BAC Sequence – LE_HBa0125P18

>C06HBa0125P18.2
AGAAGGGTTCATCCGAACCACTTCGACGAAAAATATTACTTCCTCTATTTCACAAAGAATGATCGAATTATTTTGATACGGAGTTTAAGAAAATAAAGAA
AACTTTTGATCATGTGATTCTAAATTAAAGTTATGTCAAATGTACAAAATTGCTCTTTAATCTTGTGGGCTTAAACATACCACGTGGAAAGTAATTGTTA
TAAAAAAAAAAGAAGAGGTCATTCTTTTTAAAACATACCAAAAAGGAAAGGAGATCATTCTTTTGTAAACGGAGGGCGTACTATTTATACATGGTTAAAA
TTATTTTTTAGGTATGTATAATAAATGTCGAACTCCCTCCCACTAGTTTGTATGTTTACTTCTCAAATTTTGAACCCCTATTAAAATTTCTGACTCCGCC
CCTGCGGTTGACTAAGTGACTGTTACCATTTTTGGGGTTTCTTTTTTCTTTTTCTTTAACTTCTGTATTGTGATTGACCAATTGATAAAGGGTGGAAACA
AATATGAAAATTATCACGTTAATAGAATCTCAACTTAGTTAGTTATGATGGTTTTGGAAGGAGTTTTGTACATTATAGCTTTGTAAGAAAATAGCAGAAT
TTTTTAAAAATCAAAATATGAAATTTATAGATTCTTTTAACGTCATCAAATTAATACTTTCTTTGTCCATTATTAATTTTTATATTTTTCATTTTTAAAG
TTAAATTATAAAAAAATTGATTAATAATATTACGATATATTTTTTCATCATATTGATATAAAAAAATGTGATGTATAGTACTTTTTGAATAGTTTTTAAA
AATCTAAATTTTTTGTTTAAAATATCAAACTAATATAACTTTTAAAATTAGTCAAATTAACTTTCGAACGGTATAATATAACACACAAAAAGAACAGGAA
AAAAAAGAAAGATGGAGATGCGGGGTATCGATCCCCGTACCTCTCGCATGCTAAGCGAGCGCTCTACCATCTGAGCTACATCCCCATGTTGTTTACTTTT
TCTGCTTAAAAAAGTAAAATTCTAAAACTAAATGTCAAAATAAACATGTACAAAAACTTTTTCAATAGCTTTATTATGTACTACTGAGTTAATATTCCAT
TTCAACCGATTTTCAGTTATACTTGGTTCATGAATATTTCCAGATACTCTGGTACTTGATGGTTTTTTAACCGATTTTTTTTAACATTTATTTGCGTAAG
CAAGTTCTTATGCCATCATCAAATACTGCTAAAAAAGACTTATAATGAAAAAAAATCATGAAAAATATCAATTTTATACTTTTATTAAAGCTCAAACACT
CATTTATAAAGTGATTGGAGTCCACACACTCAACTTTCGTGAGCATTTATAAAATTTCAAACATATTATTAGCCTTTGGAGATTTATGAATTCTTAAGAA
CAGGCAGTTGATTTTTTATGATATTCCGTTACAAATGAGATTAAAATACATTATTCAAAAATTATGTAGCATAGTAATTCAATATTACCTTCTTCTAGCG
TGACTCAAATCCTCAACCGTTCATAGCTCAGTTCTAATCACGAATTTAATATAAAAGTATTAGTAGTATATATTTAAATATGAGGAGTGAGTGGTGTTGT
TCCAACTTCCAAGACATATTTTATAAAAGAAGTAAAAGAACTCTATTAATACCATACAGAGTGACTTGAGCAGTGACGTGATTTTCCTACCTGCAACGCC
ATGGTTTCCGTGGCAAAAACTTCATATATATTTCAGCAATTTTGCAGTGTCTTTCACAAAACTTCCATAGCAATTAGTGTGTTTTCTCTTCAGCAATGGC
AGCAGAAAACGTAGCCCAATCAACCTTCCCACTCCAAGATCGTGTGGCCATTGTTACCGGTTCTTCTCGCGGAATCGGCAAAGCAATTGCACTTCATTTG
GCCTCACTTGGTGCTAAACTCGTCATCAACTATTCCTCCAACTCCACTCAAGCTGACGACGTCGTATCCCAGATCAATTCCACCTCCGGTTACCCACGTG
CCATTGCGGTCAAGGCCAATATCTCAGATCCAGATCAAGTGAAATCCCTCTTTGACGCTGCTGAATCGGCTTTTCAATCGCCGGTCAACATCCTGGTAAA
CTCCGCCGGGGTACTCGACGGAAAATACCCGTCAATCCTAAACACAACCCTAGAGGATTTCGACAGGACTTTTGATGTGAACGCTCGTGGAGCTTTCGTA
TGCTGCAAGGAAGGTGCTAAGAGAATCAAACACGGTGGAGGAGGGAGGATTATATGCTTATCGACGTCCTTAGCAGCGGCGTTTAGACCTGGATACGGAG
CGTACATCGCTTCAAAAGCGGCCGTGGAAGCAATGGTGAAGATACTGGCGAAGGAACTGAAAGGGACAGGAATAACGGTGAATTGTGTGGCGCCGGGACC
CATAGCGACGGAATTGTTCTACGAAGGGAAAACAGAGGCCATGATAAAGAGGGTGATTGATGATTGTCCACATGGAAGACTTGGCCTGCCGGAGGATATC
GCGCCGGTGGTTGGGTTTTTGGCCGGCGACACTTCTGAATGGGTTAATGGACAGATCATTCGTGTCAATGGCGGCTTCATCTAATTTATTTATTTATTTA
TTTTGCCAAGAGTTTTGTTTTACCTGCAGTTTTCTATTGTGATATCTATTTGATTTTGTTTCATTTTCCCTTATTATATAATATAATATAAAATAATAAC
CAATATACATAAAAATCCCCCTAAATTCGAAATAAGAACTTCCTTTAGTATTTAAAATATACAAATATTTATATATTCCTTAATATTTTCTGTGTGAATT
ATTTTTAACTCTCTCAACACCCAACTCAATTGAAGGCTGGGTATTGTTACATATCACGTTTTTATTGGTCCACGTCTCTAAAAATTTAAAAAATATGTTA
CTCATTTTATAAAATTCATCTGTTCCAAAAATACAACCCGATCCATTTCTAAACAAAAATTCCTTATAAATCTCTAAGCCCGATTCTCATTCTCCCAAAT
CTACAAAAACTAACGTGAAGATTTTTCTTTCGTTAGCGTGAAGGATTTGTTGAGTTCAAAATTTTCGTGAAGAAACAAAGAATTTGCGAAATTTTTTATT
GAAGAAGTAACGACAATCTTGAAAAACTGAAAAGTAAGGAAACAAAATCAAAATAATAGACGAAGAAGAATAAGTTTGAATCTTATATTTCGAAAAACAA
TATTTCTTTCAAAGATTTAACTTTTAGGTTTGAAGAGCATAGATTTGAGAAAAATTAAGAAAAATATGATAAATTAGGTCACCATTTTTTGGATGATTGG
ATTGGTGAAGGAGAAGAGATAATTAGGATTCTTATAAAAGCGAAGATTGTTCTTCAAACGGGTAATGGGATGGATATTACCGTTGGGGGGACAAATTTAA
TTTTTTAAAAATGTTGAAAGATGACAAATGCGTCGTTCTAAGCTGTAACAACACACGCACAAGGCTGGTGTTCGAAGAATTGAAAATAGTTCACATCAAA
TATGTTAAGGGGTATATAAACACTCATAGAATTTAAGTATTAAAGTAAATTTTCGTGTCAAGTTTAGAGAGATAAATCAATTTGCGAGTATTGTTTTACT
TCCTAAATCCTAATTAACATAACTAAAATTCAACAATGCATTAAACATGTTTAACGTTGATAACGATTACTCATGAAAACAAATCAAGCATTCAAATTCA
ATCACCATTGTATTTGGGAGATCACATGGAATTGAAGTAATTTACACAATTTCAAGTTCATGCATATTGTAAATAAATAAATCATAGTAATAAGATGGAT
GTCTATCAATATTTTTACTCACATTATAAATAATTGATGAGAAAAATTAGCATGTCATTCCACAAAAGAGTGGTGTTCAATAATTTTAAATCATAAGCTT
CCATTACAAATATTAAAATAATGTTCTTATCATATCAATTGAAATAGTACTGCAGAAAAGAAGACCAACATATCAGATTTTATTTTAAAATATAAATTTT
TTAAAGACAATAGATTATCAAAATTGCAAGAACCACAATTTCATGCTAATTTTTATGATTTTGTTTTATGTTTATAAATATGTAATTTCTAAATTGTATT
TAAGAGCTAATTTTGCTGTTTGGAGTTTTATCTATTTTCAAATCATCATTTTCATTTTCTTAAATATATTTGTTTACCTTATTTATCATTTTTAACTTGG
TCCAAAATATAAATAAATACTATATGTTATCTGAATTTATGACTTCCTATATTACTTTTTTTTAATCATTTATTAAAAGTTTTATATTTGTGATAAGATT
AACTTATGTTTTAGTTATTTCTTTAAATTTGAAGATGTTTCTTTCCCAAATATAGCAGACATATGAAGTATCTCCATTTAAAATTTTTGTCCTACAGTGT
CGAGCGATTTATTTGACTATGACCAAAATTAAAACCGATTTTCAAGTTTGACTATCTCTTTCATTAGGAAAAAATCTAAAATAGTTTTAATCTTTAGGTT
CAACCTCAAAGTCATTCTTAAACTTTTATATCATGATCCTTCATATATTGTAATATTCATACATATTTTATTCTCTCTCAAACTCCGGCCTATTTTTAAA
TATTCATTTTATCTATAATTTTATGTGTAGAACGTTAAAAATTTTTAAAAATATTTTTGATAGAAATAATACTCAATGTAAGAGAAGGTGTGAAGAAAAT
CTTATTTTGTTTGATAGTAATATTAATACGGCTAAACTGAAAACACTTTAACATTTGACTTTGCAAGAAAAGAAAAAATGTACAATTGCACGTGACAACG
ATAAATAAATCTCTTGATTTTAACTGTAAAAATGTACAATAAAATAAAATGTTCCTTTCTTTACATGAAGCTATTATTTCTACTAAATATATATAAAAAA
ATAAAAATTAAATTCTATACATAAATTATGAATAAAAATAATATTACAAAATAAGAAAGAATTTGGAAATTGACCTAAAATGTAAACATGAGGAACTATT
ATAATTTGTGTGAGAATTCAAATATGATTTTAATTCTTAATAGAAGATAAAGAGACTATTTTGAACTTTTTCTCCTCTTTTAATTATTTGTTATGAGTAT
TAAATATTATCACACATTTAGCACCACACCAGCACTTTTCGTTTGTTTATCCACAAAATTCCATTTTCTAGCAATTTCAGTGCTTTTCTTCAGTGATCAT
GGCGGAAACAAACGTAGCCCAAGGCCAAAGCCTCGGGAATCGTGTAGCCATTGTTACCGGCTCTTCTCGCGGAATCGGCAAAGCAATTGCTCTTCACTTG
GCCTCTCTCGGAGCTAAACTCGTCATCAACTACACTTCCAACTCTACTCAAGCTGACGACGTCGTATCCCAAATCAATTCCACCTCCGATTCCCCACGCG
CAATCGCCGTCAAAGCCAATGTCTCCGATCCAAATCAAGTCAAATCCCTCTTCGACGCTGCAGAATCAGCCTTTCAATCGCCGGTCAACATCCTCGTCAA
TTGCGCCGGCGTACTCGACGGGAAATACCCGTCGATCCTAAACACAACCCTAGAGGATTTCGACAGGACTTTCGATGTGAACGTGCGTGGAGCTTTCATA
TGCTGCAAAGAAGGCGCTAATAGAATCAAGCGCGGAGGAGGCGGAAGGATTATATGCTTAACGTCGTCGATGGCGGTGGCGTTGAGGCCCGGATTCGGGG
CGTACGCGGCGTCAAAGGCGGCCGTGGAAGCAATGGTGAAAATACTGGCGAAAGAACTGAAAGGGACAGGGATAACGGTGAATTGTGCGGCGCCGGGACC
CATTGCAACGGATATGTTTTACGAAGGGAAAACGGAGGAGATGATTAAGAAGGCGATTGATGAGTGTCCACATGGAAGGCTTGGACTGCCGGAGGATGTG
GCGCCGGTGGTTGGGTTTTTAGCCGGCGATGCTTCTGAATGGGTTAATGGACAGATTATTCGTGTCAATGGCGGTTATATTTGATACTAGTATATGTTCG
TTTTATTTCGTTTTTTATTTGGCATTTCCTTTGAAATATTGTTATAATCAATATTTTTAACCTGAAATAAGGTAAAAATTAAATAATACAGTTCAATTTG
AAGTCTAAATTTTGTGAATATGCAATTTTAATTTTTTATTATTCATTAAAAAACTACTTATTTATTATAAGAATGATATATATATAAAAAAAACGAACGT
ACTATCATAAACTTAACTTATAGATAGTGTCTACATGAGTAAAAATTAATGTAATTTATTTTAAATACATTATATTTAAGTGGATTTTTAATCTATATGA
GATACACAATAAATCTCTTTCGTATCTTTTCATCTCGCTCACCACTCTCCCATGTATTTTGTAGCCGAATACATAAGAACCTCGCTTACCACTCTCCCAT
GTATCTTGTATCACAATACATAAGAATCTCGCTCGCCTCCCTTCCCAATATCACTCGCCTCTTTTCCTATCTTTGTGTATCTAGTGGCAAATGTAATTTA
TTTTAAATACATTATTTCAAGTGGATTCATATGTATATATCTGAGATACACAACAAATCTCTTTCGCATCTCTCCCATCTTGCTCACCACTCTCCCATGT
ATCTTGTATTCCATATATATAAGAATCTCGCTCACATCCCTTCCCAATCTCACTCGTCTCTTTCCTATCTTTGTGTACCTAGTAGCAAAAATATATGTAT
TTCTTCAATATATGATAGAAACCAAAAATATATGTATTTCTTTAATATATGATAGAAACTTTTAATAAGTGATAAGATACGAAATATTTTGAAAGTTAAG
TAATAGTGCTATATATCTAATTAAGTAATTCTCCCTTGCTTCTTTATTACTTTTATCGCTACTTCATGAAGTCTCTTCGAATGATTTGTGTTTGCTTAAT
ACATGCGTATCAATTATTGTTGAAAGAAAAGAAAAAAAAGACAAGAATAATAACAAAAACTGAATAAATTATACACTTTTCATAATCTAATATTATTTCT
TTTTAAATCCACTTTATTCTACTTTTGAACTATCTAAGCCATAATACTCATATTCTACTTCACATATGCATTAATATTTGGAATTTTCGATGTTATCCTT
TTCATAGATGGATGGTTGTAAGCAAACAACTCATTTTCAACAGCATATTGGACTTATCTTTAGTGCATATAAGTTAAATTTCATTGGAATCAATAGAGAT
GCCCTTTGAATTTAAACGCAACAATTCCATAAAGCCCTATTAATTCCCCATATCAACATGTCCCAAAATCATTTTTCTAAATTCATCCACACACAGTGCA
TAGAAAAAATCATTATTCTTTTGTTTGTAAACAGTATCATGATCGCGAATCGAATAGGATTCTATTAATAACTGTACGTTTCCCTATTAGTACTCATATC
TACTGGGGAAAAAAAAGCTAGTAGTAACAAAGAACCATAACATTACTAGCATCAATGGAGGAGATTGACAGAGAAGCAACTAAAAATGAAATAAACTACA
GAGGAATCAGAGCCATGCCCTTTGTCATAGGTTTTTTTTATATATATACACTAAACTTGTATTAGTGAATAGTCTCATAATTTTTCCTTTTCTTGACACT
ATTTTACATATAGCCGAGTCTAACTTGTTATTGTATGCTAAAAACTGCAGGGAATGAGACATTTGAGAAGCTGGGAACAATTGGAAGCTCATCAAATCTG
TTGGTTTATTTGACAAGTGTTTTCCATTTGAAGAGCATAACAGCTACTAATATTGTCAACATCTTCAATGGCACTTGCAACTTTGGCACCTTGCTTGGAG
CTTTTCTTTCTGATACTTTGGTCGTTACAACATCCTTGGATTTGCCTCAGTGTCTTCCTTCTTGGTAACCAAACGCCAGAAAAATGACTTCCTCGGACAA
AAATTGTCTAGAAATGATTCTAATTACCAGATCTCTTCTTTAACTTACAGGGAATGCTAGTTTTGACATTAACAGCAGCAGTCACAAAGCTTCATCCACC
TGAATGTGGAAATCAAGAACCTGCACCAATATGTGTTGGTCCAACACCAGGACAAATGATATTTTTACTAGTAGGCTTTTGTTTGCTAGTAATTGGTGCT
TCTGGCATAAGGCCATGTAACTTAGCATTTGGAGCTGATCAATTTGATCCCAAAACTGAATCAGGAAGAAGAGGAATCAGTAGTTTCTTCAATTGGTACT
ATTGTTAGGATATACTATTAACCATGCGTTTTGATATAGTATTAATATTGAACAATTGTTTATTTATTTATTCAATTCAATAAAGTGTTACATTAAATAG
ATCAATTGTCATATATGTGTCCTTAACTTATATAGTAGATGATTTGGTGTATAGAGTTTAAACTTATACACAGAAGATTAAATCATCAGTTCTTATAAGT
TAAAATTTATAGTTCACAATCATAGATGGAAATTTGGACAAAATCATCAGAAAGATTGTAGCACGAGATTAAATGTAATTTATCTTGATTATGAGAATGG
CATAGTTCTAACTTCTCGTGCTAGTGCATTTGGTATGTATTGAACGGGACCAAGCAGAGATAGTTGTTTTAGACTGACTGATAAAAACATATTCTCTAAA
CTATTAAATGTACTTATATTCTTAATCTTGATATAACGATTATGATCTGTATATATTATTTATCATTTAGATTTATTAAAAGATGAGATTCTGAGATGGG
TCAATATGCCTGGTAAATTGGATGATAATAATATATATTGGTGAAATAATTAGTTAGTTGATGGAATCCATGTCTCAGTATAGAGATTGATGATACACCT
TTTATGAGAAGCTTGTAAGTTTTCATGTGTAAACCCGGCTGGTAGATTTATGAATCTGGCACATGAAACAAGTTAAGTATTGCTCTAAAAGAATTTAATC
ATTGAATTAAATTCATCAGTAATTTAATTTATTGATTAGTATCAGTAATCTTAACATGGGGAATCAAATAAGTGTTTAGTGGTGAATTTCGAAATAAATA
GAGGAGTTCAATTACGAATTTTTAGTGGAATGGTTTGTAATTTATTATGGTAAGAATAATTTAAATTAATTATTTAGAATTATTTCCATAATAGGAAGCC
TCAGTAATAAATTCTATGGTCCCTCCCGTGCCCAATTTAACTAGAACTCAGAATCCTATTTTCTAGTAGAAGATGGAAAAGTAGCCTTCTCCTAAAAGAA
AAAGAATTGGTTTTTCCTCTCCTCTTTGGACTAGGAAGACATCTCTATAAATAGGGATTTTTCTAACCTAGATTTGAAAGAGTATTCTATACAATACTTG
CCCACCCAAGTATTGAGAGAGTTCAGTTGTTGATTGGGATCACTGTAGAAGACTATAGAACTGGAGTTGGATTTACTTCAAGATATCTGCACACGCTTCA
AGAGGTAATCCTGAGTTAATTTTCAGCATACTTTGTATGTGATAACTATTTGTGATTGTTATTTATATTCATGCAAGATGTATGATTCTGAAATGCTTCC
GCTGTATATGCTATTTTCCAACAACTATTTCACTCACACATTTGCTGTGATGGTCTCATTGACTGTCATTGTGTATGTTCAAACAAGTGTCAGTTGGTCA
TTGGGATTAGCAATCCTCACAATTATGAGGTTCCTTTCTTGTGCACTTTTCTTTGTGGGCACCAAAATTTATGTCAGGCTTGTGCCAAAAGGTAGCCCTT
TATCAACTGTGGCACAGGTCTTAGTGGCTGCTATCAAGAAAAGGCACTTGCAGCTGCCAGAGCAACCATGTTACTCCCTATTCAACCATGTGCCTTCCAA
TTCCTTGACTTCTTTGCTTCCTTACACTGATCAGTTTAGGTAATTCCACTTGCCAGCATCAATGTTACAAGTTAATTTCGCGTAAACTGACCCTCAAAGT
TAGATAAACTACTGACTAACTAAAAGGGCTCATGATTTCAGATTCTTGAGTAAAGCAGCAGTAAAAACACCAGAAGACCAAATAAACTCATCAGATGGAT
CAGCAGTCAATCCATGGAGGCTTTGTAGCATTCAACAAGTGGAAGAAGTGAAATGCTTACTAAGAGTGATCCCAATATGGGTAGCTGGAACTATCTATTA
TGTCTCTGTTGTTCAATCACAAAATTATGTTATCTTCCAAGCCTTACAAAGTGACAATCAACTAGGCCACAACAATTTCCAGCATCTTTCATAGGCATTT
CCATGCTCAGCATAACCATCTGGTTACCAATATATGACCGTGTTTTACTTCCATGGCTTCGGAAATTCACAGGAAAAGAAGATGGAATCAGCCTTCTCCA
GAAAATGGGAATTGGAATATTTCTATCGATCGTAACAATGTTCATATCAGGGATTGTTGAAGACAGGAGAAGAACCCTAACTATGACTAGGCCAATGCTA
CAAATGACTCAGGGGAAAGGTGCTATTTCATCTATGTCAGGACTATGGCTAATACCTCAGATGGCATTATCAGGTGAGCATTTGCAAATCAATGTTTCTT
TTACAATTTTTGCTCATCTTTTCAACTTTGACTTGAAATAGAGAATTTGTCCATCAATGGTGCATGTGTCCATGTACAATCCAACACTCCATGCACCAGT
GGACAGTCGGAGGCATTTATATTTCACAGAAAAGGTGAAATTCTTAGACTTATGAAAGATGAACTATGAATGCATTTGCCATAGATGTTTCATTAATCAA
GTACAAAAAATAACAGTGTTTCACTCAAGCTCCACTTCTACATACTATCTTTCAACCTTAACGTACTTCAAATACTCATAACTGAAAACAGGTCTTTCCA
AGGCATTTACATTAATCAGCGAGAATGAGTTCTTCTACAAACAATGCCCTGAAACCATGAGGAGCATCGCTGCATCTTTCTTCTTTGTTGGATTGGCAGG
GTCAAGTTATTTGAGCAGTATCATAAAAAGTCACTCAACTATTATGTATAACAAACAACTAAACCGAATTTTCCCAAGTGTCACATAAAGATATTACATA
CTTTCTTTCTCAAATTAATTTTGTTCCCTTAACTCTTTATTTTTGCATCCCTACATTGATGAATCAAAATGTAAGCTTCTGGTGGGAATTTATGAAAGAT
CAATTGGTGGCTAAAACATCACCATATTTTGAGATATTTCTTGTAGGCATAGTTCTAATAGCATGTTAGCCCAAATATAATACAACGCTTTACCCTCAAA
GTGGAACTTCCCAGCACCAATCTAATTTACTCAAGCCCTTAAATGGGTAGTGATGGGAAACCAAAAAAAATGAACTAATCCATTCAACAGCAGGTTAAAG
AAATTCCCTCAAATATATTGAGAAGACACCATCACACACCAAAGCAAAAAAGCCAAACTTCTTTAATCAATGAATAGAGAGAAGCAGTACAAAAACCAGA
TGCTGCTAAACCATGAAATAAAAACTCTTGAGAATATAGATAATGAATGCTGTTATAGCTTAATATTCATTCTTGGTCAATTGTAATATATATAATGTAG
TCAAGACATGAAAGCAGGAAAAGATGAACCAAGAATTCAAAGCAAAAAAATGTATAAAATATATAAGGCACTTTTAAACGCTGAAGATGTTACTACTATG
AACTTGTCGCTCCAGAGGTAACTCACACACTCATTATGTCTTCATTCTATCACCCACTCACCAGTTAAGTAGCACTAGTCATACTTGCTCCCACATCAAA
CAGTGTATGACTGCTGAATTGTCTCTATGTCAAGACCCTTCAACTTCACCACTGATTCCACGTGACCTTTAAGTGTGTGCAGCTCACGTTGCCTGCAATG
AAAAATGTAGTGTTCAATTTCCAAGAAGTCACGAAAAATCAACATGTGTTTAGCTGAAGAAAGCTTAGTAAAGATAAAGTGAAGCAAGCAATGGATATGG
GATGTTGTAGCATGGCCATATGAGTAAAGGGAGAAGAATGAAATGCCCACAAATACAAGTTCAACTTCACACCCAACTAGAAACATAAGCAGAAACTACT
GTACTTCTGTTGTCAAAAAAAATAAAAAAAATTCAAAATGACAATCTTTACCTAGCGATTTCAGCTCTCCTCTTTGCTTCCTCAGCTAACTGATTAAGCT
CATTGAAATTGGTAGCTTCACTAAACAATTTGGTGTCAGGAACTTGCAGCCCATGAAGGGTCCTCTGTGCGTGGGCCCATTGAAGCTCACGTTGTTCTTT
TCCGAAATCCTTCTTCCTGGTGAAAGCAATCTGTAATACAAAGAAACCCGTCACATACCGTTAGCATGAGAATGAATATATATCATATATGTATATCTCT
ACTGTATCACATACCCTTTGCTCAAGAACAAGATCCCAGGCCCTTCCACTGAGAGCATATCTGATTAAGAACTTGATGATATCAAGCGGGAAGTAGAATA
CTAAATTGTAGAGCCAGATCACTCCTGCCCAACCCCAGCCAATTCCTTCGATTGCAGCAAAGCTCCAACTTGCATAAACAGCAATCAAGGTGGCAACCTG
TTTAAAATTAGCAACCAAACATTATAGATTGATCAAGTTGTGGAAAGTTTGCCAGAATGAATGAGCAAATGGCTTACCAGTTGAGCAATCAGAAAAGCAA
CCACAAGCAACAAACCAGGACGCTCAACAAACGACCAACTTCGAGATCTTGTGACAAATATCAGGGCCTGACTGATAGTGCTCACTTGAAGGTAAATTGC
TGATGCAAGTTTCCTGAAGTCATCAGTTGCTGTCCTCTGAAGTGTTGATACCCCAAATACACGCTGGACAATCACCAAACTGAGTGAGATTACAAACTAA
GAACAGTTCATAATTAACGCCAGTTCAACTTTCAACAATCCAAGCAGCAAAGTCAACAGATCATTTAGTTTAATATACAGTTAGTTATCATAACAACACT
ATTAACAAAGTTCTGCTGCACAGGTAAGATGAAAGTCCTCCATAGTTTTTCACAGATAAAAGATGACCAGTCTGTGCGGCCAAACACTCTTTCATTAGTT
CTTATTATATAATACATAACCAGTCTGTGCGGCCAAACATTCTTTCATTAGTTCTTATTATATAATACATAACCAGTCTGTGCGGCTAAACATTCCTTCA
TTAGTTCTTATTACATAATACATAACAGCTACATCTCAAACTACCTGCATCTTTTTTGTGAATATTGTGTCTGTTCATTGTCATGTCAAAACTGAACAAA
TTTATTGATATTATACAGGAAACTCATATGCTCACCGGGAAGAAATCTGTCTCATATGCTGCCCAAAAGAAAATGACTGTCATCATTGCCAAGTAGCCAC
CAAGAACAACCCCAGTAGTGAAAATCTCAGCCAGCTTCCAACTATCAGGCAGAGGAGATGGTTTGACCCTATCCTTTGATATTGTCATAATGGTACCTGA
GATCATAACATTAGAAGTGAGACGTAGAAAAGACACTAGAACGGCAAGAGAACTAACTAAACACTGCAGTGGCAGATCATACTAAACTTTATAGAAGAGC
TTTTGATGAAATGAAAAATGATTTTGTACATGTGAGGAGTAGCCTCTTATTTCTATTTCTCTTTGGTGCATCCATGGGGTTCCGATTTGAATTAAAGATT
GGATGTCTTTTGTAGAATATCATTTTTTCTTTAATAGGTTTTTTACTTTTCTTATACCACATGAGTAGGTGTTATTCCCAACATAATAAATTACTATGAA
CCGGATGGGGGAATAATTAATTGGAAAAATATCACATGTTAGTATGTTTACTTTAGGTCCTATACTCTCTATGATCTTTTATTCATGTCAGAGATTTATA
AGCCATCAGAAAATATAGAGAACTTCTAGCCCTTTTTAATTTTAATTTTGTATAATACAAGCATGTTTCATTTCAATACCCTCAAATTTCATCTTACAGA
AAAATTAGTGGTTTATTAAAATGACGGAATGTTGAAACTAAACATCGTCTATGTTACTATTGGTGAAAAGGACCAACCGTCATTGAGGATTGCAATGATA
AGCACCATGAAAGGTGGAAAGTCAAACTTCCAGATAAGGGCCAGAAGCATAAAACCAAGCTGTAACAAAAATAGAAGAAGAATGTCAAAATATCATTTAA
GAATCATAAAATTAAAGAGAAAAGAAGAAGCAGCAGCCAAAAAACATACCACAATACGGATTGTGATGGAAACAGCATATATCTGCCGATGAAAAAAAAA
AGACAGATAAATTATCAATATTGTGCATCAGAGACAGATTGTAAGTGCATTAAGCTCATTCAGGAATACACTACCCTCAAAATAACAGCTGCTATGATAT
ACCAAAAATGTAGGATGTATAAGGATTTAAATATACGCCTCTAGTAACCCAACAAGAAAAATATATACCGTATAGTTTTTCATCCTTTGAAAGATTGCTC
GACTAGTCAGAACAGCACTAATGATGACACTGAGACCAGGTTCAGTAAGAACAATGTCAGAAGCACTACGAGCAGCATCAGTGGCATCATCAACAGCTAT
CCCAATATCAGCCTTCTTTAAAGCAGGAGCGTCATTGACTCCATCTCCAGTCATTCCACAGATATGCTTCCTAGCTTGCAAGCGTTTTACAATCTCATAT
TTGTGCTCTAAGGCAATGAGCAAGACAAGGTATCAGTAAAGACGAACATTCCGATAAACAAATACCCTATTGAATACCCAAAAGTAGAGAAGTAAAAGAA
TTTTCTGAGAGGGATATACCAGGGAATACTCCAGCAAAACCATCAGCCTTTTCTATCAGTTCATCAATTGGTAAAGAAGCAATTGATTCATCCTTAGTCT
GCCCCAACAGAGCAGATGAAGGATACATGTTGGTTCCCATTCCCAGACGACGCCCTGTTTCTTTTCCTATAGCCAGTTGATCCCCTGCCAAAAGAACAGA
CATCAAGAAATTTAAGCAGGCACATAAACATGTCGAACTTTGATGTAGCAAAAGACGCAGTACCAGTAAGATGATACATGTCCAAATTACATCTGAGCTT
TTTACATCAAAAAGCAATATCTTGGTAAAACACAAGTTGACAAACACAAAGTAATAGTATTTAAAATTCAATTGTGAAAGCCTGAAATCCTTATCAACAC
AATAAATGAAAATGCCAAGCGACGGGCAGAGACATCACTTTAAGTCAATAAGACCAGGCGGTGCCTCTAAAATGAGACATAACCCAGTACCACTATAATA
TTGTCCTCACCAAAAATCAAAAACAAAAAGGCACAGTCCCAATATCGGAACGAATCAAAAGTAGTCTTTGATGCAACAGCCAACAAGCTCAGTGTACAAA
GAATTACTAGCAGACTGCATTACCATCTCAAGTTGGTGATAATTTTGGAAACCTCTACTCACTGGATACATTTTTCCTTTCTCTCTTCCTTTTATTAAGG
GGTTGGGTAGCCATTACTACCAAGTTGCCAATATAGCATGCAGTCTATTTGCCAACAATTTTTCAATATATTGATCATAAAAAATGAAAAAATTAGAAAT
ACCTGTGATCATTTTAACATTCACTCCAAGATTCAAAGCCCTCCTTATAGTCTCAGCACTGTCGTGTCTTGGAGGATCAAACAAAGGCAGGAGACCAATG
AATTGCCATGGTCCTCCGGAACTCTCCTTCCTTCCCTCTGGAACTTCCTGCATGGGAAGTTAGGGTATATGTGATTAAGCGAAATAAAGCTCTATTTTTT
CGACACAATGATAGAACTTGGAGACAGAGATAATTAATCCCTCCTCTCCACTATAATAGTATAGGTTATATGCTTAAGCTGCAAGATAATTGATTCTTTC
AATTTATATATGACATGATGAGTTCCACAGATGATAAAAGGAAAGCAAAATACCTGGTAGGCCACACCAAGTGAGCGCAAACCCCTCTCAGCAAACTTAT
CAATCACCGCATGAACTCTACGTTCTATGTCTGACTTGTTGTGTGCAAGATTTAGGATCTAATCCAAATTGCAGTGATTGGTTAGAAAATGCAATCACGG
AAAGTAAAAGCAAGCAAAGAAGGACTACTTAGATGATCACAGTCATACCTGCTCTGGTGCCCCTTTGCTGACCCTGTGCATTTTTCCTTCACCATCAAGA
TAAGTAAGCGCTGTACGCTTGTCAGTTGGATTGAAAGGAAGAAAGTGTATTTCACGAATGCCAGCACGAGCCTGCATTAATGGCAGCATTAGAACAGTTC
TCTAGCTAAAATGGATACACCAATCACACAGTCATGCAATTCTAAAGTTACCTCCTTCGGGTCAGACAACATCCCAACAATAGCAGTGTCAATGGCATCC
TGGTTCTCTGTACGAGACGCTCGAGCTGCCATCAGAACGACAGTATCTGCGTCAACACCTTTGGCAAAAACCTGATAATTTAGCAGGAACAAACAAGAAA
ATCAGAATCGGTGTGGAATAAGGAATAAACACAAGACTGAACTCTTATTCTCACCTCAACAAGGTTTTTGTCAACAGTAAGCTTGTTTAGTGTAAGGGTC
CCTGTCTTGTCACTACAAAGCACGTCCATACCAGCCATCTCCTCAATAGCTGTCATTCTTTTCGTAATAGCACCCTGAATAGTTAAAATGATGAAATATG
CAATCGCTTATCAGAACTGTTGAACTACAATAACTCACGATTGAAGACATGCTGAAACACCACATCCTAAGATCAAGATGCTAACTAACAAACCTGTTGA
GCGAGCCGATGAGATCCAATTGCCATCGTGACTGAAAGAACCGTTGGCATGGCAATTGGAATTCCACCAATGAGAAGGACAAGAAGATTGTCAATCCCAG
GGCGATATTTGCGGTGTTGGATAGGGTACATCACAATGATCTCTATTATCATCCCCACTGCAATAGAACAGATGCAGAAGTTTCCAATAGCAGTCAAAAC
CTGATAGAGACATCAACAACATTGAATGTGAGATTTAAAAGAATGAGATTATCAACTAATATTCAAAACAAATAAGACAATACAAGTTCAACTTGCCTTT
TGGAAGTGTCCCACTTGATTTGTACTGTCAACAAGGTGTGCAGCCTTCCCAAAAAAGGTATGAACCCCAGTGGCGATGACGACAGCTTCTATCTCTCCCT
GCTTACAGGTAGAACCAGAGTAGACACCATCTCCAGGACCTTTAGTTACAGGAAGAGATTCACCAGTCAAAGCAGACTGCAAGTAATAGATAATATCAGT
GCCACAGTTAAACAAAATATTGAATGCAGTGAGCAACCACTTATTAAATCGTAAAAACTTAATCACCTGGTCAATTTTCAGGGGATCACCTTCAAGAAGA
CGAGCATCTGCAGGAATAATATCTCCCAGTTTAATACTGATAATGTCCCCAGGAACAAGAACAGCAGCATCTTCTTCATTCCATTTTCCATCTCGAAGAA
CCTGCATATATCACAAGAGCAAACAATTAAGACAACTTTCCATTAGTTTCTCAACCTCATACTTCCCATCAAAATTATGAAAGTTAACAACTTTCACATG
CTGTCTAATAGCAATTGAATAACAATGATGGTTGGTGAATCTAGAACCTTGGCTTTAGGAGCGAGACGAGCCATGAGAGCAGCTGCTGCATTGCCAGCAT
TATTCTCCTCAATAAAACTAATTGTTGAGTTAATCACTAGCAAGGTAATAATACCCACAAAATCTTGCCAATCCGGAGGCTTTCCCTACAAAATTCGACA
TATATTCAATTTAAGTCAAAAGAACCAGCATATTGTCCAATATAAAGGTAAATCAGCTTGTTAGCACTTACTCCTCCATTTGCAAGAGCAATTGCCATAA
TAGCAGCAGCTTCCATAACCCATGAGAGGGGGTTCCACATAAACCCCAGAAATTTCAAGAATTTGCTCTCCTATAACACAGCAAACAATAACACTCAACA
ATGATAACAGTTCACTTTTAACTTTCACGTCAAAAACTTAAGCATCAAATTCTCCATCAATTCAGCTTAGTTCAACTAAAGACATCTAATTTTCAGCTAA
AAAGAGTCCATTCAAAGTCCAAACAAGACAGACAAGATATCCAAAGAAAACAAAAGGAGAAAAGAGGAAACATTTCAGCAACAAAAAAAAAAGAAAACTA
ACCCATCAAAGTACCAAATCAAAAAAGGAAGAGAATATACAGAGATTCAGTTCAAAGTGGACCAGCAAGGGAATCAAAAAAACAAGAAAAGGAACAATTC
TACAAAAAGGAAAAAAAAAAAGAGTAATCATCACCACACCTTCTTCTCCTCTAGTTTGTTGTACCCAAAAATTGCCAACCTTTCTTGGGCAGCTGTACCA
GTAAGACCCTCTTTGGTACATCTCAAATTTTCAAAAACTTCTTCAATGGGTATATTCTCCTGCAATTACAACACCAACAAAAAAAGGAAACAAACCCATT
AAAACCAACGAAATATAAGTTCAAAAATTTGATCTTTTTAGTCAGATCCATTACCAAATCCACAGTCTCCTTTAATACAGCATCTAACACCTCAGGTTTC
TCCCCCATCTTGCTCAATTTCCTCTCTTCCTATTTCAAGATTCAACACAATTTTATTATATTATATCAATAAGTTACTAAAAAATCACCCATTAAAGAAA
AAAACAAGATAACTGAGCTGAGTTAAAAGAGTATGAAGAGAAGCAACAACTGCCCACCAAAGAAAGATAGGATTTTTCTCGGGTCCAGAAATAAGATTGG
TAAATCGCCCACCAAATCCAAAACAGAGTGTGGAAGACTACTATATAACAGGCTGCTACCCTGTTATGTTATTACTCTTACTCTCCCCGTTTCAAAATAT
TTGTCATAATTTTTTCTTCAAAAAAACTAAATAATTCTACTTATAACCAATATTATTACAGTTTATTTTTTCCGAAAGTCAAATTATATAATCTTGACCA
ATGCTATCATAATTTTCACTTTAACTATTTTTGACCGATGTTATTATTATTTTCGAGAGTCAAATCATGACGAGTACTATCACAATTTCCATTTTAAGTT
TGAAAGTTAAATCATACAAATTTGACCGGTATTCTTAAGATATGATTTTTGGTGATTATTGTCCTAATTTTATATTTTGAATTCGAAAGTTAAATGATAT
ATTGATCAATATATAATTTTTTTCATTATATTGATATGATAAAATTGTAACTATAATATTTTTGTATAAATTTTTGTTAAAAAACATTTTCCTTTCTTTT
TAAAATTTATTTGTATTTAGTTTTAACTTTAATTGCATTATTTTCTTTCACTAAAATAAACTTCGCTTTGTTTTACTTTTTCTACTAAAAGAAGTAACAC
AGTTTTTTTTGTCTATATAAAGAGATTCTGTTGTCTCAGTTAGTGAGTGACCATTAGGAGTAACATAAAATAATTAAGTCACAAATTTCGTTTAAAACAT
TTATAATTAATTATATAATATAATATTTCGATAAAAAATATTTTAACCGATGACAATTGGTGTAATAATAACAAGGGGTGTGCCTGCACATGCTCATGTC
CCCCCCACCCACACAAACAAGTACCATACTTCTTTTAGTAGTCTTTTTTTTTTTAATTTGATTTAATTAAAATTTTGTGATTTTATTTGTGAATAAGAAG
AAAGACAAATAAATATCTTCTTGTTTACAAAAATAAAATATTTTCTTTTTTAAAAAATAAAAAGACAGTCAACTTTCCTAATGCACGTTACTTAGTTGTA
CTACACAAACTTCTTTGACGTATAGCTGGTCACAGTCTATTTTGATCCAGATTATAATATTTTTTTTAAAAAAAATAATCAAAAAAGGTAATTAAAATAA
TAATACTAATAGTATTATTTATTGGATTTTTTCAACATTATGTTATTTTTTTATTATTTTGTTGTGGACTGATATATTTGCATATAATAAAATAAATACT
TTAAGCCTGCAAGTTGACACATTCCTTCAACCAGTAAGACCACCTAGCCAGTTTACTTTCACCTCTCTAAGCAATTTATATTTATTTATTTTATTCGGTA
TTTAAAATTCATCCGAATTAGATTTACATTTATATTAGAAAAGTTTCATATTAAAAATAAAATGTTTTATGACAAAACTGACTATGTACTCGAGACCTTC
AAACTCGAGATCTTTAATCAAAGATAAAGGGAAAATGCATAACTATCTCCTCATTCTATGTCGAAAATTCTAGAGACACACTTATACGATACTAATGTCC
TATTATCCCTCTGAACTTAATTTATAAATAATTTTCTAGTCCTTTTGGGTCTACATGACACTAGCTTGAAAAAAATGTCAACACACGTTGGGCTTACAAA
ATAGTGTCATATAGGTCAAAAAGGGTTAGAAAATTATTTATAAAATAAATTCAGGGGTAATAAGACCTTAATATGGTATAAGTGTGTCTCCGAGATTTCG
GACATAGATTTAGGAGGTATTTATGCATTTTTCCCAAATATAAAAGAAGTACTTATGATCACTCTATGACAACTATTTAAGAAATTTTATTGTTGTTAGA
CGGCCAAAGAATTATATATTATTCTTAATTATTATTTTTTGCAAAGAAATAATAGTTTATTTCATCAATTGANNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATTCAAATATATATATTTTTAAATTAA
ACTATATCACATAAATTTGTCGAAAGCTTAAAATATGAGATGGCGATGGGAACGAGTAGCCAATCCAATTAATTTGATATTTACGAAGTATCTTCTCCTA
ATAATATTCGACTCCATTACAATTTCCACATACTTTCTTCTTCATCAAGTCTCTTTCCTCCATAGACTTATCCCCAAATATATAAACTCACCCATCTTAA
CTATCGAAATACCCATTTCGATTCTTCACTCCTTCGCTAGCTTTGTTGCTTCGGTATGTTTATGTACATATGCACATACTTTATACAATTTCAATTTTTC
TATTTGTTCTTATAGTTTAATCGTTTTTGTGTTAAGACCTAATGTGTGAAGGAAGACTTGCTTGCTAGTTTGATCTAGGTCAACTCTGTATACTTTCAAA
TTAAAATTTTGATATTTCGAAAAATGTCACATGAATTGGGGAGGGGACAGTAGTTATAAGCAGAAAAGTGTTGTTCTAGTTTCTTTAATGCCATGAAATT
TAGTTTATAGCCTTGTTGGATTGGGTGTTGGATTATGGGTTTGATAAGGTAAAGTGGGTTGAGAAATTTGACAGCAGAATTTAACTTTGCCTTTTATAGA
TGAATATTGAAAACAACAATTGAACTGGTGATATTGTCATTTAATCTTTTCTTAGTTAACTGGGAGAGTTTATTGCTGATGTTCAGTAACTTTGTAAAAG
AAACTAGAGTAGCAGTTGCTCCCTAAAGTGTGACTTAACAGTTTGTAATCTTTAGTTCCAGGGAGAAGTTCGAGAATATTACCCTTTTTGGATTTGTGAA
CTTGAGGTGTCCCAAGTGTAATTTGTAAAGTGTAAACTAACTATTGTGTTCTTTTCGTTTTAGAATTTGTTACTCGTTTAAATTGCTCCTTTATAATGAC
AGGTTCTGATGGTGTAATATATCATTTTTTGAGTTTGTTTTATGGGTGACTTCTGTGAATAATCTTCCTTTTCATGCAATCGTTGCAGAGTATGGGCAAT
CTATTGGGCTGTGTACAAGTTGATCAATCCACCGTCGCAATTACAGAGCAGTTTGGCAAGTATCAAGATGTGCTTCAGCCAGGTTGCCACTGCCTGCCTT
GGTGCTTCGGATTCCAGTTAGCTGGCCATCTCTCCCTCAGGGTGCAACAATTGGATGTTCGCTGCGAGACAAAGACAAAGGTCTATTCTTTATTCCGAAA
CAGTAATTCCATTGTTTTGACACAAGCTGTGTTGGTTCGCAGCCAAATCATCAAAGTCAACCACAATTTGCACTTTAACAAACATAACTAGGTGATGATT
TTTCAGTATTTATGCATATTAATGACTTAATACATATTGCAACAAATGTGCAGGATAATGTGTTTGTCAATGTTGTGGCATCAATTCAGTACCGTGCCCT
GGCAGACAAAGCAAATGATGCTTTCTACAAACTAAGCAACACTAAGGGTCAAATTCAGGCCTATGTTTTTGATGGTAGATATTTAATCTGTCTGTTTATA
TACTATTTCTGAGAATAAATTGATTTCAATGGGTAATGCTAACTTACACAAATCTATGTTTATATTTTGTCAGTCATTAGAGCAAGTGTTCCAAAACTCA
ATCTTGATGATGTTTTCGAGCAGAAAAATGAAATTGCCAAGGCTGTCGAGGATGAACTTGAGAAGGTAAGCCGATTCTTCAATGTTTTCTTAATTGATAC
AGGCAATTTGAATTTTTCATTGGATCTCATATGTATGTCATTATGATCCTTTATAGGCTATGTCGGCTTATGGATATGAAATTGTTCAAACACTTATAGT
TGATATAGAACCAGATGAGAATGTGAAGAGAGCTATGAATGAAATCAATGCTGGTATGGCTAAAATCTCATCTCTTTAGTTAAGCCTGATGCCTGCTGGT
TCTCAACTGCTCTGACTAGTTAGTACTTTGTCCAAGAGGACTATATACATCAGTTGATGGAGGGGGCTACAGTGGGATTCGAACCCACCATCACTAGTGT
GAAGGTGTGGGCAGCTCCCCAACTGAGCTACAAGCCACACTATAAAAGAGTATCTTTTCATGTCCTAATTGTTTTCAATTCTACAGCTGCTCGGCTGAGG
GTGGCTGCTAATGAGAAAGCAGAGGCGGAGAAGATTTTGCAAATTAAGAGGGCTGAAGGAGAGGCAGAATCAAAGTATCTTTCAGGGTTAGGTATTGCAC
GACAGCGTCAAGCGATTGTGGATGGTTTGAGAGACAGCGTGCTCGGATTCTCAGTGAATGTGCCTGGAACCTCAGCAAAAGATGTAATGGACATGGTCCT
TTTAACCCAGTACTTTGACACCATGAAAGAAATTGGCGCTTCCAGTAAATCATCTGCTGTCTTCCTTCCTCATGGGCCTGGTGCTGTAAGAGATGTGGCA
AGCCAGATCCGCGATGGACTCCTTCAAGCTTCTGTGAACCATTAAATGTTTCTACTATATCAGAAATGTTAATTGTGTTTCACTTGAAGCAGCCTTTTTC
ATTTTGTGTTTACTTTCTGTTAGTGTGGATATGTTTGGCGAGTTTGACTTTGTATTTGTGAATGCCTCTAGTATCTTATATTGTAAAGAATTTAATATCC
CAGACCTTTGAAGAATTATATACTATTAATAGATGGATGTGATATTTCTCCTCGTTAATTGTACCTGTTTATTTGTTCCTTTTACCCATTCTTCATCCTT
GATGATTGATCTTTTATTGTTTTACTAGCTATGATACCTAGACTCTTCAAAAATGTCAATGATTGTGTGTTAAAGTCGTCAATAGTAATGTATTTTTGGA
GAATGACATGATGTAACATTGAACCTGAAGAATCTGTGCAACTTAGCTTATTGGTGTGTAGTACAGGGTCATATTTTTGTTGTGTGCTATGCTAAAGGAA
GGTGATTGATCCCTCAAAATAACAGGAAAAATTCCAAAGGGAGGTTGTATCAATATTCTTGCTTGTTTTGGCATACACCTATTGGGCATTTCACCTGCTA
GTTTAAGCGAGTCAAAAAGTTGATTAACATTTGTGAAGGGACTTCTTGTTCACTCACATAGCTTTAACTTTTGTTTCGATTTTCAAGTGAAATGCATATT
TTAACATAACTTTTAACGTTCAAAACACTATACAAATGCGAAGATTTATGGCCATCAAGGCCCTCCAATAAATCTATTGGAATTGGCTTTATATCAATGT
AATATCATTATTCATACGTAATAAATTTTTGGATACCCTTTAAGAAATTTCTGACTCTACTTATAGAAAAGAAAATAAATTTATAGATGAAATTAAATAT
GCAATATTTTATATACGAAAATATTCTATACCTTTAAAAAAAATTATGACATGAAAAACACGCTCTTCTCTTACAGGAGGCTTCCCTCATCTTTCACGTG
CCTTCAAACATTATTTTCCTCGATATATAGCCGTAAAATCATAAATGCATTCAATAATATATTTTTAAAAAATACATCAATTGTATGAAATATATAATTT
GAAATAATAATGAAAAACCCAAGTAAATGACCAATATGATTATAAATAAAGAAAAAAGAAAAGGCAACTAAAAAGAGTAGTTCCATAGATCTTGTATAAT
ACACCCATTCACAAAATTCCTCCTTCTTTACTGTTTTCCCCTTTGTCCTCTCTCTAAATTGTGTGTGCTCTTCTTGATCATCTGGTGTCCAGTTGAAGAT
TGTAGATGGATCATTCATGGCGTCCTCATCTTCCTCCACCACCAATTCAAGGTAGAATCTGTCCATCTTGTTCAATCTCACACTTCCCCTTTTGCCCCCC
TCCAATCCCTTTCCCTTCAAACCCTAGTTTCCGATATCCACCACCACATCCCAATCAACCCCTCTCCCGCCCTCCACTTCCTCCTCATGAGGCCGCTTAC
GACCCCTTCATCGATCATCGTGGTGGACCCCCTATGCCCCCTCCTCATCGTCCCACTGTTGATGGCTACGAGCATCATCCCCGCCCCTCAGATGTGTATG
GAAATATGAAACCTACTTATGATTCACCTGGTGCTTTCAATGTTGGAGTGAAGAGAATGAGAGTTGATGATTCATCGGGTACTTTTACGAATGAAAAGTT
GACTAGTTTAGCTAGGTTTTCAACTGATAATGAGAGGAGATTGCAGCTGATTAACGAATTTGGTGGGGCAGCTTACGAATTAGACAAAGGGCGTGGAAGT
TTTGATGGTGAAGAATATGGAAAATTTGATGGATTTTTAGGTGGAAAAAATAGCAATAGCAGTTATGTAGATCAAGGTTATGGTAATATGGATAGAAATC
AAACATTTTGTGACCAAGAACGTTTTGAGAGACAGCAATATCCACCGAGGGAAGGGAATGTACAGTTTGGACAATTAGGATATGACAAGAATTTGCCAGA
GAGAAATGGTTACAAATATGGTAGTCCTCGAGCTGATACTCACCACAATGTAGAACACAACCAACAGAATTGTGAAGGATCAAGGTACAGCTCAAAACTT
GGAGGTGGTTATCTTCCAAGGCATGGAGTTTCAGGGATGAATAAACTGTACAATGAACAGACAAGCCATTTGCCCGTGGATGGTCACAGTTACAACCATC
ATTATTCGCAGGCTTATGCAATGTCAAATCATGTGGATTCAAAATCAAATCATTATGGTTCCCCACATGACCAGAGGATTAATTCAGCTGACCGTAGTGG
CACAAGCTTATATTCGGCACAGGGTTGTAAGACATACGCTAGCCAGCCGCCACTTCCAGCTTCTCCTCCACCCCCTCTTCCATTGGAACCCCCTTTGCAT
GAACGTCTTGTCTCATCTTCACCTCCTAGAACTTCGGCCTCATTGTTTCCAGGTTCTGTTGGTTCTTCAGCTCCTTTGTCATCATATTATCCTCCACTTC
CGGAAGAGAAGTCCATGTCACGTTATCAGCCCAATTTACATTTGTCATCTTGCACTACTATTGAGGTACTCCTTCAATTCTTTGTGGGATTTGTTTATGT
TCTTCACTTTGCAGTCTGTTATTAAGTGGCTCACAAGATAATATTATATAATAAAGGCCTAACCCATTGGTGGCCCCTAAAGTAGACACCTTAACTAAGT
CATGCTTATTTTAGACACCTCATGTAGAATCATGTAGAATCTCGCTGTGTCATTTTGACTCTTTTTGCTTACATGGAATAGTGAGTGTGATACACTCATC
GAGCGTGTGAAAAGGTTGTTTAGTTAATTTTTGAATTATTTTTTTCTTCTTCTTCCCCATTTTTTGTCACTATTTTGTCCAAGTTAAATTTCAATACATT
GTGAATGAAGGTTTCAACAAAAATGACGGAAAATGCTTCTAAAATTTAAGAATAAACCCATTCATAAAATTCTTTCTTAGAAAAATTTAATATTTGCATG
GAAGTGAATTTAGGAAGATCGATAAAAGCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGCTTAGCTTATTTTGTGGGGAAGAGGCCGGAGGTGTTAAGTATCTCATTTTGTTAGTCAATGGAGGT
TGTTGTCTCATTAATTATATGACTTTGAATAATTCGTATCTTATGAATTATCTTTAACGTTGAATTATCTAGACCTAATATTATTATTTTTCACGCAAAT
TACCTTATTCGGTGGAATGGAGGTAGTTATTTGATAGTGTTTGCCAACATATTGACTCAAATACTACTAAGCTCACATTTTGACCCTTTATGTCATTTTA
ATTTGATTGAACATTAAATTTAAAATATAATATTTTGATCTTTGTAAATCAAAAGAAATATGTATAAAATATATGTCATTAGGTATAATAATTTTAAAAA
TGTCAAGTGAATAATTAAAGTTTAAAGAGTTACTACTATACAAGTGAAATAATATTTAAAAATTGTCTGAAATTCAATTTCGAAATTAAAAAAATTAAAA
AATGTCATGGCCAAATAGGATCGTCGTCCCATTATCCCTTTTTTACTAAGATTTATAGATGTAATAACATTTAAATTTATTGTTATCTCTACTGTATATA
TGGTGTGAGAAATAAAGACAAAGGCAAGGCCAAGTGAATGAGAATCAAAGAGAAAATCCAAATCTAATGTAATTAAATTAGAATCTTTGATCTGTAATTA
TTAATGCTAATATTTTTTTTTTT