTATACTTCTAGGGGCTTTACAAAGCTACTCCAACAAGGCAGATAGGGGAGATAAAGTAAA
GCCCCGCGTTGGAACTGAATTTCCTCCTTTATTGCAAATTCCTTCTCCTCCATTTCGTGCGGTGATGACTGATTCAATGCCGTTTACTGGGCTGCCTGAT
GCATCTTGCAGAGGAACTGGTTCATGCCCAGCAACTGTACTTATCACAGGGAACAACAGAACCATTGGAGAAAGTATACGTTTTTTGCTACTTTTAGTAC
GTTTAGCTAGTGTTTTATGGTAGATTTTGTAACTTTACTTTCATTTATATGAGTTTGGCCGTTAAATTTGATTGAGTTTTGAACATTCATCTCCAAATTT
GTTTTTTTTTGGGACTTCGATTAGTAAAACTTCAATTTCAAGTTTGAACTTAAAAATTTATGGCCAAACAGGAGTTAAGGAAGATATCTAAGGTTACTAG
TTAGTAGGTGCCCCCTGGAATTAGTGCAAGTCTAGTCGTGCCCAAGCTGGTCAGGACATTACGATTGTTTAAAAAGTATAGGAAGATAGGACTGGGACTT
CTCTTTTTCTGAATTTAATTTGTGAATTTTGGTAGGTGTGGCTGGGAAGATGTTCGTAGATTCTCCAGAACCAACTTCAAGAAGTGATTACCAGACTATT
GCTGATGGCATTTTCGTGAGTTCTCTTTCCTTTTGATTCTGATTGTTGCCTCATTTTCTTTCTTGTTTTTTTTTGTTTCTTATCGTTGTATCTTGGTCTT
GGTTTTGTAGCAATTTGAAGTTTTGTTCTACTTATTATGTTTTCTTATTACCCCTTGCATTATGTGTTTTGGAAATATTGCAGGGGACAGACGGCGGTGG
TGTGAGGGTGGATAGCAACTTACTCTATCATGTTCGGCCTCAATGTTCTGCTTCGCCCTTCAGAAACTCCACATCAGAAACTGGTAATGTCCTTTAGTAC
TATCTATTGGTGCTAATTTCTTTAGAGCATGATGTCTACCAATTTCTCTGTTTCATTTTCATATTTTGCAATGCCATCAAAATTTTGTGCATTTAAAAAC
AATTTCAATATGAAGCCAGTGAAGTCCAATTCTTTTTCATGCTTACTCCGCAAAACTTTTATTTGAGTTTTATATGCTCATTCTCTGTCTGCCAGGCCTT
CTATTTGCTATTGTGTAGAGTATTTTTTCTCTGTGTGAGATTTTTCAAACAGCAGAAGTATGTAAAATGCACTGATTTCACTTCTATGCCAACTTTAGAC
ATCATATGCGTGGAAGGTTTAAATTTGTGGCGCAACAGCTCTGCTGAGATTAACGATGAGCTATTCAAAGGATACAGAGAAGGAAATACACAGGGGATGC
TAAACGAAATTTTGGCAGGTTATTCTCTTAGATGTCTGGACTTTATAGATTGATATCTTTATATTCCTCCTATTAATACTTTTCTTGTCTCCCACAGCTT
ATGATTTCTTGGATACAAGTGGAGAGAATTTCAATGTCAACGTTCAATTCAATTCTACTTATCAGTCCAATTTTTACAATGATGAACCTGAATTGTTGAG
AATACCACGTTCTGAGAACATGGTATATCCTTGTATCCTTTTTTATGCAGCGAGTAGAAGCTTTATAATAAAAAAAAGGTTCTACATAGCTTAGATGTTA
TTAATTTCTTTTTAGTCCATTGTTAGATTGTACTTAGCAGGTGTAGCTTGCTGCTTACAAATGAACCTTTATCTTCATCTTCAGCATCAAAGTTATGTTA
TTCCTTACCACTAGCTTTGGTAAAAAGCCTTCCACTCACTATGGTGAGAGAGCATATATTTAAAGGGAAGTAGTAATATGAATTTGAATCACAAGGAAAA
TTAGGGATTATGAGGAATCATGTGTACCCAAATGTTTGAAATTTACTAGTAATAATTGTTAGATGACTCGACTCTGTAGCGAATAAATTAAAGATGAAGC
ACACATCTTGGTCTCTAAGTAAACAAGTGCTGGCCAATACTAACTTGATTTAAGTACTAATGCTTGGTGCTAGAATTTAAAGGCCTTCTGCCTGATGTAA
TGCATTGCACCTTTTATTGTTTAAAAATCTCGTAATATAAAATAAGTTAATCTTCAAATACTGTTCACAGCATATAAGAAATATGATGTTTTATGCTTTT
CTATGTAGGTAACAAATGCTTATCTCCAATTTTTACTTGGTTCCTCTACAAAGATGGTTCTAGATTTTGTAGCTGAGATGCCAGTTCCTGGCGGCTACAA
AAGGCCAGACGATATATCTACCTTTTTCAACATTGTCTTCTATACATGGGTCATTCTACAAGTGTTTCCGGTAAATATTTGTTTAGTTTGTGAAAAGTTG
CATGGTTGTGGCAAAGATGCTTTTCTAGAGGATTTTTTTTGTATTTATCATTTATTAGAAGTTTCTGGTGTCTCAATCATTTACTTTCTTTCCAGTTGAA
GTCATTTTAGTGGTCCATAGATTTAGGTTTTGCTATTATTCTTTTCATTTGTGGCATCAGAGTTCTAATCCAGGATTTCAAATCTACTCTTTGTATTTAA
GAAAAGAATATTAGTTACTTCCTTTCTAAGAGTTAAAGACTTACGTGACCACAGAGCTGCTAAAATCTTTTTTTCGGTTTCGATATATGACAAAAGTGAT
TTTGATGTAGGTTATATTATCATCTCTGGTTTATGAAAAGCAAAGGAAGCTAAGGATCATGATGAAGATGCATGGCCTTGGGGATCTTCCTTATTGGATG
ATCACTTATGTGTATTTTCTTGTCATTTCTTTGATCTACATGTCCTGTTACTTTGGATTTGGTGTATTGACAGGTACTGCAGTCTACAGTTCAGCTGCTT
CTTTTTACGTTTACATGAGCTGGTTCATATTTTTTCTTGTATTACAGGGTTAACAATTTTCAAGCTGAATTCATACAGTGTCCAGTGCATCTTTTACTTT
GTCTTCACAAACTTGCAAATATCTATGGCCTTTCTATTAGCTGCAGTATTTTCAAATCTGAAGACTGCCGCAGGTTGGTGTCTGTGTAGAACTCTGTACA
AGTCCTTCATAGCACATGAGTAATGAATTCAAAAGGAAACTGATTTTCATGAATAATAATTTTTGTAACATTTGGATATTGCAGTTCTTGCCTATACAAT
TGTCTTTGGGACGGGTATCCTGGGTTTTCTCCTGTTCCAGTCCCTAGTTAATGATGCATCATTTCCTCGTAAGTATGTTATGTCAATTACTTTATCTTAC
ACTTTTTCTATTTGAAAAGGTAAGGATTTTACTAATAGAACAGCATGACAAATGCTGAGAATACTGTACATGTGAGCAAAAGCTCAAGGTGAAGGAAACA
GCGCATGTCCACGCGTTGAAGGCCTAAAATTAGCTCTACAAATTAGGCATGCGACCAGTTTGCTTCTCTTTGAGATCATTTGGCTCTTTGTACTATGACC
AATGAAGCACGGCTATCCTTTCATATTTTTCAGGCTATCTTTAATAGATTATGTTTATAGGGGTAAAATGCCCAGAAAATCAGAAAATATGTACTTAATG
TTCCCTATTCACTTCCAAAGACATTTCTTACAAATACCTTAAAAAAGAAGGGCATAATTCTGATCCGTCATAGCCTGTCACCATCATTTAATTTGGACAA
CCAATGTGGTTTGATTCCGCAACTGGTTTGGTGATTTGGACAATTCTGGCTGTTTTTCTGTTCCAAATTGTGTTTCAGTAGAATGAGATATTCCTGGTGG
ATCACTTCAAGCAATTTTCTTTTCAGGATAATTGTTTTTTCATTGATTAATTATATTTGGTATGTTGATCACATGAGTTGAGCTTAAATGAGGAAACCTG
GTTGAGGATCTGTGGAGCCGACCCTTTTTTAAGATTGAGGCGTAATTGTTTTTGAAGTCACACTATTTGGATTCTACATGTATCTCTCGTGCTCACCAAA
TCTAACATGTTTTTTTTTTTTGGAATAGGTGGTTGGGTAATTTTCATGGAATTATACCCTGGCTTCTCTCTATATCGTGGGTTATATGAGTTGTCCCAGT
ACGCACAAGGGGGATATTTGGTAGGGACTTCTGGGATGTTCTGGGAGTATCTTAGTTACAGCAATAATGGCATGAGAGAGGTTCTGATTATCATGTCAAT
TGAATGGGTGGTATTTCTGATTGTTGCCTATTACTTGGATCAAGTTATATCATCTGGAAGTGGAAACCGTAGGAGTCTTTTGTTCTTCTTGCGAAATTCT
AAAAGGAAGCATTTAATGTCACTGGAGAAATCTTCTTTTCATAGCGCAGAATCGAGAGTTCAGATTGAAAACAATGATGTTTCCGAAGAGGTAATTAATC
TTGCTAATTTTAGATTTTCATGAACTTGCTTTGAAGAGGTTCATGAACTGATGGACCATAAATTCAAGCAGAATATTTTAAACTTGTTTGGGGGTGGAGG
AGGTGGAATGGTCAACAGATAGGGCTTGGGGACGTTGGGTGGGTGGCGAGGAGACAATGAACTTGGAAGTTACTTATGAAATTTGTTTTCCCTACTTCCA
TTGGGGAAATCATTTTCCTCATTTTTAAGGAGCTTGTTTTCCTTGAGAAAATTTCTCAAAAAAAAAAATGGAAAAAAGTTCTCCAAAGGTTTTCCTCCAT
ACCTAACACACCCATACTCTTTTTTTTATGGTTTTGATTGATCCTCACCTCGAGAGCTAACTTTATGGGGTTGAGTAAGACATAAGGTCTATTTTCATAG
CAATGTTCAGTCCAATTTTCAAGTCCTTGGGCGTATGGAGCGTGGGAGAGTGGGGAAGAGGGTGTTGGAGTCCAACATTGGTTGAGGGAATGAGTTTTTA
TCTCCTTATATGGTTTGGACAATCCTCGCCTTATGAGCTAGCTTTTGGAGTTGAGTTAAATCTAGCTTCTTTCGCGGTATCATAGCCAAACCTGTCCTAA
TTCTTTGCTTATAATATTGCACTCCATATTATATTATCGACGCTCCAAATGTCTAGTCCTAGGCGTGCATGGGTGTTAAAGTGTCTCATATTGGTTATGG
AATCAGCTGTTGCTTCCATATATGGTCATGGATAATCCTAATTTCATGAGATACCTTTTGGGGTTTAGTTAAACCCAGTGTCAAATTCTTTTCAGAATTC
TCATTAAGTATATTCTAGTGTCTTTTATGGTCATTTGGATGTTCCATGTTCTAGTTTCAGTCACTTGAATCGTCCTGCAGTATGCCTATAGTTGAGTCAT
CTCATTGTGGTCTTTTGGCTTTCTTTTACAGAGAGAGAAGGTTGAACAGTTGCTAGAAAAGCCACATTCTAATTATTCTGCCATTTGCTACAACCTCAAA
AAGATGTATCCCGGAAAGGACGGGAACCCCGATAAACTTGCAGTTAAAGGAGTAACTCTCGCCTTACCGCGTGGGGAATGCTTTGGCATGCTTGGTCCAA
ATGGTGCAGGAAAAACTACTTTTATTAGCATGGTTAGTGAAAGTTTTCTAAAGTAACTGGGAATGAATTTTAGTTACCACATAGACCATGTTTTCTTGGG
TTAAATGAAGATCTGCGTGAGTTATGTACATTGCACTTTTCCCTAGCATTTTCACAGTGTCGGAACTTATTAAACTATGGTACTAAATGACAGATGACTG
GGCTCTTGAAGCCAAGCTCTGGGAGTGCGTATGTTGATGGTCTAAATTTGCGGACTCAAATGAACGAAATATATGGTAGCATGGGTGTATGTCCACAACA
TGAGTAAGTTTATCTGTTTTCATCATACCTATGAACACTTGCGGGTATCATTTTTGTTCTTCGTTTTGCATTTCAAAGTGTTGACTTATTAAACTTCCTC
CTTTCTTCCAATTTGTTAGCTTGCTCTGGGATACACTAACAGGAAGGGAACACTTACTCTTTTATGGAAGACTGAAAAATCTCAAGGGTGCTGCTTTAAG
CGAAGTACGTAAATATAACCATCAACTTCATTTCAACATCTACTTAAATGAAGCCAAATTTAAAGAATGGTTATGACGGCTTTCTTATATTTATTTGCTT
AGACATGTTATGTTTTGAAAGAAAATTAGCCCAGTCTCTTGCTGTTGCATAGTGAATAAAATGTTCCTAACAAGTCAATGCTGCTGTGAAAGAATTCGTA
CATCTGATCATTAGCGAATCCAAAAAATTGGAAACGGGCCACCTTTATATCCTTGCAATGTCGCATTCCGTGAAGATAATTAGTCATTGTGGTCTTTAAT
TTCCTTTGGGATTCTGTTAACTACAAGTATCTTTACAAGCTCTAGAGCAAATCGCTAAGATTGACATACACTTCTATTTTTATTCTGAGAAAGCCCTTTA
TCATGACGGAGAATTGTTTAATGCATATATTTTCTCTCTTTGATCCTATTCTATTGCAACAGGCAGTGGAGAACTCTCTAAAAAGTTTCAATCTTTTCCA
AGGAGGAGTTGCTGACAAATTAGCAAAAAAATATAGTGGAGGTATGAGGAGAAGACTCAGTGTAGCCATTTCATTGATTGGGGACCCGAAAGTACGTACT
CCTCTTATATTATGACTTGAAATTGTGCTAAAGTTCTGGGTTCCAATGAGCTAATACTAACAGAACTCAAAATTTTTAAGGTTGTCTATATGGATGAGCC
AAGCACTGGACTTGATCCTGCTTCACGGAAAATGTTGTGGGATGTCGTGAAACATGCAAAGAAAGATAGAGCAATCATTCTCACTAGTAATCTGCTCTAC
ACTTAGTTTTTATGTACAAACATTTCTGTTTTGGGTTGTTATTTTGTAGTAATCTTGAAGTTTATCCTGCTATTACCATGCAATCTCAAACATAGGCTCT
ATGTTTGCTTCTCTCATTCGGGATGACATCATTGATGTTGTTCTTTCTCTTCCTCTCAGCACACTCGATGGATGAGGCAGAATATCTTTGCGATAGGATA
GGTATCTTTGTGGACGGAAATTTCCAGTGCTTGGGAACCTCAGATGAGGTAACTTCTATGACCTTACCAACTAGTTTACAACTAAAATTTCGGAACTTAA
CTAACACACTGAAGCTTGCATCTGTTACTGTGAATTGTTGAGAAAGTTAATATTCTAGTGATTTCCTACTCAATTAGCTAGGATAACCTCTCGAAGGAGT
GATCGTGCTTAAGGTTTGGAGAGTGACAATGGGAGCTTGGATTTTAAAATTTCTTGTTTATTGGTCAACCATTAAACCATTATCTAAACTAGTATATGGT
TACTAAATCAATCTCATTAAAGATTCTTATCTTGTGTGATGAGATTCTGTTGATTCTCGTCCTAGTGTGATGCCACTTCTTTGGTCTGTATGATTATCGT
ACTAATACTTCATTCTGCAATCATGGTATCTAATCTTGCTAATACTTAACTGTATAATTAGCAGAAACTCTGAATATGGCAAGTTTTATTTACTGGTAAA
GCAATAGTGTGTATGCTGGAACATATTTCTGATCATATGTTAACTGTAAATGACAGTTAAAAGCTAGGTACGGGGGATGCTACATGTTCACCATGACTAC
ATCACCAGAAAATGGGAGTAAAGTGGAAGACTTGGTGAAACGCCTCTCTCCAACTGCGAAGAAAACGTACCATTTATATGGCACTCAGAAATTTGAGCTT
CCAAAATATGAGGTGAAACTTTCAGATGTGTTCCTAACGGTTAGACAAGCAAAGGAGAGATTTCCAGTTCAGTCTTGGGGTTTGGCTGACACAACACTGG
AGGACGTCTTCATCAAGGTTGCAACTGAGCACAGTGAATTTCACTAAATATCTCTGAGTGTATGCTGTTATACAGACTTGAGACTACAGTAGCTGGGTTT
CATCTGGTTGTTGAATTCTTCATTCTCTTGCTTGTAAGATGTCATTTTGTAGACAAGAAGGATTGTTGATTTATCTCAGTGAATTGCTCCACACACTGTT
CAATTATATGTCTCTTATGGTATATCACTCCCCAAGGTTCATTTTGTTAGCTTCTGCATGACATCTGGTAATTTTGATTCTAATCCTTTCTCTGGACTTA
GAATTGGTTACAAGCTAACATATATAGATGAGTTTAGAGAAGTCGATTAGACTTCCCAAAAGAACATATTAATACACTTTGGTCCGCGCCATAACTGAGC
TACAGAAAGCAATTCAGACTCGTAACGAGTTCTCAAGGTGCTATATTCATAAGGATATTGCATATACTGATTCCTTGGACAAAAATGAAGTAACAAAGGA
GAAATACTTGTGATATAAGACAATCTCAGCATTTACATGCTAATTACACATTGTACTCTCTATACACAAAAAATGTTATCAATATGCAAAGCTTNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATGAT
GATAATCCCTGAACAGTTCTGGAAAATTTCAATGGAGAGTAGTGATTTTTTACTAGTATACCCTTACATATTTGAGGAATAAATATATATTCTTTCATCC
CTATCCATTCGTTTCATTATATATATATATATGATAAAAAATTTTAAATTAGTTGAAAAGAAACATATTTTTGTCCTAATTTAGAAACCATTTAACTTAA
TGTCATTCTTAGCACACAAAATGTAATACATGTCCAAAATTTACATGTTTCAAAAACATTACAAACGTTACCTATTTAATACGGTAAGTTTTAAATGTCT
TCACTTTCTTTCTTAAAATTCGTAGGACGATCAGCTAGCATCAGCCAAAGATGAAATGCGAGAAGTAATGGAAGAAAATCAGAGGCTTCGAATGCACTTA
GATCGAATGATGAAGGAATATCGAAATCTCCAGAACCAATTTCACGATATCGTTCAAAAAGAAACTGATCAAAAATCAAGCAGTACTACTGTCAACACTA
GTACAACACATCATGATCATGAATCTGATCAAGAAGCTGATCAACTTGTGTCCCTCAGCTTAGGAAGAACTACTAGCGATATGAAGAAAGATGATTTATC
TAAAATCTTAAAGAAAGATAAAGTTCATGACGATGAAGGAGTTAGTAATAATAATAAAAGCCTTGATTTAGGATTGGATTGCAAGTTCGAAACAACGCCA
ACTGAATGTTCACCAGTGAATTATAGTCCGGAGAATAGCTTAGATGATATTCAAGCTAATAAGGATGAAAATGAAGAGACGTCGAATAAAAATCTCAAGA
CGATGAGAAATAATGGAGATGGAGATGATGTTTCGCAACAAAACCCTACTAAAAGAGCTAGGGTTTCTGTTAGAGTCAGATGTGATGCCCCTACGGTAAG
GATTTTTCAATTTTTTTGTATACATGCATGCATATTGTGATATTAATTATAATTAAGTAAAGAATGCAATCTAATCTATGTATTTAATTATGTTAATAAT
GATTTTTCTTTAATTTCAAATTTTTTTTGGTAATATTATTGATCAGATGAATGATGGATGCCAATGGAGAAAATATGGTCAAAAAATAGCAAAAGGAAAT
CCATGCCCTAGAGCTTACTATCGTTGCACCGTAGCACCAAATTGCCCAGTTAGAAAGCAGGTAATATATAGAGGGATGATTGAAATTCCTTCATTCTTAA
TTAGATATGTCTCGAGTTTGAATACAATGCATGAATCCGAAGTCAATCAAGCTCTAGAACACCAAATAAAAAGTTATGTTCTATAGTAGCTTATTTAATC
CTCATAGATTAATTTAACTTATTTATTAAAAGTGTAAAATCTTATTCCACTTTTTATAGTAATTTAAGTTAATTAGTTTTGTTTTATTCATCATAGTTTA
TCTCGATACAATTTTTTTATAAAAATAATAGAAGATTTTTAATATTTGTGATCTCAAATACACTTTTATATTTGTGTGATTATAAATTTTTTAAAAGCGT
CTTATTAAGAAAATATGCATAAGATGTAATAGTAAAGAAGTAGTATCAAATATAGTGAAAAGGACTAAAAGTATTACTCATTTTTAGGCGATCTGATAAA
TTAAATTTTATAATGAATCAATTTATTACTAGTACTAGTACTACATTATCATGGTAATGATACAATTGTTGCTTGTTGGTTTTGTAGGTTCAAAGATGTG
CCGAAGACATGTCAATATTGATCACCACATATGAAGGAACACACAACCATACCCTTCCTCTTTCAGCCACCGCAATGGCTTCTACCACCTCAGCGGCCGC
TAGCATGCTGTTATCCGGTTCATCTAATTCATCAGACCCAAACCCACAAGTAACTGCCACCACCACCACTACCCCTACTACCACTACTTCTGCCAATATC
AACGGACTCAACTTCTATCTCTCTGATACCTCAAAACATCATAAATCGCCATATTACTTTCCTAATTCATCCATCTCAGCATCCGCACCTAATTCCCTCC
CTACAATTACACTCGATTTGACTTCCACCTCGTCCTCGTCCCCGTCCTCCTTATCTCATCTAAACAGAATGACTCAGAATTTTCCTCCTAGATATAATTA
CAATAACAATAATTCCACCACAAACCTCAATTTTAGCTCAGTACTTGAATCCAATTCCCTTCCCATTTCTTGGACCAATAATTATCCAAATCAAACCTAT
AACAAAAATAACCAAAATTTTGGTCCACTTACATTTTCATCAAGATCAAGTCAAGATAACATTTTCCAATCATATTTACAGAAAAATACTACACAATCTT
CTTTACCACCAGACACAATTGCAGCTGCAACCAAAGCAATAACATCAGACCCAAATTTTCATTCCGCATTAGCTGCAGCTCTTACATCGATCATTGGAAA
TTCTCCAATTGAAAACAAATCCGTCCATAATTTAAATGTTACTGAGCCATTTCCAATTTTATCCAGTCTCCCTTCAAGCTCAAATCCGAATAAATGTTCG
TCAAGTTTTTTAAATAAACCAACCTCTTCTGCTTCCGCGAATAATAATAATAATAGTAATAGTAATAGTAATAGTACACAGCAGCCTGGGAATAATAGCA
TGGTGTTTTTCGGGCAATCTTCTTCTTCGTTACCATTTTCGACGTCTAATAAGGGTAAATCTACCTCTCCTGGTGATAGTAAGTTTGATTGATTAATTTT
TTTTTTCTTCATGTTTTACCTCTGAAATTGAACTTTGTAGTTAGAAGGATTAATCATCTGTATAGTCTGTAGATATGCTTTAGTGTCATTAACACAATTG
ACACTTTGGAATTAGCATTTGTAATTTGTTGTTGTTGATTAACTTGACTATGGTTGTAAGATTTTTGTACAAAATGTAGATTATTTATTTAGTAGATGGC
TTATTTGCTTCTTTTTTTTTTGGTGTTTAATAAAAAAGAAGATAGAATGGGATATTACAAACAGTCCTGAATATTTAGCAAAAAAAAAATAGAATAAGAA
TTGATGTAGAAATTTTCGTTTATATTGAATATGTTATGGTTATTATTACGTTGTTCAGTTAATCAATGAAACCTATAGCAGCAAATAGTAATGGTACTAT
TTAGGTTGGTCAATTAACATTTCATCGGAATATTAATCAAACAAATTGATAAACTTCTGGTATATACTATCTCTAATTTGATACAATATTAAATAATTTT
AAAAATGTTTGTGTAAGTGGCTTTCTATGTTGTTTTTTTTTTCGAATCTAATAATTAGCACAATAATTTTAATTTCTAGCAAAGTGGAATAGTAGATAGT
GGGTTGTCCATCGATCAACTATGATTCAATTTCTCCGATAAAATATACAAAATTGGACTATAGAATATACATTGACTAACACACATACGAATACGCCATA
AATTTCGCTCAAATTATAGATAACTTGCAATTATGTTAGTCTATTTTAGATCTATTCATTTAAATTTATGTAACTTTCAACTTATTTTAACCCGCTCAAA
TTCAACCGAACTCACTTATTTAATACCGCTATTTTGTCATTGCAAAATCAGTTGTTCCTCAACTAGTTAACATCATATCTTTTTCATGTTGGAATATATT
CTATTTCTTGTTTTGTTAGGTTAGAATGTCTTACGCGTCATGAGAACTTTTTTTAATTTTCTTCAATCATATTTACTATTTGTTGTATTGTTGATGTCAA
TCTTATGATATTTTTTGTTTGTTTGTTGGGTATTAATTGATTGTGTGACCCACTACAAATCTTAAATAAGATTGATATGTGTCCCATTNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTATGGCTGAA
AAGGCAGAATAGTCTTTCCCAATGTGAAAATGGCGGAAGTATTTAAACGGTTATGCAAGAAAGGACTTTGGCTTCCCCGTGTAAAAAACAATATGAACAA
AACAATCGCCATTTGCCTTCCTTATTAGCTTCATCAACTTGCTCCATTTTTTAACCCTAAAAAAAACTGATAATTCCTTTGAAAAAGCTTGAAAAAACAG
AGTGATTTATGGCAATGGAGTTGCAGCAAAGAGGATTTTCTCTGTTTTGGCAACAAACAATTGCTTTACTGAAGAAGAATTTTTTGCTATCAATGAGAAG
CAAAAGAGCCACATTTCTTCAGTTGTTTTCATCGTTGTTCTTCTTGGGTCTTTTATTTGGAATCCAAAAAGGTATGGATTTTCGCTCTAAACATCCTTCC
ACCATCCGTGCAGTCAATGATCCTCAGCCTCTTACGAATCCTCCGATACCGCCGTGTGAACACAAGTTCTTTATTAAACATCCGTGTTATGACTTTGTGT
GGAGTGGAAGTGGCAACAAAAGAATTGAATCCATTGTTTCTGGAATTTTAGCTAATAATCCAGGTCGACCTATTCCTTCTACCAAGGTATAATTTTTAAT
TTACTCTCTGTGTCGATGTTTTTTCCGTTTACAGCAGCTCCTGCGCCTGTTGATTTTGCACCTTCTAACATCTCGAGTTTAAAATACATGATTTTCTCTT
TGAGAACACTCGCCTCTCTTAAAGACCTTTAATGATTTGTAGTCAGAAATAGAGTTAGTTGTGGCTTGAATATGGATGTAATTCCTTGCTTTTATGCTGA
TGATCATTTTATCCATTAATAAATTACACTCAAATTTGATATAAACGGTAAATAATTTAATTTACACTATACATGAAGTGTGTTTGAGTTTGCCTCACAT
CATTGTGAAATGGGAATTGAGACTCGGTATATGATCTTGGACAATCCTCACTTTACGGGCTAGTTCTTTGGGACTATGTTAGTAGGGTCAAGGTTCATTT
TTTTTTATAGAAGTATCAAAGCCAGGGTTGTCCTAATTCTCAGTTGGTCGGATTTTAGTCTCCATATGTTATTGTCCCACGGTCCAGTTGGTTGGCTTAG
GTATGCCGGAAGGGGCAGGTCTTGGAATGAATAAAGCCAAATCACTGTTCTTCTGCTTTATCTATTTAAGAATGAGATACAAATTGGTAGCTCTTTGATC
TTCAAAGTGTTCATTAGGTATGTGGCTGCCACTAATGTTTTTATTTTTCAGGTCAAGTCATTTGGCACAAAAGATGATTTGAACAATTGGCTTCTCAGTG
ATCCAATGCGTACCCCGGGAGCTTTGCATTTTGTGGAACGAAATGCCACAGTTATAAGTTATGGTGTAGTAACAAATTCTTCTACGTACATTAAAGTTCC
AAGGGCATCTGAAGATCCAACATTCAAATTCCAACTTCCCCTTCAACTAGCTGCATCAAGAGAAATTGCGAGGTCATTGCTTGGAGGTACTATAAGATAG
CAGTTTTCCTTTACAATGATTATTAATAAATTCCGGAGACATTTTTATCAAAATAAAACATTGCATCCTGCCTTCACAGATTCAAAGTTCAGCTGGAATG
TTGGTCTCAAGGAATTTGCGCGTCCTGCAATAGAAGATCCTGAAGCTGGAGACTCATTTCAAGATTCTTCATTTGGTAATATTTTCAGTCAAATATTCTT
CTATGCAGTATCTATGTTCGGCTTCGTATTCCAGATTAGCACAATGGTTCTCGAGAAGGAGCTCAAACTTCGCCAGGTAATAACCCATATTTTTGAGAGA
CTTGGATTTTTATATTCAACCTATTCCTGATTTTCAATTTGATACACAGGCAATGACTGTGATGGGACTTTTTGATTCTGCTTATTGGTGTTCGTGGCTT
CTATGGGAGGGAATTATGACATTCCTTTCATCACTCCTCATAGTTCTTTTTGGAATGATGTTTCAGCTTCACCTTTTCTTGAAAAACAGCTTTTTGATTG
TTCTACTTCTGTTCTTTCTTTTCCAATTGAACATGGTGAGTTCCTTCTGATTAAAGCGATACCATATAAGACTAGTTTAGCCATCATTGCAGTATAACAG
GACTGAGACCCTTTTGCATCTTGATGTGCTAGGTTGGTTTTGCCTTCTTAATATCAAACTTCATCCGTAAGTCCGCTTCAACTACCTCCGCTAGCTTTGC
CATATTTGTAATTGGTTGTGGGACTCAGGCAAGTCAATTCTCAGATCTAAACTGCCAAAACTTATAAATGGATCTTATAACACATTTTTTATTCTCTTGC
AGGCATTTGCAGGGATGCTCTATGGTAGCACAGATCATAAAACCAGATATAGAAGAATACTTTGGTCCTTCTTTCCGCCCAATCCCTTTTCAGGAGGTCT
GGTTACTTTATTATATGGAGTGGAACATGGTGGGATCAGCTGGAGTAAGCCATCTCCGGGTGATGATTCATCCTGTTATTCTATGGTACGGTAGAGTTTT
AATTTTAATTTCTCTTTTATAGTTTTTAGGAAAATAATCTTTCAAATTTTGATCTTTTTTGAAGTCTAATTCACCATGTATCCAAGATGATAAGAGATCC
TAAACATTTGTTTCTGTGTTTTATCTCTTGTGTATGCATGTTAAAACTTATCACCCTCTTTCTTCTTTCTATAATCAAGTTGTTTGACCATTTCCTGAAC
TATTTTGTCTTGCTAGCTCCATTTCTATCGATGGCTCATCGCGACGTTCTTCCTGTGGCTTGTTTTGGCTATCTACCTTGACAATATCCTACCGAACTCA
GCAGGTGTACGGAAACCCTTTTATTATTTTCTGAAACCTGGATATTGGACAGGAAGAGGTGAAGAAAAGTTTAAAGGTACTACATAATTTTTGACTTGTT
AGTCTATTTTCCTCAGTATTTTTGTTGACATCCTTTGGTAACCAGGCTTCATATTCTTTTAAAATTCAGAAAATACCCTATGTTGTGGTTCTGGTTCTTC
GCCTCCAAATGACAGTTTTTCGCAAGATGATGAAGATGTTCTTGATGAGGAAAACAGGGTGAAACAACAAGTGAAGGAAGGCAATGTTGATCCAAATGTT
GCTGTTCAACTACAAGACCTTTATAAGATGTATTCTCGGACAATAAACTTTAGTTGCCATTCTTGTTGCCTTCTCTGTTGCTATTGTAGATGCAAGATTA
AGAAACCCTTTAAGGCTGTCCAGGTGAATATTCCAACACTCCTTTGCTTGTTAGTAGTATTTGGCTGAATTGAATGAGTAACCTAGTGTTTCTTTATCCT
AGCAATAAATCATCTGATATTGAACTTCCACAGTTGACTTAGTTGACTGATAGTTGATTTTTGTGCATCTCTTTCTAGTAAGATGGAGTGACCCTTGACG
TGATATAAAATGATCATTTTTTCGAGTTTTATCATTTAGCATCTGCACTTGAAATAAGTGAAGGCATCATCCACATGGTTTTCATCTAGCATATCTGCAG
TCTGCTTCCCTGCAGGCTACAATATTAAGACAGCAAAAACATTGGCAAATTTCTCAATTTTCATCATAGCATTCATTGAAAATTTTTGGAATATGCGTTG
CAATGAAAGTGGCATTTTTTATTCAGGGACTGTGGTTAAATCTTGAGAAGGATCAATTGTTCTGTCTCCTCGGACCAAATGGAGCTGGAAAAACAACTGT
AATTAGTTGCTTGACTGGTATAATTTCAGTCACTCGGGGAAATGGTAATAGCTTTTCTTTTAGAAGTTCCAAGTAAGACCATGTTCTCTTTTGATTGAGC
ATGAATTGCTTAACTTATATATGTTGATTTCTGACAGCACTAATCTATGGAAACTCTGTTCGAAGTTCGGTTGGTATCTCCAACATAAGAAAGCTGATTG
GAGTCTGCTCACAGGTAGCGATTTGAGTCTTCTAACAAGTTCTGCACTCTTTCTTGGCTTGGTTTTTTCTTCCATTGACTTTGTGTGGCCATACTTCAGT
TTGACACACTTTGGGATGCATTATCTGGACAAGAGCACCTTGAACTTTTTGCCACCATCAAAGGCTTATCCCGAACATCAAAAAGATCAGTAAGTATCCG
AAACCATCCCTACTCCTTCTCGGAGTAAAAGAATGCGAAATGATTAAATATATCTAAATATTTGTGACCTCACTGGCCTATATTCATAAGTCATATATGT
TTGCATCCTAAATAAATTGCCACAATTTTTCATTGACTCTTTGATTGAACAACTGGCTATTGCATATGACTTCTCACTAAAAACTTCGATCTACTTGAAT
GGCAGGAAGCTAAAAAATTGTTGGCTGATGTGAAGCTCGATGATGTCGCCGAAGTGAGAGCAGGAAGCTACAGTGGTGGAATGAAACGTCGCCTCAGTTT
AGGAATAGCATTGATTGGAGATCCAAAAGTTCTCTTTTTAGATGAACCAGTATGCAATTTTTAGAAGCTTTGATCTAGTATAATCAATGTTCAAATTTGT
TTCTTCAATCCTGAGGTAAGTTCATGCAAATTGTAGACAACAGGTATGGATCCTATAACTCGGAGGCATATCTGGAGTGTAATTGAGGCTGCAAAGCAAG
GGCGTTCTATTATTCTGACGACACATTCTATGGAGGAAGCTGATATTTTATCAGATCGCATTGGAATTATGGCAAGGGGTAGACTTCGTTGCATTGGAAC
ATCAACCTTGCTGAAGTCTCGATTTGGTGCTGGATTTATAGCTAAGATTAGCTTCAGTAAAGTTGCTAATGATGTAAATGTCATGGAAAATACAATAGAC
AGCAAGTATCATGAGGCTGTCAAAGAGTTCTTCAGACAGGTGCTTTCTAGTAATGAAGCTTTTAAAAATTATATTCAATATATAAACAAGTGTTCTTGAC
TGAATTATTTGGTTTTACAGCGTATAGATGTCACACCAAAAGATGAAGATAAATCCTTCTTGACTTTCATCATCCCTCATGAGAAAGAGAGGCTACTCGA
AGTAAGTACCTCGACAAGATTGCTTCAAGAAAATGTAACATGTATTTCAATCACTCAATACTATGTGTCCTGATATTATTTGCACATTTGTATCAGAATT
TCTTTGCAGAGCTAGACAACAGAAAAACGGAGCTTGGCATATTAAATATCCAAATCGGTCTCTCAACGCTTGAAGAAGTGTTCTTGAGTATTGCAAAGAA
GGCAGAGCTAGAAGGGGCTGCATCAGAGGGAACTATCAAGCCATTGATTTTACCATCAGGAACTACACTTCAAGTAGGTGCACCACTTTGGAATTATATT
TATGTTACGGGTTTAACTCATATACACTGACTGACCGTATAAATTTCTTTTTACACTATCTGAAGTTTTAACTTATTTAGTAAACATGAAAGATGAAAAA
CGAACTCTATTGATTTGCGTTACAATTGCAATATAGGTACCTGTAGGATCAAAATATGTGGAGATCCCAGGCACAATTTCCGCGGAGAATCCTCGAGGAC
TTATGGTTGAAGTTTATTGGGAGCAGGATGATCATGGCAATCTCTGCATTTCAGGCCATTCAGATGAAACTCCAGTTCCACCTAATCTTCAAATATCAAC
TTCCCGTTTAGTTACTGCCAAGCCAAGAGCATAAGATTGAGAACAGTGACCAGTTCTTAAAGCATTTATTTCTGTTTTTCTCAAGAACATATGTTGTAGA
TGAAAGATTTTAAATGTACTTTTAAAATCTTACATAGTAACTGCCAACTTTTTTTTTGTTTTCTTTCTATGGTCTTGTGCATTGTGTTAAATCATCGTGT
CTAAAACAGTAGAAGAGTTTTGATCAGTTTATTTATAATGGTATTCATAATTCTGTGATCGATATCATAGGGAGAAATTTGTTTTTAAGTCTTACCATCA
ACGATTACAACGTAGAGCAAGTAAGCTTAGATACGTACTTACAACTTCGGCAAAATTCAGTCGTTTTGACTCAAATCTTTGTATTATGTACTGGTAAAAT
GTTATAGATCATTGTTCTAAATTCTAATCACTAGTACAAGGTGTGTTTTGAACTTCTTCTGTACTCAGGTCATGGCATGTTGGTTTACTTTTACTTCTCA
CATTGAGCATTTCAATGTCAAACAATATTTTCTTTCGACCATTTAATGTTTTGAAAGAAAATATTTGTGTATGACCAATTTAATTTTCATTTTTACTGTC
TAAAGAAAATCTAACAACAAAATGTAAATATAGTTTGGTAATGAATGAATAGTACAATACACATTCAAATGGCAACTCCTGCTTGAAATTAAAGTTCTAG
TTGTGTTTTCAGTTCCACAAACAGACCCCCGGATTAGCAAGTTGAAACACCATTATTTGCAAATCAAGTCAAACGAATATGCTCAAAATTCAAACACAAG
AAGAAAGAAAAAATACACGAATAAACATCTAACAATATGTCAGGATCATGATAAGTTAATATGATAGTATACTTCAAATAATCATGGATAATGTCTCCTT
CCTATCGATCGACATTTTAATTTTTTACTTAATATGTTTAAGATCATAAGACACATATTGATACATGTCACATATCTAGTTTAAAATCGCAAGATTCAAA
ATGATGATCAAATCAAAATCAAAATAAAGCTAAGGAAGTATTACTTTTGTGAATTTTAACCAAAAGAGCGTCGAATTTGCCAACTCAGCCCGTCAGCAAT
GTACATCAACGGTAAGGAATTGTTCAAAATTTGAAAACCCAAATTGAAAGCCTATTATTGGACCCACAAAATGGGCCCAACCCAAAGAGCCGTTCCAATA
TTCTCAGCTTTTCTTTTTTTCATTATTCCCCACTTTTTAATTTAATTTTGAAGCAATTCTTACATTTCCCGCTCAGACGCTGAATATAAAGCAACAATTT
CCTCATCATCCATCTTCACTTACCAAATTCTCTCGTCAATTGAAACCCTAGAATTCACCATGGACGATTCCGCTAAAGATCAATCCTCCTCTGTTTCTGG
TATTCGCTCTGTTAATTTCTCTGTGCTTTTTATGGCAAAATCTATGGTTGATTATATATATATGTGTATGTATATGTGTTTGAATGAATTTTTCATTTGC
AGCAAAGGCTAAGCAATCATCATCATCAAAGCTTCTGCGGTATCCGTTGCGATCGACCTCTAAATCGAAGGAAGAGAAGTTGCCTCTGACTGATTCCTCC
AACTCTTCTGCTTCTGCGAGGTTTCTAATCTCTGTAAATCTGCAATTTCTTCATTTAGATATCTGGTATATGTATGTGCTGATTAGATTATACGTAAGAT
GAATTTTGGATTGAAATTGCGTTGTATGCAGATATATAATTCAGTGGAATTTTTTTTCCTGGTATTTTACTGTTTTGTTCGGGTGCAACAATTAGGATAT
CTTGTAGTGACTGGAAATAGAAAAAACTCAATGAAGTAGCAGACAGAACCTTCTTCCATATGAAATAAGGTGAAATCTTATTGATCCAATAATCATTGTT
GGATTTGTTGGCTATTTGACATATTATATTATTCAGTGAAGAGTTTCAAGCTTAATCACCTGCTTTTGTGAAGCTTTTCATATTTATGGCGCTGAAGAAA
TTTTTCTAACCTGTATGTGGCTTCCAGAATCAGTAGATGCTTGATGCTTCATCTCTGAGCGAAATTTGAATCACAATCCATGGTGAAACTTTTAGTTTTC
TGTTTATATTGATACGTGCTACTCGCTGCTTACCTTTCATTTGGCAGGTTCTGATGTATTAACTCGCCTTTTACTTTTGGTTTGTGAAGTTTCTGCATTT
CATTTTAGGGACTTGAACATAAAGAGTTTAACTTCTTGTGGCCTTTGGTACTTGAAAGTTGTAACAAGAAATAAGTCATAATTTAGCCACGACCAATAAC
TTCTAGGCATAGTGAACTAATGAGAGCTACTTCAGACAAAGGCTGTCAAAGATGCAACTTCCTCCAAGTCTTCTTATTTTATTTCTATTGCTAAGACTTA
TTAGGTGTCTCCTAATTCTGCAATAACATCAATCTCTGCTTCATTTGTCTTTCAGGGTAAGACCTGCATCAAGTGTCAGTAAGAGTGTTGCTGCCCTTCC
CCTCTCTGGGAAGGAAAAATCAGCGAAGCCTCCAAGACGGCTGTCTGTTCCCTCCAAGTCAATTGTCAGCCCTGCTTCTAGACCACTTGGTATTATAACC
AAGGAACCAAAAAAAATAGGCAAACCCATTTCTGAGACTAGAGCAAAGAGATCTCCTAGTAACCAAGGAAAATCGGATACACCACAATCAAATGTTTCAA
AGTCCTCAAATAGAAAGAAATATGACCTTATATCCTCAGCTTCTTATTGGCTATCACAGATTAAGCTTTCTGAATCTGCTGCTAAGCATTCAATTTCCCT
GGGCTTGTTCAAACTTGCTTTGGAGGCTGGCTCTGAGGTATGATACTATATCTTCTCCCACATGAATTTAAACTCTACATTGAAGAAATAGTGAGCTCAT
TGAAATGTAACTAGGACACCTTTAGTAGATCTGCCTGACTGCCTTTCAAAACCACAGTAAAACTCTGAAGATTTTGTAGTGACTTAGTGCTATAGATTTC
AATATTCTATTATTCTCTCACTTCCTTCGTTTAGCAAAGACTATATTTTTAAAATCAAATTATTGGTTTCTAGTAAGATCATTGCTCGGCTTCCTTGCAC
TGCAATGCGGGTTACAAAATCTCAGTTTCAGAAACAACTTGGCTCTTGTAGCTGGTAAATCGAACCAATATGATTGAAAGTATTTGACTCTTTTTTGCTA
TCATTTCAGCCTCTTCAGCGTCTGAGAGATGAGCTGAAATCTTATGTGCAACGAAATGCCCTTGTTGAACTTGAGGAGCCTGTGAAACAATTGTTTGATA
GCTATAACATCCTCCAAATATCTGAGCAGTTGCAAGTTTCTGAGACTTGTTCTCATGTGCCATCTGATAATGACGTTCATAGCTCTTCTTCTGTTGCAAA
CACTGAGAGACTGCAAACCAAAGTCTTGAACAAAGACTCTACTAAAGCTGCACAAGTGAAAGAACCAACCAAGCAGCAGCCTTCAAAGATTGGAAGCACT
CCTAGGACCCGGAATTCTGTAAACAAAATTGCTGCAGCTGCGAAATCTATATCACCAAAAACTGGAGGTCGTACCACAAAAGAGAAACTTCAAAAGCCTG
CTAAGCCAGAACCAAATAAGGCTAAGGTGATGAAAAGACAGGGAAAGAGATCTGCTCAAGGAGAAGGTAGTTAAAGAGTGGACCTTCCTTGGTTAAAAAT
CACTTGACTTTTTGAGTTTAAAGTTAGTTATTTGTATTTTTCTTTCACAGGGCCTGTCGATGCCTGTATTTCAGAGAAAGTCCTGGAAGAAGATAAGGAA
AATCTGGTAAGGGGCACAAATATGGTTTCTCATTTTGATGAGTTGAATTTCTACCTTTTCATTGCATTTTGGTTGTACTGACTGCTATAAGTTACAGGAT
GCTCCACAAACAGAAGTGATTAGCACCTGAAGTTTTTGGCAGGAAGCTTTTGAAATCATATCAGAGGCCAAGGTGGAAGTATTTGAATCTGGAGTGTGCA
TTCCAATTTTGGATTTGGTTTGTTTCATTTGTTTATTCTTAATTTTTAAAAGAAAAATTACCGAACCATTATACAGTTGTGTCTAGCCTGTTCGTATTGG
AATTCATGCAAGACGTACAGTGCGTTCTTTTTTACTCAACAGCTTCTATGCGCTTGCAGTTGAATATTACTTGGAAGTAATTATACCTGCAGTATATACA
GTGTTATTTTTATCATTTGAATTAGCTTTTGATTTTAGATCTCAGTGACATCCTGGGCATCTTCGATTCCTTTAGTTCGAGTATTTTTCCTCCAAATTTT
GTGTTTTTCATCTTTGTAACAAATAGCATGAAATCAACGGTTGTTTGAATTTGATTGGTTCTTAATCCTACTACCCAGCATCCTCAAGTGCGCTCTAGCA
GTCCAGTGCGGTGCTATTGCATCTATACATGCATATATCTTTTATGCTGCTATATATGACACTATATTAGTATATTACTACTTCTCTATCTGCTAGAAAG
AAATATCAACTTAATGGACAAGTGAATTGTGATTCATCTCTACTATTGTGAAATACAGACTGAAAAGGCCACTGTGACAATAATTATTTTGTTGTCATTT
TTTCTTCTTGCAACTTTCTCTGAAAATTTTTTTGCGAAGGTTTCTGTAGGTGAACATGCAGTAAAATCATTGTTTGACACCTACAAAATAGAACGATCTG
CACATCTATCGAAATTAGCTTGTCTACTTCATTAGTATATGTTGTTGTAGTACTATGACAAATTACGCCTATGATTTCCACAACACAAAATGGCCCAATA
AAGTTCACAACAGAAGTTGACATTATTTTTTCAAAATTTAAGCCAGTTATAGTCGTTGTGTATATATACACTTAAGTATACACAAGTGATGGCTACAAAA
GAATACGGCTAAGGAGAGCCTTACTTTTGTTTACACGCTGGATAAAAATGTTAAAGATCCCGATGCACCAGTGTAGCACCATTCAAATCCGCTTAGAACT
ACTCAAAATTTTATAGCAAAATAAGTACATGAAAAACAATTCCCATGCGTATGGGAAGTTCCTTGCATTTCTAAACCAAAACGCAATCCATATATTACAG
AAGCTTGTCAATGCAATGCAGCAAATGACAATTAGGCAATAGAACCTAACCAGAATACTAGGATCAAACAAAATGAGAGTTCCATTCAAATAAAATTTCA
AAGAGGAGGTTTCAATCCGTAAATATAACATAGCTGAGCCATGGTGCTCTTCATCTGAGGTCTGCAAGGACATCTTTCGTCCCTAGAATCAGTCAGCAGT
CCAGCTCTGCTCAACAATTTCTCTCACTCTGCGATTGTACTCCCTTTTATTCTCACTGAACATCCGAGCTGCTTCCGAGTTTGCAGGTGAGTTGGGGTTT
GGATCACACAGCAATGACTGCAATAATAAGAGTGTCAGTCATTCGCAAACAACAAACCAATAGTCTTCTTTCTTGAAATAATTTTTATTAGCGCATAAGT
ACGAAAAAAGCCTTTGTTTTATTCAATCCTTCAAATCCTCTGCATGTACATGTCCCCAGTAGGATAGAGTAACTCAGCTTAACTCTCCTGACTTTGCTTT
ACAGATAATCCATGGCCACTCTCATCCTGTCTCCTTCGCATTTACTCAGCAAGGTACAACCCAAATTAATTAACAAATTCCAAGTAGGAACTAAAAATCT
TTAAGGGCAAATTAGGGTCTAGCAACAGCACCATTTTCTTGCTTAAGTACAGCAGAGTCAACATGCTTAAAACTAAGGAGCTGAAAACCTTAAGTCATAC
TCATCACTTAAGGTTTTAAGTAATAATTGCTCGACATAAAGCTTCCATCATCAAGAATCCGGCAAAGCATGAGGATAGTACGTCTAGCGTCTTAAGCATA
TCATCCATTGAGTAACAATTTCTACTTCTGCTTGGGTATCTATGTCTTGAATTGCATACATTAAGACATAAGTCTACTACCCCCTTTACTCGGCAAGTTC
AACTTCAAACTAGTCAACATCTTAATCTACACAAAGATCGATCATCTCATTATTGGATGTAATTGTAATAAAGAAATGAATATTCAGGCACCAACATCAT
ACACAATTCTATGTTATTTCTCTTCTTCTTGTATGGGTGGATGGTGGGTTGTGCAAGGAACTTATTAAGTCAAGCACCAGCAGTTAGGGGATTGAGTAAA
AATCTTCATGCAGAATATAAAGTGATTGACACAAATACGAGCAGAATCTTGAGGTAAGGTTAAACAAACGTACCGTTTCTTTCCATGATCCAGCAGCTGT
AGCAATCGACAAGTAAGTCGTAACTTGCACAGCTGCTAACTACCACTCTCTCTCTATACTGGGAGAATTAACACAACTGAATTGTCACACGCCTTTAACT
ACGTATTAAAAGAAGCAAAATATGTTTAGGTTCTTCTTACAATAGCTAAGGGAAGTTGGTCTTCTTTTTTTTTTTAACTGGTATAAGGGAAGTTGGTCTC
TGTTTATAGAGAAGCTTCAGGCCAATAATTAATTGGCTCCCCCACACACAATTCAGTTAGATGATTTGGCTTTATATGAATACTTTATTTACAACTTGGG
TCATGTCACTAAACTTGTCCATGTAGCGATTGGTGTTCCTCTTCAAAGTCACAGTTAGTTTTAAATGTCTATTCATAATCACCAAGTATAAAGTTAAGAG
AAATCAGCAAACTCTCATACTCCATGGAGCACTTCTGACCCTCCATCTTCTCATGCCACTTGTCAACTCAATAGAGAGACTGGTACACTCCATTGTAGTC
AATGAAACAAACCTCTCATTCTATCTCCGCAATGTGAATTATCAATACATGGAGAGTCCACACTCCAATTGATAACACATGAAGGGGGGAAAGTACTTGA
CCATGAGATAATATTTTATCTGATTGAGTCTTTGGACCATGACCAACCTTTTCTAAAATCTAGAAATAGAAACCATGCTCTGGGCAAAAGTGCTTGAGAA
ACAGCAGTCTTCTCGAAAATTCCCAGATCAAGGCATTCTTTTAGCATCAATCGATGTGATTCCTTAACAATTGCTTCATCATCATAAAGAAACAGAAACG
CACAATACAATATGCAAATGTAACTACGTAGCCTAAAACTAAAACAACGATAAGTCAAGCTGTCACAAGGATGATATCTCCAACCCTATAGAATGAGGAA
CAAGAAACTACTCCTTTGCAACACATATTTTCATTTAATGATGCTTTCAACCATTAGATTTAATAGTAAAACTCAGGATTAAGACATGGATAACTTAGAG
AATGTGATGTCTAAAAATCAATTACAGTTCTATACCTGAATGGATGTAAGTATTGCCGCAACATCATAAATTGGACTCCATTGATTCTGAAGAATATCCA
AACATATACTTCCATCTGCATAAACTGGAAAAAAACGAAGAACAATTCCAGACATAAAATTTACTATTCCTATCCACTGTTGACAAATAAAAATCAAATC
TTGAACTCCAACTTACTATTAGGATGAAACATGCGAGAAACAAACCGCACTGTTGGTGGCTTGTTGGGGTAATCCTCAGAGAATTGAAGAGTCAACTTGA
ACGTACCTGATGTTCTCAAATAGTATAGTTACAACCGAACTAATTAATTCATATCAAAACTAAGGCGATATGAAAAAGAAATCATATTATGTCAAAAGAA
AAGGATGGCGAAGGTAACAAAAGCCACAGGACGCACTTGCTAACACCAACAACCTTAACTTTTGGCAGAGAGTAATAAACTGACAAGAGATGATAATACA
AAAGTGACTTGGAAAGCCAGGACTGGAAATGCTTGGACTGGGAGATCAAAGAAAGGATTCAAGCATTTCCAAAACTAGAATATGCATCACCTCTATGAGA
TGATTCATAACATTCATCACTACTTATTCGTAGGCAAGGAATGTCCTGGGAGGGGACGAGGGGTGCGACTCTCCAAACTGATTATTCAGAATTTCAAATC
ACAGAAAAGAGAGACTGAGATGATTAAAACATAATTGAATTGTACAGACAACAATGCATAAACAGTAGATGTGCACCAACTACAACGCTTTAAGCCTTTA
ACATTCTTCTGCCACACTGCACTAACGACCAAATGCAAGGATAACTCACCACCATCCCAAGGAGTGTCATCAGGACTGCAGGTTACACCAAAACGAAGAG
AAAGGAGAAAGTAGATTATTCAAACCATATGATAACAACTGCCCCAAACAGACATTAAACACATATTTGGCGTATTTTAATTACACAACTCACCCAAATA
TCACGGCATTCCAAAGCATAATGTTGTTGTCTTGAGGTGCACCACTAATACCAGCAGGAGGGTCCTGCTGCAACCTCTTGAAATCCCTCATCAGCCTCTT
TCTAGCTGGAGTCGACATTGTAACCACCTGCAAATCACATGGTCAAATTAATCTATCTATACTACCTTAAAAGCATTCTCTATATTTTATAATTTATATT
TATCTATATTATATTATAAATAGACACGTTTTCATATTGAAGAATTGTGACGTTACTGAAGATTCTGACTTTTCTAATAAAGCACAATTAACAACTATTC
ATACTACTATTTGTTGTCTCTAAATAGAGGGGTTTCCTCTCATTTTCAAACTATGAAATTTCCAAATTTTCTACTCTTCTTCTTCTTAAAAACCTCGAGT
GTAATTTGCAACCATTGGTATCACACTAAGAATCAATCTTTGCCGGCTGACCCATTTACCATTTCTATGTACTTAAATTTCCAACAAAAAGGAAAAACTA
CCATTCAACAACTACTAAACACTCATATCAAACATAAAACACCCAAAATCTCTTTCCAACACCCATTGTTTTTCCTATAAATTGCATTAGCTCTATAAAT
AAGAACACACGTACCTAAAAATCTAATCATTGTTCATCTTGCGATAAAGATAGTGGCTGGTGAATTTTGAGTAAGTTTTTGGGGGTAAAAATGATTGGAG
AAAGAGTAGGAGTAGGAATCCTCTCCAATGTGGTTTGCAAACTATTGCATAGAAGCAGGGGTTTTACCTGTGCGCACCCAAAGGGTAGCGGCTGCGGGTT
TTCCTTGTCATCAAAAAAAAAATGGATAGGAGTGGGAGGTGGTTTGGATATTTTATTTTTTTTTTTGGGGGGGATGGGAAAAGGAGGTACAATCAGAAAA
AATATTATTACTTTGTTGTATATTATTTAATTTTTAATATGTAACTTTTTCTGTCTCATTATAAAATGACTTGGAATTCGACATGCAAGCAATTGTATTA
TACACACACTGAGAGGATGAGAAAAGGGTCTACAAAGTAGAGTTCTGTCGAGTTTAGGAGTTCATTTGGGAAGTAGTAAGTAGGAGGGTTCAAATGACAA
ACGGAGCCAATTACAAGAGACTCCCAAGCCAGTCCGCCTTAATTTTATTTGTTTCTCTTCCTTATTAACTTGCTATCCTTGTAATTTTACTTTTTTTTAT
TCATGGATTCAACGCAAATGGTAATTTCTGCTTCATCCACTCACTATCATGGTCCAACGATATTAGAAGAAGGTACAAAAGGAAACCTTTTTCTCCCCAA
AGAAACCATTTCGGCGATGGCGTTAGCGCTTTGCGATGACAATAAATATCAGTCCAATAGGCTAATCATTCATCAATCCGCACTTGTATTTTTCTCCTAT
GATTTCCATCACATACATACTTTAATATTTTATATCATTTTAAAACATTAATACTAATTTGCAAGAGATACACATGCTACAATACATGCTCGAGTACTAG
TTAACAAACCCAACAAAAGAGAACTACTATTGAGCTTTTTCTGTTTGCCCTTTATTATATTTAATGACCCATAAAATCTGTCTAGAGCCAACCCTTACGC
ACTTTGAAACTTGGGGATGATGAGCCCAGCCCTCTACCCTCCTCCACTTAAATACTGCACTTTAATTCGCTTGGTGCATGGTTCAAACTTATGACCTAAG
TCAAAAATTTTAGTTCTAAACACCACTTCAGGATTAAAAGTATGTAAAAGTTGTTTATATCACTTTAACACAGTCATCCAGGTATAAATCAAGTTCTCAT
TTGGCTTAACTCATGATCTAATTATGATCATCTCAATCAAGTAACAAAGCTCAAATTCCAGAACAATAAATAACAATAATCAACTGTAGCACACATGAAT
TAGGGCTCGCACATACAATTCCCCTAATATAACACTATTTACTGAAGATCAAAAACTTCTCGCTAATTGTCGCAAAAGCACAATCACATAAAATTCTTAA
ACACTCTCCAAACTAAATTAGAATTATCCAATTTAACCGCTTTCGCTTTTAACAAAAGATCAGTTTCCTGTCCAGTTTCCTTGAACTCCAAAGATCCATC
GGAAATTGAAGATATAAAATCAAAGGACTTACCAATACGGCGGTAACAAGGCGGTGAGGTAGGGTTCCGAGCTAAGGTCCTGTGCTTTGTGTTCTCTCGT
AGCTGCCCCTGGAGTTCGCAAAGCGAAGGAGAGAGAAAGATAAAGGCAGAGAGGAATAATATATAGTGTATTATTGCGTGATGAGCTTTGAGTTGGTCCC
AATTTAGCCGGCCCTACGTGTACTAGTATCTCATTCGTTGTATTTGGCTTTGCATCACAACCATACATTTAGAGCCTGTTCGGCTCTCAGCTTAAAAGCT
GGTCAAACTGATTTAAAAGTTGGTTTTTGACTTATTTAGCTGTTTGGCAATACTAAAACAGCTTATTTTAAGTTAAAAAAACTTATTTTAAGTCAAAAGT
TAAAAGCTGGGGTAGGGGTTATTTTAAGTTGACCACATTTTTATCTTTTTGTGCTTAATATTTTTATACAATCTCCAAATTATCCATATAACCTTAACAT
TTCTTTCTCCCATTTTTCCCTTTTCACGTTTGAAATAACAACTTCAGCACTTTTATTCAAACCCATAACTGCTTATTTTAAAAATAAGTTTCAGTACTTT
TAAAAGTACTTTTTTAAAGCTACTTTTATTAAGCCCATCCAAACGGACCCTTAATTGCGCGATTTAGAGATTCATCTTAAATTTTTAGTTTTAAATAAAT
TATGATAGCTAAACTTATATATAAACATAGAACATAGCTTATATGATATTATAATATTAAATTATAAATTTGTGTCTAATAAAAAAAAATTATGCATTTT
GAAGGACGATAATTACAGACTAACACAAATTAAAGACAAATGATTCATCGTTTATGCTAATTTATACTCCATGATTATTTTAAGTGAAAGTGTATAATTA
GATAAGAAATTATAAATATACTAAATTTAATTGTCTCCTTAGTAAGATATATTTAATTCACTACGAACAAAAGATAAATGTATATATCCTAAGCACAAAG
TTAAGAACATAAAGAGAAAAAAAATTGAAATTTATTTTAAATTGTCTCGTTACAAGTAATAAGAAATTTAAAGTTATTTTTATAAAAAAAAAAGATAATT
TTTGTAGACAACTTAGTAATAAAGGAAATGTGATGCATAAAATGAGAAGATATGAGAACATATATTAACTACTAGTAAAGAATTATGTATTAATGTTTGC
ACATCAACATGTTGCGATTTCATCTTTTTATTTTTTTAATAAAAATTATGACTCTGTCCCCAATTAGAAACGAATTATGTATGTAATGGTGACGAATGAG
AATAATTTTTTCTCTTTAATGTTTTGTTTTGTTTCAGCTTTTCATTCGGAAATGCATCACTTAATGATTGCATTACCGTATAAAATGAGACAATATGAAT
ATATACATTTGCGGACAAGTTGAATAAAGGAAACCAATGCGAGTATGTGATATATAAAATCAGATAATATGAGAATATATTTTAACTAGCTAAAAAATAA
GTAATAAAAATTATTTTACGTATATCAATATGATTATTATTTTTTTCATGTTTTGTATCAAGAAGCTTAAGCTTCATAACAATGGCAATCACAAACAAAG
AAGAGCCAAGGCTGAAACAGTGAAGCTGATTTTATAAAATGCAAAAGCTTAACTTGATCTTATGCATTAGTAGAGTATTTATAGATTACATAGAAGCATC
TAGAATACACATTTAAAACATGTGATAACTAACTTTCATAACTAACTAACTACTTGTATAATGCAATGTTAATATTCAACATTTTGTTTCCGTCATAAAA
ATTGTGACTATAGCACCGATCATAAATCTATGTATGTGATACAATTAGCGAGTGGACATATTTTTTCGTGTTCTCTTTAAATTATTTTCCTTCGTTTAAG
CTTTTTATAAAAATCCTAACTTAATTTCAAACGTCGATTATACATTTTCTTTAAAAAAAAAAGTAGATTTAGGACAATTAATATACATATATAAATTGCA
ATATAAATCCCTCAGGCATTAGTGGAGATTGATGCTTACAGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTATACAAAAATATTATAGTTACAATTTTATCATATCAATATAATGAAAAAAATT
ATATATTGATCAATATATCATTTAACTTTCGAATTCAAAATATAAAATTAGGACAATAATCACCAAAAATCATATCTTAAGAATACCGGTCAAATTTGTA
TGATTTAACTTTCAAACTTAAAATGGAAATTGTGATAGTACTCGTCATGATTTGACTCTCGAAAATAATAATAACATCGGTCAAAAATAGTTAAAGTGAA
AATTATGATAGCATTGGTCAAGATTATATAATTTGACTTTCGGAAAAAATAAACTGTAATAATATTGGTTATAAGTAGAATTATTTAGTTTTTTTGAAGA
AAAAATTATGACAAATATTTTGAAACGGGGAGAGTAAGAGTAATAACATAACAGGGTAGCAGCCTGTTATATAGTAGTCTTCCACACTCTGTTTTGGATT
TGGTGGGCGATTTACCAATCTTATTTCTGGACCCGAGAAAAATCCTATCTTTCTTTGGTGGGCAGTTGTTGCTTCTCTTCATACTCTTTTAACTCAGCTC
AGTTATCTTGTTTTTTTCTTTAATGGGTGATTTTTTAGTAACTTATTGATATAATATAATAAAATTGTGTTGAATCTTGAAATAGGAAGAGAGGAAATTG
AGCAAGATGGGGGAGAAACCTGAGGTGTTAGATGCTGTATTAAAGGAGACTGTGGATTTGGTAATGGATCTGACTAAAAAGATCAAATTTTTGAACTTAT
ATTTCGTTGGTTTTAATGGGTTTGTTTCCTTTTTTTGTTGGTGTTGTAATTGCAGGAGAATATACCCATTGAAGAAGTTTTTGAAAATTTGAGATGTACC
AAAGAGGGTCTTACTGGTACAGCTGCCCAAGAAAGGTTGGCAATTTTTGGGTACAACAAACTAGAGGAGAAGAAGGTGTGGTGATGATTACTCTTTTTTT
TTTTCCTTTTTGTAGAATTGTTCCTTTTCTTGTTTTTTTGATTCCCTTGCTGGTCCACTTTGAACTGAATCTCTGTATATTCTCTTCCTTTTTTGATTTG
GTACTTTGATGGGTTAGTTTTCTTTTTTTTTTGTTGCTGAAATGTTTCCTCTTTTCTCCTTTTGTTTTCTTTGGATATCTTGTCTGTCTTGTTTGGACTT
TGAATGGACTCTTTTTAGCTGAAAATTAGATGTCTTTAGTTGAACTAAGCTGAATTGATGGAGAATTTGATGCTTAAGTTTTTGACGTGAAAGTTAAAAG
TGAACTGTTATCATTGTTGAGTGTTATTGTTTGCTGTGTTATAGGAGAGCAAATTCTTGAAATTTCTGGGGTTTATGTGGAACCCCCTCTCATGGGTTAT
GGAAGCTGCTGCTATTATGGCAATTGCTCTTGCAAATGGAGGAGTAAGTGCTAACAAGCTGATTTACCTTTATATTGGACAATATGCTGGTTCTTTTGAC
TTAAATTGAATATATGTCGAATTTTGTAGGGAAAGCCTCCGGATTGGCAAGATTTTGTGGGTATTATTACCTTGCTAGTGATTAACTCAACAATTAGTTT
TATTGAGGAGAATAATGCTGGCAATGCAGCAGCTGCTCTCATGGCTCGTCTCGCTCCTAAAGCCAAGGTTCTAGATTCACCAACCATCATTGTTATTCAA
TTGCTATTAGACAGCATGTGAAAGTTGTTAACTTTCATAATTTTGATGGGAAGTATGAGGTTGAGAAACTAATGGAAAGTTGTCTTAATTGTTTGCTCTT
GTGATATATGCAGGTTCTTCGAGATGGAAAATGGAATGAAGAAGATGCTGCTGTTCTTGTTCCTGGGGACATTATCAGTATTAAACTGGGAGATATTATT
CCTGCAGATGCTCGTCTTCTTGAAGGTGATCCCCTGAAAATTGACCAGGTGATTAAGTTTTTACGATTTAATAAGTGGTTGCTCACTGCATTCAATATTT
TGTTTAACTGTGGCACTGATATTATCTATTACTTGCAGTCTGCTTTGACTGGTGAATCTCTTCCTGTAACTAAAGGTCCTGGAGATGGTGTCTACTCTGG
TTCTACCTGTAAGCAGGGAGAGATAGAAGCTGTCGTCATCGCCACTGGGGTTCATACCTTTTTTGGGAAGGCTGCACACCTTGTTGACAGTACAAATCAA
GTGGGACACTTCCAAAAGGCAAGTTGAACTTGTATTGTCTTATTTGTTTTGAATATTAGTTGATAATCTCATTCTTTTAAATCTCACATTCAATGTTGTT
GATGTCTCTATCAGGTTTTGACTGCTATTGGAAACTTCTGCATCTGTTCTATTGCAGTGGGGATGATAATAGAGATCATTGTGATGTACCCTATCCAACA
CCGCAAATATCGCCCTGGGATTGACAATCTTCTTGTCCTTCTCATTGGTGGAATTCCAATTGCCATGCCAACGGTTCTTTCAGTCACGATGGCAATTGGA
TCTCATCGGCTCGCTCAACAGGTTTGTTAGTTAGCATCTTGATCTTAGGATGTGGTGTTTCAGCATGTCTTCAATCGTGAGTTATTGTAGTTCAACAGTT
CTGATAAGCGATTGCATATTTCATCATTTTAACTATTCAGGGTGCTATTACGAAAAGAATGACAGCTATTGAGGAGATGGCTGGTATGGACGTGCTTTGT
AGTGACAAGACAGGGACCCTTACACTAAACAAGCTTACTGTTGACAAAAACCTTGTTGAGGTGAGAATAAGAGTTCAGTCTTGTGTTTATTCCTTATTCC
ACACCGATTCTGATTTTCTTGTTTGTTCCTGCTAAATTATCAGGTTTTTGCCAAAGGTGTTGACGCAGATACTGTCGTTCTGATGGCAGCTCGAGCGTCT
CGTACAGAGAACCAGGATGCCATTGACACTGCTATTGTTGGGATGTTGTCTGACCCGAAGGAGGTAACTTTAGAATTGCATGACTGTGTGATTGGTGTAT
CCATTTTAGCTAGAGAACTGTTCTAATGCTGCCATTAATGCAGGCTCGTGCTGGCATTCGTGAAATACACTTTCTTCCTTTCAATCCAACTGACAAGCGT
ACAGCGCTTACTTATCTTGATGGTGAAGGAAAAATGCACAGGGTCAGCAAAGGGGCACCAGAGCAGGTATGACTGTGATCATCTAAGTAGTCCTTCTTTG
CTTGCTTTTACTTTCCGTGATTGCATTTTCTAACCAATCACTGCAATTTGGATTAGATCCTAAATCTTGCACACAACAAGTCAGACATAGAACGTAGAGT
TCATGCGGTGATTGATAAGTTTGCTGAGAGGGGTTTGCGCTCACTTGGTGTGGCCTACCAGGTATTTTGCTTTCCTTTTATCATCTGTGGAACTCATCAT
GTCATATATAAATTGAAAGAATCAATTATCTTGCAGCTTAAGCATATAACCTATACTATTATAGTGGAGAGGAGGGATTAATTATCTCTGTCTCCAAGTT
CTATCATTGTGTCGAAAAAATAGAGCTTTATTTCGCTTAATCACATATACCCTAACTTCCCATGCAGGAAGTTCCAGAGGGAAGGAAGGAGAGTTCCGGA
GGACCATGGCAATTCATTGGTCTCCTGCCTTTGTTTGATCCTCCAAGACACGACAGTGCTGAGACTATAAGGAGGGCTTTGAATCTTGGAGTGAATGTTA
AAATGATCACAGGTATTTCTAATTTTTTCATTTTTTATGATCAATATATTGAAAAATTGTTGGCAAATAGACTGCATGCTATATTGGCAACTTGGTAGTA
ATGGCTACCCAACCCCTTAATAAAAGGAAGAGAGAAAGGAAAAATGTATCCAGTGAGTAGAGGTTTCCAAAATTATCACCAACTTGAGATGGTAATGCAG
TCTGCTAGTAATTCTTTGTACACTGAGCTTGTTGGCTGTTGCATCAAAGACTACTTTTGATTCGTTCCGATATTGGGACTGTGCCTTTTTGTTTTTGATT
TTTGGTGAGGACAATATTATAGTGGTACTGGGTTATGTCTCATTTTAGAGGCACCGCCTGGTCTTATTGACTTAAAGTGATGTCTCTGCCCGTCGCTTGG
CATTTTCATTTATTGTGTTGATAAGGATTTCAGGCTTTCACAATTGAATTTTAAATACTATTACTTTGTGTTTGTCAACTTGTGTTTTACCAAGATATTG
CTTTTTGATGTAAAAAGCTCAGATGTAATTTGGACATGTATCATCTTACTGGTACTGCGTCTTTTGCTACATCAAAGTTCGACATGTTTATGTGCCTGCT
TAAATTTCTTGATGTCTGTTCTTTTGGCAGGGGATCAACTGGCTATAGGAAAAGAAACAGGGCGTCGTCTGGGAATGGGAACCAACATGTATCCTTCATC
TGCTCTGTTGGGGCAGACTAAGGATGAATCAATTGCTTCTTTACCAATTGATGAACTGATAGAAAAGGCTGATGGTTTTGCTGGAGTATTCCCTGGTATA
TCCCTCTCAGAAAATTCTTTTACTTCTCTACTTTTGGGTATTCAATAGGGTATTTGTTTATCGGAATGTTCGTCTTTACTGATACCTTGTCTTGCTCATT
GCCTTAGAGCACAAATATGAGATTGTAAAACGCTTGCAAGCTAGGAAGCATATCTGTGGAATGACTGGAGATGGAGTCAATGACGCTCCTGCTTTAAAGA
AGGCTGATATTGGGATAGCTGTTGATGATGCCACTGATGCTGCTCGTAGTGCTTCTGACATTGTTCTTACTGAACCTGGTCTCAGTGTCATCATTAGTGC
TGTTCTGACTAGTCGAGCAATCTTTCAAAGGATGAAAAACTATACGGTATATATTTTTCTTGTTGGGTTACTAGAGGCGTATATTTAAATCCTTATACAT
CCTACATTTTTGGTATATCATAGCAGCTGTTATTTTGAGGGTAGTGTATTCCTGAATGAGCTTAATGCACTTACAATCTGTCTCTGATGCACAATATTGA
TAATTTATCTGTCTTTTTTTTTTCATCGGCAGATATATGCTGTTTCCATCACAATCCGTATTGTGGTATGTTTTTTGGCTGCTGCTTCTTCTTTTCTCTT
TAATTTTATGATTCTTAAATGATATTTTGACATTCTTCTTCTATTTTTGTTACAGCTTGGTTTTATGCTTCTGGCCCTTATCTGGAAGTTTGACTTTCCA
CCTTTCATGGTGCTTATCATTGCAATCCTCAATGACGGTTGGTCCTTTTCACCAATAGTAACATAGACGATGTTTAGTTTCAACATTCCGTCATTTTAAT
AAACCACTAATTTTTCTGTAAGATGAAATTTGAGGGTATTGAAATGAAACATGCTTGTATTATACAAAATTAAAATTAAAAAGGGCTAGAAGTTCTCTAT
ATTTTCTGATGGCTTATAAATCTCTGACATGAATAAAAGATCATAGAGAGTATAGGACCTAAAGTAAACATACTAACATGTGATATTTTTCCAATTAATT
ATTCCCCCATCCGGTTCATAGTAATTTATTATGTTGGGAATAACACCTACTCATGTGGTATAAGAAAAGTAAAAAACCTATTAAAGAAAAAATGATATTC
TACAAAAGACATCCAATCTTTAATTCAAATCGGAACCCCATGGATGCACCAAAGAGAAATAGAAATAAGAGGCTACTCCTCACATGTACAAAATCATTTT
TCATTTCATCAAAAGCTCTTCTATAAAGTTTAGTATGATCTGCCACTGCAGTGTTTAGTTAGTTCTCTTGCCGTTCTAGTGTCTTTTCTACGTCTCACTT
CTAATGTTATGATCTCAGGTACCATTATGACAATATCAAAGGATAGGGTCAAACCATCTCCTCTGCCTGATAGTTGGAAGCTGGCTGAGATTTTCACTAC
TGGGGTTGTTCTTGGTGGCTACTTGGCAATGATGACAGTCATTTTCTTTTGGGCAGCATATGAGACAGATTTCTTCCCGGTGAGCATATGAGTTTCCTGT
ATAATATCAATAAATTTGTTCAGTTTTGACATGACAATGAACAGACACAATATTCACAAAAAAGATGCAGGTAGTTTGAGATGTAGCTGTTATGTATTAT
GTAATAAGAACTAATGAAGGAATGTTTAGCCGCACAGACTGGTTATGTATTATATAATAAGAACTAATGAAAGAATGTTTGGCCGCACAGACTGGTTATG
TATTATATAATAAGAACTAATGAAAGAGTGTTTGGCCGCACAGACTGGTCATCTTTTATCTGTGAAAAACTATGGAGGACTTTCATCTTACCTGTGCAGC
AGAACTTTGTTAATAGTGTTGTTATGATAACTAACTGTATATTAAACTAAATGATCTGTTGACTTTGCTGCTTGGATTGTTGAAAGTTGAACTGGCGTTA
ATTATGAACTGTTCTTAGTTTGTAATCTCACTCAGTTTGGTGATTGTCCAGCGTGTATTTGGGGTATCAACACTTCAGAGGACAGCAACTGATGACTTCA
GGAAACTTGCATCAGCAATTTACCTTCAAGTGAGCACTATCAGTCAGGCCCTGATATTTGTCACAAGATCTCGAAGTTGGTCGTTTGTTGAGCGTCCTGG
TTTGTTGCTTGTGGTTGCTTTTCTGATTGCTCAACTGGTAAGCCATTTGCTCATTCATTCTGGCAAACTTTCCACAACTTGATCAATCTATAATGTTTGG
TTGCTAATTTTAAACAGGTTGCCACCTTGATTGCTGTTTATGCAAGTTGGAGCTTTGCTGCAATCGAAGGAATTGGCTGGGGTTGGGCAGGAGTGATCTG
GCTCTACAATTTAGTATTCTACTTCCCGCTTGATATCATCAAGTTCTTAATCAGATATGCTCTCAGTGGAAGGGCCTGGGATCTTGTTCTTGAGCAAAGG
GTATGTGATACAGTAGAGATATACATATATGATATATATTCATTCTCATGCTAACGGTATGTGACGGGTTTCTTTGTATTACAGATTGCTTTCACCAGGA
AGAAGGATTTCGGAAAAGAACAACGTGAGCTTCAATGGGCCCACGCACAGAGGACCCTTCATGGGCTGCAAGTTCCTGACACCAAATTGTTTAGTGAAGC
TACCAATTTCAATGAGCTTAATCAGTTAGCTGAGGAAGCAAAGAGGAGAGCTGAAATCGCTAGGTAAAGATTGTCATTTTGAATTTTTTTTATTTTTTTT
GACAACAGAAGTACAGTAGTTTCTGCTTATGTTTCTAGTTGGGTGTGAAGTTGAACTTGTATTTGTGGGCATTTCATTCTTCTCCCTTTACTCATATGGC
CATGCTACAACATCCCATATCCATTGCTTGCTTCACTTTATCTTTACTAAGCTTTCTTCAGCTAAACACATGTTGATTTTTCGTGACTTCTTGGAAATTG
AACACTACATTTTTCATTGCAGGCAACGTGAGCTGCACACACTTAAAGGTCACGTGGAATCAGTGGTGAAGTTGAAGGGTCTTGACATAGAGACAATTCA
GCAGTCATACACTGTTTGATGTGGGAGCAAGTATGACTAGTGCTACTTAACTGGTGAGTGGGTGATAGAATGAAGACATAATGAGTGTGTGAGTTACCTC
TGGAGCGACAAGTTCATAGTAGTAACATCTTCAGCGTTTAAAAGTGCCTTATATATTTTATACATTTTTTTGCTTTGAATTCTTGGTTCATCTTTTCCTG
CTTTCATGTCTTGACTACATTATATATATTACAATTGACCAAGAATGAATATTAAGCTATAACAGCATTCATTATCTATATTCTCAAGAGTTTTTATTTC
ATGGTTTAGCAGCATCTGGTTTTTGTACTGCTTCTCTCTATTCATTGATTAAAGAAGTTTGGCTTTTTTGCTTTGGTGTGTGATGGTGTCTTCTCAATAT
ATTTGAGGGAATTTCTTTAACCTGCTGTTGAATGGATTAGTTCATTTTTTTTGGTTTCCCATCACTACCCATTTAAGGGCTTGAGTAAATTAGATTGGTG
CTGGGAAGTTCCACTTTGAGGGTAAAGCGTTGTATTATATTTGGGCTAACATGCTATTAGAACTATGCCTACAAGAAATATCTCAAAATATGGTGATGTT
TTAGCCACCAATTGATCTTTCATAAATTCCCACCAGAAGCTTACATTTTGATTCATCAATGTAGGGATGCAAAAATAAAGAGTTAAGGGAACAAAATTAA
TTTGAGAAAGAAAGTATGTAATATCTTTATGTGACACTTGGGAAAATTCGGTTTAGTTGTTTGTTATACATAATAGTTGAGTGACTTTTTATGATACTGC
TCAAATAACTTGACCCTGCCAATCCAACAAAGAAGAAAGATGCAGCGATGCTCCTCATGGTTTCAGGGCATTGTTTGTAGAAGAACTCATTCTCGCTGAT
TAATGTAAATGCCTTGGAAAGACCTGTTTTCAGTTATGAGTATTTGAAGTACGTTAAGGTTGAAAGATAGTATGTAGAAGTGGAGCTTGAGTGAAACACT
GTTATTTTTTGTACTTGATTAATGAAACATCTATGGCAAATGCATTCATAGTTCATCTTTCATAAGTCTAAGAATTTCACCTTTTCTGTGAAATATAAAT
GCCTCCGACTGTCCACTGGTGCATGGAGTGTTGGATTGTACATGGACACATGCACCATTGATGGACAAATTCTCTATTTCAAGTCAAAGTTGAAAAGATG
AGCAAAAATTGTAAAAGAAACATTGATTTGCAAATGCTCACCTGATAATGCCATCTGAGGTATTAGCCATAGTCCTGACATAGATGAAATAGCACCTTTC
CCCTGAGTCATTTGTAGCATTGGCCTAGTCATAGTTAGGGTTCTTCTCCTGTCTTCAACAATCCCTGATATGAACATTGTTACGATCGATAGAAATATTC
CAATTCCCATTTTCTGGAGAAGGCTGATTCCATCTTCTTTTCCTGTGAATTTCCGAAGCCATGGAAGTAAAACACGGTCATATATTGGTAACCAGATGGT
TATGCTGAGCATGGAAATGCCTATGAAAGATGCTGGAAATTGTTGTGGCCTAGTTGATTGTCACTTTGTAAGGCTTGGAAGATAACATAATTTTGTGATT
GAACAACAGAGACATAATAGATAGTTCCAGCTACCCATATTGGGATCACTCTTAGTAAGCATTTCACTTCTTCCACTTGTTGAATGCTACAAAGCCTCCA
TGGATTGACTGCTGATCCATCTGATGAGTTTATTTGGTCTTCTGGTGTTTTTACTGCTGCTTTACTCAAGAATCTGAAATCATGAGCCCTTTTAGTTAGT
CAGTAGTTTATCTAACTTTGAGGGTCAGTTTACGCGAAATTAACTTGTAACATTGATGCTGGCAAGTGGAATTACCTAAACTGATCAGTGTAAGGAAGCA
AAGAAGTCAAGGAATTGGAAGGCACATGGTTGAATAGGGAGTAACATGGTTGCTCTGGCAGCTGCAAGTGCCTTTTCTTGATAGCAGCCACTAAGACCTG
TGCCACAGTTGATAAAGGGCTACCTTTTGGCACAAGCCTGACATAAATTTTGGTGCCCACAAAGAAAAGTGCACAAGAAAGGAACCTCATAATTGTGAGG
ATTGCTAATCCCAATGACCAACTGACACTTGTTTGAACATACACAATGACAGTCAATGAGACCATCACAGCAAATGTGTGAGTGAAATAGTTGTTGGAAA
ATAGCATATACAGCGGAAGCATTTCAGAATCATACATCTTGCATGAATATAAATAACAATCACAAATAGTTATCACATACAAAGTATGCTGAAAATTAAC
TCAGGATTACCTCTTGAAGCGTGTGCAGATATCTTGAAGTAAATCCAACTCCAGTTCTATAGTCTTCTACAGTGATCCCAATCAACAACTGAACTCTCTC
AATACTTGGGTGGGCAAGTATTGTATAGAATACTCTTTCAAATCTAGGTTAGAAAAATCCCTATTTATAGAGATGTCTTCCTAGTCCAAAGAGGAGAGGA
AAAACCAATTCTTTTTCTTTTAGGAGAAGGCTACTTTTCCATCTTCTACTAGAAAATAGGATTCTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAATATCATGAATCAAATACCCTTGTTCAATT
TAATTGGTCAATTCTAACAACTTGCCTTATACGTCGTCCAATAATATGACTAAAACTCTCATTTATCAACTTATTCTAGTTTTCTTCAAACCTAAATAAT
AGGATGTTCTTAATGTAAGATTGACCTTAAAGTATTTTAATTAGAATTTATGTTATAATTTTTTTAAAAAAAATTGAAAATGTAAAACGAAAGATTACAC
ATCAGAAAAAAAGATAAAGAAAGGTTTCTTAGAAGTGTTTGTTACTTTGTTAAAATTAATTAAGAAACTAATGACAAATGGAGATTAATCTATCAAATTA
TTCAAAATCATGGAATGAGTTTAATTTAGGTTATATGTTGCACCTTGCCAACATGCCATTTTATTAAGGAAATAGCTCCGTGAGACTTGGGATGAAGAGA
TCATAAATTAAGTAGTGTTACATACTCAAATAATTTAAAAAACACTTAACAACTATTTACATTCGGAGTAGGTCAAATGGTAAGGTAAGATCATATATCC
GTTTGACTCCTCGTGGGGTACAACTTATATTTAGTCATTTGATTAGGAATAGTGTAAAGTTTGAAATAACTGTTGATCAGGGCGGAGGAAGTGTATAATG
AGAAGGGTTCATCCGAACCACTTCGACGAAAAATATTACTTCCTCTATTTCACAAAGAATGATCGAATTATTTTGATACGGAGTTTAAGAAAATAAAGAA
AACTTTTGATCATGTGATTCTAAATTAAAGTTATGTCAAATGTACAAAATTGCTCTTTAATCTTGTGGGCTTAAACATACCACGTGGAAAGTAATTGTTA
TAAAAAAAAAAGAAGAGGTCATTCTTTTTAAAACATACCAAAAAGGAAAGGAGATCATTCTTTTGTAAACGGAGGGCGTACTATTTATACATGGTTAAAA
TTATTTTTTAGGTATGTATAATAAATGTCGAACTCCCTCCCACTAGTTTGTATGTTTACTTCTCAAATTTTGAACCCCTATTAAAATTTCTGACTCCGCC
CCTGCGGTTGACTAAGTGACTGTTACCATTTTTGGGGTTTCTTTTTTCTTTTTCTTTAACTTCTGTATTGTGATTGACCAATTGATAAAGGGTGGAAACA
AATATGAAAATTATCACGTTAATAGAATCTCAACTTAGTTAGTTATGATGGTTTTGGAAGGAGTTTTGTACATTATAGCTTTGTAAGAAAATAGCAGAAT
TTTTTAAAAATCAAAATATGAAATTTATAGATTCTTTTAACGTCATCAAATTAATACTTTCTTTGTCCATTATTAATTTTTATATTTTTCATTTTTAAAG
TTAAATTATAAAAAAATTGATTAATAATATTACGATATATTTTTTCATCATATTGATATAAAAAAATGTGATGTATAGTACTTTTTGAATAGTTTTTAAA
AATCTAAATTTTTTGTTTAAAATATCAAACTAATATAACTTTTAAAATTAGTCAAATTAACTTTCGAACGGTATAATATAACACACAAAAAGAACAGGAA
AAAAAAGAAAGATGGAGATGCGGGGTATCGATCCCCGTACCTCTCGCATGCTAAGCGAGCGCTCTACCATCTGAGCTACATCCCCATGTTGTTTACTTTT
TCTGCTTAAAAAAGTAAAATTCTAAAACTAAATGTCAAAATAAACATGTACAAAAACTTTTTCAATAGCTTTATTATGTACTACTGAGTTAATATTCCAT
TTCAACCGATTTTCAGTTATACTTGGTTCATGAATATTTCCAGATACTCTGGTACTTGATGGTTTTTTAACCGATTTTTTTTAACATTTATTTGCGTAAG
CAAGTTCTTATGCCATCATCAAATACTGCTAAAAAAGACTTATAATGAAAAAAAATCATGAAAAATATCAATTTTATACTTTTATTAAAGCTCAAACACT
CATTTATAAAGTGATTGGAGTCCACACACTCAACTTTCGTGAGCATTTATAAAATTTCAAACATATTATTAGCCTTTGGAGATTTATGAATTCTTAAGAA
CAGGCAGTTGATTTTTTATGATATTCCGTTACAAATGAGATTAAAATACATTATTCAAAAATTATGTAGCATAGTAATTCAATATTACCTTCTTCTAGCG
TGACTCAAATCCTCAACCGTTCATAGCTCAGTTCTAATCACGAATTTAATATAAAAGTATTAGTAGTATATATTTAAATATGAGGAGTGAGTGGTGTTGT
TCCAACTTCCAAGACATATTTTATAAAAGAAGTAAAAGAACTCTATTAATACCATACAGAGTGACTTGAGCAGTGACGTGATTTTCCTACCTGCAACGCC
ATGGTTTCCGTGGCAAAAACTTCATATATATTTCAGCAATTTTGCAGTGTCTTTCACAAAACTTCCATAGCAATTAGTGTGTTTTCTCTTCAGCAATGGC
AGCAGAAAACGTAGCCCAATCAACCTTCCCACTCCAAGATCGTGTGGCCATTGTTACCGGTTCTTCTCGCGGAATCGGCAAAGCAATTGCACTTCATTTG
GCCTCACTTGGTGCTAAACTCGTCATCAACTATTCCTCCAACTCCACTCAAGCTGACGACGTCGTATCCCAGATCAATTCCACCTCCGGTTACCCACGTG
CCATTGCGGTCAAGGCCAATATCTCAGATCCAGATCAAGTGAAATCCCTCTTTGACGCTGCTGAATCGGCTTTTCAATCGCCGGTCAACATCCTGGTAAA
CTCCGCCGGGGTACTCGACGGAAAATACCCGTCAATCCTAAACACAACCCTAGAGGATTTCGACAGGACTTTTGATGTGAACGCTCGTGGAGCTTTCGTA
TGCTGCAAGGAAGGTGCTAAGAGAATCAAACACGGTGGAGGAGGGAGGATTATATGCTTATCGACGTCCTTAGCAGCGGCGTTTAGACCTGGATACGGAG
CGTACATCGCTTCAAAAGCGGCCGTGGAAGCAATGGTGAAGATACTGGCGAAGGAACTGAAAGGGACAGGAATAACGGTGAATTGTGTGGCGCCGGGACC
CATAGCGACGGAATTGTTCTACGAAGGGAAAACAGAGGCCATGATAAAGAGGGTGATTGATGATTGTCCACATGGAAGACTTGGCCTGCCGGAGGATATC
GCGCCGGTGGTTGGGTTTTTGGCCGGCGACACTTCTGAATGGGTTAATGGACAGATCATTCGTGTCAATGGCGGCTTCATCTAATTTATTTATTTATTTA
TTTTGCCAAGAGTTTTGTTTTACCTGCAGTTTTCTATTGTGATATCTATTTGATTTTGTTTCATTTTCCCTTATTATATAATATAATATAAAATAATAAC
CAATATACATAAAAATCCCCCTAAATTCGAAATAAGAACTTCCTTTAGTATTTAAAATATACAAATATTTATATATTCCTTAATATTTTCTGTGTGAATT
ATTTTTAACTCTCTCAACACCCAACTCAATTGAAGGCTGGGTATTGTTACATATCACGTTTTTATTGGTCCACGTCTCTAAAAATTTAAAAAATATGTTA
CTCATTTTATAAAATTCATCTGTTCCAAAAATACAACCCGATCCATTTCTAAACAAAAATTCCTTATAAATCTCTAAGCCCGATTCTCATTCTCCCAAAT
CTACAAAAACTAACGTGAAGATTTTTCTTTCGTTAGCGTGAAGGATTTGTTGAGTTCAAAATTTTCGTGAAGAAACAAAGAATTTGCGAAATTTTTTATT
GAAGAAGTAACGACAATCTTGAAAAACTGAAAAGTAAGGAAACAAAATCAAAATAATAGACGAAGAAGAATAAGTTTGAATCTTATATTTCGAAAAACAA
TATTTCTTTCAAAGATTTAACTTTTAGGTTTGAAGAGCATAGATTTGAGAAAAATTAAGAAAAATATGATAAATTAGGTCACCATTTTTTGGATGATTGG
ATTGGTGAAGGAGAAGAGATAATTAGGATTCTTATAAAAGCGAAGATTGTTCTTCAAACGGGTAATGGGATGGATATTACCGTTGGGGGGACAAATTTAA
TTTTTTAAAAATGTTGAAAGATGACAAATGCGTCGTTCTAAGCTGTAACAACACACGCACAAGGCTGGTGTTCGAAGAATTGAAAATAGTTCACATCAAA
TATGTTAAGGGGTATATAAACACTCATAGAATTTAAGTATTAAAGTAAATTTTCGTGTCAAGTTTAGAGAGATAAATCAATTTGCGAGTATTGTTTTACT
TCCTAAATCCTAATTAACATAACTAAAATTCAACAATGCATTAAACATGTTTAACGTTGATAACGATTACTCATGAAAACAAATCAAGCATTCAAATTCA
ATCACCATTGTATTTGGGAGATCACATGGAATTGAAGTAATTTACACAATTTCAAGTTCATGCATATTGTAAATAAATAAATCATAGTAATAAGATGGAT
GTCTATCAATATTTTTACTCACATTATAAATAATTGATGAGAAAAATTAGCATGTCATTCCACAAAAGAGTGGTGTTCAATAATTTTAAATCATAAGCTT
CCATTACAAATATTAAAATAATGTTCTTATCATATCAATTGAAATAGTACTGCAGAAAAGAAGACCAACATATCAGATTTTATTTTAAAATATAAATTTT
TTAAAGACAATAGATTATCAAAATTGCAAGAACCACAATTTCATGCTAATTTTTATGATTTTGTTTTATGTTTATAAATATGTAATTTCTAAATTGTATT
TAAGAGCTAATTTTGCTGTTTGGAGTTTTATCTATTTTCAAATCATCATTTTCATTTTCTTAAATATATTTGTTTACCTTATTTATCATTTTTAACTTGG
TCCAAAATATAAATAAATACTATATGTTATCTGAATTTATGACTTCCTATATTACTTTTTTTTAATCATTTATTAAAAGTTTTATATTTGTGATAAGATT
AACTTATGTTTTAGTTATTTCTTTAAATTTGAAGATGTTTCTTTCCCAAATATAGCAGACATATGAAGTATCTCCATTTAAAATTTTTGTCCTACAGTGT
CGAGCGATTTATTTGACTATGACCAAAATTAAAACCGATTTTCAAGTTTGACTATCTCTTTCATTAGGAAAAAATCTAAAATAGTTTTAATCTTTAGGTT
CAACCTCAAAGTCATTCTTAAACTTTTATATCATGATCCTTCATATATTGTAATATTCATACATATTTTATTCTCTCTCAAACTCCGGCCTATTTTTAAA
TATTCATTTTATCTATAATTTTATGTGTAGAACGTTAAAAATTTTTAAAAATATTTTTGATAGAAATAATACTCAATGTAAGAGAAGGTGTGAAGAAAAT
CTTATTTTGTTTGATAGTAATATTAATACGGCTAAACTGAAAACACTTTAACATTTGACTTTGCAAGAAAAGAAAAAATGTACAATTGCACGTGACAACG
ATAAATAAATCTCTTGATTTTAACTGTAAAAATGTACAATAAAATAAAATGTTCCTTTCTTTACATGAAGCTATTATTTCTACTAAATATATATAAAAAA
ATAAAAATTAAATTCTATACATAAATTATGAATAAAAATAATATTACAAAATAAGAAAGAATTTGGAAATTGACCTAAAATGTAAACATGAGGAACTATT
ATAATTTGTGTGAGAATTCAAATATGATTTTAATTCTTAATAGAAGATAAAGAGACTATTTTGAACTTTTTCTCCTCTTTTAATTATTTGTTATGAGTAT
TAAATATTATCACACATTTAGCACCACACCAGCACTTTTCGTTTGTTTATCCACAAAATTCCATTTTCTAGCAATTTCAGTGCTTTTCTTCAGTGATCAT
GGCGGAAACAAACGTAGCCCAAGGCCAAAGCCTCGGGAATCGTGTAGCCATTGTTACCGGCTCTTCTCGCGGAATCGGCAAAGCAATTGCTCTTCACTTG
GCCTCTCTCGGAGCTAAACTCGTCATCAACTACACTTCCAACTCTACTCAAGCTGACGACGTCGTATCCCAAATCAATTCCACCTCCGATTCCCCACGCG
CAATCGCCGTCAAAGCCAATGTCTCCGATCCAAATCAAGTCAAATCCCTCTTCGACGCTGCAGAATCAGCCTTTCAATCGCCGGTCAACATCCTCGTCAA
TTGCGCCGGCGTACTCGACGGGAAATACCCGTCGATCCTAAACACAACCCTAGAGGATTTCGACAGGACTTTCGATGTGAACGTGCGTGGAGCTTTCATA
TGCTGCAAAGAAGGCGCTAATAGAATCAAGCGCGGAGGAGGCGGAAGGATTATATGCTTAACGTCGTCGATGGCGGTGGCGTTGAGGCCCGGATTCGGGG
CGTACGCGGCGTCAAAGGCGGCCGTGGAAGCAATGGTGAAAATACTGGCGAAAGAACTGAAAGGGACAGGGATAACGGTGAATTGTGCGGCGCCGGGACC
CATTGCAACGGATATGTTTTACGAAGGGAAAACGGAGGAGATGATTAAGAAGGCGATTGATGAGTGTCCACATGGAAGGCTTGGACTGCCGGAGGATGTG
GCGCCGGTGGTTGGGTTTTTAGCCGGCGATGCTTCTGAATGGGTTAATGGACAGATTATTCGTGTCAATGGCGGTTATATTTGATACTAGTATATGTTCG
TTTTATTTCGTTTTTTATTTGGCATTTCCTTTGAAATATTGTTATAATCAATATTTTTAACCTGAAATAAGGTAAAAATTAAATAATACAGTTCAATTTG
AAGTCTAAATTTTGTGAATATGCAATTTTAATTTTTTATTATTCATTAAAAAACTACTTATTTATTATAAGAATGATATATATATAAAAAAAACGAACGT
ACTATCATAAACTTAACTTATAGATAGTGTCTACATGAGTAAAAATTAATGTAATTTATTTTAAATACATTATATTTAAGTGGATTTTTAATCTATATGA
GATACACAATAAATCTCTTTCGTATCTTTTCATCTCGCTCACCACTCTCCCATGTATTTTGTAGCCGAATACATAAGAACCTCGCTTACCACTCTCCCAT
GTATCTTGTATCACAATACATAAGAATCTCGCTCGCCTCCCTTCCCAATATCACTCGCCTCTTTTCCTATCTTTGTGTATCTAGTGGCAAATGTAATTTA
TTTTAAATACATTATTTCAAGTGGATTCATATGTATATATCTGAGATACACAACAAATCTCTTTCGCATCTCTCCCATCTTGCTCACCACTCTCCCATGT
ATCTTGTATTCCATATATATAAGAATCTCGCTCACATCCCTTCCCAATCTCACTCGTCTCTTTCCTATCTTTGTGTACCTAGTAGCAAAAATATATGTAT
TTCTTCAATATATGATAGAAACCAAAAATATATGTATTTCTTTAATATATGATAGAAACTTTTAATAAGTGATAAGATACGAAATATTTTGAAAGTTAAG
TAATAGTGCTATATATCTAATTAAGTAATTCTCCCTTGCTTCTTTATTACTTTTATCGCTACTTCATGAAGTCTCTTCGAATGATTTGTGTTTGCTTAAT
ACATGCGTATCAATTATTGTTGAAAGAAAAGAAAAAAAAGACAAGAATAATAACAAAAACTGAATAAATTATACACTTTTCATAATCTAATATTATTTCT
TTTTAAATCCACTTTATTCTACTTTTGAACTATCTAAGCCATAATACTCATATTCTACTTCACATATGCATTAATATTTGGAATTTTCGATGTTATCCTT
TTCATAGATGGATGGTTGTAAGCAAACAACTCATTTTCAACAGCATATTGGACTTATCTTTAGTGCATATAAGTTAAATTTCATTGGAATCAATAGAGAT
GCCCTTTGAATTTAAACGCAACAATTCCATAAAGCCCTATTAATTCCCCATATCAACATGTCCCAAAATCATTTTTCTAAATTCATCCACACACAGTGCA
TAGAAAAAATCATTATTCTTTTGTTTGTAAACAGTATCATGATCGCGAATCGAATAGGATTCTATTAATAACTGTACGTTTCCCTATTAGTACTCATATC
TACTGGGGAAAAAAAAGCTAGTAGTAACAAAGAACCATAACATTACTAGCATCAATGGAGGAGATTGACAGAGAAGCAACTAAAAATGAAATAAACTACA
GAGGAATCAGAGCCATGCCCTTTGTCATAGGTTTTTTTTATATATATACACTAAACTTGTATTAGTGAATAGTCTCATAATTTTTCCTTTTCTTGACACT
ATTTTACATATAGCCGAGTCTAACTTGTTATTGTATGCTAAAAACTGCAGGGAATGAGACATTTGAGAAGCTGGGAACAATTGGAAGCTCATCAAATCTG
TTGGTTTATTTGACAAGTGTTTTCCATTTGAAGAGCATAACAGCTACTAATATTGTCAACATCTTCAATGGCACTTGCAACTTTGGCACCTTGCTTGGAG
CTTTTCTTTCTGATACTTTGGTCGTTACAACATCCTTGGATTTGCCTCAGTGTCTTCCTTCTTGGTAACCAAACGCCAGAAAAATGACTTCCTCGGACAA
AATTGTCTAGAAATGATTCTAATTA