BAC Sequence – LE_HBa0139J14

>C11HBa0139J14.2
TCTTACCTCCGTACAGTATCAACATAAAAAGGATTTTCTCGCATGCAGATCCCTGCTTCTCGAACTTCTGTGACCGGCTTTTCAAGAACTCTTTTATATG
CCTTAAAATAGTTAAAAGGGACTATTCAGTTGTCCTAGAAAAAGAAGTTAAAGGAAGATGGCATAGCAAAGTTAGCAACTTACCTTTTGACAGTATTTCT
TTAAACGGTCCTTGAGCTTTACTTGTTGTTCTGCTTTAGGCAAATCAAGAAAAGACTTTGATCGTTGACCATCTCCTACTTCAACAAGTTCAGATTCGAG
TTGTCTCTTTATGTGGTAATAATCACTGATGTTTGGTATAAACAAAATATCAAGTTTCAGTAGCAATCTATCTGAAGTTTCCAATTTTTCACTAAATGAC
TAGAAAATATACCTCCTTTTTGCCATGTATATTTCACCACGCCAAACCCACTCAAGCTTCCGGAGACACTTTTTGCCAGGACGATTAAAATCGCATGCAG
TGCATATCTCATCTGATACTATTGATGGTGGCTGATGGAATCAAGTTTAAAGTTAGATTCAAAAGGCTACCAAATATAAAATGCTACATCCACAATAAAG
AGATAATGCACCCAACATGAAGCACCTCCTCAATAAGACAGCAGAAGTAAAAATCAGTATTTGTCAGCTGTTCAGCACATCATGTTTTAAAGCAATTGGG
TGTCAGCCATAAAAGATCCACATAAAGCCCATTGCAAGCATCTAAAAGTAACTGCCGAATTGTTCTCTTAATTTTCTTAGGCTGCTTCTTGAAATGACAC
AATACAAAATATATTGATGATACTCGTAAATTCGAATTATTACTTTTTAGGCTGGTAACTACTCGTAAATTAGAATTAGAATAATTTATTAATGGTCATG
CCCTAGAGGCTGCACTTAAACAGCAGCAAAATCAACCAATATTCACAGCATGGACTTCCAGGACAATAGATAAGTATAATTTGAGGGTATAGCAGTGAAA
AATTAGAAATATCGTTCTAATCCCCTTCAGATATGATTGGTTTAGTGTTACGTAGACCCCGAGAATTTACTATTTAATTGATTCTCAATCTTCTAACTTG
TTTCCGATTGAACCTTCTACAACTTGTACTTTCTTCTGCCTTGTCTCCCCCAGAATCTCTTACGGACTGAATATTATTGTGAAGACTGAAGACTCCCACA
TTAACCCCATAAAGGGATGGTGGTCTCATTAATATAGTTTGGGCAATCATACATTTTGAGCTAGCTTTTGCGTTTGAGTTAGGCCCAAGATCCATTTCTT
TACATGGTATTGGACCCACATTAAATTGCTAACACATCACATATCCAGCCCTGTGCGTGAGGGATGAAGAGTACCACATTTACCATTTAAGGGTTGGGTG
GCCTCATTAATTTGGGCAATCCTCACCTCTTGAGCCAACTTTGGGGGGTGAGTTAGGTCCAAGATCCATTTTTTTTTATGACAAGAAGAACCTGCAACCG
CAACCCTTTGGGTGTATGAGAAATATAGGAAAAGAATATTATTGAATTGTTGTTGTGTCTACATTATTACATGAGACCCTATTTAATAGAATACAATCCT
TTATCAAGTAGGATACTATTTAGTATTCCTATTTCTATTCTAATTGGATTGTATAAACATATTCCTATTCTAATAGGATTGTATTAACCTATTCCTATTT
CAATAGGATTATATAAACCTATCCTATTCTAACAGGGTGCGCACGGGGAAAACCCCTGCTCCTAAGCAATAGCTCGCAAACTACATACGAGAGGTTACCT
ACCCTAGGCAAGCCTGATGCGACGATCTCGACCCAAAAGGCAAACCCCTTGCTTTCGCTGGCAAGGGGTTTCGACTTGAGACCTCCAACATGGAAGTCCC
AAGCCCAAACCACTGGGCCACCCAAAAGAGTGCCCAAGATTTCTATACAAACATATACTCAAGATTGACTCTATTCGTTCGAAGTCTGGTGTTCCAATGA
GGGGCTTAGTGAGATATTCGCAAGTTGATCAGTCGACTTCACAAAATTGACAGTCAGTCTTAATGTACTTGTCTTCTCATTAAATACTGGATTTGATGCA
AATGTCAGTAAACACACAGATAAAATTTCAATGTTAAACTTCCCAAACTAAACCTGCAAAGACTGCTTCAAACAATAGAGTGACTCACATAATAGACATA
CAAGGCTACTAAACTCCCCCTGAGCAACAAAGTGCTCAAAACCTAGTATAAAGTATATGGATCATGTTGGAATCAAAAGATGAGTCGTATTAAACAAGTC
ACCGAAAAACTGGCTGGAACATGCTCATATGCCGGAGTATTAGGTTTGATGGCTAAAAATGGTCAGAATCTAAGAAATAAAATTATATAGGTAGGATCGG
AATGATGTCACGACCCAACTAGAAAATAGAAATTAAATAGGATAATTCGAATTGATGGAACGACAGGGTAGGGTCGGAATGACGCCACGACCCTAATGAA
AAAGAGATTATATGGGTAGGATTGGAATGATGGCATAACCCTGTACAAATCAGATTTCAGGAGTCATCGGAAAGACGAATGGAACTACGCAAATCAAATC
TGAGGAGTCATCGAAAAGACACACGGTGCTATGCAACTCAGATATGAAAAAGTAGTTCAAAAAAAACTCATGGTACTATGCATATTAATATGAAAAGTAG
TCCGGAGAGATGCACGGTGCTACGCAAATAAGATATGCAAAAAAAAAAAAGGTAGTCACCAGAAGGATGACATGGTGCTACACAAATTAAATATGAAAAA
GTAGTCACTGATATGATGGCACGGTGCTACAAAAATTAGATATGGAAAAATAGTCACTAGAAAGATACACTGTGACCCAACTTTTGCTAACAAAATCATT
GCTCGAACGGGCGGCATATATGAGTAATAGCCGCCCGCCGCAGCGGAAGCTCTTTGATTGTTTACCAAGATCGTAGAGGCTCTGATACCATGTGAGAAAT
ATAGGAAAAGAATATTATTAAATTGTTGTTGTGTCTACATTATTACATGAGACCCTATTTAATAGAATACAATCCTTTATTCCTATTCTAATTGGATTGT
ATAAACATATTTCTACTCTAATAGGATTGTATAAACCTATTTCTAATAGAATTGTATAAACCTATTCCTATTTCAATAGGATTATATAAACATATTCCTA
TTCTAATAGGGTGCGCACAAGGAAACCCCTGCTCCTAAGCAATAACTCGCAAACTACATACGAGAGGTAACCTATCCTAGGCAAGCCTGATGTGACGATC
TCGACCCAGAAGGCAAACCCCTTGCTTTCACTGGCAAGGGGTTTCGAACTTGACACCTCCAACATGGAAGTCCCAAGCCCAAACCACTGGGCTACCCCAA
AGAGTGCCCAAGATTTCTATACAGATATATTCTCAAAATTAACTCTATTCATTTGAAGTCTGGTGTTCCCAGAACGCCCATAGAAATTCATCTTCTAATG
ATTAACATGTGATATTATCTTCATCTCAAGATTTACAAAATTTCAAGTTCTATGCAGGTACTTTAGACAAGGTAGCGTGCGATAACTATCCCCAATTACA
AGAAGTTAATCGTTAAGGATCAACCTGCTGACTTTAAAGCAGAATGCAACAAGAAAAAGGAACAGGTTTAAAAGTCACACAAGACAGGCAGAGAATAAAA
CCCCACAAGTCTTCAACCTCTAGCATCGTGTATCACTAGTCTTTTATTGTTTTTCCTCGCTTTCCAATTTTCACATGTCTAACCAAGCTGCTGGAATCTA
GATTGAAAATTTCAAGTTAACTCTGTTCCGCATCAGCACAGTTATCTGTGCATACATAATACTTCTTTAACAGTCAAAATACTGTGCTACCTTCTCTTTG
CAGCCCGACAAATGAAGATGTTAAAGATATAGTCTTGTTGTTTGGTAGGTAATAAGCAAGTTGTAAAAAACTACTCCACTGATATAAACTGACCGCCATC
CTTCCTCTAGGACATTTTTAAACTTGAAATGGCAGACTATTTTATCCTAGTCTATTAACGATTTACCTTGTCAATTTTGTATGTACAAAAAATTAACTTT
TCTGCCCATGGTTTCTTCCATCTAAAACAGAAAACTGGATTTTCAATTCCTATAAACTATTCAGAACAGGGAAAAGAACACATTCAATCTGGGAAGAAAG
AGTAACAAAAAAGCCAGACATAATAACATCTCAGAGAAGAACATTCTTCAAGAAATGGACTGTGAAAGCTGACATACCTGAAGCCTATTTGTAAGTATGA
TGTTTGGATACATGGCAGCTACATCAAGATGATATATGAGGGGGCATTCTTCCCTTAAAGGATCATCTCGTAAGCTCATTAGCTGTAAATAATATGGTTA
AGATGGTCAGAGAGGAGAAAAATTTCTGCAAACATCTAAAGATTTTCTCTAACTATTAAGTTACGCAATAAGAAAGAGAGTCTAAATAAGAAAAAAAAAT
GACAAGGAAATCAGAAACTTCCAAAACAATAAATTCGACTCCTGTCAGATATGGCCATGGGTGCCGGCAGAATACTTGTAAAATCTCTCTCATGTGACAA
ACAAATGCCTCAACTCAGCTGAAATTATCAACAAATGAAACGAAGGATGCACTACCTTTTCCATGATGGCATTCTTCACTTCATCATAATTTGTGACAGA
CTGCAAGTCCATCTTCCCCTCAACTACAATAGAATACTGCAGATCTCTATCAAGGTTGCTGATCAATAGCTGGAGAGTTGAAAATCTTCATGTTAGTAAC
TGATACAATGGAACAGAAGAGCCTAGAATATATCAAAAGCAACTGTAATAGACACAAAGATCTCAAAAGGCGAGTCTTTACACAATTTAGGATGTAGTTA
CTGAACATAAGAGCAATACAGCAAGCTAAAAATGAACACTTCACAGTGAATTACTACATTCATCTACAGAAGCAAGAAGAGAATTGGGAGTTCAATTGGC
CTTTGGAAAATGCTTTAGAGAACAAAAGCACCCCCTAAAGCAGTCTATTTAGAATGTATAGCTGAAAAAAGAGGCTTGTCTAACACAAGCTGCACTTCAA
AAAGAGGCCTGTCTCTCTGCAATATATGTTTCTTATGCAAAGCCTCGTTGGAAGCAAACAATCATCTTCTGCTTCCAGCTTATCCACCACTCTCTTCAAT
CTTTCTGTCAGTACCTTAGAGATCAGCTTGTAAAAGCTACCAATCAAGCTGATGGGCCTGAATCTTTAAGCTCCTTTCCTCCTGTCTTGTTAGGAATCAG
TGCAATGTAGGTTGCATTAAAGCTTTATTCCAAATATACCACTTGAGTGAAAATTATGAAAAACCTTCATTATGTCTTAACTCAACAACCTCCCAACACT
TTAGGTAGAACCCCATTATAAAAACGTCAGGGACTGTCTATAGCTCGCGTCTTCAGACACTCAAAAACTTCTTGCTCTTCAAAGACTGCTGGCGATGCCT
CTTTCTCATCCTCTGTGATTGACTGATGGTAGGATGGTTGCTAACATTTTCAGATTGCCTCCAGTTTTCAGTGTTTGTGAACAGCTTCTTGTAAAAAGAC
ATGAATTCTTCCTTGATTCTGTTTGATTCAGATAAAGTCTCTCCTTGTAGCTCAACTGATCAATGTGATTGTATCTCTTGTGGGCATTAGCATTCTGGTG
GAAAAACTTAGTATTCATGGCCCCCTCCTTGAGCCATAAGGCCTTTGAACTGTCTCCGGGCCACTTCTTCACTCTTCAAACATCCTTTACAATGGGTTTT
TTGTTGTTGTATGAAATTTTGTTACGTTTGTTATAAGACAGTTGAAAACCAAATATATTTTCCTCTTCAAAGTCGATTATTCATAAAAATATAACCAACA
GACATCCATGTATTTGACCAAACTCTCATGCTAGTCCAAAAAGTTTATAGTATTACCAACTAGATGGTTTGAGGAGAAACAAGACGTCTATTCCTTTTTT
CTTAAAATAGATTACCTACTTCATTTCATGGGTCAACAGAAATAATTTTAGATAGATTGTTATAAGAAGTGATTCTGGTGATAGTTTAAAATGGTGAAAA
AATAGAGTAACTAGAAGAAAAAAACTCATGAAGTAGTATTACATAAATTCATCTAATCTGGAAGAAGAGAAAGCTTTATAACATTGTTAACCTCATAGGC
AGAGGGATCGAGTTTAAAACTGGTTGGGATGTCAGATCTGAATACACCACTTTCTAGGCATTCCACATGACCACCAATGTATGTCTCACTGTCAAGGAGT
TGACTACCATAAAACTTCTCTGGATCAGACTGGTGCTTGTTTGGACAGATAACATTTGCCTTATAAGCCTGTACGCAGGTGAAATGCAGAAGAAAAACAA
ACAAGGCAGTTAGAATACAGAAGAAAAGTGGAAAACATCAGTGGAGATTTCCTTTGTCCTCTTTTCCTAGTCAAACAGAATCAAAACACTGAAAAGGCAC
CAACCATAAAACTAAAATCCATAAAGAAGGAACTTCCTGAGAACCACAAAGAAAAAAAGAGCTTCTAAAGACAGCTACCTGAACCATAAGAAGCATTTCA
CACAAAGTCCCACTTCCTTTGCGCAAGACTTCATCTGGCGGCATGGGTATTATGGTTGCAAGGGAGAAAATGAAGGGATGAACATAAGTCATGTACAAGT
AGTATGTTGAAACAGCATCTGAAACAGAATATGAAGCCATCATCTGCAAAATCATTTAAACACAAAAAAGTTAGGTTATCCAGAATTCCAGACTGGTTTT
CCTCCAGTGAATAAATGAAAAGACGATGAATGCATTTTCTCCTTTACCAAAGTAGCACTCATACACAAGTTAGAAACCAAAATAAGATTACTACTCTACT
CACCATGATTAACAATTCAGATAATCATGGTTGTTTGAGGGGAAAATATAATACTCCCTTTGTCCCAATTTATGTGTCGCAGCTCAGATTTTGAGAGTCA
AGCATCTTGATTTTGATCATGAACTCGGACATAGAGTCTTTAAATTTTTTGAAACAAAATTTCCATTTTTCAAAAACTATGTAAAAATAATATTATACGT
CACAGCAATTAACAATTTGAAAATATTTAAAAGCCATATGAAAAAATTGTGGTCAAAGAAAAATTTCTTCAGCAAATCACAGTTGTTTGAGGGGAAAACA
TAGTACTCACTCAGTCCCAATTCTATATGACACGGTTTGGATTTTAATCGTGAATTTGGACATAGAATATACAAGTATTTTGTAATAAAATTTACATCTT
ATAAAACTATGTAAAATACGATTAAGTCACAACAATTAACAATTTAAATATTTAATAGGCATATGAGAAAAATCATGGTCAGAAGAAAAACTCGTTTGAC
ACTCGAAATCCAATCACCACCATAGAAACTGGGACAGAGGGGATATTAGAGAGAATGGAAATCAGGGCCACGCAAACACAGTTGTTAAAAGAGCTCTGCT
CTTGGCTGCTTGGCCGAAATTCCATGGATGAATAACCCAAAAGAAATTGGTAAAATCAAACAAGAATCCTCATACTAGGAGGCAGAAATTTTTTCACATA
GTATCTTATTCTTCAATTTTTTCTATTGCCTGTTGCTTCTTTGCTTCGTTCATCCTGTTATTTCGTCCAACTTCTTTTGAGCCAAAGGTCTACCGAAAAC
AATCCATCTTACTCTCCCCAGACTACTTGTTGGATTACACTGGATATGTTGTTGTAATCTTCATACTAGGAACCTACTAAGGTAATTCTTTTTTTTTTTT
TGAAACTGGTAACATTTGTATTTCAAATAGTACTTAGGTAGCACTGAAAAACCATATCTACAAATGCAGAAAGTATAATCTATCCAAAAAACTGAACCAA
ATCTAAATGGATCCTAAAATATCGATGATTGACTCAGTCTCATTGGAGTAGACATTTGTACACCAAAAGCAGAACAACAAAATACACTTAAGCTTAACTT
CCTGCAGGGTGTTGTTCCAATTCTCAAAATATCTCTCGTTTCTCTCCCTCCATATAGTCCACCAAATTCTAGCAGGGATCATTCTCCACCTTTCTCTGTT
TGTAGCCGCAACTCCAGCCATCTTCCAACTGAATAGAGTCTCATCAATCTTGCTAGGCATACACCAAGATATGCTCTGAGATAAAGGAAAATCTGCCACA
GCTGCCCAGTAAAGTTGCAATGCAAGAAGATATGTCTCACTGTCTCATTAGCCTTCCCACACAAGGAACATCTATTGCATAGAGAGATTCCTCTCTTGGC
CACATTATCCAATGTCAAAACTGCTTCATTGGCTAGTAGCCATGTGAAGCATGCCACTTTGTGTGGCACTTTGATCCAAGGTAATTCTTTCCATTTTCTG
GCTATGAATCTCAACTGTTATAGTAGATTCATAGATGCGAGACTGCAACATCATCTAAACAGTGGGGAGGACTTGGGTTACAGACTTGAAGACTTTTAAC
GAAACACTTACGGGTTAATGTTTGTGGAGGAGAAGCTTTATGGAGAGAGGTGATAGGGAAAAAATATGGAGTAATGGAAGGGGATGGAGAACAAATGAGA
TCATTATACCTTTCGGGAGTGGTGTGTGGAGGAATATAACAAAGGGATGGAACGCTTTCGATGATAACATTACTTTTAGGGTTGGGGATGGGAGAAGAGC
TAGTTTGGGGGTAAAGGTAGTGTGGAGGTTTGGTGCTTAAGGATGAATTTCCAGTATTGTAGAGGGTCTCCTGCCAAACGGAATTATATTCATCAAGTAA
AGGGGACTCGAAAGGATGGGACTTTTTGGGATTTGAGGTGCAGGAGGAATTTCCATGATAGGGAGGTGACTGAGCTTCAAAGAATACTAGATTTACACCA
AAAGCAATGTAAGTCAGTCAACAGACCCAATGCTTGGGTTGGGTGTCGGGGAATAACACAGTGTTCTTTTGTCAGGTTTTCAATGAGAAGCTTTTGGTGA
GGTGGAGGATAGTTTTCTATATGGTGCAGTATGGATACCAAAGGTGCTGACAGTCGAGGAAGGTGTGCTTCATGTGGTTTGCTACTGGAGGGGTGATTTT
GATGACAAAGAACCTAAGGAAGTGAAAGGTTTTCTACAGTGAGTGCACGGATCATATTTTGATACATTGCAGATTAGCCACGAGGTTGTGGGAGCCTTAT
ATTTACATGGTTTGGTGTCACTTGGATAATGCCAAGTCTCATGAAGGAGTTGATGTTGGCGTTGAATGTTACTCATCTTGCTCTAATGTGGTCATTTGGA
AAGAGAAATGGGAGAGCTTTTGAAGAGGTGGATAAGAGCTTTGTTCAACTTCAACTGAGAAGTAGTCTCGATCCCTCTTATTATCTTTTGGTGTAACCAT
GTAGTTCCTGATTTAAAGAGGATTGAGTGTCTTTTGGAGAGACCCATATTTTGTAGGCTTCTCCTTTTTTGAAATATCTCTTGTTTTTTATAAGATAAAC
GATATTATTAACAATGGGCCTTGTTTTTATTAATGAAAACCTTACTTGATCCAAAAAAGAAAAGGGGTACTAAAAGAGTCATGAGAAAGCTAATAAGATT
CCAAAATGATTTTGAGTAGATAAATGGATCACAGCCCTCAAATCAGAGAAGGGAACTTAGCTACCACATGCAGTAAGAGAAATTAATCCTCAAATTTTAG
CATGTAATATGCAAAAGGAGGCAGAAATTACAAAGTAACGATGATGGCTCAGAAGATAAACATCCCTTTTAATGGAACGGACAGGCTTTTGACTAGAAAG
AATTTCAAAGAGACATGCTCATGCAGCAGGGGAAGAAAATGACTTGCCAGCTAAGGCTACACAATCTTGGATCCCCTCAAGATACTCGTAGTCATATGAC
ATTAAATGATGATTGTGAAATCCTTAGATAATGGAAAGCTATAAACACAAACTTTTCATCATAAAATTGTAAAGCATGAGTTTTGGTCTGTGCAATCTGC
AATGTGGCTTCCTTTGGGTCAAACGAACAAGTTATCAATCATGTCTAACACTTCTATAGATAATATCATCTTTGAAATTCATGGTGAACTTACTAAGATA
TACCAGTTTGAAATAACTCATACCTGTGGTTTTTCCTTTGCAAAGCGAACCATATCCTCAGGATTGACTTCTAGAGGGTCATAACCCAACTTGGCCTTCG
TTACAGCCTGAGTTGGAGAGGAATAAGGCAATAGTTACATCAGATGCCATAGTGAAGAGTCTGATATACTTGAAGACAGAAAGTTCAGTCTAAATAGGTC
GAAATTATAAATAAGCCAAGAAACTGAAAAGAGATATAACTTCTTCATTTACCACAAATGAAAAATCTCTTGAGCCAACGTATCTGGTCATAATTCTAAA
CATAAGGTGAACTCATTCACTTCTCATTTTTTTACTACTTTAAGAGAGCCATATTTCTTTCTTTACATTCTTAGGTTGATTATGTGAGCTCTTTGGAACT
CTTTATTTTCAAATTTTAGAGGAAAAAAAAGTACAACAGTTACCTATGAAATTTTGTAGAATCTCAAGGGAGTGGGAAGCTTTTCTATGAGGAAAAATAA
CTCTACAATTATCCACCCAAAATCATTAGGATCTGAACATTTGATTTTGAGCCATACACAGCAAATGGGAGCTCCAAGATGCAAAAAAAAATGTAATCTG
ATTGTAAAGGAACTACCACCGTCCAGTTTGATAAATATCTTTTACAAGCATACAAGTTTCAATCCAGGCTAAGCTGCTAAGGGGTACGGAAAGAAGAGAA
CACACTTTCAACAGATATGAGCTCTTAGGCAAAAGACGTGTGGAGTCCACAGAAAACATAAAATATTGATATTACGTAATCAACTGAACAATTAATCAAA
GTAGAGAACTAATGTGAATTTCACACTGTGAAGACAAGAAAGATCATACTGGAATACATGAAGGCTTCAGCAAAAGGTTAAAATCAAGTAAAACAAATAT
AAAGAGCATAAGCAATAAGAAAAGAAAAAGAGGTTATGAGTTGCACCTTCAGACCTTGGCTTCCTTGAGGAAGATAACTATCACGTTTGACCCAAGCAAA
ACAGTCCAGATGGCAAGCATATTTAGCACGACATTCCCCTTGATTCTTGTCAAAGGAAAACCCAAGCTCCTGCAGTGAAAAATAGAGAACAATAAAGGGT
CATTGAGTGTATTAGCAAAATAATGCATGCATTAGCACTATGTATTAGTAGACAGTGGTCCCTTGTTTTGTACACTTTTTTATGTTATGCATAACTAATG
CTTGCATTAGTTATATAATCTATTGTGTATTGCAGAGTGTATTACTAATACCATGAATTCTAGGTGTTAGTAAAGCAAAAGGATTTAATGCATGCATTAG
CATGGTTAAAAGCCCAATTACCCCTCAAAAACACTTTTACATCTTTTCCTCCATAATTGCGAAGGATATTTTTGTACATAAATACTTTTATACAATGCAT
ACTATTTTCAACATACCAAACCAAACAATGCATAAGAAATAATCTATGCATAATTAATGCAAGCATAACTAATACAAGCATTAATAATACAAGCATTACT
AAATACTAACACACTCTATTGAGCATTATTTTAATACTCTATCTAACCAACCCTAAGTGTGTAACATGGGTTTCAGGCAGAAATGAGAAACTACAAAAAC
ATAAAACGAAGAAAAAGAAGATGATACTAATTTCAAAAATGATGATTTTACAAATTATTATTGAGATTACAAATCAACAGAAACAGACAACCTTTGTTGT
AGGAATTACAGCAATCCTGCAAGAGTTTTCTTTTTGAGAATGGTAACAGTTAGTCTATATATCCACTGGTACACTACATCAAAATATGTAGTTCCCTTCT
AGTGTTACAACTTACATCTTGAACATCTATCTGTTGTTCCTATGAATAGTCTAAAACGTCAAAAATATCTTCTCTTTGAGCTATTAATTTATGTATACAC
CAAAAAATAACAGTGAAGAATCGAAAAACAAAATATTTTGGGCAGTATGGGTATGCTGAGCCAAAAAGGACCTTATCAAATACCTTAGCAAGAGAAACAA
CTAGTATATTTTTGTCCAAAAACACAGAGAAATTACACAATTATGAAGTTGGAAATGGACAGAGAGCAGAGCTAGATAATGAATTGGGTGCATCAGGAAA
AAAATGGCAAAGTAGCACTGCTCTGGAAAACCATCTACAAGATGCTGAATCATAAACTACTTGAGATTACAAACACAAACACTTTTAACAGTAAGGAGCT
ACATACATCCTTGAGGCTCAAGCCATAATGAGTAGCTCTTGTCTCAACAAATGGCCAATCAAAGAAGTCACCGTTATATGTTACATAGATACCAGGCTTC
GCCACTTGCATGTGTGCGAACCAGTGCCTAAGGAGCCCTTCCTGCAACAAAACAATGTTGTAGAAGAATGAATGTCTTAATGGTGAAGAAATAGAGTGTA
CAAAATTTCAGAAAAAACATTACCTCGTTTTTCACATTTGTCACTTTAAAATGCCCTTCATATTCTGGTTTTGGGGTATACTCTATATCCTCAATATCCT
CCCCAACATACTGGAAATTCAGAAAAAATTGGTTACAATTGCATAGAAAAATAATTAATTTACTTTCCCAAAAAACAAATTAAATGGATCCTTGTTTGTA
GATGTATTGCTAAAGAATTCGCTACAAGGAGGAGTCTCACTAACAACAACCAGCTATATAATCTATACGAAGACCCTAAATGGGCAAACACAGTGAAGAA
GACCTGAAGAAAGTAGATCATGAAGCCTAACACTAATTTATCATATTTTTATAACAGATAGGAGAAGGAATTCAACAAAACCTAGTTCAGATTAGAAAGT
AAGTGTAAGAAACACAAATGCTACAGATTAAGCACCTCTCTGTTAATAATGAGATAGCCTTGGCCATCAACCATGTATGAGATCATCATTATGGAATCAT
ATTCGGCATCAGGAAATTTAAGAGGAAGCTTTGTGGTTTCAATATCAAAGGCGCAAACATGAACTTCAGCTCGCTGCAAGAGATCAGTCCTCCTCTCCAA
CACAACACCGGAGCTAGATACACTCACATCATACCACTGACCACATCGAACATCTAATAAATGTAAATTTCAACGTTAAGATCAAAGCACATAAACAGTT
AATTCAAAAATTTAGATACTTCAGAAATCTTAGCATTGAAAAAGACATTACCAATGTCAATGGCAAAGCGAACATGGTAGGGTACATCATATTCACGTAG
ATCAGTGATATAATCTATAAAATCTTGACTTCGCTGCTTGCTGCATGTCAGGAAACAATCACTTCAAGATGGACGTACCCCATAATGAATCTTAAATGAA
AGGATTGATATAAATTGATGAGGAAATTAAACAATGTCAAAATAACTGATAATCATCTAAAGATATGTGAACTTCACTAAATACTTAATGGATGGACTAT
GGTTATTGATATTATTTCAAAATATCAGAGATACCTTTTCCCCGTCAGTATAGATTCATATGCTTCTATTGTATCAAACTTCGTTTGATTTCTCTCAACA
ATGTGTGTTAGATCACGCTTCACGTCCATCAACTGTTGGACAGTGTCAAATGATATCTTTAAATATGATCTGTGTAGGCCAGACAGATGGTTTTTCTGAA
AAAGAAGAAATAAATATCAGAAAGAGATCTTGATGGCATAAAAAATATACAGTGTAGGTATGAAGCAGCAGTGAGGCAACATGATAAAATCATGTTTGCA
ACTAATTGGTATCGCCTAACTAGATCTCGTCTTTCATTGTGCCCTATCTCTCGCTAAGTGTGCATAGGTTCTAAGAGATTGTAGGTCTTTCTACTGTCCT
CAAAAAAAAAGAGAATGTAGGTCTTTCGGTGTGATTTCATTCCATTTGATTTTAGCTCTACCACCCTTGTAACACCTTTCTCCCCCTATGGACTGATGGA
CTGATGCATATGGGGCTTGACACACGACATAAACAAATCCTCAAGTGACATTCTCTCATTCTATCATCAAATGACTTCATTTTTAATACCGTCTAATCTT
GTATGTTGCAAGTCGGTCTTTCATATGCATTTCCTTCTACCATCCCATTTTAATTCTATTTCACATCTTCATCTATTCCATTCTCTTGGGAAAATGAGCC
TAGGTATCAAAATTCACCTTAAATTCAATCTTTCATGTTGAATAAACTTGCAGTGCATACATTTAGTCTTCTACTTAACCTACAACATATCTGGTTCCAT
TAGTTCTTTCTGCAAAGTTATCTCTTTAATAATAGTTACAAAGATAATTTGCAAACATTAAGATAGAAGTTGTTTTTATGCACATTTCACCATAGACAGC
ATAAATGGTTTCATTAAATTAGTCTTAGGCCTAACTCACACTCGAAAAGTTAGCTGAAAGGAAGGAGGATTGTCCAAGCCTTATAAGGAGTCCACCCATC
TCATTAATCACCAATGTGGGATTTTTGTCATTTTTCAACACCCCACCTCAAGTCCAGTGCTTAGCATCTACTGCATGCCACAAGGACAATTTTTAATTGG
GCCACCCAACCTTGGGCAAGACGGGTCCTGCTCTGATACTATGTTAAATTAGGTCTTAGGCCTAACTCACACCCCAAAAACTAGCTCAAAAGAAAGGAGG
ATTGTCTAAGCCTTATAAGGAATATACTCATTTCATCAATCACCAATGTAGACTTTTGTCATTGTTTAACAAATTCCTTTGGTAAAGATATTTCCTTATA
CCAAGTAAATGAAAAAAGGAGCAAACGAAATGGCAGGAAGATTTTCTATCACCTAGGTGTTACTTACAACTTATGAATAGATACCAAAATACCCGTGAAA
CTTCAAAAAGAGGTCTAATATAGCCTAGTTCACAAGATTATATCAGTGACACTGATGTCTAATAGTTTGAGCATGTTTCACATGCATGAAAGGTGAATAA
ACAAAAAAAACATGTTTTTCACAATGTTTCTTCTTCCCAAGACCCACAGACATCTTTAAATCCAATTCTCTTTCACACTCTGACACCTCATGATTAGACA
TATGACCAACTTTCTCTTGTGCATAGCATTCAAACAATGAGGACCCACGGACAAATATTTTAGTAATAACATGATATGGGAAGTGATGTAATGCAGAATC
AAGCCACGTGCTTGCTGAATTTCTAGGCACACTTTACACATCCAATAGCTCTTTTTATGGGGTTTCATAGTACAATCCCACTCATACACACTCTAAACCT
CCATTAACATGTAACTTTTATGAAAGCAGTCATGAAACAAACAAATCCTAAATTTGATGTTAATAGACTTACAAGATCAAGATCCTCTTTCTCTAAAACT
TCAATATCTGCGATTTGAGATTCGTATCGCCTTCTCAGATATGAGTCAACATCCATTTCCATTTTATCCTGTTGAACAAATGCACAACAATCAGCAAATA
TATAAAATTTGGAAGAAGAAAAACTTTCATTGCTTGGAGTACAAAAGGAATTTAATGGACTGACCTTTGTTGCCACATAAAAATATGGCCTGAATTTGTA
CTTTGCTTTGAATGTTGAACCATCCTTCAACCAGAAGTTCATGCATAAAAACTCACCAAAATTAACATTTTAATACTTTCTCTTACCGAGTCAATAAACA
ACATTCCACTAATAATATCTAACCAATAACTCACATAAATAAACATATCAATATTTCCTCTTACCGGATCAATAAACAACACTTCCACTAAAAATATCCA
ATCAACAACTCATCTAAACTGACATATCCATATTTTCTCTTATCGAATCAACAAACAACAATTCCACTAAGAATATTCAATCAATAACTCACCTAGTTGT
CATTTCGATATTTCTCTTTTTGGATCAATAAACATGTCATTTCTACTAAGAATATCCCATCAATAACTCACGGTAACTAACATGTTGTATCTTTTCAAAT
GAATAAACATACAAACAAAATGACAGCTATATTCCATCAGTATGAACTTTTACCTGACAAACAAAATAAAGATCGACACAACTGTACACTTTGCGAGTCT
CCTGATCCTCCCATGACGACTACAACATTAAACCAAAAAAACTCAAAATTCACATTTTAACTAAAAATTCAAAAAAAAAAGTATAATATGTGATGTAGTA
GTAGTAGTACAGAGGCAAGAGTAAGAAGCCAGCCGAGTCGTTTATCTCCTTCAGTGAAAACATCGAATCCTAGCTTGGATTCGAGCTGTTCTTCGGAGTT
AAGTGTGAGTTTCTGCTTCTTTGAAAACCTAGAGTCCCGCCGGTCCCAGCGCCGGCTATTTTCAGCGGCATTCATACTTCTTTCCGATGGTAACTCCGGC
GAATGAGATCGGAAGTTTGGAGATAAAGTTTAGATTTTTTGATTTCACTGTCTACTAGGGCCTGAAAGAGGGAAAAAATCTTCCACTTTACAGAGGGAGC
TAAGGGGGTAGCGGGGTTTAGAGGGGTGGGGGTACTCTCTTTCCCGCGCTTTTTTTTTTCTATTATTTTCTTTATTACTCCTATTTAAAATGTGAAATGA
CAATGTTGCCATTATTTATTATATTCTCATGTTGCGGAAATGAGTACGTTTCCGATGGATGAGAGGGCATATTAAGGGAGATAGGACGAGAAATAAAGAT
ATTCGAGACAAGATATAGGAGTGACCTCGATGAAGGAAAAATGTAAGAAGCAAAGTTGAGAAGTTTTGGATAAGTGAAGATCAAGAGATGCATGGAATTC
TAATACGGAGATTTGAGAGATTGACTATGATGGTTTTCAGAAATGTAAGAGCAAGTCGAAAGAAATACTAGATAGAGATTATTAGACAAGAGATGACGTG
GTTGCAGCTTAACAATCTTGGATGCGAAATTGTGAAAAATACAGCTTATGGTAAAGGTTAGTAGATAATCGAGTGTTGTCTTGCTTATCTTTCCATGCCG
ATAGTCTAAGCTTTTCTTGTATAGTTTAGTGTCTTTCAATTTCTACTACTATTTATTGTCTCTTGTACTTCGAGTTGTACATTATTTTACTGTAGTTACT
GTTGAGTTAATTTTGTTTTTGAGTTGATTGTTCTAAATTTTTAGCTACGAGTACACATGTTTGAGTGTAACTGTGGACTCAGAGAGCGACTAACTACAAT
GATTTGCACTAGAAGCGAATCGAAATCGTTGTCTAGGTAGTGACTTACCACAACACAGTGTTTGTAATAAGTTATTTACCACTTTATAATTTCAGTCCAA
TATCAATATTGTAGTAATTTTTCCAATAGCTACTGTTCTTTTTTTTTTCTCCATAATTATTATTATGCTTTATAACGTGTTTTCGTGATTTTATCACTTC
CCTTATAATCCTGTGCTCTATTTTAATATATATATTTTTTGAATCAGGGGTCGATCTAAAATAATTTTTCTACCGCTCAAAATAAGATAAGATTTCTATA
TACTTTATCCTCCCATATTTCACTTGTGAAATTACATTATGCTAATAGTTTTATTTAGTGCACTGACTTATATATATATTGATTAATATTATTTTGAACA
GTTACAAAACGTATTAATCTAAGAAGAAAAGAAAAAAATTATACAAATGTCTTAAATGTTGTTGCGTATTCCTTGTGTTATTTTATTGATTTTCAATGTA
AAATATCATCTAATTAAATTAATTTTTGTAATGAATTACATAATCAAATCTCATATTCTCGACTTATTTTATTTTATATTGTTTATGTGCTGATTTTGTT
AGCCTTGAAATGAAAGATATCATTAATATTTTAAATAATTTTAAACTAAACTGCTATATAATTGTGTTTTCTGAACTTTAAATTTTAAACAATCATGTCA
TTCTCATAAATGAGTGTCGTTATACCATTGAAATTCAAATCTTGTAAATGCCCTTTTAAAGAATGATACGTGAACGGAAATAAAGTCATTTTCTTTTAAC
AAGACTACAAAGATTATTTTCATAAAAAAAAAATCATATTATACAGATAGAAAATAACTTTATTAAATTGTGTTTTTCCTCTGATAATAATATATTTTAA
ATAATTGAAAGAAAATACATAGAATCCCTTAAAACTTATTTAGTATTCTCAATTATTACTTGTGATTTTGTGAGAATTTTATGACACCCCCTCCCCCTCT
CAATTATTTTAAAGTGATTTTTTTTTTTAAAGTTACACTTAATATATATGTTACGTACTTATCACATGTCAAACAAGACAAATTAAAAAAAATTACTTCA
TTTGAATTTTGAATTTTAATTGACTTCAACCTAAATAAGTTTTGATGTTAGAAAAAACTTAATTTTTATTCAATTAAACACTCAACATTGTCAAATAATG
TATTTATTTGGTTTCATATATAGTCTAAATTGAAATCAAATTAATATTGATCAATCCTTAAAACAAAATTCATGATTGAATTACTCATAACTCATGAGTT
CAATATGCTTAGCTTTTCATTTAAAGTCCATTTCAATGTCCAAATAATATAAAATTGCATGAAAAAATTTAAGTATAAACTCGAAATCAAGTATTAATTA
TTTTTGTTCAAAATGTGAACAAAATCATTGCTCAAATTCTCAAAATTTAGTTCCCAATTCTAAAATGGTGAAAAATAAAAACAAAATAAACTATTCATAC
TACGCTAATTTTTGGCATGTATCGTAGGTCGTGCAACACACGCTCCTCGCACGCTTAACATGTCGTGCATCAAATTGAATATAAAAATTTTATCAAAACA
ATTGCCGAGGTTATAACCCCAACAAAGTGAGGCACTACGATTTAATTGTGGAGGGTGGTTATAAACCATAGAAAATGGAATAAAATTATTTCTTGAAAAA
GAAATCTCGAAGGTTGAAACCCCCGCTAATTGTTGATTTCAGGGGTTGCTTAAAAACTCCTACTACTTAATTGTGTCAACTCTAACGGTGGAGTTGTTGA
AACTCCTGCAACAACCAATTGTCGGGGTTTCTAAACCTCGCTATTTATAATTCTAACTCTCCCGATTTGCCCCTTTTTTTTTAGTGTATAGATAATAATC
TTTATTTTTTTTTATTATCATTATAGTAAAAAAATAGTCCTTCGAACTGAATTTTACAAGTGATTTTTAAATTTTAAAATATTATGAAATTACATTGTAA
GTATACAAATTTTTTTTCGAAAGGAGAAGAGCGTCAAGCAACTCCAACTCTAGCTCCAGAGGGCTCCGTAGAGTAGGAGAATGCTCAAATCCATCTACGT
GTAATTTATATTCAAGATAATTTCAAAATACAATTCCAAAAAAGCGATATTAGTCAAGTGAATACATGAACGAGCAAATGATAACCAAAAAAAAAACAAA
AAGTATATGGTGTAAACTAAAGAAATAAACCATAACTAAAGGTGCAAAAAAGCAAAATACTCGATATAAGTAATTTAACGGTTGAGATTTAATCTCTACA
TAAGAAAGGGCAAAAAGCCCTAACTATATATTCATAGCATTCACCACTCGTTCGCCTCTTTCTCTGTACATTCGGAAGCAGCAGCAACAGCAGCCCTACG
CCATTAAAGCTTACAAATCTCACACAAAGTAAATTACTTGATTTGATTTGATCTCTTATGGTTTATCTAACAATTCATTTCTGTTGTTTTTTTCTTGTGT
TTGTGTGTAATTATTATTAGTTTTGTGTGTATTTGTAGATAAGAAAATGAAGGTTATCGCTTCTTACTTGTTAGCTGTGTTGGGTGGCAACACCTCCCCA
TCTGCTGCAGATTTGAAGAAGATCCTTGCTTCTGGTATTGTTTTTTTTTTTTTAATTTCTTTGTATATACATTTTTTTTTGTATGTTAGTTTCTGTGTGG
TGGTTTGAAAATGATTCTTATGAATGTGAGTATGAATATGAAATAACCAGCTGCTTAAGGTTACGTATAATAGATCCTTGTAGTCAAGCCCTTTCTCGGA
CCCTATGCATAGAACTTAGTTCATCGGGCTGCCTTGTATTCATAAATTGTTTTCGTTGCGTGTAATTTCACAAGTGGGGTTTGTAGGTAGTAGTGGAAGA
GGATTTATGATTAGAAAACTCATATTTTGTTGAATATTATGGCCTATATAAGATTGGTTAAGGTTTGCGGTACACACCAACTTCCCTAGACCTGACCTGT
GGGATTTTACGTTATGCTGTTGTTTACTGATTTATTGATGTGTATTGATGTATAAGTATCAAATGAATGGTTGTAAGACCAAGATGATTAATTTATCTTT
CCTTGTTTATAGTTTCTTCTATTTTTACTGATTTTGAGCATGACATTTCTGAATGTGGTGCTGTTTTCTTTGTGTTAGTTTATTGTAATGGATCCTTGGA
ACTTTTTGACACATGTGTTTGGTTTATTTTATGGATGTACGGAGAGATGTTTACGTGCCTAATGGAGTAATGCGGGTTATTGTAGTATTAGTTATAGTTT
TCCAAACTGCTATAAAAGAAATTTTGATTCCTGGAAAACGAGAGTAATATTTGAGGAAAGTAATATGAAGCACCTATCTATTAGAGTAGGTTTAGTTTGT
TTTATACTGAGAGGCCTCGCCTTTCTATATTTGATGTACTGTTAATTTTATGTTTAAGTTCTATGTTAACAACACATCCTATAGAATTCCATGAGTGCAG
TCTTGGTAGAGTGGTGTGTGCACAATCTTACCTTGGGAGGGTAGATAGGCCGTTTCTGATGGACTATGTCATATAATTCCTTCCTGAGGTATCCATGCGA
GACTGGATTACTCTATTATGCTTACTTTCCTTGCATAGATAGGATAACCCTGTCGTTGATTTGTATTTCATGGATAAAATAAGCATCATAATACTGTTTA
CTTTCTTTAATTTTGCATTCTCAACTTTTTTTAATGTGTGGTGCAGTTGGAGCTGAAGCTGATGATGATAGGATTGAACTCCTCTTGTCCCAAGTAAAGG
GCAAGGACATCACTGAGCTGATTGCTGCTGGCAGGGAGAAGTTGGCTTCAGTACCCTCTGGTGGCGGTGGTGGAGTTGCAGTAGCTGTATCTGGTGGTGG
TGGTGCTGCAGCACCAGCTGCCGAGGAGAAGAAAGAGGAAAAGAAGGTGGAAGAGAAAGAGGAATCTGATGATGTAAGATTCTCCGTTTAGTTTAGGGGT
CCTCGACTTTTTTCTGTTGTGGATGATGTTTCTTGTATATCTACTAACATGGTTGTCTGGTTTTCAATAATGCAGGACATGGGCTTCAGTCTCTTCGATT
AGAGGAATGTTTAACTGGTTTCTGTATGAATGGTCTTGTTCCCCAGTTCCCGTTGAGTTTATTCTGGGAATCTTTTTGTCAACTTACTGTTTTCGCTTTT
AGTTTAGTTAATGCACCTATATTTTGCTTGGTAAACATCTTGAGTCAATTGGAAATTACTAGTATTGTTGGATTTATTTGCTTCTTTTCTTGTTGATGTA
TTCGTTGTCAGTTCAACTCGTCAAAACCTGCAATTCTCAATTTATAATACCAAGTTAACTTGGAATTTCAATCCAACTGGAAAAAGTCATCTACAACCAA
CAAAATACCTGTGTAATTCCATAAGCTAGGTGTTAACCCTAGAAGCCATTTTCGAAAGTGAGAACTTGCAATACAGACGTGAGAAGTGAAATGAAGCTTA
CTGATAATTTGAATTCATAATAGGGTCTTGTACAGTAACTGCAGCTACAATTCAAATATATGAAGCTAGGACTTAAAAAGATGTCAAAAAGGTCTACACT
TGTTGTAGTTCATTTGAAACCGCGAAAACAACATCTAGGTCTCTAACTCTATAAATTACTGTCCACAACATGAACATTGATAATAAGCTAGGCCGTTCTG
TCTCACTAATGAATCTTGAGTGGAAAACGCTGATCGTACACTCCTTGTGGCAATGAGCTAATCCTAATACCAGATCAGCCAGCAACTCCCATTCACTAAT
ATCCTTTCAACTTGAGTGAAGCAAGTGGAATTCTACTTCCCGGAGGCACGAAAAGTTTCTTAAAACTGAAGGAATCTATGTTGTATAGCAGGTTTTGAGA
AAAGTACCAGAAGTCATAGATTACACAGATACATGTCAGATCAGGGTCCAACGAGGATAGCAATACTTTCCAACGTAAAGTCGTAGTACTCCTTCCAGTT
CTCCAGAATAAAGCAGATGTAAACTATCCAATAAGGAGCATAGCCACAACAAGAACCCATTTAAGACTTTGGAACAGTCACATTCAATATTTTTACATCC
TGGTATGGCTTGTCACCTTTGTCGGTCTTCACTTTCTCTAAAGACTGTAAAAATCCAAAAGAAAAGGAATGGTTAATCAGGTCCCAAGAAGTAACCATGC
ATTAAATATCACATCAGACAAACTGCAGCAATTATCATTTCAATTTGAACTACAACATATTCACCAACTTTCTTCCTTTCTGGATAAATAAATAACTAGA
GATATTGTGCTGATCAGGACAAAGCTCCAAGTGGTCTATTAGTTCAGTAATCAATCCATAGCAGAGACAGGAGGGGGAAACTTTATAAGCTAATAATACC
TGTACAACATCCATTCCTTTCACCACTCTGCCAAAAACTGTGTGCTTATTGTCCAACCATGGAGTGGCAACAGTTGTTATGAAGAATTGAGAGCCATTTG
TGTTTGGCCCAGCATTAGCCATCGAGACAGTGAAGGGTCTATCATGTCGCAGACTGCACAGACCAATATAATCGTTTAGATGAACTTAACCCAGAGCATA
AACTAGAAAACATGTTTATCAGCTATTTAGAAAATCAAGTTAAAATTAGATGTCATGAGGCTGCGTCAGCTGTTATTTAAGGCAATGACTAAGCTATCCA
TTCTCTAGACCCTAGAAAAATCTTCTCGGAGTCTACAAAGCAAGCAAAATGAATCTCCAGAGTCAAGCAAGGAAGAAGACTACAGCACATGCTAAATATT
ATGACGTGTTCCAGAAGTATACTTGTGGCTCCATGAATGGAGTACAAGCTTCTGATTAGATTCAATCAGTCACTTTCATAATCATAAGCATTAGAATTGT
ATGATAATATAAAAAGCACAGAAAAGCAAAAGATACTTTTCATTGGTAGGGAGGAAATCGCTGGGTCATCTAGTTAAATTCATGATATAGCTAAACAGCT
GTTGCCAGGAAGAATTAGCAATTTATTATTTGCAACTGAATTTAAAAATTCAAAACACTGACAAAATCATGGTCATCAGCATATTTAAGACGAGTAAAGG
AAGGCAAGCAAAAGAGATTTCATTTTTGGCTAGTCATTAACTTTTATTTCTAAACTATGCACTGGCAATCTTCTATTGCATATTAGGGGCTGCAAAAGCT
TCAGCAACCTTAAGTACACGGATAAAAAATTACACTGTACTATTACTATGGATCCATTTACTCCATGGATTGAATACTTAATTAGTCTTACCATTTGACT
GGGTTTTTTTATTCCCTTTTACTGCTGCAGACACTTAAAAATGGGCTGATGTTCAAAGAAAAAAAAGGTCGATTGAACCTAAAAACACATTTTACACTCA
AATGGAACAATCTTTTATTATGAGCCTAGACTTCCGGTTCCCACAGTCTACCATCACGTTCAACATTCCAAAAAACTAAATAAGCAGCATCAGTAAAACA
ACGGCCCTTCACACGACACATATCTAGGAAGGAGGGAGCATAGGAAATAAGTTAAGCCTGTACAATTATGCTTTTATGGATATATACAAAACAATACATT
AACATACCTTTTATGGAACTCATCTTCAAACTCCCTTCCCCAAATAGATTGGCCACCCGTGCCATCTCCTAATGGATCTCCTGTCTGAACCATAAAGCCT
CTGATGACCCGATGAAATATCAAATTATCATAGTATCCATTCCTGCAGTGTGTTGTAAAGTTCTCCACTGTTTTTGGACACTCTTCAGGGTATAGCTTCA
TATGAATGTCACCCATACTGGTATGCATGATCTAGGTCAGAGCAAAAGAAAGAAAGAAATGAATCAGCAAATTTCTGTCTATCTCAGGATTAGTACAAAT
ACATAAAAAGGAAGGGCCTCTACCACGCGAAGTAATAATGGAAGAACATACGTTGCTCGGACTCTTAAAAATCCCACCAGGTTCATGTTGGATCCTCCAA
AAGTAATGACTTTTTGGAGGATCTGTCACGGGGGTGGCAACATTTTTGTAGAGTCCGAATAACATAGAAAGAACTATAATCTTTTATGAATACCACAATA
ATGCAGAAAAGTGTCATTCTTCAGTTAAGAAAGGTTGCCCAAGAGCGCATAATAGGTTTGCCCATCGTGTACCAGCTTATGAAGACCATTCTCGAGGTAG
CGGTTTTATAGCATGCTATACTGTTATCTCATTCATTGATTGATCAGGAATCAGAAAACAGAAGTAGAAGAAGGTAAGTCCTTTATTCAGGATTAAGTGA
CTTGATTTAAACGGACCACAAAAATCAATCTTACTTAAAACCTTTGTCAGTCGATACCAATCATTGTCACTCACATACAGTTCGGCTCCTACAAACTCAT
GGACAAGGATATCCAGTTCAAGAGGGGTTTTGGATAGGCTTAAAAGTTGGTCAAACCTACTTCTAAGTCAGTTTTTGACTTCTGCAAATGTTAGTCAAAT
ATAAAAATAATTCAAAATAAGCAAAAAATGATTTAAAGTAAGTTGGGAAGTGTTTGACAAGGTTAAAAATAACTTAAAATAAGTTAAAAACCAAAAGTAG
GCCTTCCCTACTTTTTATTTTGACTTAAAAGCTATTTTTTTTAAGCTAATCCAAAACGGAACCTATCTGAAATTTTCCATTTATTTGATATATGCCAAGT
AAAACCATAACTTACCACATTATCTGGAAGGGATGTAGTAACGGACTTCCCAATGTCAGATACGGCCAAAAGTTCATCAGGAGGTGGCTTTTCATTGAAG
ACATCTCTTCCCTTGGTAGGATCATCAGGTTCCTCAGGTTCTCTCTGACTGTTAAAGAATAAAATCTGAGCTGTTAATAAGCATAAATTTGAAATTTAAA
CAAGAAAATGAGGTTTTATTCAACAGAAGAGATAACAAGAGGGCAAGGGCTGATACTTTATAGAAGTATGGAACATCAATTTAAATCACCCAATGTCGAA
GAAACAGCAGCCAACTGAACTTTCCAATTTTTTCACGGCTCAAGATAGTTATCAGACAACTTTAAAGCTTAATTCTAGTAGAAAAATCGATATTTAAGCA
TCTCTCAAAACAATTCATTTTTCATCATGCACACGTCCTAGTTTGACTAGTTTAGATAAAGCTGTCACCATGTTTCCTTTACCATGCCACTAAGGTCTAG
ACTGAACAGGTCAGTGCAGTGGAAAAGGTCCAAGTTCATCATTGACCAATGGATAGAAAAGCAACAAAGTTCAAGATAGCCTTCTTTTCGTTCTCTGTAC
TATATAGCATATACGATACCTGAACAAATAGATTCTATGTTTCTTGAAAGCACAGCAAAGTAGATTGGGATCTATCAAGGGCTCCTTGCTTTCATTTGCA
TTTGCTGCCGCAGCAGGGATTTTTCTTACTTTTTTACTACTTCTATCACCTTGATACAAAGCAATTCTCAAAAATCTATCATTGCTCTCCACCTTCCCCA
GGATACGAGATACCTTGTTAGTGTGTAGATTTATAATCTGACAATAGAAAAATTAACCCAAAATAAGAAAATGAACATCGAAGTAGCATGAAACTTATAA
TAACTCCAGTAAGGCACATGTACAAGAAACAGAAAATATAAATGCATCTTGACAGTTTACTGGACATTTTCTTACTTTAATTCCTAGGAGAGTTGCATAT
ATAATGAAATTGGAACTTTCATCAAAAACAGCATTAGGTTGTGGTACACATTCTGTTTTCTCAATTTCTTTTTCCACAGCCATTCTTCGTCCAAAGTCAA
TAGCTTCAAGTCGGTATAAAGGAACATCACTCCTCTGGAGATCTTGTGCCACCTAAAAGATGGAAATTTTTCGATTATCACCAAAAATAAAAAGGAACAG
AAGAAGACAAAAACCACATCTGTACATACATAAGTTAATAGATTATTTAAAGGAGTAATTTCTTACCTCAAGAGATTCATCATACACACGTCTTAGTTTA
CCTGTCTTGAACCAAAATATACGAATCCTGCGATCTGGTGAAGTTACCGAGAACTGTTTACCATCAGGGCTTACCTGGATACAAAGAGAAACGGATAAAA
GGTTTTTGAAGACGCTGTCCACTAATTGATAAGAATAAGAAATTGAAACTGCTTATAGCTAACTTGACATGTACTAATGTACATAGTCAAAGAGTAGTAG
TTATTGTTGTTAAGTAAAAGGGTTTAAGTACACATATTTTCCAGCAAAGGTTTTCCTGTAATACCTCTATAGAAGAAACAGCAGTTTTGCATTTCACAAT
TTCAAAGAGATCAGTATCACTCTTCAATCTAAAATTCACCCTGCAGGCAGAACATAATAAGAAAAGCATGAGCGGTGACTATTACAATTAGGAGCAAGAG
ACAAACTCTTGAATATAGCAAAGAAAGTGAGTGGACCTATAAATTAAATAATGTATGCTTATATTCTTAGATCGTATAAGAAAAACCATAACCGGTAGAT
TTAGTACTACTCTATTGAAGTGAATACACACTAAAATAACAACGGATATGGTCTAATAATAGATGCCATATAAGGCCTTTTTTGACAAGGCTATATTTCA
GAATTTAAAATTGATACTCTTCGCCAACCCCAAAAAAACACCATTCCAAAGCAATAAAGGGCAATAGAGAAAAGGGAAACACAAATTCTTGGATTCCATA
CATAGAGATGTAATACAAATATCCAAATGGATCATTCTAAAACTTAGATTGGGGTTTGAGCTCCCTGAAATCAATGATTATTGCCTCCGTTAAGGGACCA
GATACAAGGAAAATTACTTTTAGAACTTGAACACATACAGATTCTCTGGGAACTTAAGTGTGGCAGGACTCCAGTACTCAATGATCCCTTTGTCATCTGC
TGATATCACAGTATCAAAGACATGATTGTATTTCATGACTTTGATGGGGCACAACTGTACCTGATTACAAGGAAACTAAGTTAGCAATTTGATTAGTGTG
ACTGCTGGTAGAAACTTCATATTAACATAACAAAGAAGACCAATGAACTGCACAAACGACATATCAACCTTAGTATTGAGTCAAGTCAATGAGAATACCT
CTTTAGATATTATAGGATCATTTGTACCAGCTCTTGCATCATATATATGCACCAATGAGGAGTTACGATCACTAACGGCAAGTTTAGCCTTGACATCCCC
TTGTTTATATACCCATTCAACACATCCAGGTATGAAGGGAAGACGAATCATGGACATCATGTCATAATTCACTACGTCATATATTTTCAGAGACTTATCA
CTTGAAATTGTACAGCAAAGCATACCATCAATGCTAACCTGCAAAGAAATTTAGGTTAAGTTGCGGATTGTTCTGTTCAAGCATACTGATAATAAACTGG
AATAGGGAATACTGCTTCCAGTGAGCCTTTGGCTACTTACTGCAAGGCCTTCAATTGGTCCAAGATGAGATCTAAAATGTTTTGCAAACTCGATACCAGT
AGGCTTTTTCTTCCAAAATTTCAGGTGACCTGGACAATAAAGAAGAGAATTTGGTGATTTAAGCAAACATCAAGAATTAATATGTCCTCTCTTACCATCA
GTACTCCCACTAATGAAAAAATCTGCTGCTGAAACAGCAACATGAGTAACCACGTCTCGGTGCATGTAACTTTTTTCATACCTGCATCGAATAATACATG
GTTTAGTAAAATTTCCGACATGACCATGTCCAACCTTTCAAAGTTGAGGCGCCATTATCCAATTCAAAGAAAAAGTTGAGTCATTATGATAATTCATCCT
TATTTTCTAACAGTAATTATAATTCATCTCTTTTTAATTAACATTGGGTTTATCGTCACACCCAGCCAAAAGCATTGATTGTCCATGCATGCCACGAGTT
GCCTAAACAGAGCAAGACAACAAAAAGAGGGCTGGAGCATACACAATCCATATTGAACAATGGTCGTGTGACCTGTGGTTACAATTGAAAATCGGGCCAG
GCAGATATGTGCAAGTGTGACATGGAACATATTAGGAGATGTCTCAACATTGAAATGTGCCTAATAAATTGGAAGAAGCACAATAGAGCATGATAAAGTG
AAGTTAAAAACATGCCAAGACCACTAAGCAAACTACATTAATGGACGGAAGTTTTAAGAATGTTCCCAAAGATGGCAAAAGTTCCCATGGATCCTAGAAG
ACTCAAGAACCTCAAAATATCAAAAGGGATCGACAAAGAACAAGCAAAGGATACCAAAGGACAGCCGAAGAAAGCTAGCAATTTGAGGAAGATTCTAGAA
ATACCTAGAAAGACTCGCCCTTGGGTACATTAGGTAGCCCAAAGCCCACCAGATTTAGTGGGGTTTCCACCAACTTTGAAGGATCCAAAGCCTTAGGAGC
CTATAAATAGTAGGAGACCGAAGACTGCACCTTAGTAGGCATGAGCAGCCATTCACATAGACTGACACACGACACATCAAAACCCTTGGTCTAGTATCTT
GTAAACCATTTAATGCATACATCTTCGGTAATCAATAAAAGGGGTATTTCGTTCACTTTCCAAGCTTCTCTCTAGCTTTCCTTAGTGTTTCCAGACACCA
CAACCATTCTACTAAAGCTATCCACCATACTTGAGCTAGGTGACACATCAACACTAGTAAAGGACTAAGTCACGTAACGGACTAGGTTGGTGACATTATG
ATTTTGGTTTCAAATCTCGAATGTCAAAATTCAAAGTATAGCTATCATATTCCTTTGTTGATTTCGTGAACTTCTACAATTTTACATTTGATCTTTTGTG
ATTTCATTTGAGGTTCAATGTATAATATGCCTTGGATTGCTTGTGAATCCACTTTTTCCCTATTTTTTCATTCATTTACTTAGATATAGTATAGCTTTAG
TATGATTTTCTTTCATTTCCAGTCTCTATCCTCATCCTTCATTCCCGTAGTATTAGCACTATTCTTATAAAATATAATAAACCCTAAAAGCATTTTAAAA
ACAACAAACACTGTGAAGTTAAACATATCCATACATAATAGTATTACTACTTACAAGTTAGCAGACGGAAGTGAATCGAGATAAGCTTGCTCAAATTGAA
GAGGACGTTTAGCACGAGCACGAGGAGCTGGACCCGGTCCAATAACCGTTTCGGTTTCCTCCACCACCGCCGCCGCCGGATTTCCGTTCTCATTCTGATC
TGCTTCCTCCATCTCTCCCGTCGCCGTCGCCGGATTTCCAATCTCACTTCCGATTTGCTGCAGAAATTTGCTTTCTAAGTGAGAAGGAAAGTTTTTGTAA
TTTTGAAAAGTGCTGAGCTTATAATGTAAACCAGAAATGAGTCCCCGCCGATTTGACTCAAAACCCGAGGCTCCGAATTGGGGTGCGTTTGACCATGAAA
ATTTAAATTTAAGTTATTATTAAAATTTCGATAAGTAGATTGAAATGAGAAAAAATGAAAATAAATTCTTTCCGTGATTTTTGAATTCTCAAATTTTATA
ATTAGATATGATTTTTTTTTAAGTTTGATCACATAAGAGATGTCTAAGAAGGATAATGTAAACGTAATTTTATGAAATTATGTTTTCGATAGCACTTTAA
CTCGGATAAATTTAATGAACTTTCATTCCATTCGATATCATAACATAAACATTTAATGTGAGTTTCATTTCATTTTCCTGCTTCAATATTGTGTAGTACG
TTAATATTAATTTATTCTTAAATATTTCTCAAATCTAATATTAACAACTAATAATCAAAATACTATATTATAGAACATGCATTTCATAAATGATAAAGAT
TTATCAGTTTAATCTCACTAAACACTTTTAAAAATGTAATTTGATGAATTAAAAAACATATTTTATTTTTAAAATAGTTTTGAAATTGCTTTCAAATAGG
ATTTTTAAATTTTGGCAATGTTCTGAATTTATTTTATGTAAAATTTTAAATATAGTTTTGTTATTAGTGCATTATTTTATACGAATATGCGCTTATTATA
CTGTCATTTGATAGTTGGTTTAGATATGAGTTATATATGTATCTAATTTTTCATAAGTAATGCTATGTTTAGTAGTTGAATAGGATACAAATTATTCAAA
TATAAAATTAATATAATACATTTTTAAAACCCGCTTAACTGATATAACTATAAGTTATGAGATAATTTATTTATTATTTAATACTCATTCCTTTATAAAT
AATTAAATTGTTGGGGTGTTTCTTGAACTCATTGCATAGAAAATTCAAATGAAGGATAAAAAAAAGGAAAGAATATTCTGAAAGTAGTATTGATGATTGA
ACAATTATGTTAATTCGAAATATAAAAAAATATCTCACTAGTTCAATTATTTTGAAACGGAGAGAGTACAAGATAGAATGTGGGATAACTAATACATGCA
TGAGATAATATATAGATCTACCCATGCTTAGGACATGTTTGGATGAGTTTATAAAAAGTAACTTATAAGTTAAAAGTCATAATTAGAGGGTACCCAACGA
CTTTTGACATATTCTAAAACATTTTTAGCCTAAGAGTGAGTGCTCAAAAACACTTTTAACCTTTCTGAACACTTTTTGAAACTTAAAAAAATACTTAAAA
ATAGGCTAGTTCAATCAGACACTTGGTCCTTAATGACCCTTTAGAGATCGATTGGTCGCTTGTTAGACATAAGTTATTCATGTATTAAAACCAACATAAA
TACTCCTAATCTACTACCATGTTTGGTAGCATATTAGCAGTTATATACAAAACTCAACGGATCATGTACGATGGTTGGTTATTGATCTACGATTTCGCTT
TATTAATACATGTATAACTTACAAGGATATATATCGATTATGTAAGGTAAACGAAGAAATAACTAATGCACGTATAACTACTTTCTTGCAATACTAATAC
ATGTATAACTTTAACTAGCAATTAAACGACCCAAAAATATATGTGATGATGACTACAAACTATACATAATAATTTGATTAAATCTTTTTAAATTGATTGA
CTAGAAATGTTAAAATGTCATAAATATACTCTTTGAGTTGGGTATCCAAATTCAATTAAAAGCCCAATTTGTTGCTTTGAAAAGTGCTTAGTTTAGCCCA
GTTAGCTAAAGCCCAACAGTTCTTTTCTAACCATTAGTTGGCCCATAATCCATAGTCATAGTAATTGATCTATATAATTAAGTATAATGAGAATTATTTG
TACAAAGTGTTAGCGAGTTGAGCTTAATTTGAACGCCGTAAAAATAAAAATAAGCTGAGTTAATAAATGAACGAGTTAATGACCCGCTCAAAATTTATTT
GAGCTAAAACAAGTTGGACTAAAATGATTCAAGAAATGAATCTCAATCCACTCTGTCTAATTCTTATTAAGTTTTAATTTCTTTTTTATTTATTTATTTG
TAATTTTTCTCACTACAAACAAATGAATTGAGTAAATAAAAATGGAGTGGAGTGGGGATTGTCTTCCATATAAATCTTTATCACTTGGCTATGATTAAAT
AATATACATTCACATATAAATTTGTGATGTTGTAATTAAAAATTGTTTTATCCAGTATAGTATTTTCATCTAATAATTTTAAGATAAATTTATATAAATT
TCACTAGTTTAAGAGTTAATTATTTAGATACACTTTAATTGGAATATTATGAATCTTATTAGATTCTTGTGTATCAAAAAACGTCAAGATACATGTATAT
TGAGATACATGAGGTCAAAGTACGGTGTAATTTATTCAAGATATACTATACCCAAACGGATGCATGTGATTCACGTGTATCTGAGTTACATAACGAATTT
CACTAGCTTTTCTCTCTATTTTGGTCTATCTAACAGTGGTATCGACGTATATCTTCCTCGTTATATGAGAGGAAACTTTTAATTAGTGATAAAATACGTA
ACATTTTGAAAATATAAACAGTAGTAACATATATTTTACGTAGTGAAATATGTCTAACTATGTAGTTTCCCCTAATTTGAATATTCCTCTGGGTGGTTCT
AAACTTAACAAGTTATTGATTCAATAAAATTTAATTACATTTGTTATTCATATCTATATTTGTGTTAATCTTTTGAATATATATAAATAACTTATCTAGA
ATTTAACAAATACAAAGTATTTATGTCCAGAAATCATAAAATTTGAATTATATTTAAACTAGATAGTTAAGGTTCGTTCACGGACCCAATATAATGAATT
ATCTTTATAATTTTAATTTTTTTAATCAAAATTCACATATTATTTTATCATAGTTTTTAAATTTTTCTAGTTTTTTAAAAAATTACAAAAATTCTCTATC
AAATACATTCTCTCCTCTGTCAGATACATCACTATCTCCTCTCGTATACATACATATTCTCTTTGAATACATCCTCATTCCCTCTTGAATACATCTCTAT
TGTTTCTTGGATACATCTCTTTCCTCTAGGGTACATCCATATTCTCTCTCAAATATAACTCTCTGCTCTCGGAATCATCCGTGAGCTATGTGTCTGCAAA
TTTTCTGAATATCAATGTATAATGACTGATTTATCCGTATGTCTGCTGATAATTTTTTTTTTTTAATTCTAAGAATTTTTTTGTAATTTGAAAAAATAAA
TAGAGATATAATGTAATTAACTCTTAAAACTGTGAAAATTTATGTTATTTTAACTTAATTAATGTGACATATTTTTCTCTTAAGTCAATTTCAAAAGAAT
GATGTATTAATATATTAATAACATTTTGACTTTATAATATACATATTATTTTTAGTAAGAAGCTTTATAGTCATATGAACATCTATGGTTTGTTTTAGAC
CACGAGTTTTAAAAATATTTTTTTTAAATAACTTCATTTTAAGTCAAATAAACATTACATAAATCAAAATGGAGTGAGTACAAACTTTAGTTAATTTTTT
TTTTAAAAAAAAATTATTTTGCTATTTAACAAAATTTAAAATGAAAATGCTAATTCTTTTTCACAATTATATTTTATAGTTTTTTTAATCAATATCTAAT
CGATGATAACTAAAATTTTAATATAAATAAGGTAATAAAGTAACTTAATTCTGAAATTCAAGTATTGATATTAATTGAAAAAATATTTATTTATAAATCG
TAAAGCACTCATAATTTATCATGATTCAAGATTGTAAAAAGTAGAAATCAAGACTAAAAAGTGCAACTCACTATCATATGAAGGGCCATAGTCTAATTTT
TGTGGAAGTATCCTAAGTATATGATATAAAATTCTATGACAAATTAATTTTTGATCCCATATATTTATACTTTTCAAAATTTATCCCGTTAATTGGTTAT
GTATTTTCTTAAACTACAGTTATGCGGTCATTATTTATCAATTCTTACATTATCAACTCTCTATTTTTTTTTTATCTATTTAGAATTGAGCTATTTTTGT
TTTCTTATTTAAGTCACAATTTCTAAAGATAAATAAATATTATTTTGGAGATAACATAAGTTAAATTAAACTATATGAATACTTATGTTTAAAAACATTA
TATATAATTAAAAAAGAAATTACATACATGAAAGATTGTAGGATTACACTGAATATGTTGTAGTAGTAATAATTATATATGAACGATTTTAATTGTCACG
AGTATAAAGTAAAAATATTTTTCACATTACTATTATAATCAAATAAATACAAATTGATTTTAAAAATAAAATAAAATGAGTTTGTGGGCCACACATGAAA
CAAAACTTTTTGTGACTCTTGAAAAGAAAAATTGGATTCTTGTAGAAAACTATTTTGACAATTAATTATAAAATCATAAATTTAGAACTTTGCTCATAAT
AATGTTTAAAATTGCAAAATTATCATTGTTGTCCTACTACTTCACTCTTCTATATAATAGAAATACAAATATATCTCAGGAAAATGACGATAAAATTAGA
TCATGTTTGAGAAAAAAAATAGAAAGAAAAATACGATAATGTTAATTAAAAGTTTCGATAAGATTTTCTTTTTCTTATTTTAAATTTTTAAGGTATATAA
CTGTTGATATGACATATAAGATCCAAAAACGTACAATAGGCCAAAATAATAATAACAAAAGGGCAAAAGACAGAAATCACATACTTTTACGACAAGATTA
CTATTTGTCCCTTATAAGTTTATAATGACAAAATTCCCTCAAATGATACAATAATATAAGCGCTGATATATTAATCTGATGCACGAGATACATTAATTAT
TAAGTAAGATATAATACATCTTATATATATGATACACTAATTTGATGTACATTTTATACATGATACATTAATTTGATGCGTGAGATACGTTAATTTGATG
CGCAGATACATTAATTTGATGTGTGAAAATAAGGGATTTTGGAAATTTGTAAAACTAATAGGAGATAATGATAATAAGAGAGTTTAAAGGTGAGATTTCT
GTCATTTATCCCAAAAAAATTGTTTGAGAAATTTTCATAGCTAATTCAAACAAGAATCAATTCGTTTGTTGAAAATCAAATTTTAGATATTAAAATATTA
AAACCAATCTCTATATTCAATTACTTTTAACTTAATATCAAATCAAACAGAAGTATTAGGTGATTTCGCTTTATTGTTCAAATTTAGATGAATAAAGCTA
TTCAATTCTCTATATTACTATATTGATGGAAGGTAGTCGGCATTGGGATCACAATGACATAACATAGTGTGAAAACTAACAAAATAAGTCTTGAACGATA
ATAAATCGTAAACAAAGAAAATATACGAAAAGAAACATAATCTTTAATAAGATTTGATTAATTAATCTACATAGAGAAAACTAATATAAAATACATAAAA
TTATTGAGAGTATAATCTCCTCTTTAACGAAACTCTTTTAGTGACTATATAAGATGGTATCGTGTGAAAGATATGTCAAAACTAAATTCTGAAAAATAAT
CAAATATGAAAAGGACATTTTTCTATAAAAAAAGAGAAAATAATTATACTGAATGAATTCGAATATTTCTCAAAAACAATTGAAATATATATAAGTTGAT
TCAAACATTATTATTATAGTAAAAATAAAAATATTTGATAACCAAATATCGTAATAAAAAAACATTTAATAACTTTTTTGTATCTTTTAAATTTTGATGG
ATAAAATTATCGATACTTATCCTACTAAGAAAGAATTTGGTGCGGAAACTATTTGAGAGTGGTTGAAAACTCATCCCCTTCTCCAATAATTTTGTCTTAT
TCCTTTTGTAGGAAACAATAACCCCTATGCATGGACCCAACTTGGTTAATTGTAGTAGGTCATTTTTAAATTCTAATTATTCGATTCGATTCAAAATAAA
TATCAAGTTAGTAATAGTAAAAAAAAAATTAAAATTAAAATTGTTTTAAAAATTTCAAACAAAAAATAATAATCGACTTTAACTATATTTAATGGAAATA
TCATACCATATTAATTTTCTCAGCAAATATAAAATAAGTTAAAACGATATTTGTTTCGAAACGAAAAAATCAATTCCTATAGAAGCTATCAAAAGTTATT
GGCCATAATAATTTCTAATCACATTGCTCAAGATTCCAATTAGAAGCTACAAAATTATGTTTTGTTTGTTCTCTAATGAATTCTACAATGATCATAATTA
GTCTAAAAGGAGCTTTATCTCCTTACTTTATTAAGTATTATAATTACACTTTTCTCCATAATTAACTCTTTCTTCATGACAGTCGATATAATTATCATAA
TCATCAGACAAAACCAATTTACCAAATCAAATCAAGAAAGCACATCAACCACCATCAATAAACAAAACTAATCCTACCAAAATAATTGCCACAGTCTAAA
AAATAATAGTAAGTGATTTCTTTCGATCTATCGCGGTATAATAGTGCTCGTAAACTAACATGAACACCAACAACATAAAATGAATGCATAATACAGAACC
ATGGTCTTTAACTTACCGTTAGTTGACAACTATGATTTTTAACTTTAGGTTTGCACAAGTAGGCACTTAAAACTTCCTTTAAAATTGAGCAAATTGACTC
ATTTGTCCTACGTGGATTATACCAGGAAGGACGTGTGTATACTTGTTCAATTTTATAGAAGTTTAAATACCTACTTGTGCGTAATCAAAATTGAAGAACA
TAGTTATCCGCTGAAATCAAGTTATTTATGTATTATGTCTACAAAAAATAACAACACAAACATGAAATAGATGCATCGCGGATGTTATTGTAGAGAACAC
GTCCAACACTCTTGAGTGTGTAGGATGATATTTGAAATTCAATCAGAATAATCTACGGAAAAAAGGTCTAATAAATACCATGATAATTATTTATGTGGAA
AATATTTTTATGTAATTTATGAAATTCACAAGGCACCCACCCATGACTAGCTACTACCCTACAACCTTACAAGATCCTAATAATTAAACAAATCACATGG
AAACATCATGCTTTTCCACAAGGAAAAGAACAAGATTAGCAAAAACATGATGCTGACCCATATTCTTGACCTTCCACCACCCAACCAAATCCTTCACACA
ACCAGGCCCTTTGCTTGTGTAACAATTGTCTACATGTATTTTGTCAGGATCCAATGTTTTAGACAAAGGCATTGACTTATAAAAGATTTAGAAAATGAAC
CTTCCTTTCTTTGTCCACCTATAATAATAGCAATGTACAATAGAGCATTGGCTAGCAAACAACAACAAAAACTAATGTCTTTGTTGTATTCATATAGCCT
CATATTCATATTGGTGGGTCAATATTCATTAAGATCCAACAAAAGTCCACCACAAATCACTTCTTTCTTCTTCTTCCATTCTTTTCTGGTCCAAAATTTT
TGACTTTTTTTGAGTCTTTATTCACACTAGTTAGTAGTAGGATCTGATACGAGTGCAACAATATTTCTGAAGAGTCTGAGGGATATAGGCTAGTAGTATT
CAACTGAGGTATCAGGGCAACTTCCATCAGAGAGAAATTCTTTACTGAATGGAGGAGGAATGAATGGTGGTGAAGTACATCTTAGAAGTGCCCAATTGAC
TCCTTGGAAGAATGGATGGTGTTTGATTGCTGTAGCACCCATAGTTGATCCCATTCTTCGCGCGGGATCCTTAGTAAGGAGTTGTGATATCAGGTCTTTA
ACTGGGGCTGGCATTGATGGTTCCTTAGGGAATTCGAGGGCTCGGGCAACGATGTTAGCTAGGGTTAGTTCATGGTCTATACCTTTAAAAGGTGTTACTC
CATATAGCAACTCAAATATGAATATCCCTAGTGTCCACCAATCTACTGCACTACCATGACCTTCACCTGATACAATCTCTGGTGCCAAATACTCGTGAGT
TCCCACGAAGGACATGGAACGAACATCGACTGGTTCAGCTACAAATTCAGGGCCACCAGCATGTCCTGCCTTCTTCTTTCGCTTTCTTTTCGGGTGGAAG
CATGAAACAGCAGGTACTATACAGTTTGGAAGGATACATGAAGAAGCTGTGAACTTTGGTGGTTCAATTTTGTACTCATTTTGTTGAGGTCCACCATTAG
GTGTATTTTGGCTTGAAATCACTTGAGCTGGTGTTGATGTAGAGGTGTCACATTTTAACGAGAGATCAAAGTCCGTGAGCATGATATGACCATCTGATCG
GACCAAAACATTTTCAGGTTTCAAGTCGCGGTAAACTATTCCCATCATGTGAATGTACTCCAACGCCACCACCACCTCCGACACATAGAACCTGTAGATA
CCATGAGATTAGCAAGTGGTAACATGAGGATTTTCACTAAGGAGATTCGAAATGTAAAAAGTTAAACACAAGAAGATAAGACTAATGGAAGCATCTGAGG
GAACAAAGAAAAGAACCATAGTAAATGAAGCAAGAACTTTATGACTCAAAACTTTTTAACGCCCACTTTTTTATCTAGTATTCGATATTTGTATTGATTC
TGAGACACACGAGAATGATTAAATAGGAAAGTGCTCCCGAGCAAGATTTTTTTCATGCTAAGGTTCGAAACCAAGGAGGATCCAAGACCTCACGGCTGCA
CAAAGAAGTTTGTTTCAACTCTTATCATATGGGGAGGGGGACCAATATGCTTCTTTAAAGATAGCAAAACTACTCTATACTTTAGTTTGTGGAATATATG
CTGGCCCCCCTAATTGTTTCCCCATGCAACGTAGCAAGATTAAAAAAGTAGGTCCTTGAAACATTGTCCCTATATCATGGCGCAACTTTACTGTCCTCTT
CTCCTTTTTGTGCTCTTCGTTTGGTTGCTTTCCACAAGTGCAACATCATTACATTTTGTACTAGATTAATTAAAATGAGAAAAAAAAAAGTTTGTGGGAT
ATCCATAAAAGAAGAAAATACCAAGGATTTTCACAAGTGCTATCTCTGAGAAAGGTTTTCTTCGCATACCTTAACCTTACCTTTATGGGATAGGGAGGGT
TGTTTTTGATAGACACAAGGAAAATAACGATAACAAAATAGGAAGACGAACAAAGTAAATGAATCAAGTATAATAACAGCTGTCCGAATTAACATGAGCA
CAAACATCAACTAATTCCACGAGGTATATGTTATCTCCCACTAGGATAGGATATCGACTATCTAGGTAGACAATGAGCAAATTGAAAAGATAATGCAAGT
ATATTAGAATAAACTCACCCACATATTAGTTGAAAAGTATGGCCTACACAAACAGGGCATATCTTTATATGCAAAATATATCCTTGTACTTTGTAGGCAA
AACAATGAACATGGGAAACAAGAAGGGAAAGACTATGTACCCCCAATAATTCTGATTAGTTCAGTAGGTAGTATTGCATTTTGACAAAGAATTAAATTAT
TATGAGACATTATTTTACGTCTACTATTTTAGGTGTGAATTGTTGATCTTTTGGTTAGTACAAGTTTGACCGACAAAGTTATTTGGTATAATATACTATG
ATCTCATAAGTGGGTCTTGGGAGGATGGGAAGTACGTTGCCCTTATCCTAACCTTTGTGGAGGTAGAAAGATTATTTCTCAGAAGCCCTCAACTTTAAGA
AAAATTGTGTTTAAGAAAAAGAGTAGAAATCATATTGATAACCAAAAAAAAAAGAAAAGGAAGAACTGTAGTGATGATGTTACTCCAGACTATGACCATG
CTCTACCACTGACAAGGGAGAAATTACTCGACTACTTACTAACTATCTAATCGATATAAGGTAACAAATATTCTATATAATTAATTAAAATACGTATAAA
CTGTCTAAACATAATGATTTATAAAAATATAAAAAATTATCTGATTTTTCTTTTTTTTTGTTTCATGTGTCACAAGGGATCGTATAATCAAAAGAGAGGT
CCATCCAAATCATAAAAATCCAAATGTAGGCAGTGAAATGTCAAGTCAAAAAAAGTAATAATCTTGAGAACAGGATTTTCTGCTCAATCAAAAACTACTT
CTAAAGTAAAAGCTAGAGAAATTAAATTTGAATCATTTCTACTAGTTTCCTTCTAGCCATATTATTATTTTTGGTCTAGATAGGTTGTGATTATCTGTAT
AACTTGTGTACCAACATGGCATATTTGTCAATTATAGGAATAGTTTATATATATATACAGGGGCCTCCCATATAGATCAATTTATTGCAATATAATAAGG
GACCACTTTGGTAAAGAATATATATTAATAAGAAAAAAATAGTTTTCAAAATTAAAATTCCAAATTCCTTATATTAAGGAAAAGTTACAAGGCAAGACTA
TTCCCCTTAATTTTGGGAATGATAACTGGAAAAGTATTACATTTTAAAAAGTTTGTTTGACAAATTAACTTTGGACTCAATTACCAAAAATAGAATTTAA
ATATTTGAAGAATTAACTATCTTGATTTCATTAATAAATTTATATAGAATCTTCCAAGACTATCTTTCTTAAGAAAGAAGGTAAAAATCTTTTCGAATTC
GATTCCACATAATATCAACGAAGATTAGTCTAGAGTGATCTTTAATTGAAAATAATTATTTTTGTTAAAAACCTTTTTTTTTAGAAAAATATAATTATTA
CTATTATAATCTAAAATTTAATTAAATCTCAATATAAACACATAAACATCAATCAAAAAACCTAAAATCTACACAACTCAAAACTTTAGTGACTCCATGT
TCATTCTTTTCGAGTGTGATAACAAATAATAATCACAAATTTAATTGATAAATGATAAGAAAGTAAAGTATATAAAGATTTTATCTCTATTTCGTGAAAG
TCTCTAAAAACATATTAGTAACAGAGTGAAGGTAGAGTTTAAAACAGAAAAAAAAATACTCCAAATCAAATATACTTGTAGTGAAATATATCATCAATTA
ATATTTTTCAAATTTAAAAATTTGATTTGAAGTGTTGGTTAATTTCAAAATCATTTTATTTCACTATTTATATTAAAATAAAATAATGAGAATACTATAT
GGTATCCATATAAAAGGCGAGATATTTTATTTATAAATATTCTTATTTATCTCATCGCATATTTATAACTCACTTTGATATTATAAAATTTTAGTATGAA
ATATATTCTTTTAAAAAAAGGACTAGAGAGGTGATTAGCTCCTTCCTTTTTCACATGCACCTCATCAAGTCAACTATTAAAAAAATTAATGAAATATGTA
TTGATTGATTAGTAAATAGTAATATAGCCCACTCCTATCATGATCATTAAAAGCTCTATCACTCCAACTAAACCATAATAAATAAATCCCAAAACAATTA
TAACACACAAGTTCTTTTTTCCTAAAAAATCATTATGCTTTTAAAATTGATTAATTCAAATTCACATTTTTTTTTTTATAATTTATCATAAAAATAATAA
CATTTTTAAAGATTCGAACAACTTAATTTCATATGGCGCGTAAGTTAAACTTTGACTTTTAAGTATAGAAGTCATAATACTAAGCACGTGTGGATCACAA
CTTATAATAATAAATTAGACTAATCATAATTTTCTAATTATCTTTCCTAATTAATTACCATTTTAATCAATGATCCAGTGTGCACAAGTCCACCATAGAT
CCAGTGTGGCCAAAGTGAAAAGAAGAAGAAAATGACACTGACCAACTTAGATGGAACCATAATACTGACAAATTATCAGCTCCAACACCACCTGGTGGAC
CCCACAGGAGCAAAACGATAAAGGTAGGATCGAAAAATTCATTCGAATTTAATCAAAACTTATACATAACTATTTCTTTTGTTTCATTTTTCATGTATTG
CTTTTTTGCATTTTTGAGATTCAAATAAATTTATTCGTAGACTTAAGTCTTTTTATACATTTTGATTAATCAATTATTGTGCTTATTTTAAAAAATTTAA
AAATTTCATACGCAAATACTCGATTAAAGAAAAAAGTATGACATAAAATGGAAAGAGAGAGTAGTATTTTTTTGAATTGGTTAGTGAAAATGTTTAGTTT
TGTCACTATCAACATCAATATCAAAAAAAGTAAATTAGTTATGAACTTTGTAGCTAATTTGATAACACGAATAACAAAATTAGTATTGATTGAAGTTGAT
GTGTATAGTTCATATGTACTATGAGAGTAGAGAATAGTGTACCTGACAGCGGATTCATGGAAGCGTTTCGCCGGTTTGACGTTGCCGGAGTACGTGTAAA
TCACCGCCGGGGCAAAACTCCGTTAATAAACACGACCATTTCGGTGAATCAATAGAAGCATAAAGCGTGGGAAGGAAAGGATGATCTAACATTTCAAGTA
TTTCCCGTTCAGTCCTCGCTCTTCCTTCCTTATTACGGCTCGCAAGTTCCTTCTTATCCATAACTTTCGCTGCAAAGTACGCCGATACCGCCGTCGATTT
CGAAATCTCCGTTACCGGAGCAGCTTTGATTTCCGCGAGAAAAACGGAACCTATATCGCCGGATCCTAATCGATGGAGAAATCGGAGATCAGTTAGAGAA
ATTGCCGACGAAGTAGAAGTTGAAATACCCCGTGTAATGGCGTCCCAGTAAGGATCACCGGAAGGAGTAGCGGCGCGTGGCTTAGTGATATGGTGGTGAA
GAGAGCTGGATGAGATAGAAGAAGCCGTAGCCGTCCATGTGGCTTCGGAGCCGGAGCTAGTCGACCGGTTAATATCAGTTGCGGTAGTGGTAGTAGAGTT
GAAGCTGATGCTTTGAAGATCGTCGACTAAGTCGTCGAGCCATGGCTCCATTTTTGGCTCGAGTTTTTTTCTTTTGGGAGAAGAAGAAAAAAAAATGTGA
GTGAATAAAGAGACGTAAAGAGCTTTTTTAAGGTGAAATTTTTATTTTTCTCGGGGAGAGAAATTCGCTTTGGGCCGTGAAAAAAGGTAGAATTGGGCCA
CGTAAAGTCCGTTGTTTGTGTAGTAGATTTTGGGTACCATTGGGCCCATAAAATATTTTCTTATTCTCGACACGCGATATGAAGTCGTGATTTCGAGTCA
GTATTTGAATGTTACGACTTGGAATCATGATAAATCTCATGTTATTTTCTTCTAAATGATTTAGGATTCTAAATCAATGTGGCGACTTAGTTCTTTGTGT
TCGTAGAACTCTGATCGCGTTCATAGAGAAGGATTGCTCTAGATATTTGTGTACGTGAGAGCTATAACGTGTTTGTGAAGAAGGATTGCTCTTGAACGTA
GCGTTCGTCTTATAATGGATGAATAAAGTTGTGCTTGCGATTTTTTTTTTCGTTTCGTAAGGCATAATAACTTGTGTCTTACGAATTTTATTTGCCTAAT
AAAATTTTTTGTTTTCTAAAGATAATTTTGGCCACTTTCTTATTAATCAAAGTGCTGAAGACTAAAAGGACAAAAATTAAAGATTATTAATTTAAGAGGC
AAAAATTAAAAGCCAAAATAAGAACATTATTTATGAGGAAGAAAATTAATTATCATTCGTATTTTATTTCGCATAAACTAATATTTAAATTTATACATAA
TTTTTATATAGAGAGAGACAACATAAGAATAACCAATTACAACATGACTAAAGCTATGTGGTGTATCAAATAAACAACCAAATATTATATTGTCAATGCT
AAATTTCATCACGTCTTAAGTACGAAATAAAACTTTTTAGTATAACAATTATTTTATATAATTTCTCATTTAGTATTCGCTATCCAGATTGAAATTCGAC
TATTTCAGATTCACGTCGTATAGGATCTCAGTTTTTTTCATTTGCAGAGTTCAAACACGAGACCACTAATTAAGAAAACAAAAAAAAATCTCTATTATTA
AATAAACTTACGGTATTTTAAAATTATGAATTTGTAAATTGTAGTGTTTGCTATTTATTGCAATTTTATAATTTTCCTCATATTTACTAATTTTCATGCT
AAAGCTCAATCCATTGTTGGTGTGTTTTTGGTTATCACGTACTTATAGTTGAATCAGAAGCGTATTTATATTTATGAATATATGTAATTTAACAATGTTT
CCTCATACTTTATATTTTATTCAAAAGATTTACTAAATATTTCATCGTAAATTTTATATTTATTTTAATTGCGATCTTGATTTGTCGTGCTCTTATTCAA
ACATCAAATTATTCAAATCAAAGGAGAAAATATTAAATGAGAAAACGATAGTAAGAAAAAGTTAAAGAATAGGGGAATAAATTCGAAAATGACTATGATG
GAGAACAATTTATTAGCCCCTTAGTTTGAATTTTGAAATTGTTACATTTATGGTTGTTCGAGGAATAAAATAAAATAAAATTAAAAGTTTGGAGATGTTG
GTTAAATTATTTTTTGGTAGTAATAATTGTGTGTATTCAACGTTACATCAAACAAGCAAATTTATTATAATATGTGTTTTGATATGAGTGATGCTTAAAA
TAAATAGCAATATTTGAAGGTAAAGTTGAAAAATTGGTTATTAAAAATTAAAGTTGTGATTGGATATACGTGAACTCACTAAAAATTGGTGGCTTAAAAT
CAATTTTAATGGAGTCTTTTATTTTTTCTGCTCAATATGTTTCAAAAGAAAAAATAATCTATAAATTTATGGGAAAATTACGCGGTTAAATAAATTTATA
CTACTTAATTATTCATCATAGTTATAGTTTACTATAATTACTATTAACGACTAACATTATACATTAATTATGTGGGCTGACTTCGAGTTTTTATTATTAA
CCACATTTATATATGTATAATTCGCCTAAATATACAAATACATATGTATATTATACAATTATATAATCAATATATATATATACAATTCACCTCTCTCCCA
CTCTCTGCTTCTCTCGCTCCCCTCTTTCCTCCCTCTCCCAATCTCGCTCGTCTCTTCCCTCTCTCTCTCTCTCTCTCACTTGTTTATACAAATGCATAGG
TAGAATATAAAATTATCTAACCTATATACAAATACAATTAAGCTCTCTCCCACTCTCTGCCCTCTCCGGCTTGCCTCTCTCCCAATATCGTAACCTCTCT
CTCCTTCTCTCCCAATCTGGCTCGCCTCTCTCCTTTCTCTCCCAATCTCGCTTGCTTTTTATACAAATACATGTGTATAATATACAATTATCTAACCAAT
ATACATATACAATTCACCTCTCTCCCACATTTTGCCCCCTCTCTTTGGCCTCTCTCTCCCAGTCTCGCTCGACTCTCTCCTCCCTATAATATGTAGCTAC
GAATTGTAATTATCAACCTATAGCTATGGAGAGTAATTAGGCTATTTTTTAATGGCTGTATGTGAAAGTTCCCTTGAATGTATTATAGATTCATTCTTCT
TTAATTAGAGTTGTTGGTTCGAGTCTTATAATAAAATATATATTGTGTTAGAAAATATAGTTGCTCTCACAAAGATTAAACATTAGATGAAACTATAAAT
CCCTCAATTTAGAAGCTTGATTATCCCTCTAATCAACTTTGTGGACACGCAATTTACTTGAATTTTTTTTCCTTAAAAAAAAATAACTTTTAAAAGTTAA
CCAAAATAAATAAATTTGTAATATATAGCCAAACTATATTTTGAAAAAAGAATAATATAAACCAAATAAGTCGGTGAAATATTTTCATATTTATTCAATC
TTTGTCCTACTCCATATTTGTAATTATGTCCCACAAATTTATAACAATAGAAAAAATGTAGGTCAAATGGATCGAACGGATAATTATGCATTTATGCTTC
ATGATTTAGCTTGTTAAAAATCAGTATTTTAAATATATTAAAATATTAGTCAATCAGTAAGTTATTGATTGACTTAAATATCGAATTAGAAATTATTAGA
CAGTGCATTGACTCAATCATTTCAATAGTCATTTCATGCTCTACTTAAGTTGATTTATGGTAAATCACGTTGAGAAATATAAGAAAATTCAAATTTTGAC
AATAATTTTTAATGGATTAACGTCTCATTCAATAAGAAAATTAAGTAATTCACTTCCGCATCAATATATCTTTAATTTTAAAAAGTTAATCTGTTCACCA
ACAATTAATTCGATCATCCAATATCAATAATCAATAAATTGATTTTATAAATGACTTATCGATAACGATTCAATTTTGTTAATTCCTAACAAAATACTCA
TCTATCTAGTATATATTTTATATATTAAACAAGAAATTCTACCTTGCCTCCTAAAGTTATATCAAATTCACAATAATAGCCTATACCAATAATAGAGGAC
CACAACTATAAATTTAATTAATGAGTATTACTTATTATTCATATTAAAAGTTTGTATAAATAGTGATCATGTACACCTTATTTTTTCAGCCTGTATTGTT
TTCCAACCACCAGTAATTATTTGTTCATCTATATTAATTAATTCAAAGAAGTTACTTTTTTTGGGACATTGAAAAATACATTATCATATTACTTACTTCA
AAGTTTAGGGGACAAATTAAAAGTTGACATAAATATACTAGTACTAGAGTCTAGAATTTAAAATCTAAAGTATTTATTATTTTTCGATTTTCAACCAATG
TTCGGAGTTCATATTGGAGCTCCAATCAAATTCGGTGCGCGCTCTGTAGGGCCCATTTGGGGGTGACGCTTCCAACAAGTTTTTCTTCATATCCAAAGCT
CGAGCTACATACCTTTGGTTAAGAGTGAAAACACTCCCACCAATACACCACAACCCATGTTGATAAACCTAAGTATCTATATTATTACTCATATGAGCCA
AAAGAAGACGCAAATGTAAGATTGACTTGATAGATTCAACTCAACCTAATATTTTTGAAAAGAAATACTATGTATTAGTACTCAATAAATTATTTATTTA
AAATTGTATGTACATGTCAATACTCCTAAAACACATATGATGATTGCATATTTAAAATAGGCTTCTAAAAAAAACCAATCATATTATTTAGGGCAAATGA
CAGAAATCACATACTTTTAAAGTAAAATTATCATTTGTTCCTTATAAGTTTATAGTTATAAAAATCTCTAAAACTGATACAATAATATAAGCACTGATAC
ATTAATTTGATGCACGAGATACATTAATCGTTAAGTAAGATACACTACATTTTATACATGATACACTAATATGATTACATTTTATACATGTTACACTAAT
TTTATGCGCGAGATACATTAATTTGATGCGCGAGATACATTAATTTGATGCACGAGATACATTAATTTTATGCACGAAATACATTAAAATGATGCGTGAA
AATGAGAAATTTTGGGGATTTATAAAATTATTAGAGCAAAATGGTGATAAAATAATTTAAATGTGAAATTTCTGTTAGTTTCCCTATTATTTATATCATC
TATTTACTAAGCAAGATAATGCAAAAACACATAAAAGAATCTTAATATAAGATTTGGGCTATTTATTTGACTTGAGAAAAAGAGTGGTCAAGCCCAGATA
GAAATTGATTCGTGGCCAAGCCCAAATAAGCTTTCAAAACAACAAGTCGTTATCAAAAAATGAAACTTACGTAAATATATTATAATAAAAAAGTATTTAT
CATTTATAGTAATAATATTTTTTTTACTTGACCACTTTTAATTCATTTATAATATAAGTTTAATTATAAAGAACAATTTATTATTCACATATAATACAAG
TTTTAATGATGGATAATACATTCATCACACATTTTAATACACTTATAATATAATGTGACAAATTTTTTACCAAACAAACATAATATATTTCAAAAACAAT
TATAATTCGAATACATTGCATACATAATTCACCTTTATTACATATTACAGATATATCACAATATTACTATAAATGATAATAAACAAAAAATATCGCTAAA
ATTAATAATTATTTTTTAAAATGTATTAATTTATGTAATTTTTCAGTCAAAAAATTGGAACTGAGCCTAAATAGATAGGGATGACAATGCGTTGAGACCG
TGTTTGACATATGTTGGGAAAAGTGTTTTTTCTTAAATATATATGGATGTGAATCGATCAAAAGTTGAAATTAATTTTTTTAAGATTGAAGCGGATGCGG
TTTTTCATTTTTAGTGTCTCTCTTGATCAATCAAAAGTATAAGCATACATTTTAGTTAGCAATTTATAATTTGAGCTCGATATATCTCATTTCTATACAT
TATATCTCAATTTTAAATACACCACTCAATATTTAAATACAACACGTTCAATTTCGAATACATTCCTCAATATCTTGATGGATCACGTAAAGTGATATAT
CTGATCGATATATCGTGTAAAATAATTTATCTGAGAATAAGAGAGAAAAGGTTTTTATATTTAGTAAATTTTAAAAAATATAATCAAATAAGTTGCATAT
TAAATAATATTTCCTTATTATAGATAAAGATATTGTTATAAAGAAGTAAAATATAATATTTTTTTAGAAAATTATGATTATCACGATGAAATGTTATTAT
AACGATGAATGTAGTTTGATTTGTCATTAAGTGGAGTAATTCATTTTGTTCGAGTAAATATTTCTTCATTTTTCATTAAAAGTTTTAGTTTGAGTATTTT
TAGATATATAAAATCGTCTTTATTAAAAATTATTTATGTTAAATATTTTTTTTTTTTTTTTTTAGGTGAATTCGAGTTTAATCGAACTTTCGAAAATGAG
AAAAAAGGATGTGAACACCGACTCATTGTTTCTCTTGTCCGCCATTTTTGAGCTCTTCAATACGAAAACAAAAAAAAAGCAAAAAAATAGAGTGTCACTT
CTCGTGAAATTCCCCCCAAAAATTCAACTCTTTCTTCATTCAATTTCACTCTTCTTTTCTCGTGATCTTCAAAGTTATTGTATTAATCTCTTCCCTGTTT
TCGTTATTTTCAATTTTGTTCTTGTATCCACTTCAATTTTCTCTATTTTATACGCAATTACAGTTCAAAAAACCTTACTTGTTTCCATTTTAATGGAGTT
TTGACCTTTTGATCATCTTTTTTTTCAGGTTTCTACTTCTACACTCTCTCTCTCTCTGTATCCCTTTTATGACACAGCTGCATCTTTTTCTTCATTCAAT
TTCGCCCCTCTTTCTCCTGTGCAAAGTTTTTTTTTTTTTTTTTTTTGTAATAATCATTTGTGGGTTTTCGTTATTTTTCATTTTTATCAACTTTATCTTT
GTGGGTTTTCATTATTTTTCATTTTTTTCAACTTTATCTTTGTGGGTTTTCGTGTTTTTCTTTTAAAAAATCAACTTTTTCCTTGTACCCACTTCAATTT
TTTCTTTTTTATACGCTTATATTGTTGAAGGAGCCTTACTTGTTTCCATTTCAATGGAGTTTTGAGTTCTTGATACTTTTTCAGGTTTTTGCTTTCTACC
TCATATAAATCTTTTCTCATTCAGTTTTACTCCTCTTTCTCATGTGTGGGTTTTCGTGATTGTCAAAAAAGTTCAACTTTGTACTTGTATCCACTTCATC
TTTCTCTCTTTTGTATTCATATAGAGTTCAAAGAGCCCTGTTTGTTTTCATTTAAATGAAGTTTTGAGCGCTTTCTTCAATTCTGATCATTTTTTTCCAG
GTTGCTGCTTATGGTGGATAATAACAAGTTTAGGTTGTTTTTTCCTTCTTTTTAAAAATATTACAAGAAGCTGCAAATTTGTCCTGTTGTATTGGATTTT
TTTGATCTCGTCTGCTTTTTGTTAATTGCTGATTAAGTTTTTTTGGTGATGCCATGGGAGATCTATAGATTACTGAAGACATGGCCTTAGATAGGAAGTT
ATTTTGGTCGCAGATTAGGGTAATAGATTAGTAGGTAGTTGAGCGTCATCTCGTTGTTCCAGTGGATAGGTTTTTCCTTTCATACATGTTGTCCAGCATT
AGTAAGATCTGAACTAACTACTTTATCAACATTAATTTGCTTTTAAGTTGTGAAGACCTGGCTGTTCATGCTCTAAAAGATGAACCATGCTAGACAAGGT
TAATTATATATGTATTCTACAGACTTGCAATTCCAGGGAACTGCATGATGCTTTTATTCAGCTTGTTAATGCAGTCACAATAGCAATAATAATGGCGAGA
AATAACTTAAGGCAATCAATAATATTGACGCTTACAATGTTTTAACTTGTCCGATTAATATCTACAGTATATCTGACATTCGCTGCTTGTATCAGGCGTT
GAATGCTGGAAACAAGAAGCAAGAAGCAAGTACCCAGTATGGTCGCTCTTGTTCATCGTTGGAGTTAAACATGATTACTCTCCATTTTGGGGAGTTTCTG
ATGTACTGTTTGATTTGTGTTTTTCTTCCTCTTCATATTGCTTTGTTGGAAATGGGTTAGAGAGTTACTGGCGTTAAACTTTGTTTTTCTCAGTCTTATA
TATATATATTTAGTAATAATGGCTAGGTTGCCTGGTAGTAGTGAGATTACAGAGTTACTAGATGATCCTGCATCTAAACTGAATGAAGGTGCACAAAAAC
ATCATAACGTAAAGCATATACAGAAGTATTGTATTGAAGATGATATTAATAAACTGTTTGAGGCAATAGAGATTAGGCCTTCCAGTAGGGGTGTCAAAGA
TGTGACGAGTAAACGTGCGATGAAAAGGCCAATGAGATTTAGCACCTCTCGTGCATCAGGCATAGGAATTTCTGAACCTGTAAGTTTGAAGCAGGCCTTG
AGAGGGTTATGCATCTCTCAGGCATCAGAGCTGGCTGCTGTTAAGAAGCAATTGCCAAAAGCGTCCAGGTTGTCTACAGTCTCAGAAACAGGAGCTGTGA
AGAGACTGTACAGTGCTGTCATAGTTGAGGCCAATGATCCTGAACATAATGATGATGGAGGTATACAGAATTTGGTGGAGATATCCCTCGTTCCGGAGAA
GAGTATGGTGGATTCTTTGCATAAGAGTCCTGAAAATGTTCCAGTGCAAGAACAATTCACTTGTGAAGATGCATTGAAACATAAGGCAAGTGAAATAGCA
GCAGAAAGTGATGCCCTTTGTCAGTCAACTGATGGTTATGAGTACTTGAAAGAAGTGTCTGGCCAGAAGACGACATTGGAGTTGCCACATTCTTCAACTG
GAAATTGTACTGATAAAGTGGAACTAGTTCGAGATCAGATGGTGCCTTCTGTAAATGAAGCTCCAGCAGCTGCAATGGTAGCAGACAGGGAGTACGAGCA
AGATTTAAATTTTGTCTCTTGCTCCTCGTTTTTTGGTGCTGGAAATACAGTCACTAATCCTACGTCTAACAGTCCAAGTCTGATAAAACCAGTTTTTAGA
AGCAAAACCTTTTTTAAGAAGAAAGTTTTATCTTCTTTCACCAGCCGTCCGAAGCATTCTAATGGTGGAACTGATAGTGATTTGTCTTGTAGCACAAGTG
AGTTTCCTCGTCAGACACCTGAATGTGCTCAGAGGAACAATCAGAAAGAAGAGGTAGAAGTTAGTTCATCTTCTCTGAATTCTGGTTTCGCCAAACTAGG
TCTGAGCTCAAACAACTGTAACAAAGCAAGAAGTATACTAACACAGTCTGATGAAAAATCAAGGTCAAAGGAAAAGGGGCAGATGTCTCAAAGTTCGAAG
AGTAGTATTGGGGATTATAGCAGCACCACAAGCCTTAGTGATGAAAGCTATCTCAGTGGGTCTAGTCGCAGTGGTTACCGGCCACATATGTCAAAAGATT
TGAGATGGGAAGCTATTGTTTGTGTTCAAAAGCAGCATGGAAATATTGGCTTTAGGCATTTTAAACTGCTCAGAAAACTTGGAGGTGGGGATATTGGGAA
TGTTTATCTGTCTGAGCTAATGGGCACAAACTGTCTGTTTGCTGTGAAAGTCATGGATAACTACTTCCTGACCAGCAAGAGGAAGATGACGAGAGCTCAG
ACTGAAATAGAAATTCTTCAAATGCTCGATCATCCGTTTCTCCCAACTCTCTTTACCCATTTTACCAATGACAAATACTCGTGTTTAGTGATGGAATATT
GTCCAGGTGGTGATCTGCATGTACTGCGACAAAAACAACCAAGCAAGAGTTTCTCTGAACAAGCTGCCAGGTAATTTTTCCTAAATAGTGTACTTATCTT
TGAAATTATTTCTTTTTTCCCAATTCTCAATATGCATTTAAAAAACAAAGGTAAATAAATAAGCGATGAAATAAAGAACATGTTGGAGCCAATATGTTGT
GAAAATGTCTATGTTCACAGCCCAAAGGAATCTCATCCATGTACCAAAATTACTTATACTGATAATTTACTGATAAATGATAGCTTGAACTTTGCTGTCA
CAATTATTTTTATTAAATAGATAAGAACTCCAGATGTGTTAATGTGCTGTTCTAACTCATGTTTATAAGCTAGCACAGGCAAGAAAGTAAGACAAAATTG
GAAACTTACCTATTTTCTTTGTTTTTGAAGAGGTTGAAAACTTCTAATAGTTGTTTCTCCTTGAAATTGTTTTTTTATGGAAAAAAAATCATCTTTACTG
CTTTTATAAAATAATGTGCCAATCAAAATATCAAAGTAGTTAGTTTGCGTTACAGCTATTTGCTTTTTCTGCTATTTAATGAAGATATTATTCCCAATAA
TTTGGATCTTCAAACAAATTGTGACTTTGTAAGGGAGGTTAATGAAAATACTAAGTTCGAAAGAGGGAGTTTCTGCATCTTTAAAATTTGAAGGGTCAGC
GTGGCAGTATTCAGAAGCCTCCATGTTCCAACATTATCTGCTCCTTCCCTTAATATTTTCACTTTTGTATCTTTACCTTTTTGGCTTTTCCATGTTTCTT
CCTTGAGCATTGATCTTCTGTGTTTGGCAGAACTCTGAATTTCTGGTAAATGCTGCTTTCAGTAGAAGACGATATCTAGAGATTGCTAAATGACAGCTAA
TGACAGGACGGCTGTGTACTAACAGTTGATTCAGTTCAACGTTAAGAGGGGGGAGGATGAAAATGTAGGAAAACAAATGCTGAAGCAGTGTAGTGAATAA
ATGGAAGTAATGTAAATGAGCTTCCATTTCAGTTGCATCCCTTCTTACAACATTATATAAGGAGACTTTTCTGGTTAATTAATTTGTGGGGGGGGGGGGG
GGGGGGGAATGAGTTGGGATTTGCAACCTTTTTTCGGATTGTTTCATCTCTTCAGATATTATGATTCCTTGATTTTGTTTCACATTTTAAGACGAGATAT
TCAAAATTAGTCTAAATATTTTAACCTATGGATGTTTTTTTTTGACTTTTTGTGCAGATTTTATGTTGCTGAAGTTCTTCTTGCATTGGAATATCTTCAC
TTGCTTGGAGTTGTCTACCGAGACTTAAAACCTGAGAATGTGTTGGTCCGAGAAGACGGTCATATCATGCTGTCTGATTTTGATTTATCTCTTAGGTGTG
CTGTTAATCCTACCTTGGTGAAATCGTCTTCTCCCATCATTGAGCTTCCAAAAAAGTCTAGTCCGTGCTCAGCTAGCTGCATAGATCCCTTCTGCCTACA
TCCGTCGTGGCAAGTATCTTGCTTTGGCCCCAGGTTTCTATCTACAGAAGCAAAGACACGTAAAATAAAGGCTGACCTAGCTGCACAAGTCTCACCTTTA
ACACAGCTTGTTGTGGAGCCAACCAACGCTCGATCCAACTCATTTGTAGGAACCCACGAGTATCTAGCTCCGGAGATTATCAAAGGGGAAGGTCATGGCA
GTGCTGTAGATTGGTGGACCTTGGGTATCTTTCTGTACGAGCTTTTATACGGAAGGACTCCTTTCAAAGGGCCAGGAAATGAGGATACACTAGCCAATGT
GGTTTCTCAGTGCCTCAAGTTTCCAGCTAGTCCTACAGTTAGCTCTCATGCAAGAGACTTAATCAGAAGGTTGTTACAGAAGGAACCCGAGAACAGGTTA
GGAGCTATGAGAGGGGCAGCAGAGATAAAGCAGCATCCATTCTTCGAGGGACTGAACTGGGCGTTAATTCGATGCTCAACACCTCCAGAAATGCCTAGAT
CCTATGACTTGACAAATGTCGTTGTCCCTGATGCCAACCGACTAAATAAGGAACGCGACAAGTGTCAAAATGAGTTGAAAAACATAGGAGAGGACATGGA
GTTTCACATGTTTTAGATTACAGTAGTCTGAAGGTATGAGAAAGGAGAGTTTGGTTTTACATTTTACACATTGTGTCTGATCTATGTAACTAATAGGCAG
TAGTGTAACATATATATATAGTGTACATGTTCTACAAAGTGCAACACATGAAGAACATATATGTAATCATGTTTCATAAAATTGTTGACTCTGCTATTAT
GTATCAAAGTGATATTTTCTGATGTCCAATTGGAATAGAAAAAGCTCATCTACAAGCTTTAGTGGGCAAACTTATCATTTAACTAGTAACCGTGTTGGTT
GGAGGTAATAGATTTTCGTAGAATCAGTTGAGATATTTACGAATCAATTGAGATATACACAAGTTGGTCTGAATGCTATGATTCAGATATGTAATGTAAA
ATAAATTATATTCGATTTGATATCAACTCCAAATTAATTCTACAAATTTTATCTTCAAAAAATCATATTTTGATTGCGCTTTCACTATATTAATTGTACT
TTAAATTTTTTAACATAATTATATAGAAAAAATAGAAAAAGAAAATTTGAATTGCAAAGTGACTCCAAGAATTAATCAAATTTTTCTATTTGGTCATTAG
TCAAACAACAATCAACCTTATACCTCTGCATTATAATTTTTCTTTCATCCAAATATTAGTTTGAATAAGATTTTCTGTTCATAAATGTGTTCTTTCCCCT
CCCCAAATTACTAAATGACAAAATATTAAGATCACACTTATGATATATGATACAATATTTTTTAAAAACGAAATATAGTTATATTTAGGGTGTTATACAA
ATACAAAACACATTATATTATATCAAGTATTTTTGGTTGATACAAGTCTAATATAATTAATATCTGTTGCACGAATATAATTCCGTCACCTAAAAATGAT
GATGCAATTTTTTTACACATATTTAGCTAATATGATACTATATAATATATGTTTGATACATATATACGTCACCTGAATATAATATCTCTTTAATGATTGA
TACGATTGATACCTACGTAATACAACTTTTTTGCTTAATACATAAACTATGATTATATCTATGTTTCATAATTATGATGTAAATTATATGACATTTTATC
ATTTTGGCCTTTTGAAATGATTTCTCATTTCTCAAATATCTTTTCTAGCTTTATTGTTGCATTACCAGAACCAACCACCATTGAAGTTTTGAGTGATGAG
GTCCTTACTCTTTAGTACAGTGACAATTCTAGCCCCTTCAAAATTACCAAACTGCCATCATTCTCACTATGCTGCTCCTCACTCTCTCAAATTCCCATTT
CTCACTTCTCTTCTTCCTACTAAATCCCCATTTCTTCTTAAAGAAAGCTATAAAAGTGTAAAAATCAAAGCTTTAATGGAATCAGGAATGGACTCAAGTA
CAAAACCTTTTTCTGTTCTCTTTGTGTGTCTTGGAAACATATGCAGAAGTCCAGCTGCTGAAGGTGTTTTTACAGATTTGGTTAAGAAAAGGGGGCTTGA
TTCAAAGTTTAAGATTGATTCTGCTGGTACTATTAATTATCATGAGGTATTTTCAATTGGGGGTCTGTAAAATTTGTAGTTTATGATTGATTCTGTTGGT
AGTATTGATTATCATGAGGTATTTTCACTTGGGGGTCTGTAAAATTTGTAACTTTTTGATTGATTCTGCTGGTAGCATTGATTATCATGAGGTATTTCCA
TTTGGGTGTCTGTAAAATTTGTATTCAAGATTGGTGCTGTTGGTAGTATTGATTATCATGAGGTATTCTCACTTGGGGGTCTGTAAAATTTGTAGTTTAT
GATTGATTCTGCTGGTAGTATTGATTATCATGAGGTATTTTCACTTGGGGGGCCTGTAAAATTTGTAGTTTATGATTGATTCTGCTGGTAGTATTGATTA
TCATGAGGTATTTCCACTAGGGGGTCTGTAAAATTTGTAGTTTATGATTGATTCTGTTGGTAATATTGATTATCATGAGGTATTTTCATTTGAGTTCTGT
AAAATTTGTTAGTTATGATTGATTCTGCTGGTATTTTTAATTATCATGATGTATTTTCAATGATAATTAAATGTAATTTTTTATGGTTTTGAATATTTCT
TGGAGTTGATCATGTTATAATGTTGCTTTTGTTTTTGTTTGTCTTAAAGGGAAATGAAGCTGATCCAAGAATGAGGGCTGCTGCTAAAAGGCGTGGAATT
GCGATAACGTCTATATCTAGGCCAATTAGGGCTTCTGATTTCAAAGATTTTGATCTCATTCTTGCTATGGATGAGCAAAACAAATGTGGGTTATTGCAAA
ATCCCGTGTCATATTCTGGGTTATGTTTTTTTAGCTTTTCTTTTTATTAGGCCCATTTCATTTTTTATAACCGTGGTGTCGTGTCAGTTTGTGCATACCC
GGACTAATTCCATAGGTACCTGTTACCTTCCACCAACACATATATCTGGTAACTCTGCTCACCAAGTTTTGCTTCTACTGAAATTTGAACTAGAGACCTC
ATGGTTAAGGGTCTATCTTGATTTTCCTACTTTATGTTCAGCTCCACATCTTCTTGGTATAATCTTGATGGTTTGAACATATGTACCGTATCAAGAACTG
ATTTGTTTTATAACACAGCTGATATTCTTGGGGCTCTGGAGAGGTGGATCCATAGAGAGCCATTGCCAGCTGATGCAGCGGAAAAGGTTTTTGAATTGAT
AAGTCTTATACTGGTACTGGTTATCAACTGCATTTCTTAAGTCTGTTATCCTAAAAGTGCTTTTAAATTCAGGTCCGCTTGATGTGTTCCTACTGTAAGA
AGCATCAGGAAACTGAAGTTCCAGACCCTTACTATGGTGGAGCTCAAGGTTTTGAGAAGGTAATGTCTGATAATCTCATAATCCATCTATCTTGTTACGC
CATGATGAATAACCCAAAAGCTGCCTGATTTTCACATTTTAGATAGCGGAAGGCTTCTTGCTCCTAGCTATACTGGAGAATCTCAATTCTCACAGTGCTT
ACTTTGTTAATTTTAATGTTGGAGCATTATGATAGTCATACCACAATATGTTATGTTCTGTTGGCTTGAATTAAGTAGTTAATTCTCAATACTATGCCAT
ATAATGCCTCGAGCTGTCAAATAATACAGAAGTATAATGGTTTAAAGACCCATTGCTCTTGATACACAATTGCTAACCACATTTTCATGGAAAGAATGGA
TGATGAATTGGAGAGATCATTGAATTTGTCCTCAACACTTCAGAATAATGAAGAAAAAAGTCTAGTTTATGTGTTCTTTGAAATTATGAGTGAATGACTT
ATTCTGCTTAGTTTATATGTCATCTATAATACAGCCTGCTGTCCTTTGCTTATACTAGAAGACTGATCTTGAAATACTAGTGCCATTTGAAAAGTGCACA
CAATAGTCACCTTACTCATGCTTACATGCAGTAAAGCCCTACTCAATAGAAAATTATCCAGCTTCTCACCTCATATTTCCTTCCCTCTGGCTGCACGGAG
AGAAAAAGGAATGGTGTCTTGAGCTATAGCCCTGATAGCTAATTCTCCCTTCACTTCTTACCTTCTCGTTTAACCATTCTTCTAACTCCCTAAGACCCTA
ACAGCCTAACCCTTTCCAGTCCCTCAATCTCCCTGAAGTCATTAATTAACTCTGTTATCCTGACCTCAACCCTCCCCAAGTCCTACATATGAATCCTGAT
GCTTGTCTTTCATCAGCCATAGTTATAGTCTTATCGGTATCTTCAAGAAAGTACATAGGACAAAAATAGTCCTAAAATTTAGGCTATCGACAAGGATCGT
TTGGAATATTTGGTTTGGAAAAATCCAAGGAGGTATTTTGGAGAACTTTTACCAAGTCCTTGTATGTTGTAAGAGGACTTCATATCTAGAAGAAAATTTT
ATAATTTGATGTTTCATTAAGTGCATGGAAATTTGGATACCTTTGTAGTTTCCCAAGGTCTTCTCAATAAGCCAAGCACATATTATCTTTTAATTCCTGT
TGAATGATTTTCACAGAAAATGCTAGAAAAGCCCCATCTTAAAAAAGCAAAAGCTCTTTACAATGAGAAGAGTTTCTGCAAGAGGTCATTTCTGAAGGTC
TTAAAAGACCTTATTAATTTACTAAGATGGTGTGTTGCTGCTACAATATATATATATTATGTGTAAACACTGTTCATTTGGATGAGTCAGTTCGCTTTTG
TTTGCTGTTAAACTTGCAGTTGATGCTTACTGCCAGTGCCAGCAACATGCATCTAATTCTCAACTCTACATCTTGCTCACAGGTACTAGATATGCTTGAA
GATGCTTGTGATTCACTGTTGGAAAGCATTGTGACAGAACAAAATTTAGGTTCATAGATGTACTTTAATCACCAGTATTCTTACTGCCAATAAGGCAATT
GGTTATTCAAAGCATATACCATGTACTCTACTGCTCATTGTTTGAACTACCGCGACTTGTATAGCCGGTCTGGTTCTAGCCCATGGTATGCACTGATGTG
TTTATTGTTTACCTGGCAAGTTAAGCAAAGATCTGTAGAAATACAAACTTAAAGTGAATGATGAAACCTTCTTGACATTAGTCCATGTACTTTGTCCTGT
TTCCCACCTCCCTCCCTCTTGGCTCTTTCGCGAAAATTATCTCGAAGAAAAAATGATCCACTACCACCTGCCAATTCTGCTGATGATCTTTGGTCATGAT
ACATTTTCTTCTTTTTGCTCTTGCTATTTTCTTATGTGGTAAGAAGCAGGAGCAGAGCTAGTGAATCCCTCTTGCTGAAAAAGTTATATTGTGCAAATAG
GGTAAAAACTAGTTCTTTTGGTTATATGTAAGTTGTTGAATCCCCTGGAAATGCTATACATGGCATACTGCTACAGAATTTTCAACACTAGTATGTATAT
CGCGCAGATATATAGTAACTATACAAAAGCTTTAGGTAACAACACAGTATGCTTCAATCTCGAGCACTTTGGGGGTCGACTATATGAATCTCCACTGACA
ATTATCATTCCATTTGAGTTCATCTCAGGTCAATAGTACACACTTAAGGCTTAAGTAACAAAAATAAAACTTTCATATGATGAAGGACTGTTTAACTCCT
TTTCGTGATCGTTTTCGCCTTGGGTTTGAACTCAGAATGCTTGAAAAAGCACTTAGAAGTTCTGTATCCTCCACATTGATTACCATCTTTGCAGCCTCTG
GATTGGCAATAAGCAGCTTTGCCACTAGATATCCTGCAATAGTCCATGTCTGAAACAGACGTGCTTGTTTCCCAATGAACCCTCCTCGCCTTGTATCGTA
GTACTCAGGCCACCTATCTCTGGATAAGCGTCTTTCCGCAATCTTAATTGCTTTTTCAGCTATTTCAGGCCTCTTCATTTTTATGCATGCCACAGTCAGC
TGAAAACAGTTCATGTTTACAATAATCAACTCATCTTTTCTGCTGTCAATGTATCTCTTTACATGTTCGATTCTACTCTATGTTAGAACATTTCTGTGAA
TGACACGTACCTGCCAGAGCAACGTTGGCCAGGATCCTCCATTATGGTAAGACCAAGGCCTGCACCAGGTATTCAGAAACATCAGCAAGGTAAAGATAGA
AAACAATCTACACATTACAAGAAGAAAAGAAAAAGAAGATGAAGACAATACGTGTTTTTCGGATCACCACCAGTAATAATGCGCCATTCCTGGCCCTCAA
GAGCAGGATAACATATCTTCAGTGGCATATCAGCTACTAAATCCTCCCATTTGGCTTCAATAAGATCTAAAATGGCATGTGACTGATCTATGTTAGCAAG
ACTGCTTACAATGGACCAAACGTTCCCAAGTGAAAAGAACCGAAAATCCATGTGAGCTGGCTGCAGGTTTCCGATAAGATAACCCCCTTCACTAGGCATC
CATTCCACCAGCCAGGGAGGAATTTGATCTGGATATATATTGAACTTATTGATTGCATCATATGAATACTCCTCCGTTTTGTATCTATAGATCTCGTTCA
ATTTTTTCACATCGATCCAGTAGTATTCCCTAATATGAAATGACAATGCTAGCAATCGATTGTTAAGTGCTCTAACAAGGTCTGTTGATGCCTCCTCTGG
AGCAAGCATCTCCCGTGCACCAAGTAAGGCTGAATAATATAACGCCTGCAAAGCATGAAATATCATGATACGAAAAAAATAAGAGTTTCCTGAATGCTCC
CCTTATTAGTTCTATGGTTTCTTCACTGTCGTTTTTCCTTTTCATAACTACTTTCATTTGCAGCACTTGAGCTGAGGATCCTTCGGAAACAGTCTCTCTA
CCTCCATAAGGTAGGGATAAGGTTCGAGTACTCTACCCTCCCCAGACCCCAGTTGTAGGATTTCATTGAGTATGTAGTTGTTGTTAATATGATTAGCTTA
GAACCAAAAGTGAGTATCTTAACATGAATAATTTCACCTTTTCATTTGACAAGCTTGTTGCAGACAGGAAAAAGAAAAGACCTGAATTTCCAGAGGGTGG
CCATGGATTCCCATGCGACGATCTATCATGCAAGAACCATCAGTCACCAACAAAGTCGGAAACATATCAAAGCCATCTGCAAGACATAGCCTGAGTATCA
TCTTCATTCCAGTTTGGACATCAACCCTCTCCTGAAGAGAAAGATCTCCAGAGCATTTCCCATATGCTCGCAACAATATAATCCACCATAATCCTGGAAT
CAATTCATGGAGTCACAAATCATCAGATATACATTAAATTTGCTATTCAAAAGACATGCATCAAGAGTTACCAAAAATCACCTGAATCAACAGGAGCAAC
TCGACCAATTGCTGCCTCACCGAAGTCTGGATCCAGTACATCTTCTGTTGCAGATTCGTCATTATCAAGTGGAATTGTACGCACTTTGAAGCTGGCGGGC
ATAAGTCCTTGACCTGGACTATAGCAATCCATTGTTTTCTCCCAACTCTGTTTGGAATAGAAGAAGATGCTTAACAGGCAAAAAGCTAATGGAAGTAAAA
ACTTTTTCAATTTCACAGAGTTGAGAAAAGTGAATGTCATGAATGAGTTCATGTGTAATATTTTATTTATTATATTGAAAACCATAATGTCCGGATCAGT
TTTCTCGACTAATTGCAAGGGATACCTTTCCCTCCCACCACCTACAGCTACCAGGTAGTCCACCAAGTCTATGATAGACGGGAAGAAACCATGCATCAAG
TAGCATTTTTCTTACACATTGTACTGGAGAATTACTTCTATTTCAAATGGAGCCATCTCTCACATGTAACTAGGTAAGAGCTAAGAAAGCTAACTTGTAC
ATACCCACAACGAAATCACAGAGGTGGGATCCGGGGAGGGTAGAGTGTACACAAACTTTACCCAGTGAAATCCCAAAGTTATGTGCAAACTTTACCCAGT
GAAATCCCAAAGTTATGTGCATTACAACAGACATGAATTTCAATATGAAAGCAATCAAGCTGAACACAGAACAAAGTAATTGTTTAAGATAGTTTGAGTC
ATTTTACCTGCAACTGAAGCGTGTGAAGTATAAAGTTCCTCACGATATCGTATTCTCCTTTAAGAAGGAATGCTATCCCAGAAGGTATAAAATCGCGTAT
AAAAACTTGATCATAGTTTAGCATAGTTGCTTCACTTGGATCATTAGCAGCTATAGTTCCAACTGGACTGCCACAGTAATAAACCATGGCAGCTCGCAAA
AAATGCCACGCTTCATCCTCAATAGACTCCGTATTGGTTCTAGGCCTACTATTAACTGAAGCAGCAGTCTTAAAACCTTCACTGAAAGGCCTAGCTCCAT
TTTCCTGCTTCATGTTCTGTTCATCTGGAGCAAGATTTGGAATCTTTGGAGACACAGTGTGCATCGACTTCCCATTTCCACCTTTAATGATTGTCTCACT
GACTCTTTCAGGTTGTTGACAATTGCAGATCAATAAGTTTGACTGACTAAGAAGCTTTTCTCCGCAGAAAACACTATGTAAGCCATGAAAAGCATGTAAA
CTCGAGCAATCTTGCAGCTTTTTTATACTGTTTATCTGCTTATACCTCCAGTCCCCGTAATTTCTAGCTTTAAAACAACGTTCATAACAAAGTAAAGAGT
TTGACTTCGCCAAGATTGAACTTGTTCGGACTTGACATGAAAGCTCACCGGATAAAAGCTGTAGGGCAGCTTCTGAAGCCCCCATTGTCAGTAAGTATCT
GAAATTGATGATACCTTCAGCTTTGCAGCTATTGTAATAATTTCTGGATTTAATCAACACATTTACATGAAATAACATTGTTTAATACAGAAAAAGGGAC
AATCCCCAACATGAACCAGTCATTCCTTATCAAGAAGACCATTTCAGCAAAATGATAGAGAAAACTGAAACCATAGTATCTCAGTTTACAAACCAAGAAG
AGCTTCAACAATCATAAGAAAAGATTCCACCTTTCTCAAAGATCTCAGCTTTTCAAAACAAAGAGTTATTCACTGTGCTAACTACAAAGGGTCATCATCC
CTTAACAAGAAGACCCCTTTTAATGGACATTTCAGCCAAACGATGGAGAAAACTGGAAATCAAGAAAGTTTCAATAAGACATAAGAAAAGACCCCATCTT
TCTCAAAGATCTTAACTTTTTCAAAGAAAAGAGATATTCACTGAGCTAACTACAAAGGGTCATCATCCCTTAACAAGAAGACCCTTTCCAATTTGACATT
TCAGCCAAATGATGGAGAAAACTGGAAATCAAGAAAGCTTCAACAAGACATAAGAAAAGACCCCATCCTTCTCAAAGATCTTAACTTTTTCAAAACAAAG
AGATATTCACTGAGCTAACTACAAAGGGTCATCATCCCTTAACAAGAAGACCCTTTCCAACTTGACATTTCAGTAAAATGAAGGAGAAAACTAGAAACCA
AGAAAAGACCCCATCTTTCTCAAAGATCTCAACTTTGCTTAAAAAAAAAACAGATGTCCACTGAGCTAACTAACTACAAAGGGTCATCAATCATCACCCC
TTAACAAGAAGACACTTTTAAATTGAACACTTCAGCAAAATGATTGAGAAAACTGAAACCGAAACCATATAATCAATTTAGAAACCAAGAAACTTCAAAA
AAGAGCTCATCTTTCTCAAAGATCTTAACTTTTCAACACAAAGATTCTTGAGTTTGCTCAGTAAAGATAAAAATACTGTGTTCTCCAGAAGGAAACAGAA
GAAGAGAGCACTAACACAGTGATATATGTGGTGACAAGAAAAAGGGGTTACTGAATTTGCTTACCTATTGGAATATAATTTGTGAAGATGTTTACTTTAT
ATTACTGATTTAAAGGTAAAATCTTGCAGAAAAATAACTTGGGCTTTTTTATGAATTTTCTGGGGAAATTCTTGAAACTTTTATAAAAAAATTGTATGAA
TAAAAAAAATTAAAAAAAATAAGAAATAGAAATAAAAAATAAAATAAAATTTAAAAACTCAGAAACGATGTCGTATCGGAGAGTAACCTGTTTTATCAAA
GTGTAACTTCTCAAACCTCAAAAGTTTAAAGCTTTGTTGTCAATGGCGCGAGGCTTCTTGATTTCTACACAAACCAAAAATTCTTCACATTTTCTTCTAA
ACTCCATTTCTGAAACTTCAAGATTAACTAAATTACCCTATTACCCTTCTTCATCATCTCTCCGTTTCTCTCTTTCACCTCCTCCTTCTCCACCTCGGTT
TCTGTGCAGTTGTTGCAGTCACTTCCAAGAAAATGGCACAATTGACATGTCAGTACACTCAGAGGCATTTGCAAAGCGTATGGCTATGGTGGGTCTCAAA
CCCCATCATCGTATTGGTAAGTTTTACCCCTCCATTGTATTTTTATTTTTATTTTACTTTGTGGATACAAAGAAAGAAGAGCTGAAAGTGAGAAAAAGAT
TGCAGTTTTATAGTATAGTCGTTTATTCTTTTTGTTATAGTGAAATGCTGATACTTGCATCTTCATGGAGGATTCAATTTTACCAGGTCCATGTTGGAGA
TATTGTATAAGATGAAAAAATTGGTTTAGATATGTGTTACAGGAGTTGAGGGTCTATTGGAAACAGTCCTTTTAACTTCATTACTAAGTCTCTGTACGGA
CCACCCTTCTCAGACTCCACTTGTGGGAGGGATTACACCGGGAATGCTGTTGTTGAAAATATTTGTTTAGAAAAAGACTTGGTGTTATAATGAAATGTTG
TTATAGATGATGATGTGGAGGTCTCAGTGTACCTTTTTTCATTGGTTTGAAAAGTGGTTTGCATGAGTTAAAAATCTTAATATCATGAGAAGCTATTTTA
CATGTTTCATGGGATGATTAGTACTACCCCATTCCTAATCAGAAGTTTCTGATTTGAGTTTGGGGAATGGAGCTGTGTTTAACAGGGAGCTTTTTAGCCC
AAGTGGATAAAAGATTGCAACTTTGTATAGTACCCTTTACCGTCCATTTGTATATTGGTTTGCTTTACTTAAAAATCTCAATATCATGAGAAAATGTTTC
ATGTGTTCCATGGGATGATAGGTACCCATCCATCTTTAGCCAGAGGCTTTAGGTTTGATATTTGTTAATGGAGTCCCCTTAAAGAGGGATCTCTTTATCC
GAAAGTGGATAAAAGGTAGCAGCTTTATAGTGCCTTTTCGTCCATTTTGTTATTGATTTGCCTGACTTAAAAATCTGAAAAGCATGAGTTTTTGTTTTAT
GGATTTTCAATTTTCTTGTTATGTAATATAGCTTACAAAGAATTGCCCAAGGAAGAAAATTACAGCTCATGATTTATTTTTCTCTTTGATTGGTAGGTTT
TGCAGTTATAAAATATCAAATCCAAGTAAATTTTCATGTTTGGCTATTCTCTCTTTAACGACTATTAGATTAAAATTTCAAATTCCAAGTGTGGTTTTGT
GGTGACCATGATTCTTCTTGACCTTTTTTGTAGTTCTGGGCGTTTCTGGTGGCCCTGATAGCATGGCCCTCTGTGTCTTAACTGCTGCATGGAAAACCAA
TAACCTTGGTAATGCTGCTCAAAAGAATGAGTTTGTTGACGGGCTTTTAGCAGTGGTAGTTGATCATGGACTTCGTGCTGAGAGTAAAGATGAAGCTCAC
CTTGTTCATCGTCGAGTCACAAGCATGGGTATATATGTTCCTTTTAACTTCTTCTTTATCATGAATGTAGCAACATTGCTTAATACCTTTTTAATAGAGA
TATAATGTAGGCCTTGTATAGGAATCAAATGTGAGATTGTTTGCTGTGAATGGTCAGAAGGCAAGCCAAAGCAGGGTCACTTGCAAGAAGCTGCTCGCCA
GAAGAGGTCATTACCAGAGTTTCAAATCATCTTCAGTGAAATGCTATTTCAGAGCCTTGTCATATCTGGTTATGCTGGTTTTTTGACTGACTATGTTATA
CATTCATCCTGATGTTAATATGTCGTCATTATTGTGAGTAAATAAGTTGTCCCTCGTCTTGTTCAGGTATGAAATTCTCCAAAGTGCTTGCATCCGGCAT
CAGATTGGTGTGTTGATGACTGCACACCATGCAGATGACCAGGTATTAATAGCATTTACTCTCTGGATTTTTGTATTTTGTCTCTAAAAACTTAGCACTT
ATAGATGGCAATCTGTTTAGTTTTGTCAATACATTAAAAAGAGCTAATGGTATTTGAATACAATTGATGTTGCGCTCATGCAAATGTAAGTTGAACATTA
TTGCTTTTGACAACATTGTTGATAGTTTTAGCAATTGCTAATCGGATTACTCTACAGGCAGAACTATTCATTCTTAGGTTATCTCGCAGTAGTGGCGTGC
TTGGACTCGCTGGAATGGCATCTGTTTCAGAGCTGTTTTTTACATGTCCAGATTTAAGTGCTGAAGTGAGTAGCAATGGACTTTTATTGGTGAGACCTCT
CCTGGAGTTACCTAAAAAAGATATGTACAAGGTTTGTTTTTTACAGTTTGTCTGTTTGGAGGATTTTCGTAGCCTTTAACCTGAATGACTTCTTCTATCT
GTAATTAGAGTGTTCAGGGTAATATTTCATCAGGATCTTAAAATGATTAAACTACGTCTGCAGATTTTGCTAAAAAGATTCAGATGGTTATTCCTTTCCT
AGTTCATTTGAAGCTTCTAAAATGGCATTACCTTGTATTGCAGATATGTCTAGCTGCCAATCAAGAATGGGTCGAAGATCCCACGAACAGAAGTGCATTA
TTTGCTCGTAATAGAATTCGGATGATATTGACTGACTTGGCATCACGTGAGCATTTGACTTAATTATGCATCTACTGTTTTGGAGGAACCTTATTAACAG
AACCTGTATTTACCGTATCTTGATCATATATATCTTTTCCTGCAGCTATCTTTAGATCCGAGTTGCAAGCACTTATCGCTGCTTGTCGGAGAACAAGGTT
GCATGTTGACAAAATTTGTTCCAACCTGATGCATCAAGCTGTGACTATCATGCCTGTGAGTTCTACAGTTTAGTTGGGAATGCATTCTAACCAATAATCC
ATTGTTTCATTATTGATACTCGATAGCCTTCAGAACAGGTGTTCTACATGTTTGAGAAATGACACCTATCTGCATTTGCTTTCAATCATGCCTTCTCTTG
GGGGGTGTATTGGTCGTCAATTTGTAGTTTAGCACCCTTTTCCTTGCATATACTTGACAGCCCAGTACCTGTCTAGAACAGAATCAGTAACATCTTAATT
CAACCTTATTTTTTGTATTCCACGCCAAAATGAAGCTCGTCTCTATTTGGAATGGGGGATACCTGTCTAGAACAGAATCCATAACATACTAATTTAACCT
TTTTTGTATTCCCATGCCAAAATGAAGCTTGTTTCGATGTTTTGTTTTCTTTTTTCAGACCTATGGGTTAGTCATAGTTACCAATTTGGAAATGTTTCTA
CTCCCTCCCGAACGAGATATCTGAATGCATGTCCTAGAGCAGTTTAGGCATCGTAGTTCTAGCCTTCTAGGCATGTTCCTTGCATTCCCATTGTTTGAGT
ATTTGCACTTTCTTATTGTCACAATGTGAATGATTAAAATCCAATCATTAAATAGGTGACATTCAGTGAAGTATAACTGAAAAAAAATTAATGGATATAG
ATGAACTAATCATTTGGAAGAAAAACTTGGAACGGAATCCTTCAATGACTACTGGTACTGTTGGTAGAGGTATTTTAACTAGAACTTATCTGTGTAATAT
TTCCTTAATAATGATTCTCATCTGGAGAAGAAAAACACTGTATATCTGTACCTTGTCTTAGCGTGATGTTACTAATCTCTCTCTATCATTCTCAGTCTAT
CCCTTTAATTTTTTTTTCTTCTGGAAAGCAGGAAGGGTATGCGGTGATTGATTTAGGAATCCTCTGTCCTTCAGAATTAAAGGACATAGTCCTCTCCAAG
TTTATTGCTTTGTTACTGCAGGTATTGCCACTTTTAGCTTTCAATGTAGACATAATACATAAACAGACGCTCAAACATGGCCTCACCTGGAAAGTAAACT
CTCCAACTTAGGGAATGAACATCTTGATACCTCAACTCGTCTTCATTGTGTCAGTTGAACACTCCAACTTTCAAAATGATCATCTAGACACCTCCAAAAT
TTGTGTGCCATGTCAGCATCGGGTGTCCATGAGACACACTGGGAACGAGTTGAAGTGTTTAATTGTCAGTTGAGACCAAGTTGAGGTATCTCGATGTGCA
CTCTCTAAGTTTGAGGCTTACTTGTCAGCTAAGGCCAAGTCTAACTGTCTATTTAATGTTACCAGTTTCCAAAAAAAGTTAAGTGAATCTATTTATGTAT
TATGCCAATAATCAATTTTTTTGGCTATGTTGTAGAAAACTTTTCTTGACTTGTATCTAATGATAGATACCTATTTATGCCTCTTGTTTTCGGTGTAGTT
TGTTTCACAAAAGCAAAGGCCTGTCAGAGGCAGTGCATCAAAATTGTTATTGGACTACATTCGGACTTCCCCATGCAAGGTGAATATAATCCAATTTAAC
TCTAACTGTGCACAAATTGTATAAACTTTTGTGGGCAAGAAATTCCTTTCTTTTGATACAAGACTGATGATTTTCAATAATACATTGTCTAATGTATATC
AATAATGGCACCTGCAGACTGCTGTTACTGCATCCAGTTGTTACCTTTGTCCTGCTCCTGGCTCCAAAGGCACTAAAGTATTGATTTGCTGCTCTACTGA
AGCTGAAATGACGCTAGAGTTGCTAAATCCATACTCGTCTGAAGGATATAACAGCAGTATCTCAAAAGAGGTAGAGCAAATTGTAGCAAATGGGAGGTCA
TACTCAGATCAGTGCCCTCAAAGTATGCTAGGAGTGCAATTTTTTAACCTAACATCTTCCGATTCCGTTTTAGCTGAAGCCAAAAGGGAAGGCATTCTTA
GTGAATCTACTTACAAGAGCATTATTTCTCTTCAAAGAGAGGAAAGCAATAATTTCAAGTCCAAAACTAATATTGCGCTCAACAACAAGGTGGAACACAA
AGTAGAATACACAGCTTCTGCTCCAAGCAAAGTACTCCATCCTGAAAAAGTTGGGTACTTCATGAACAGATTTATAGTGAAGTGGTATCTGTGCAAGCAA
AAGACTTACACTTCATATTTCATGAATAATTGTAATCAACTCCTAGATTTTGGAGAAGAAATATGTAACTTTTGCAATTCTTGTGTCCTTGGCCATGATC
AAATGGTCAGGGTCCGTTACATGATTGATGCTGATTGGTTGTACCTAGCAACGTTATCAAAAAGAGAGGATAGAAGAACTGTTCATGAAGAACGTTCCCT
TTCAGTGGAGTCACAAGTAATCAACGATATAAACTTGTGTTCTGCTTGTACAAAAAAATCAGCTGAAAGAGCTCTCGTCTTATTGAAGTCCATTCCTGTT
GCCGCAAGAAGAGCTTTACCTGTCTTGGTCAATGTGGATGGAGTGTTGCTAAGCATACCAGTAAGTCGATGTCTGTTTTTATGTTTGTGTTTGTGATACT
AATCTGATAGTATTTTTCCTATATTTAATGACCCTCCCTGATACATCTTTTCTTCATCATTTATGCTATTTAGCCTAAATCTTGAGGCATTTATTGCCAG
CTCATCATTATATGAACCTGATAAACGCAGGGGTTGTTTTAATGGCTAAAAGTTACTCAATTGGTTTTAGTTTCCTAGAGAGACTGGTGAAAAGCTGTTT
AGGCCAAGATTTCTGGTTGATCCAAGGGGATTAGACCAAAGTGGAGATATTCTCTCTTTGAACTCTGCTAAAATGTCTACGCTGTTTTGTTCTGTCCTTG
AGTAAATGAAGGGCCATTCTAGAAAGATCGGAAATGGCTCATATGTAGCTGTTCTGTTTTCATAGTGTGCCTTCTCTCAGGCACTGATCCTCTACTTAGT
GCTTCTAACATCCACCTACGACCCAACAAGTGTTGTATTGCTGCTTCTTTTCGTTTTCTGCATCACTGAACATATACAGAAGGCATAGTAGCACAAACTT
CCTGGTTATAACTAGCTACTGACCGGTAACTTGATCTTTCTCCTCTTCCATTTACTTGCGAAATACCAAATATAAGCTAGAAAATTACTTATTTTCCTCC
AGGAGAACATTTCCCTTTCATACCAAACACACCAAAATGTAGTTTACTATTTCTAAGGGCATCAATAGCGTAAACAGCTGTCCCTGAAGATTTTGGTTTG
TGTTCACACGTTCCATGCTGGTTTTCGTGTGTCAATTTCTGTTTCACTCTCCCAGTTTCTTCTTCTCATCTCAGTGGATTAGCTGGTAGCCGGTACTAAT
TTATTTCTTTTGCTTCTTCTCAGAGTGTGGGTTTCGAGCACTGTCCTTGCTTGGTGGCATCCGCTATATTTAAGCCAAAAATCCCACTCGGTGGAGGTTA
CAATTCATTCCTCTAGCTGGTTTACAATGTAAACTTGTTCATTTATCATTATTAGTTGAGCTGACCTTCTGATGTTTTCGAAGAGGGGGCAAAATCTCTG
CTGAATGGAGGTTATAATGTATTCCTCAACTTGGTTCTTGTACCATGTTGCTTGTATCATTATTGGTTTAGCTGGCCTTCTAGTGTGTTACCAGAGGGTG
GAAAGCCTCTTCTGAATGGACATTAGTATTCATTTTTCGAGTTGGTAGCAATGTAAAAACAATGTCAATTTGGTCCATGTACCATTGGTGGATAGAGGAT
ACAATTCATTTCCTCTAGTTAGTTTATAATGTAAACATGGTTCATTTATCATTAGTAATGTATCTTTCTGGGTAATTCTTGTATATTAACCGCGCAAAGT
AGAGATGGAAAAAACCGCATACCATGAAGCTGTAAAAGTAGTTTATATTCACAGATCACAACTTGCCACCCCATAACACAGTTTACCTAAGTTCAAGACA
GCCTTTAAAATGGAGGTAAAAAAATATGCCTCCATTGACAATCTAGACCCAGCAAAACTAAAGCTGCAATTCTACCGTAAGAATCCCATCACATCCAATG
TATTTTATCTCAGGGTGAATTTAAATGCAATAAACTAGTTGTACATTGCATTTTCTATAGTAGCCAAAAGAATATACATTTACACAAAAACTAACTACAA
TAACTATAGCATTTAGGCATCATCAGTGTGGTTATCGTTGTCATGGTCGCCTTCATAATACTCATCGTCACGTTGGATATGCTTATCTTGGGTATGTTCT
GTGAATTCAAGACAGGGTAACAAAAAAAAAGGTAAAATCAGAGTTAGATCACTGTAGTTCCACATTTGAGCATGTTGTGTGCTTATTATATTCAGATTTC
TACTTACGATTCACGCGCTCATCTGGATTTTGTTCATCTTCATCAAAATCAGGAATATAAAAGTCAGGTGGTACCTACAAAAATATGAAAATTTTTCAGA
CTACCAAGTCACTATCTTCCCCAGATACCTTACCTTCAGGCCTCAATCACAATCATGCCTAGAGGCGTAAAATGCACTTCTAATGACAGTTACGGCACAT
TGAAAATGCAGGCTGCTCTTTTATGCATTGGAGAAGCATTCTCACAATGGTGAATGTACTGAATGATTGTAGCAAGTGTAGAAAGCTGAAACTGCATTTT
ACATACTTTGTGTATTTTCAAAATCTACATAAAGCGTCAAAGAAGCAATCACTTAAAAGGGACAAAGCGCATCACAAGTGCAGTTCTTAAGCAATCCGAG
TACATATAAACAAAAAAATAGCATGCAATTATGTCCATATAGTTTGTATGTGTGTGCTTGATTACTTGGCAACAAAAAACTCCAAAAGATGCACTTGACT
TACCTCTTGCATCTGTACGCTCGGAGCATGCTGGAGGCAACGGAGATTTTCCATCACTTGCATTTTTATGGTGCCAATGTATGATTTGCTATTCAGGTTC
TCCTGTTCAATCAATGAAACAGGTGATTAGAGCGAGATCACCATGCCAATTTGTTGTCATTTTTATTTGAAAATGCTTATTGGAACATGACATCACTGGA
TCAAGCAATCGGTCATCTTATGGATGCTACATTATAAATATCAACAGAATTTTGAGGAAAAGGCCTCCACACCTTGAGTGACTAAGATGATGACAAGTAA
AGAAAAGCAACAAAACGATTCAACTTACTATGTGTCCACCAGGAAGCTTCAGCGAATAATCAGGGGCAAAATATTTGATGTAATCATTGTCTGGTATTTC
TGCAATTATTTATAAACTCATTGTGTGAAATAAAATTATTTCTAAAAAAATTAAACCATTAAGCTCATTTAAATAACATCATACAAGCAGATAACTTGAA
TTTCTTACTAGAAAATAAGAACCATGAAGTAAATTTCAGATAACAACATTATAGCTGATCTTTTCTTTTTCCAAGTAAAAATCAATTGTTGAAACAGCTC
AAGAAGTTCAAAGGAAGGAGTCGAATTCCAAGAACTTCAGCTTCCATATAAACCTTGCAAAGTTATTATCTAGCCATGCCTTTGACCAAAATCACCTAAT
ATTAACGTGAACGGTTGAAACTAACACATTTTCTATCTAGTTACCCACTTAGAATATCTTACACCAACAACAAAACAAGAGCAGTTACATACTACAAAAT
GGAAGAGGGAATAGTAAATACAAAACTGTCGCACTAAGGCAACTGGGCCAGATACCAAAAACTCAAATACATCAAGCAACTGATCTATACTTAGAATTAT
GTTCAATCAATTAATATCCCAATGAACTATCCCTCAAAAACGGTTGAGCTCAGCTATATGACTAGCATCCAAAATAAGGAGATGGAGTTTCACAATATAA
TTCAACATATTAACCTTCAACATCAAATTTGCTACAGTGAACATCAGTCCACCATCTAGCTCAACCTGGAAAAAAAAATTCTTCTCTGCACTCTGTCAGC
AATTCAATTCCTGTGCTCACAGCCAATTTAAGCTGCGAATGTTCTGTCCGAATCCAAACTATTCTAATACTACTCTGCTTATTAGTAATTTGTCTTTTAA
GGCAAATAAGAGTTCTGAGGTTTAAAAGAGAAGTTCTCGGCATTCTCTAAATTGCATACTTATACCTAAACATAAATCTTGAACCTGACCAAAAGAACTC
TACCTAATATTGAACTGGAACAATAATAACCAGAACTTAAACCAAAGATATCAGTGCCATCCTGTTCTGCATAACCAGTTAAGGAATCATCTTCATTAGA
ACCATATAAAGCAACACCCAAAACTCCCATTAAGAGAAAAACAGAACCCCTCGCCGTGTAGAAAATAAATTTTGTAGCTGAGTACAGACGTTTTTTTCCT
CCTCACATGGCTAGAAGTAGATAAACAGGAATTCCCTTACGCATTTGGATCCTGACTAAGCCACTGACAGTCTCGAGGCATTACAGAAATAAGAATATGA
GGCAGTGTGAAAACATTGCACAAAAATAAAAGCCTGCTCATCATACCATTAGGAAGTTCTGTGTCTAAAAGAACTCCAGTTTCCAGAGCCCAACAACGGG
CGACATTCTCTTTTGTGTATCCCCCACCTCCAGTTACCTGTAAAAGGTCCCATGCAGTCAAACAGATGCAGGTAACTTGTTATGAACCAAAAAATGTAAT
CTGAATTGAGAAACACCTACCAGCAGTGGCAAATTAAATTTCTTCACAAACCTTACACATTCAGCATGTCCTATAAGAATCATTCATTGATAGAGATAGA
TTAAAAATCACCAGAAGGCAAACCAATGCATTCAAGCTCACCAAGAGCTGAGTATTAGAGATTGAACACAATCCTGGAAGTATTTAGAATAAGAAACCAA
ATACAAGTAGAATAGCACCATCAATAGAGAGGTTGAAGCAGCCCAGACGGTCTCCAGCAAGCGAATCTGCCCCACATTGCAGAACTATTGCGCCAGGTAA
ATATGTTTCAACAACCTTTGAAATAATCTATGAAATGACATGTTGCAAGTAAGATGCTACAAAACTAAATTAGAACATAGTAAAACTAATATGATAGAAA
CTTTCTTTACAAACTTACTGTTTTGAAGAGTCTAGTGAAACTGCCATCATCTATTCCATCCTTGAGAGGCACATTTATGGAATAGAATCTTCCATCTCTT
TCCCCTGTATCCTTCAGAATAAAACCACGGTAAGCAAATCTAGAGGTGTTCATAAGAGGGGCAGGAGTTCCATCAAAAAGGATGAATTTACACTATCAAG
AGCAAAAATGAAATTCAGATGCTCTTGCGCTACAAATGTACTTCAATTTTGCCCTACGCTGGGAGTAGCAATTAAAAAGCCAATAATTGAGAGTCAATCT
TTGTATTATAAATCCTGCATTACCATCCTTTATATAACTATCAATACTAATACCTACATTACAATCCTTTGTATCACCAATTCATGTATTACCTTACACT
ACAATCCATGCATTGCTAATCCATACATAACTTGCTTCTAAACAAAACGACTCCTTAATGAGGAGGAAAAAGATCTTGCATACAAGGTGTACACAAAGCT
GCATATCTTGATTTTAGAGAAGTATCAATGTTTCTGTTTTCAAACCTTGGATTAGTACAAAAGATATTACTTACCCCTTTCTCAAAAAAAAAGATCAGTA
GTAAAGATATCAATAATTACTTTACATCCAAGAGGACAACCAACAATGTTCAATCACACACACACACATGACCTAATTTCCTTTTCAATTATTCTCATAA
TTTTGACTCATTTCCTAAATGGCTGAGTTCTCTGAAATTTGAATACCTTTTCCAAACTCTTTGCCTTGATATTAGTTTCTATGACAAGCTACCTTATATT
TTGTGGGTGAAATATAAGGGTTAAAACGGGTTAGAAATTGGGTGGGTTTTAATTATTGTGAATCAAAATGTGGCACCAATTAGACATGACATGTGGCTTT
TTAAAGAGTTAAAGTTGACCTGAATATTTCTGTTAGGTTGAGCCTTTGAGGGATATTAAGTCCACATATAAACCTTGAGGATATTTTTAGACCCAAAGGT
GGAAGAGGGGTATGTATGAGCCTTTGCTCATTGGTTGGGTATTTATGAGCCTTTTCCCTATATTTTAGAGCAACTACTCCGTTTGCCACTTTACTTCTTT
GGCGACAAATTACTTCACCTTCATGCTTGAAGGAAAACACAAGATATCCAAATTTATACACTAACTATGTTATATATTTTTCAAATTTTGATATGACATT
TTACTTTACAACATTGATGTCTGATGCACTTTGACATCTATCGAATGCATGATAACTTCCACCAATACAACTATCAATACTTCGGCAGATGGAAATAAAT
CATTTCTTGTCACCATTGTTGGGATTCGAACCTTTGTCCTTAAGATTGTTACTCCAACTCTCTGACTAAGAGCCACCCCCAAGGGCTTGATATAACATCC
TCTTAGCCATTTCAAGTTTTGACATTTCAAAGATTCTTCTCCTAAGTATTAATCTCTAAACTCGTTAATCTCTTTCTGAATGGAAGATTCTTTTTTTTAT
AACAAAGATGTAGGAACCAATGTGCCTCTATATTTTGAATAAATAAGCTTCTTAGGTCTTAATCTCTATATATCCAAGAGGATCGTAGAATAAGGTACAG
TCACAATAATAAATAGCACATAGAAGTCAATGATATTCAAGTGAGCCCGTAAGAGATTAGCTCATGTTAGGTTTTCGACGTAAAAAGAAAAATCTAGAGA
ACAAAAAGAAGAATGAACTGTGAATATAGAAGTACCTTCATATCACCAGTTCCAGGAAAGAACTTATCCCCATACTTGTGGAAACTAACAGTCATTACCC
TGCAAAGAGATCTAATATTAGGAACTTAAAATTCCAGCAACTGTCTAATAGTATTTTGGACTGCACCAATTTTGGTAAATATTTATCTCACTCCTTAGCC
AAAACACATCACGAGGAAAAGTGCACTTTCTACACCAAAAAGGTTTTATATAAGGCTTATAGCATTTTGACAAAAATGTCAAAGCTATAGAACATAGTAG
CAGCAAAAATCATACCAGACAAAAATTTTCCAACTGTGCAGTACGCAAACAAATCAACTGGTTAGAAGCCAATTTTTTTTTGAAAAATTGAAGTATTCAA
CTGGTGCCAAGGTGGAAGCTTCATTGTCACAGCTACTGAATAAACAGCAATTTAATAATCAAGTGAACATGTGACACTTTAATTATTCCTATGCATGACA
CAGATAATACGAGGGTAAGACGAAGATGCTTCTGAGAGGTCACATCTACAGTAGTATAAAGAATTTCACTACAGATTTCTTACTGGCAAAGTTGATCATC
ATTCAGGTTCTCGGAGTCTCACTCTAGACTCACTAGCTACTACTTTAAGCCTTCATATTGATTTAAAATTTATCCTCGGGTTTAACATTAGAGAAAGAAA
AAACAGAGAAGGAAAAAGGAAAAATTGGAGAAAAACTACAGAAAATAATTCCACCTGTCAGTGAAATAAAAGGCCTCTTCTACACCATCACCATGATGCA
CATCAATATCAATATAGAGCACCCGCGGATGATACTTCAGAAGCTCCAATATCCCCAGAACTAGGTCATTGATATAGCAAAATCCTGAAGCCGCACACTT
CTTGGCATGATGCAAGCCACCAGCCCAATTTATTGCAATATCACAAAGCTTATTATTCAATCTACGTGCAGCATCTGCCACTAAATCTTTGTTAGCAAGT
GATTTGAGACTCAACAGTAATAGCATGTTAAAGGCCAATTTTACCTATTGTCCCACCAGCATATATTTGACAAAACTCGAATAAGTTGTCAAATACAGGG
CAATCTTCTCCAAGATTATCTGATAAGTAAACAGATAAGCAATAGTTCAACATCACATTATCCAAACAAATCATCTAAAAAGACGTGATGCCAAAAAGCA
TACTCTTTAGAAAATTATGATATCAAAATTAGTTTCCATTTTGATCTTATAGTGAGTTGTTAACTACACCTATTCATCATACAAAAAAAGTCGGAGAAAG
TCCAAAAAACCAAGACATGTACAGAAAAAAAGGAAGGAGAGAAACTAGAGACAGTACAAAGGAAAAGCTGACAATAATTAGGATGAAATCAAAATATACA
TTTTTGATGGCGACTTGATGTAACTCAGAATACACATGTGAAGTTGTCAAACTGATATAATCATTAGGTACCAGAATTAGTAGAAGGGATTACTTCCGTA
CGTTGTTGTAATATTTAGCACTCTCTTAGTGCTGCAAACAATGAAACTTATTTACCAATAAAAAAGTAGTTGGGTTGGAGGTAATTGTTGTTCTATATGC
TCCGCATACCCCCCCCCTCCCCCGCCTTTTCAATCTCTAGAAATCCATTAAGACAGTTAATAGAGCACATGAAAACATTCATATATGTGATCTAGGAATG
TTCGTAAATTCTCTAGTTTTGTGCTAAAGAACCTAATTTTTCAATATTCATTGAGACAAGTCTAAGTGTATTAACATGAATACTGAGGATTTAACTAGCT
TCGGATTTAGGTGTAGCTGTTGGTGGTGGTGGCATCCTTGTTTTTTCGAAGACGACAAGTACTAGAACAAGCTAGATTCATATCAATAAGTATGCAGCTC
AAAGATGATATTTCAAAGGAAAAGAGATAAAAATAAGACAATGTTCAACACTTACATCTTGCCATTTCACTAGGGAACAAGTTCTGAGTATCTGGGGTTA
TTCTATTCAAGAACTCTACATAATCAGCAGAATGAAACTGCGCTAGCTCCACTGGATATGCTTTGTGAGGCCTCTACACAGTTCAATCAAAAAAGGTAAA
CCAAAAATAGTAAAGTAAAAGAAAAAGATCGAAGGGTCAAAAACACACTTGAATTCAAGTTTCATATCTGAACTATCACCAACTATTTACCAGTAATACC
TCAACTATTAATTGTTCCCAAAACACACCCGAATGATGGTGATATTTCAGGCACGAAGGGACAGCTGATAGCTGATTGTGTTTAGATAAATAGTTGGCGA
TAATTCTCGTAGGAACCTCACATACCTCATAATTCAAGTATGAAACTTGAAAAAACAGGATACTATTAGGCCGTACCTCATAACTCATGTATGAAACTAA
AAAAATGTGTTTTTTACCATTAACTCTTAAAAAACGGAAAACTTCACATTCACAAAAGAGAAAAGGATAGAGTAACAAACATAAACTTCCATCTTGCTGT
GAAGACCATAAGCTAGAACCAGATGATGAGTCATACACAACCTGTGCGGCTTCATTGGATGATTCGGTCCAAAGTATACGCTTCCTACATCACCTGCAAC
AAAATTTCAGCTTACATAAACAAAATAAACACTCGCATACAGAATGAACAACACCTAGGGTTTGTGATTTCTCCAGTGTGAAGTGAAAAAGGAGAAAAAG
AGAAAACTCTTACCGTCGTAGAAGTAGGAGATTTTGTCCTTGGACCTCATTGTAGATGGAATAGCTATGCAGAGAGGAAACTACCGGAGCAGTTTTCAGG
AACTTCGCCGGCGGGAGAGCTTTACCGGCTTGCCGTCGGCGATTTGCTGTGAAATGAACAATGGACTTATATGTATAATAATCTTTGTAATTCCGAAAAA
AAGAAATAGGAGGATTTAATGGTCAAAAATACCCTCAATTTTTTTTCTTTAACTATTAGTCTTTTTTCGTAAAAAATTAATAAATGTGTTTTTGATTATT
ACCTCAATAATAAATTAATTATATATTTGACCAATAAAAGAATTGCACAGTACATCCAGTAGTTGGAAAATAATTTAGAATTATAATAAATGTTAAGGGC
AAAAGGAAAATGATATTTTTTATACGCTTGAGTGGACAAATGAGGATTTATTAAGTGGACAAATGAGGATTTATAGTTTTAGTAAAGCGAACAAAAAAAA
TGAATTATTATTTGATCAATACGTGGCTAATCAAATGTTTAGAACTATTTTGAGATACGTGTTTTTTTGTTTATCGAGATGGTTATGATGAATATGAGAA
AAGGCAGAAGTAAGCCGAACAAATACATGAGAGCGGTATTAGATAGGATATGACATACATACAACTTAAGAACATGACCTTAAATTATCGTCCAATTTTC
AATATCAATATTGCTATTATTACTCTTCTACTATCTTATTCTCCACTTTTTTTTTCTTTTATTATTATTGTATTATTTGTTGTTATTATTATCTTTCTCC
TTTATTTTAACATGTTATCTATACTATTGTATTTCCTTCGCATACTTATTTTCTTGTATGCTTCACTTGAATCGATCGTTTATACTTCCCATACTTATTT
TCTTTGTTTTCTTTCCATACTTATTTTCTTGTATGCTTCACTTGAGTCGATCGTTTATCAAAAATAGTAGACCATCACACAAATTTTGACACTAAGGGGG
TATATAGTTTCACTCTGTTTTGATTATTAAACCGTAACATTTTCATTAAAAAATATAATATCTGAACTATGGCAGTTACAGATGGACAAAAAAATTTGAT
TATTAGCTTTAGAACATCAAACTTTTCAATGTGCAGGCTGTATTGTCTGCTGCATCTAACAATTATTAGCTTCAGAACATCAAAAAATTCAATGTGAATA
ACTCAAAAAATCTCTTTTGTGCTTGAATCTCCTCGGAATGATCGCGGAGAAGTCACCATTTTACTGCTTCTTGCCAATGTCATGAGACATATTGTAGATC
CCCCTGACCTGAAACATCATGCAAGAATAGATTTACAGCTGATTTTGAGAAACAAAGAAATGACTCGGACGATTTAATATGATAGAAACTCACAATCATG
AAGGTAGCTGTAGTTGCCAAAGCAAGTGGAATGGCAACTGAAGTAATCTTGTCTACGGGACCTTTTAGGTGTGTATACTTGTGAACACTCTGAAAATACT
TTTGCTTCGCAGCAAGCTTTTCTCGGGGATAGAAGGGTGTTTCTGACATCCTGCAGATTTTATTAACTTGTCAACGCAGAATCTCAAGACAAACAAAATA
TCACGGGTGTTGAAACAGGACGGTAAAAAAACATAGAAGAGGCTCTTTAGCATGCATCCTTTCGCTTTGTTAGAAGTGTAATTTGTGTGATTTCCTTGTC
TTATTTACCACTTCAGAGACATACGTTGATCTTTCATCACTTTTGTGGCTCATAAGGAGAGAGGAAAAGAGAAGAAGTGAAAAGCAAGTGTTCCTCTAAT
GCAAGAAATATGTCAATCGAACATAAATCAGGAAAGAAGATGTCAAAGTCTCAAGACTAATTAATACAAAACAGAGTCAATCAAACACATATTCGGAAAG
AAGATGGGTAAAACTCGAGACTACGACCAATCAATCAGAAAGTAGAAAATGAACCAGATGTCTATATATTGTTAGAAGGTACTAGTAAAAGACCTTCCAT
ATTAATAATGCTAATCGAGATGGTCCGGATGGATATCACCCCCCCCCCCCCCCAAAAAAAATCAATAGTATACTGAGAAACATTGATAGTCTGACTTCCT
TTTAAGGTTAAAAAGTTATTGTATTAAGAAATGTCATGAAGGTAATTCTTGTCAGTACACCACGCTCAAAGATTAAAAAGACCATTCAAAAGAAAGAAGA
GAAACAAACATAGATAAAATAAGCTAACCATAACTTCACACAAAGATAGATCGACTTGGGTGCAATTTGCACACAAGTGTAAGCTCCATCTTTGCATCAG
ATAGGTTCAAGTATCAACAAATTAAGCAAGAAAAATTAAAACAACCAAAACTGGATACATCCTGTATCTTGAAACATGTCCCACAAATATCCAATATACC
GACATTATTACCAAGCTTGCTGATAATATTTAGGCCAACAATTAGAGTGCCTTGTAATTTTTTACATGTTGATAACTGCCGAAAGATAATGTTAAGCAAC
ATTTATTTTTCTTGATAAAGAAAAGGGGTAAGGATAGAAGGATAATGTAAAAGGAGACGGCTTTTATCAAGACACACTCACATGATTTCAGATCTGTGTT
CACCAGCATTTCTCTTAGCACATGGTTTCAATATCTAACAGGCAGTAAGCATTGTTAGAATTTCGAGCACACAACGTGTCCAATTCTTATAAAAAACGCT
ATGGGTCCAATTATCATCTCTAACAACTATAAGATCAGCAGGAGCTGCAACAGCCACACTTACATCATAAACATACTTCACATAAATGAAGCTCGACGTC
TTCCACTACCATTTCCAAAATATCTAATCTTTCAGCCAATTTAACTCCATAACATGTGCTTTTAGGCATCAAATGACAGTGCAAATAACTTGCTAGTTGC
TAATAGAAAAAGAAATATCATTTCCCTTTATTGGCATTGATAATCAGATTACAAATTCTCTTGTTAGAGTGACTTAGCTAACCAACGCGACATTCCACTG
TCAAAGCCCCAACCTCCCCCCCCCCCCCCCCACAAAAAAAAGGAACTTTCTATCAAGGAACTTTTTTCCCATTGTCATTGTTAATGAAGAACTACGACAA
CCCCTGAATATCAAATACCAACATTATAGCACTCAAGGTTAACACCTAGAGGTCAATGAATTGGGTTGGCAAACATTAGGTCTCAAGCAATTTCTTTCCA
TTTGTTCAAGCCTAAATTGACAAAATCACCTACCTCTACTTGTGCAAGGTAACCAATGGCGGAACTAAATGGTATTCACCCAAACCCTCTCGTCAAAAAA
TTACTTTGTGTATACATGATAGATTTTCTATATTCAAGTACATATATAAATTGTGAATCCCCTAAAACAACACACTAAAGATTAGCTCAACAATCTAAGA
TATTCAAAATGCACCCCAACATCAAGTACTACATTGTTTTTTACATTTTTAATTTTCAAATCCCTCATTAAAAAATCATGGATCCGCCACTACATGTAGC
AGCTATAACAGGTAGCGGCTACCCCTAAATTAATTGAGATACGGAAAAACTGAACACAATCATGGTAAATATCAAATTCAAAACGAAAAAACCACCCCCC
CCCCCCACAAAATCCCATCTATCATATCAATCAAATAGATCAAATCAAACATACCCATCAATCAAAACAAAGCCACACATACAAATAATGTAAACAAGAT
ATAATGAATCATGTAAATAACAAAAAAATTGAATCAAAGAACAATAAAGGGTCGATGAAAAAAATCAAATTCACGTAGAGAAATGAACTTACTTTGAAAG
TTAGAGAGAACTTCGATAAAAAGCAACAAGTTAAGAGAGAATAGTAGACACAAAGAGAAATGAATTTGTTGAGCCAAAGGCTACAAGATTGTTACTTCCT
ATTTTATTGCCACTCAATTCGACATCATGGGACTAAAATAATTTTGGAACTAACTAATTTTTATATTTAAATAAATATAATTAATTCTTGAGTTAAATTA
TAATTTGTATTAACTACATAACATAAATTTTTAAATATTAAACTTGATTAATTTATATTTGTATTGTGTAAGACTCATTTAAAAGAAAGGGTTTTTTTGT
TAAAAATTTGGTGTAGCGTCCACGAGAGGAAACACTCTCTATCAATTTCTTATTTCATATTCAGGACTCCAAATCGACATCTTTATTTAAGAAAGAGACC
ATACTTATTCATTACATTACATTTTTTCATGATGACAATAGATGTTAAAAATGTTGGTGTTTATAACTATCTATAAACAAACTCATGAGTTTTTAAATTG
ACATTTGGAAATTGAAATAGTTTGATCATCGAGAATAAGAATTAAACTTCAGATTATCAATACTTATAATAAATGAGCAGTTTTAACAAATATTGAAAAC
AACATCATTAATTCATAAAGATTGGCATAAGATTTACGAATACTTCACTTTTTCTAAATCTCACTTATAAAAATTAAGTATATTATCGTTGAATTCATTA
CTTTTTTTTTTTTTTCATTTCTCAAGTTTACACTTTACCCTATAATTTTAAATTAGTTGGTAACTTTTTTTTTCTTTTGGGATCCCAAAAGGAAAAGAAA
AAAGAAGAGGTACTCAATTGTCTGTTATAATAAAGAATAGGGAGCATTCTACAATTATGACAATTTAAGGGGATATCTATGTAATTTGTTCCTATATTTT
CTCTTTCGTCGCCGAACACAGAAAACGGAGAAGCATACTTCCCGTAGTTGTAGCAGTAGCTTGCCGGAGCCGGCGATCGGAGATACTTCCGTCCATAGCC
GAAGGTAATTAAACACCTTCTCTACTTTCGAACAACTTCTATGTGCACAAAAATTGTTTCGGTTACTCGATTATAATTCTTTTTATGGATTTTTGTGCAA
TGATAATTTCGATGACGATCCTTGTAACTATGCTTCATTGAACGGGGTGTTTATAGGAAACAACCTCTCTAACTCGTAAATATAGGAGTAAGGTTTGCGT
ATAGTTTGTCCTTCACAGACTCCACTCGTGAGACTATATTGAATATGTTGTTGTTTATAATATCTATACCTCAAGGTCTGTGTGCACTCTTCGAGCTTGT
TAGACTCTACTTCGTGGGACTACAATGAGTATGTTATGTTGTTAGAATCTCTCATGTGATGATAGTGGAACAAAACTTGATTGAACATAGATAGTGGTGG
AAGTAGGAATTTATACAAAGGGATTCAAAAGTGGTAGCGATTTCTGAAATCCTTTGGGCTTTGTCACCTCAATAAAATTATCTTATGTCTAGGGGATTCA
ACTGTTTTAATTATGACAATAACGTCATACCAACCCACTGTAATTGTAATCTCACAAGTGGGGTATGGGGAGAATAATGTGATGGCTTTTGTAATTGAAC
GTCCTGGCATGAAATCGAACTGGTTCTCGGAAATAAACATGTTCCTCCTCACCCTTCTCCATCACCTCTCCCAAACCTTCATAGTGTGGCTTAACAACTT
GATACCCTTATAGTTGTTGCAATTCTGGAAAAATTCCACTGTTTTTATAGAACTGAAAAATTCGTTTTTTAGCCCTGTTTGCATCGTATGGTTTTTTCAT
GAAATGGTCAATGCTCATAGTAGGTGTAGAAATATATTCAGACGGGAGATTATTGAGGAAACTGTGGAAGATTTAAAAGAGATTTAAGAGTGATCTTTAG
AATTCTATGAGAGACTATTGTAGGAAAATGGAGCATTCGGAACCAGATTGATAGGATGATGATTTGATATTCTTAATACCAGAGTATAAATAATGTTACA
AAATTCCTTAGAGAAAAAAAAATGAATCTATTTTTGGTAGAGAAAGTGAAGGCAGTTGTAATAAGCAATGTTCATGATAAGGCCCTTCGTCATTATTTCT
GAGATGCCTGTTAATGTTGGAATTTTTTTTGAAGGGAACCTTTTTTGGGAAAGTTTTAGTGCCGCCTTTATTGCTGTAATAGCAAAGAACATAGACAGTT
GAATTGAAAGATCTCAGACTAATTAGCCTTTAGTTAAGAGGATATAATCCTGCCCTGCTTGTTAGCAGATGATGGCCAAAATGCCTGTTCTATTTCTAGG
GGTGATGGGGTCTCTCATCTTGGTGATAATATGGACCGTGAAATATGAGTGGATAAAAGGTTTTGGGATTGGTAAGTAAATAGAAGCATAGTGGAAGTAT
TGCCCTGCTTGTTAGCAGATGATACACACTGTGTGGTGCTGAAGTAGTGGTAGTCGAATATTTAAGATAATAGTGCTCCCAGCTGTTGTTGCTATTGCTG
GGTATCACATTAACTTGACCAAGAGTAGCATATTTTTGGTGAATGCTAGAAATTTAGTAGATGAGCTGGCAAGTACACATATTGGGGACTACAGTGGAAT
ATGTCCCGCCAGATTGGCCGGATGTTATCAAATGGTGTGGAACTAGGACCTTGAAAGAAGTAATATCTTTCTTTTGGAGGAAGGGTGACATTGATAAATA
ATGTATTAGATATTTCGGCTGTTCAAATTCTTACCGAAGTTGAGAAACAACTGGACTACTTGAGATGTAAAGAGATGCTGTGAAAGAAAGAAGGTATATT
TGATCCAATGGTCCACACTGACAGTTGACTAAAGCAAAAACTAGTGGAGAATTAGTAGTGAAGAAACTAAGGCTTCATAATAGGAGCCTTCTTTTCCAAT
GGCTGTGGTATTCTGCAGAAAAGGAAGAGCTATGGAAGGAGTTGGTAAAAGAAAAATATGATGTGGATAGACAATTAGATAGAAAGCTCGACATGCTTGT
CATGGTGGCTGTATGTAACAGAGTAGGAACCTATGACGAGTTTTCAGAAGTAATCAACTGAAACTGCATTGTGGTAAAAGATACAATTTTTATAGGATTA
GGATAAGGTGCTGGATAACTACAGATCGAGGGAGGTGTGAGGTTATCTTGCCCCTTGGCCAACTGCCTGAATGATGATGAGGAACCTATAGTATAGAAGA
AATCTGGAGGATCGAAATATTGAAACTGTTAGCTGTCAGACCGGACCGGATCCTACTCAAGAGTACCAGACCTAATGCCAGCATGAAGGATGATAATTTC
TCAGTTAAGTCTTTTTATGAATGGTTATAAGCAGAGTATGATGGGATATTGGCCATTTGCCATGGAAAATGATTTGGAAAGCAAATGCTGCTGGCTAGAG
TTTCTGTTTTGAATAAATTGTTTTGCATGAGGAATGTCTAAGACAGGACAACTTGCCAAAGTGAGGAATTAGTCTGTGCAATAGATGCTTTTTACTGCAG
AGAGAGGCTGTCTTAATGGAAATACCTATTGATGTAAATAAGATAAATCCTTACTTGGTTAAAAGAAAAAAACAAATAGGGTATGGGTGAATTGTGGATG
CATTAAGCAGCTTGGGTTTGATTTTGGGACTATATGGATGAAGTGTGGATGCACTAAGTAGCTTTGGGTGGGGTGGGGTGGGGTGGGGGTAGAGGTTTTA
GAAGAGCCAGAGAATGCTTTGGAATATGATTTCTTTTCTATGTTTGGGCAGTCAAAGAATGGAAGGAAGCATAGATGTTTCAGGATATAACCTTATCCTT
ACTGGGAACTTTCAATATTCTTACAGAATATGTACTTTTGTAGTAATAGATGATCCTGTCAATATGGTGGAATTCATAGACTCCCTGCACTCTTACAGGG
AATGATTCCTCACTCATTTTGTACTGACATAGCATCTTCTTGATGCTGGTTATTGACGATAAAGAAACTTAATTTTCCTATAAAAAAATGTTTTCATGTT
GTTGGTACATAAATTATTGGGGTATTGCTACTTTTCTCTTTATGTTGTCTTACAGATGGAATAAGTCTCTTCATTTTTTTATTTGCAGCTGAAAATGCCT
AGAGTTAAGACAAACCGTATAAAATACCCTGAGGGTTGGGAGTTGATTGAGCCTACGTTAGCTGAACTGGATGTTAAAATGAGAGAAGGTAAGTAATTTG
ATGCTAGGTGGAATTCAGCAATCCCATTTTGCCTTTTTTAATTGAAATTCCAGACCATTAACTTCTGTTTTATTTGGGTTTTGGTAGCTGGCAATGACTC
TAATGACGGTAAAAGAAAGTGTGAAGCACTCTGGCCCATATTCAAGGTTGCACATCAGAGGAGCAGATATGTATATGACCTTTACTATGGAAGGAATGAA
ATATCTAAAGAGCTGTATGAATTCTGTTTGGAACAAGGTTATGCAGATCGCAACTTGATTGCAAAGTGGAAAAAGGTAATTGATGGCAACTTCCTTTGGA
ACTTATAAAATCTGTCTGTTCTAGTTAACCGCCCTGCCTCTTGCTCATCTAAAGTCAAAGTGAAAAAGTAATAAAGAGGGTGAAAATTTGTGATAGCTAC
AGTTTTTCTCTCTTTACATCTTTGGGATGCATACAAAACCCCTTCATCTTTTTAGTTTTTTTTGACAATTTGCCCATGACAAGGGAACAAGAGCAAATGC
CCAAAAGCACAGTACAAAATGAAAAACTAAAAAAGGCGTTCTTTTCTTTTCTTCCTCATCTGCTGACTTCATCTATGTCTGTTAGATTTTAATATCCTTT
CTAGGGAAATATTCATATATTTACTAATCTTTCAACATATTATCCATATTAAACATTGTTTGTCTTAGTTAGATGCTAGTTAATGGATGGAAAAGTTTGG
AAGATAGGAGGCGTATTTTATTCCAGAAACTTGAAGCTTACCAAGATTTAGCATGTTTTGCCTCTGGAAACAGATTCATAGGCATTCTAGGAAAATGATT
CTTCTTCTTTTTCTTGGAGAGGAGGTGTGATCTTTTTAAAATACCTGCACCGTTCTATTGAACTGTGTTTGACCCTTTGCTTCTTATCACCCATCAGATA
CTTTCTTGCTGAGACGGTAAACAAACGTTTTTCAGGCTTACAGCTTATTTACAGGCACTAAAACCCATCTTACCAGCCTTTGTATTTGGTCACTTGTATT
TAACTCTTTCCTGTTTCCTGGGATTCGACTTGCAGCCTGGATACGAGCGTCTCTGCTGCTTGCACTGCATACAGCCCCGGGATCACAACTTTGCGACTAC
TTGTGCGTGTCGTGTCCCCAAACACCTCAGGGAAACTGCTGTAATTGAATGTGTACATTGTGGATGTCAAGGTTGTGCAAGTGGTGACTAATTTGCTTTT
CCAATAGCTGTATGTTATGAGATCAGATGTTCTTACTGGCTTTTCAAAGCATTAGAAACCTTTTGTCTGTAATGACCAAGGATAGTGATGGATTATTCAG
TCTTTAACCTTTTATCCTACTTGACTTTCAGACTATTTTTTTTTTTTGGTTTTTCGCCCGGTGTCTCATGCTCCCATTCAGACTCCGACTAATCCAAATT
TGTGCTTCATAAATCGCTGTCTAATAGGATTTTTGATACTCAATACTCAAATTTGAAATCTCTGGTTAAGATGAAAGGATTCTATCTATCCACTACAACC
CTCGTTGGTGCTCGACTTAACGAGTAGAGAATGAAATTAATTCATGACAAGTAAAAGTAAACAGATGTTCTTTTAGTTCTACGATCAGTTTAACATGAAT
TCTATAAATAAAACACAAGTATATATGATCATTTTTATAATACATAGTTATAAGTGATATTGTACTCTGTGTCTAAACAGTTGTACCTTTGGTCTACCAT
GATTATTGCTAAAAAAATACTTAAAGTTAAGCAGAAGTACACTATGTAGGATGTGTTTAATGGGTGTTTTCCCAACTAATCAACTTTATTACCTTAATTA
TTATAAAAGAAAAATCACTCAAAGTGGAACATAACCTCTCTCACAAGTCAACTAAGTTAGATTAATCTCCACTTAGTCAAATATTTTCTCTTTTCTTATC
TTAATCTCACCTATTTAAATTATATATGTACCGAACTTATAAAATAACACTGATTATATTGTTGTATATCGAATGTGTAAATAACTTTTTATACCATTGA
TATAATTTAATGCTTTTTTACTTTTTAAATATCATTTAGCTATGAAGAGTTTCATTTTGCTATAAGTCAACTCAAGGACCTACATGTTTTAAGCTAATAG
TTCTCGCTCAAATTTTAGGAAAATTAAAAATGTACATATTATTTTTCAACATCAAATCTACAATATTAGTTACGAATTCAAACGACTAAATATCTAATTG
AGAACTCAGTAATTAAAACGATTTACTCTATTCGATAGCATTAGAACTTTGTCTCGACTTTGGAAGTTTTACATAACATAATATCTCAAAATGGCAAAAT
AACTGTTTTAAAGAGGAAAAAAAACACTCACTTCTCCTAATTTGACCAGAATTTTTTAGAAAAATTGTTCACTTTTTTGGTTAATCTTCAACCTCATCAT
TTCTCACCACCCCACTATCCTCTATGGGGTTGGGGGAAGTACTAAAGAAGATATTGCCTAGTCCACCATGAAGAAAAAAAAAGTTTTATAAATATAAGAT
ATTTTTATGTTTTATAGTATCTCAAGAAACTTAAAAAGTTATATTCTTGAATTGAAACATTTCTTGATAATCTTGTATGCAACATCTAAAAATATTGCTT
TTTTTATTTTTTATATGATCCTACAAAAAATCTTTGATCAAGAATTCATTTGATTATTGTTTTATGAACAACTCTCCAAAATGTTGTTCATTCTGTACTC
CCTTTGTCGAAAAATTACATTATATACATAAGCTCTGAAGTTATTAGTAGACGTTGAATCCCTTTGGCTTCTTCGTGAGTTCTTTTCGTTATATTTTGAA
TCATGTTAGTGAAAATACTGACTTCGCTCTGGTTAAAATCTTGATCATTCTTCGGGAACTCTTCAAAAGATTTGATCTTTTCCTTGTTCTTGATGTGTTA
CTATTAGTGGTATAACAAGTGTTGAAAATGATGGAGGGGGCATTTGTGGGGAATGAGTTAGCAAGATTGAGAAGTAGTAATAGTAGGGGAACAAGTTGGA
GGTCATCTCAAAGTATTATGGAGGTGCTAGGAGGGCAAAGGGATGATTTTTTCATGAAGAACTATAGTACGCGATGGCGAGAGATGGCAGAGGAGGAGGA
GAAGGAGCTAAAATGGGCTGCTATAGATCGGTTGCCAACGTACGATAGAATGAGAAAAGGGATGATGAAGGAGGTGATAGGCAATGGGAGGGTGGTGCAT
CATGAAGTTGACATGACTAATCTTGGTAATCAAGATAGGAAGGTACTCATGGAGAGTATACTTAAGGTTGTGGAAGATGATAATGAGAAATTTCTTAGAA
GACTCAGAAATAGGACTGACAGGTGATTTCTCGTTCTCGTTACTAATAACAATCGTTTATACTATCAGTATACAAAAGTTAAACTCGATGCACAATATTA
GTACTCTTCGTTCTTTTTTTGATCATTTCAGAGTTTAGGTACGATGAAGATGTTACATGTTCTCTTTCTAGTTACTAATTTCACTTATTATGAATAGTTA
CATGTATTCTTTTAAATGGTGTGACATCATAACAATCGTTTATACTGTCAGTGTATAAAAGTTAAACTCGATGTACATACAAGTACTCTTCTGTTTTTGA
TCATTTGAGAGTTTTAAGTATGATGAATATGCTGCATGTTATACTATACTGATGTAAAATTTTACGCTGAAATAGGGTAGGGATAGAGATCCCGAAAATT
GAAGTGAGATTTGAGAACTTAAGTGTAGAAGGAGATGCATATGTTGGGACAAGAGCATTACCTACACTGCTGAATTCCACCTTGAATACCATGGAGGTAA
CTGTTTTTCCTCCTTTTCACAAAATTGTATTCGTCATACTAAAAGCTATGTTACTCGTACTCCAAAAAAGGTTGTCTCATCCGTGTCGGATCCTCCAAAA
TATGCTAGTTATGGAGGGTTCAACATGCACCTGACGACATTTTTGAAGGGTCAGAGCAGCATAGACGAAAAGTAAGAACAACACCAAAACAAGGATGAAT
TGTATGGGGCTGTCCTTCGATCGCACGTGTCTGTTAGTAAAATTAGAAAGAATCATAGTAGAGTTGTAAACAAGGATTCTCCAAACATGTTGCCATACCC
GTGTTGATACCTCCAAAGATGCACTACATTTGGAGGATCCGTCACACATGCATCAGCATCTTTGAAGAGTCTCTAGATAAATCATTCTTTCTAAATGCTC
CGGTTTAATTAGGAGATTTTATAGAAGATATATGAATTCTTTGTTCTTAAGTTGAACTTATGACATGAACAGGCTGTTCTTGGATTGATTAATCTTTCTC
CATCCAAAAAGAAAGTCGTAAAAATTCTTGAAGATGTGAGTGGAATTATAAGACCATCAAGGTATGTTGTCTTCTTACATCCTAAAAGCTTGCCTTTGTT
TCTTGATTTACATTACAAAGTTAGTAAAAAATAAAAATTTTGAGTTCATTCCTAAGTTAGTAGTTGATTAATGTTCTTTCCCTTAAGTGGTACGAAGCAT
GTCGCTGCCAGAAGCAGAACCCCACATTTCTTCTAGAGAATCTCCGAATTGTTTTAGAGCAAACAAAAAGAGATCCTTAAGCCAGAAGTAATTTGGTTTA
GATGTAGGATACCTATTCAGAAGTTTACACGACTCAATCATAGATGACTGAATCATCAAAGCTTTGATCTTTTTAAGTTATATTTTGCTTTGTCTTTAGC
TTGTTGCTTATCACTTATGCTGAGTTGATTTCAGGATGACATTACTCCTAGGGCCTCCTGGTTCAGGAAAAACTACATTGTTGAAAGCACTTGCAGGAAA
GAGCGAAGACGGTCTGAGGGTATGTTCATGCCGATACTTCTCTTTCGTAGAAATTGTTTACTTATATGTCAATGTAGTTTCAACTTATCGAGGACATGAC
CATAGATAAGACTTAGGAGGTTGCAAAGGACACAAACTAGGATAGAAGGTTAGTAGGTAGTAGAGTGTTATCTTGCTTATCCTTCCATGCTAGTGGCCAT
AGTGTATCTCCTGTGGTTTTTTTGTCCTTTGATTTCTACTACTATCTAGTGTCTCTTGTACTTCGATTATCGCACTATTTTGTTGTAGTTACTGTTCCTT
TTATATATTAGGGATAAGGTCTACGTACTCTCTACTCTACCCTCCTCATACCCCACTTGTGGGATTATATTGGTTATGTTGTTGTAGCTGAATCGTGAGT
TATATTTTGCAGGTGACAGGAAAAATTACGTATTGTGGGCATGAATTTCATGAATTTGTTCCTCAAAGAACAAGTGCTTATATTAGCCAACATGATCTTC
ATCATGGAGAGATGACAGTTCGTGAAACGTTAGATTTTGCTGGAAGATGCTTGGGTGTTGGAACCAGATATGACTTATTGGTGGAGTTGTCGAGACGAGA
GAAAGAAGCGGGTATAATGCCAGATCCTCAGATTGATGCATTTATGAAAGCCACAGCAATGGAAGGCCTAGAAACAAGTCTAATTACAGATTATGTACTC
AAGGTCTGTAACTTCTGTTTTTTTTTTTCTTTTTAGGTGTCAACTTTCTTGCTTGTGCCAAAATCCATTATATTAAAAGTAATGTCCCGTTTCCAAACAG
ATTCTTGGATTAGATATTTGTGCTGATATCATGGTTGGAGATGATATGAGACGAGGCATTTCGGGTGGACAAAAGAAACGTGTCACTACTGGTATATATT
TCTTAGGAAATTATACATAAATAGACACTCAAACTTGGCATCAACTGACAAAGAAACACTCTACTTTGAGTGTGCACATCTTAACACTTCAACTCATATC
CACAGTATCAGTTGAACTCTCCGACTTACAAAATGATCATCTAGCCACCTCCAAAGTTTATGTGTGGTGTCCATGAGACACACTTGAGACGAGTTGGAGT
GTTTAGTTGCCAGTTGAGACCAAGTTGAGGTGTCTAGATGGGCACTATCAAAGTTGGAGGTCTTACTTGCCAGCTAAAAGCCAAGTTTGAGTTTCTGTTT
ATGTATTATGTCATTTCTTAGTCTATCTTTCTTCGTTGTTTTGACCGTTTTCTTATGTTCGAGCTCATCATTTTTTCATTATACTTTCCTTAATGGATTG
TCTTTTTTTAATGAAATGAAGGGGAAATGTTGGTTGGACCAGCGAAAGCGTTTTTCATGGATGAAATATCAAAGGGGCTGGACAGTTCCACCACCTATCA
GATTGTCAAGTTTATGAGGCAAATGGTTCACGTTAACGATATAACTATGGTTATCTCCCTCTTACAGCCTGATCCCGAGACATTTGAACTATTCGATGAT
GTTATTCTGCTTTCAGAAGGTCAAATTGTTTACCAAGGTCCGAAAGAAAACGTTCTTGAATTCTTCGAATACATGGGATTTAGATGTCCAGAAAGGAAAG
GAATTGCAGATTTTCTAGTGGAAGTTACTTCCAAGAAAGACCAAGAACAATATTGGTTCAGAAATAGCAGGCCATATGTATATATATCTGTTCCCGAGTT
TGCTGAGTCCTTCAATTCTTTTCAGATTGGTGAACAAATTATTATAGAACTTACGATTCCATATGATAAGTTCAGTGTCCATCGTGCAGCATTGGTGAAA
AATAAATATGGTATTTCCAACTTGGAACTCTTCAAGGCATGTTTTTCAAGGGAATGGCTGCTGATGAAACGAAGTTCGTTCTTGTACATCTTTAAAACTA
CTCAAATCACTATCATGGCAACTATTGCCTTGACAGTGTTTTTAAGAACACAAATGAAAGCTGGCAATGTAAAAGATTCCGCTAAGTTCTGGGGCGCGTT
GTTTTTCAGTCTGATCAATGTGATGTTCAATGGGATGCAAGAGCTCGCGATGACAGTTTTTAGGCTTCCTGTGTTTTTCAAGCAGAGAGATAGCTTATTT
TATCCAGCATGGGCTTTTGCCTTGCCAATTTGGGTGCTAAAAATTCCTATTTCATTAGTGGAATCATCAATATGGATCATCCTTACATACTACACCATTG
GCTTTGCTCCTGCAGCCAGCAGGTTAGTTGCACATTCACTTGACATGTGAAGCTTCATTCATTTTAGTACTACTGTACTGTGTAGTTTACTAATCTTTGT
TCCCTTTCAGGTTTTTCAAGCAGTTATTGGCATTTGTCGGTGTCCATCAAATGGCTCTCTCTTTGTTCCGGTTTATTGCAGCAGCAGGAAGAACACAAGT
AGTTGCAAACACACTTGGAACCTTCACTTTGCTTCTTGTGTTTATTCTTGGAGGCTTCATCGTCTCGAAAGGTCACAATTCCATTGCTTTAGCTCTATGC
CTCAAATCATTTTTACTAAATTTCTAGTGCTGAAATACTAGAATGTTTTATACAGATGACATCCAAGATTGGATGATTTGGGGCTACTATCTGTCCCCTA
TGATGTATGGACAGAATGCAATTGCCATAAACGAGTTTCTAGATGATCGATGGAGTGCTGTAAGACCTGATTTCCGTTCACCTTCAATTGAACACACCAA
GGATAACGGATTCTAACTTTTTCGTTCTTTTGTCACAGCCAACTAATGGTTCCCAACCAACAGTAGGGAAGACTCTTCTACATGACAGAGGCTTATTTAC
CACAGAAACTTGGTATTGGATATGCATTGCAGCACTTTTTGGATTCTCACTTCTCTTCAATGTCCTCTTCATTGCAGCTTTGACGTTTTTAAATCGTATG
TTCCCTTTTTATGACATTAACTTTCACAACTCAATTGTAAAGAGATCGCGGTATATTAACTCAAAGTATGATCAATCTCAGCTCTCGGAGATATTAAATC
TGTCAGTGTTGAGGACGACGACAAAAACAACAGTAGCCCACAAGAAAAAAGAAAAGTTGGAGGTAAGTAACTTCTAGATTTCTGTTTTTGTACATTTTCA
ATCAGCAACTTCTTCAGTTATTTTGTTGTAATGGAAATGAAATGATTGAAGTAATCAAAGAGACAGAAAAGGGCTGTTGTAGATAGATTTAATCAATAAA
CTAAATGAATTATTCACTCCGTTTCAATTTTTGTCTTACTTTCGTTTTTAGTCTGTTTAAAGAATGATGCTTTCCTTTTTTGGCAACTTTTTTATTCTAA
TTTTCCACGTGGCATGTTTAAAACCACAAGATTAGAAGACATTTTTGTACATTCTTCGTATCTTTAATTTAAAAACACAACATTCAAAAGTGACTTTTAC
TTTCTTAAACTTTGTGTCAAGTCGTAACCAGACAAACAAACTGAAACGGAGGGAGTATTTAATATCTTCTAAAGTTTGGACTTCTATACAAGCCATCAGA
AGTCTTTGAATTTCTCTTTGCTGTATTCGTGACTTGTCATCCTTTAAGGTTAACCTGTAGAGCTAGAATAAACACACAGATTGAGACTAATTCGTCGTGT
AATAATTACTACCACAGGTATTCAGATGGCAGCAACATGTTCTCAAGTAAACACCAGCTGTGTTGTTCCTTTACCGATTAAGGAATCAAGAAAACGGATG
GTCTTACCGTTTAAGCCACTTTCACTAGCATTCAACCATGTGAATTATTATGTTGATATGCCTGCTGTAAGTTTTTTTTTCCAATCTTATTGATGATTCT
CACTGTTTCTTTGTTATGAGGCTTATCGTGAGTAGTTGAGATTAAATGGAATAGTCAGGATTCATATAGCCGACCCCAACTTGTTTGGGACTGAGGCGTA
GTGATTGTATTATCACTATAGCTCTCTAAACATGGAAGTTTTGTTTTATCAGGAAATGAAGACTCAAGGAATTGAAGAAGATAGATTGCAACTTTTACGA
GATGTTAGTGGTGTTTTTAGGCCGGGGATTCTTACAGCCTTAGTCGGTGTCAGTGGTGCTGGAAAGACCACTTTGATGGATGTCTTAGCAGGTAGAAAGA
CAGGTGGATACATAGAAGGAAGCATAAAGATTTCAGGTTACCCAAAGAATCAGACAACGTTTGCTCGAGTCAGTGGTTACTGTGAACAAAATGACATTCA
TTCACCATATGTTACAATCTATGAATCTCTCCTCTACTCAGCCTGGCTTCGTCTTCCCTCCGATGTAAAGACAGAAATACGAGAGGCAAGATAGTAGCAC
TCCCCTCGTTTCAATTTTGTTTGTCTTACTTTCTATTGAAGTCCATTATAAAAAGAATGCTTCTTTCCGTTTATGGCAACTCTTATAATTTTTCACGTAA
CATGTTTAAGACCACAAGATTAAAAGGGCACTTTGGTACATTCCAAATATCCTTAGTTTAATACCACAAGATTCAAAAGTCTTATTTACTTTCTTTAACT
CCGAGCTTAGTCAAAACCAAACAAACATATTGAAACGGGTTCACTTTGAATACAAACTGTGTGATGGTTTCACTAACCTTGTTTCTTTCCAAGTGCAGAT
GTTTGTGGAAGAAGTAATGGAATTGGTAGAGCTCAAACCATTGAGGAATGCTCTTGTTGGGCTCCCAGGGATAAACGGTCTTTCCACTGAACAGAGAAAG
AGGCTGACCACTGCTGTCGAATTAGTTGCTAATCCATCCATCATCTTCATGGATGAGCCTACATCAGGACTTGATGCTAGAGCTGCAGCTATTGTTATGC
GTACTGTCAGAAAGACGGTGGATACAGGAAGAACAGTCGTCTGCACGATCCACCAGCCTAGCATAGATATTTTTGAAGCTTTCGATGAGGTATTTATCGA
CTCTATCATGTATAGGCATAATTCCATTTTGTAAAATAAGTCATGATAAAACCAAATTTGTTGTTTTAAGCTACTTTTGATGAAAAGAGGAGGACAAGTA
ATATATGCTGGACCTCTTGGCGCTCGTTCCCAAACGATGGTTGAATATTTTGAGGTTAGTTGTCTCTCAATCCTCTGCCTTTTTTTAAAGGTGAAATTTG
GAAATAGAAAACTTCCTTCTGTCATGTATCTTGATTAATGCAACATCAAATGCTATGTTTCATTCTCGATTCTAGTATTCCAGTGAAATGATTATGTCTA
AATGTTCTGCATTATGGTCTAATTCTACTCTACTAGCACTAATAGACAGCATACAGGTAGAAGCATTACGCCTAGGAATCAACCACACGGAAACTTTGTT
CTAAGTCTGTCCTTTCCTTAGCGGGCTTGGGAATAAAAGAATGATGAGGCTGTATATCAGAACTCTCTTCTCTCATAATTCAAAAGGTTTTTAATTTTAA
ACTTCATTTTTTTCGTTCTGCAGGCCATACGAGGGGTTCCTAAAATTAGAGAGTGCGATAATCCAGCTACATGGATGCTTGATGTCAGCTCATCTTCTAT
GGAAGCAAAACTTGATGTCGATTTTGCTGAAGTCTATGCCAAGTCTGATCTTTATCAGTAAGTTCTTGTGGATACTGCTAAGCTAATCTGTTGTTATGGT
TATGACTTGACATAATCTTGTTGTCTTAAACGAACGATACGTAGAGCATACCAATATGCCACATGCCATATGAAAAGTTAGAAGTAAAGAGTTGTCAAAA
AAGAAAAAAAACCGCGTTCTTTCTGAAACGGACTAAAAAGGGAAAGACGGAGGGATATTAACTAGAGTCTCAATTTGCATTGCAGGAGAAATCAATTGCT
AATCAAGGAACTCAGCACACCAGCACCGCGCTCGGAGGATCTTTACTTCCCCACTCAATATTCCCAGTCCTTCTTAACTCAGTGCAAGGCATGTTTCTGG
AAACAAAACTGGTCATACTGGAGGAATTCTCAATATAATGCAATCAGATTCTTCATGACAGTAATCATTGGGATTATGTTTGGTGTCATCTTTTGGGATA
AAGGGAACAAAATGTAATCCTGAACTTCTTTGTTATAAGCTCGATTATGTTGACGAATTTCAAACTGTGAAATGTTTTTGACTTTTTCTTATCCTGTGAA
ACAGATACAGACAACAAGACTTGCTTAATCTACTTGGAGCTACTTATGCAGCTGTCATGTTTCTTGGAGCCACAAATGCTTCTGCAGTACAATCTGTTGT
GGCTGTTGAAAGAACAGTTTTCTATCGCGAAAGGGCTGCTGGAATGTATTCAGAATTGCCTTATGCATTTGCTCAGGTATCACATAAACTTCCCTGAATA
CATGCTTGATCTTCACTGATCTCTTAGTCTAGTAGCGGAACCAGAAATTTTCCCCATAAGCACTTTTGAATCCTTTTAATATCGATTGATTAGACAATTA
GTCATATTTAATATTCACAAAAAGAAATCTATCGGAAACAGCCTCTCTGTCCGAAAAGGTAGAGGTAAGGTCTCATACATCCTACCATCCTCAACAAACG
CAGTATGTTGTAAGAAATATTGACATTTTTCAAGTTTCTCAAAGTATAGCAGTTGGTTATGAGATTTTTTCGGTTTTATGTGATTTGCAGGTGGCTATAG
AGACCATATATGTTGCAGTACAGACTTTTATTTATTCTCTTCTATTGTTTTCAATGATTGGATATGAATGGACAGCAGCAAAGTTCTTTTACTTCTACTA
CTTCATATTCATGTGCTTCACCTACTTCTCCATGTATGGCATGATGGTTGTTGCTTTAACTCCTGGTTATCAAATCGCTGCTATCGTCATGTCCTTCTTC
CTCAGCTTCTGGAACTTATTCTCCGGTTTCCTTGTTCCTCGTCCTGTAAGACAAACTACTAGCAACCAAAACTTGAACATTTTCTTGATATAGCTAAAAA
CTTACAAGGTGTTTGTTTGTTTGTTTTGGTTTTAACTTTGTACAGTTAATTCCAGTGTGGTGGAGATGGTACTATTGGGGTTCTCCAGTTGCTTGGACAA
TATATGGGATTTTCGCGTCTCAGGTGGGAGACAGAATCGATGAACTTGAAATCCCTGGTGTAACTGTGAAAATGCAGGTGAATCAGTTCATGAAAGAATA
TTTGGGATATGATCATGACTTTCTTGTAGCTGTGGTTTTTGCTCATGTTGGTTGGGTTCTTCTGTTTTTCTTTGTTTTTGCTTATGGAATCAAGTTCTTG
AACCACCAAAAAAGGTAGAAGGGGAGAAATTTATCTGAATACACTAAAGTTCACCTTAGATACTAAGTTATATGTTTATTCTATGAGCCAAAGGGTTCAT
CGGAAACAACCTCCCAAGGTAGAGATAGGGTCTGCATATACGAACTCCACTTGTGATATTACATTGTGTTGTCGACGTTAGTTATATGTTTTACACCTTC
AAACAAAAGAATTGTCTAGTGCTTTAGTTTGATACAAAGAAGAGCTTTTGCTTGTTGATTCTCATTCTAGCCAACTCCGCCCAGCAAATGAAATGAAATC
ACTAACATCTATGAGAATTAAAGGATATCATTTATTGTCTTTTGTTGTTACGAAATACTTCATCTACTAAAAATATAATGAATTATTAACATATAATTAT
TATTTAATATTTCAATAGTTTTTCTAATAATAATAAAACACTTCATCTACCAAACTCCATTTTAAAATTGATTCTATGTAGATATATAATGAATTAATAC
CATATAATCATAATTTAACATTTTGATAATATTTAAATTAATGAAGGAGTAAAATCATAATTCAAAGTTGAAATTTTCTCACTTATAATAATACTAGTTC
CTGGACACGTGCATCGTACGTGTTATCCAATGTCAATTGCATCACAAGAAATAATCTTAAATTGCTTACTTAACTTTTTAACTTTATTTTTCCATCACCA
CAATAATTGTTTTCAAAACTAAAGATATATTGAACCTTGATAAAATGACAGGGAACAAATTTTAGAAATTAATTAAATAAAAATAATAAAGCAATATTGT
ATTTCATCTATAAAACAAAGTAATTATAATAAACTATAAATAATGAACCAATGGATTAAACTAACAAAATCAGTATACCGGAGAAATCAATTATCTAAGC
TTTTGAAGCTTCCCTTTGAGTTTTTAAAAATAATTTTAGTGGCAATTTCAATTTTCTTTCAAGATCAACAATCCATCTAGTATAGTAAAATTGCATCAAC
ACTCTAATTTATCGATATTTATAATCATAATAAAATTTAAAATAAAGATCCGTTAAACCTTAGTAAATAATGACATGGAACAAAATTTTAGAAACTAATT
AAATGAAAATAATTAAGCAATATATCATTTAACACTCCCAACAAATACACTATACAGTGATAACATATTAAATTGTACACATTGTTTTTCATCTTTAAAT
AATATAATCATAAGAAACTATAAAGAATAAATCAATTAATGAAATTTATAAAAATCAGTCTTTCAAAGAAATCAATCTTCTTTCTTTCATACCTCATGAA
TCTTGCTAATGTTGATTATGGAAATGGTAACCTTCATATATCATCCCACAAAGTTTAAATTCGGCAATTCTTTGATTCCATTATATATTCATTAACTCTA
CATACTTCATCATCTATTATTTCATGTAAATGTTGCTTTAAAGAAAAGAGAAAAATAATGAAAAAGAAGTCGTAAAACAAAGATTAAAGAAATCCTACTC
AACTGAAATATGTCCATGAGAAAAATGGAAACAATTTTCTTTGATGCTCTTTGGGATTCCTTTAACAGATTTATTGATTATATGTATTAAATTAAATTAG
TCTACATTTAATTACTATAGAGCTTTTGAAATTCAGCATATATATATATATATATATATTATGCATAGGACATGTACCATTTATTATTTATTGTAAAAAG
TTATTTTCTTAATGGTAATTTATCAATTAGTAATGACTTTCCAACTTCTTCATTGTTTCACTTAGAAATAACGTTTCATCTTTTTTTTCTTCTAAAATTC
CATGATTTTTGATAATGTAGTACAAATGAAATAGATACATGAACTCTCTAATTCCACATTTAATTTCTTTTTCAATTTTTCTCAAGATAAAAAATAGTTA
ATGAATTTTGTATGTGCATTTAATATCTAAATAATTTGACGTGTTATAATATTTTAATTTGGTGAAGGACAGTTTCGTAATGTAACTTTAAACTCAAAAT
CTTCCCACTTATAATAATACTAGTATCTGAAATGTGCGTTGTACGTTTGTTCCTTAATATTTTATTTTAAATATTTCGTTATAAAGTTCAGTTATATAAT
AAGAAATGCAGAAATTAACAATTTTAGTTATGATTTAATCTCTTATGGTATGAATATGTCTATGAATAGCTAATTGTTTTTCCAGATCAAACAACTTATT
TATTGAAGTAGTTTACAATGAATTTCTACTCGAAAAAAATATTAAACAGATATAAAAGTCTTTGACGAAAGTAGCAAAGACATGAAGAAGAAATAAATGC
AATTCTAGTTATTGCTGAAATCACAAATATAAAAATCTTTTTCTTTTGTGCTTATATGAATTACATTCTTTTTTTAAAAAAATATACAATAGTATTTTTT
AAATGAAAATAAAAAAATTGACGAACATTATTTTCATTTTCGAAGATCTTTTGATCTTTGTTTTCATAAGATGAAAATTAATTATACGAATCAAAAGATT
AATTTAAAAAATTGGGATAAATAGTTCTAATTTAAAAATAATCATTCCCTTTTCATATCAAACACTATATCACTAAACATATTAAGATTGAGGCTTAAAC
CACACATACATATATAAAAAGGATAAATATACCTGGAAAAAAATAATCTCTAGCAGAATGAGAATGAATGGAAAATGAGAGATAGAAAACTAGTTTTGTA
ATGTAAAGAATATGAAAAGGTGGAGAAAATTATATGAACATTGATCAACAATAACTAAGAAAAATATGACATGAAACGTTTTTGAATTGTAATCAAAGAG
ATTATGACTATCTATCTTCAATCTTAAGTATTGAATTTAGTGTAACGCATTAAGTTCGGCTGGAATGAGTTTAACTGCAGAAACTCAAAGGATCAATAAT
TAAAGATTAAAAAATAACTGTTTTGCTATCATTATTTATTTAATTTTCAAATTTTGTAAATGACATTTTCTAATTTAATAAATAAGTGAAGGGCATTTTA
ATAAGCTAACTTTGAACTTAAAATCTTCCAACTTATAATAATATATGATATGATGATATATATAATAATATATATATATATATGATGATATTTGGGTGTA
TCTACTTTCATCAAGTTAGATAGCAAAATATAATTAGCTGCAAGCAAAAGCAAAACCCAAAGCCAAAGTGTCTAGCTATCATTCAGAACATATATTTTTG
CCCTGCCAAACTAAAACTTGGTCTTTCCTTCTCATGGTGCAACTGCAATAACCTTGATCTGCTTCTTGCTCCTCACAGAACTTCGTTTCTTCGTTTCGAA
ATCAACTTTGTCCAGGTCTTCTGCAATTCCAAGGTAACCATAAAGGATTTTACCTACTTTGTCTGTCAATGGTTCTTTAGTTTCATCGTCATTGTTTCCA
GACTGACCAGAACTTATACGCTGGAAATCCGCCCTTCCATGCTTCCGATGGGCGTAGATATCACACAGTCTCACTGCTTCTTCCAAACCTGAGAGAGTAG
CGCTAAACTTCACCATAAGAATACTCTGATTTGCAGGCTTACCACGAGAAACCTTGGCCTTCTCCCCGAAGCCCATATCTGTAACAAAGAGCTGTTCAGC
TAAACTAGCGGATACAAGGATAAAAGCAATCGAACATCTGAAAATCTCATCAAGCAGCAAATCGATTAAACAATGAGGCGAAATATCCTTTCGAATTGAG
ATATATCTCTTCTTAGTCCCTAGAGGAAGTAAGGTGAAACAAATGTCTTCATCAAAAATAAAATATGCCCGAGTTCTTGAACGAGTTTGAGGGTAAAAGT
CCACAAGTAAAGGAATTTGAACCAGTACAGGTAATATCCTTTTCTAATTGTATTGCCTTTTAAAAGGGAGGGAATGAGCGGGTGGCTAGCTTTTTATTAA
TCCCCGCGACCCATTTTATTGACACACTAATAACATGATTTTATAACCAAACAAATGTATCCAGCGTGTTTCAGACCACCAAAAGTAACTTACCTCTCAG
CTTAGACTCGAGCTCTTCAGCTGATACAACCACACGCTGATCCGGATTGCTGCTAGTTATGGAACTGTTATGGATGATAACAACTGGAGGCCAGATGATT
AGATCTTCCTTCAAAGCCACAGTTTCAGCATTGGATAGCTTTTCACAAACCCAACTATCTTCATGAGAATCTGCACTCTTCCATCCCATCAAAGCACATA
AAGCTTTGTGAAGGCCTAAGTGCTGCGATCTGAGACCAGCCTTAGAGGATGTTAATGCATGACGCACGAGGCTCTCTGAGTCTACAAACTCTTCTGAATC
TCTGAAACAGCATAGAAGACGTCATAAAGAAAAGAGTCCAGTGAAGTTCTTGATGAAGAAAAGGTCCGATAAAGTTTTCAGAAACAAAACAAGGTCAATA
CAAAGCAAAGAAAATAAGCTATACAGTTCTCCAAGTAAACAGTAAATATAGATGGAATTTAGGAGCAAAAAGGTAAGCAATGACATTCTAGATACTTAAA
CAGACAAATAGACCGTTACTCAACTTACCAACCAAAAACACCTCTAAAATGAATTTAGTTTTCACAAAAGACAACAGAACTGCAGGTGTTTACTTAAGTT
CTTCATTCAGGTGGCAACTACAACAGACATTATCTTTAAACAAGACTCATCAAGAAAAATTTCTCATCTCGTCCAATACAAAATAAGCCAGTGAGAGAAG
CAAAATCCAAAGCTCACAAAGATTAACTGGATCTGCAAAGACTAGGCTAAAAACTATGTCTGCCTAACAAGATCTGGAATTAGTCGCTAAAAATGCAAAT
GCCTATAGTCGAGTATACATGTAAGCAAATTCTCCTATTTGATCATGCAGTAGGATCAACATTGACTATGGTTAAGTGGAGACGCTACTAATCATCAGAC
TTAAAATAAGAAATATGCAAACTGTTATAGCTTCTATTTAAACCCAATTATCAAACAAACTGCTTCAGCTACAGCCCCTTTCCCAAGCAATCACACCACT
TGAACATCTGGTGTGTCAAATCCAGGTTAGTGTCAAATACTTAAGGGAACAGCAGAGAGAGGTTTCTTTAGCAACTCATTCAACATCTTCCCTTTTCATT
TCCTCAAAGTCATGGTTGTTTGAACAACCAAGGTATTTGATCTTCTTTGTAAGCACCATTTTAAGATAAGGGCAAATGTACTAACTCAAAAAATACATTT
GCTCTTCATAATAAGCACCTTATATGAGATGGTGCTAACTAGCCAGATCGAGAGGAAATGCCCTAAGCTTTGGGTTATATAATTTCCTGAACAATAAGAC
TTCCGACCTACATAATTGAACTTTTTCTCCAACTCCGGAGTTTCCATGCATCAATAAAGTAATCCTTGAAACCACACTACTTAGAGCCAAATATATAAAA
AAAATCCTTATATAACGACTGTATTCAGGCACATTTCATTCCATCCGTGCAGGATTTTTTTTTTTACTCCAACAGACTTCATGGGTTGAAGCAGCATGGA
ATGAAAACGCCTCATGGGAGCCCAGCTAGTCTCCTTATTTACTTTAGCCAAATGAGTCCTCATAAAACCAGTAATATGAATTACTTCCACTGACTTGACC
GCAGCAATATAGTTATGAATAAGTTCAATTAAAAGAGAAGGAGTTTACTCCATCTATTAAAACATTTCATGATGTAAAAGACAGACCTACCTGCCACACA
CGAGGCACTTTAAACTACCAGCTTGCTCACTGAATTTTCTTCTTTTAGCTGGAGTCTCATTCAAGTGCCTCACGAACCTGAAGAAGGCATTTTGGACCAG
CTGCTTAAAATCCTTAGAGTTCTCAGGAGGTTCAGGTTTTGCTGTAGTAGTAATACCTTCTTTGGGGTCATCACCTGGTTCAACAACACTTTCATCTAAA
GTATCTTGATTTCTAGAGAGCTCATGAGAATTGAACTTTTTCACCCACGGCGGAGGTGCATGATTCTTCACTATACGGGGTCCCAAGCGCTTCTTCAGTG
AAGATTTATATTTTGTTCCTAGTGGGCGTTCAACATCAACATTCTGGTAACGTGGCCCCAGCCGCTTCTTTATATCACTTCCACCAGATTTACTAAATTT
GCTTGTACGTCTCAACATTGACACTGAAAGGTTTCTGGTGGAACTAATAGTTGCAGTGGCTTTGTGTGGCCTACCATTCTTCGCATATTTAGAGCGTGGA
ACATTTGGCTTTCTAGACATAACTACAGAATCCATATCCCTACTGATCCGCATTTTATCAGCATCTCCACGGTCATGGGTTATGTGTGCAGTCCTTATAT
CACTTGAAATCATAATTCCGGCACCATGATTGCTCATTGTGCCATGTTTTTCTCTAAGAGAAAAATTAGATGATCCAGGCAAGTCCCTTGAAATAAATCT
TTCACGAGAACCTGCCTCTATCTTCTCTAAATGGGGGTCGTATTCTCTATACAAGGCATCAGATCTTTCTAGAAGATCATCATCCATCTGATACTTATGA
AGCTCTCTTTTACGGGAGCTTTCATAGCCTCGATGTGATTCATTTTCATACTGTAGACGATTAGCCCCATAATCCAATATGTCCAAATCTGGCTTTCTTT
GGTCTAGTGCTCTGCGGGACTCAAAATAATCCGGCGGTGACCGTCTTTGTGAAGAAAAAAGAGATTCCCGTGGCTTATCTTCCATCAAAATCTCCCGATG
AGAAAATTCATCATATTTGCCCAATCCCATGTTCCTTGGAAGATTTTGAAGATGTACTTCTCCAGAACCCACTCTCTTCCCATAGAATTCACTAGACAGG
GCATTAGGACTACCAACTTCACCTCTTTGAACGTCAGAATAACTGTATGCTTCACGCCTTTCCTCAGCTCGACCAAAGTAAGACTCCGTGTAGTTCCTGA
ACCCACTAACTTGCTTTTCAGGGTTCAGAGATGATATGGTCCTGGGACTTTTATCATATCCGTCATGGCCAATAGACTCAATAGCCTTTCCACTGTCCAG
TCTACCACCATGTGAATGGATTTGGCCCTCTATACCATATGAACTGGCAATATCATCCTTATTAACTCCGGGCAACATGTTAGATTGAGATGATATCGCG
TACTCAGTATTGAATTCTGAATATCGTCTGGTCTTCAAGGAGTCCTCCATGTATGGGTCCATTGATGTCGGCACTCCTCTTCCTGCTGCTTTATGAGAAT
GGAAACCTTCTTGTAAATGTATTTCCTCATCTTTGATAGGATCAGCATCCAAATAACGTGATGCCAAAGAGTAGCCACCACTATTTCCAATGCCAGAGAT
TCTTGGCTGTGCACCAACATCAGGGAGATGAGATTCATATGAAGAGTACAACGCCCTCTTATCAGCTTCTGAAGAAATGATACCATCACCGAAACCCGGA
TAAGGCCTTCCACGATTTTCTCTCTCGCTGCTTACTCTACTACCACTAACTCCATATTCTCTGGACCCATTAACAGTATCAAACTTTCTGGGCTTATCCA
ACAAATGGCTCCATGGATACTTATTAGAAGTTGAGTCCTCATTCCCTGAGCCCTCCTTTATCTCATGCAGCCTGTGTGAATGTTCACCAAGAATGTCAGT
GTTTCCTCTATCACGATCAGAGATTCTCAAGCTCTGAGATGGCCCATAATCTCTATCTCCACCAACATAATTCATGGGTCGGGCATTCTGCAACTCTCCA
AAGTCTCCACCACCATCAATTCCCATCCTTCTCGACCTCTCAAGCTCGTGAAAGTACTCACCCCGCTGTTCACTAATCATCTGGCCACTAGGTGAAAGGT
GACGCTCCCTACTCCGTCCACGTGGTGAGCGCTGCTCCCAGTTCCTAGTCCTTACTGGTGGCGATATCTCCCTGTTCCTATTCCTTCCTGGTGAGTGCTG
CTCCCAGTTCCTAGTCCTTGCTGGTGGCGAAATCTCCATGTTCCTATTCCTTCCTGGTGGAGAGTATTCCTGGTTCCGTCTCCTTACTGGTGGTGAGCGA
TCGCGGTTCCTGTTAGTTTCCACAGGTGAGTATTCACGCCCCTGATACCTCCTTGGTGGTGAGTTTTTCCGCTCTTGAATCCTCATTGGGGGTGAGCCCC
TAATCCTCCGTGGAGACACATAATCCCTATCTCTTATCCTCCGTCTAGGCGAGTAACCCTCATCCCTAATTCTCCGTGGAGATGAGTAATCCCTGTTCCT
ATTCCTCTGTCGAGGCGAGTAACCACGATCCTTTCTCCTTTCCGGCAACCGTGGTGGACCTCTAGCATCTCCTCCAAATCTCCTCTCCCCCCTCATTATC
AACAAAAGACTAAACTTCAGCAATTTCCAACCTAAATCAACCCAAACTTCTACAGCAAACAACAGCTTCCCACTTTCAATCACCAAAAATTTCACAGCAC
AACATAAAAAAAAAAAAACTAACTTGCTAATCAACAGCAAAACGACAGATCCCCGAAACCCTAACCCTAAAATAAATTATATATTCGTCCGTAAACTTCT
TTCTACCGCTAAAATATATTCGATTCAAGCAAAAGGGTATTCAAAAATACCTCTTTCAGATCAAACAATCCGCAAAAACGCGATCAACAGATTATCAAAT
TCAAACCTTTTTAAGATGAGAATATGAAGGAAATTCCACTGTTTCTCCTCTAATCATGATGGTGATGATGCGATTGGTGCAAAGTTACGAAGATGGAGAA
CTGTGATGCGTCTGTAATGGCGTCAAATTGGAAGATTTGACAATGGCGGATCTATGGTGAAGGGGAAAAGATTGATGGATATGTGTGTCCAATGTTGGGC
CGGGTTACTAAAAGGGCCATCTATGATGGGCTTAGTTGGATTTCGTTAGTACTTGAGTAAAAGGCCCAAACCAAACTACTTTGAGAGAATTGGACAAATA
GCAAACATTTAAGGAAAAACTACAAAATATGGCAAACATTAATATACATTTAAAATAAATAGCTACAGTTCACTTTTTTTATGTTATATGGATATAATTA
CACAATAAATAGCAAAGTAATTATAATATAAATAATTAGAAAATTATTAATATTAAATAGGGAAGTTATTATTACACACCTAATTTATTATGTTTAGGCA
TATTTTATGTGATTGGTTCTCCATGTTTGCTCTCATTAATACTTTCTCTTTCACCAATTTTTCTATATTACAAAATTCTGTATTTTTCTCTCATATATCT
TTCAATTTAATATCTTTTTGATGATTTTAGAAAGAAGTTTTGTAATTTGAAATCATCATATATCACTTAATTGATTTTTTCTCCTTATTTTAATGAAGAA
CATATTTGTATATATATGTTGCATCTTTTTTATAGGCTTTCGATTTACTCGTTTCTATATTACAATGACTACAGTTATTAAAAAAAAAGTAATACAAGAA
GAACACAAACAAAAAGAGATTGAGGTTTGTGTGATTGTCAAATCTGTATATAGTATAATAGTTATATACATAGATACTAGTATTCTAATTATTATTTTTT
TTGAATCACATGTATTCTAATATTAACACAAATTGGAATGGTGTTATCTGAATATAAGTATTTGGATACATAAGTAATCTATCGAATTTGAAAGGTTAAT
TAGGTAATACAAGTATAATTGGATACATTAATAATATTTTTTTATAAACAAATACATAAGTCAACACCAAGCCTCAAGTATTATAAGAAAAACTTGACCA
AAAAGAGATTGTCGTTTGTTGATTTTTTTTCTCATTTTTTTAAACAACCGAATACTTGCATACTTTTCTTTCTACACATTCTATTATTTTCCATTTTTTT
TGTATTGTCAAATATTCATCTTTTGTTAAATAACAAAGTATATGTATACTATATTAGTGTATTCATTTTTTGATTAACAAAAATATATTCATTTTTCAAA
TTATCGTGTTTGTATGCTAAATTGTTATACTTTATTGTGTTTAATATATAATATATTAAGTTTTTATAAATAATTGCATCCTTGATATATCAATACTTTA
AATTTTATAAATAAAGATACTATTTTGATACAATTAATACAGTTTTTTATTTAGTTCATCGTAATTAAAACTGTATCAATGTATGAATAGAAAAATAAAA
AACATATACAATAATATAGCTAGAAAAAGAGTTAAAATGTAGTCATTTTTTATAAATACCATACTTATAGCTATTGAGCTTTAATAACCCTATAAATATA
GTCATTTTTGTAAGTTACTCAACATTTAAATCAAAATAAATCCTATAGCTACTGTTAAAGCTTTGTATTTCGTAGTAAATTTTGCACGATTTTTGCTATT
TGGTTCGAACCCCCTCATCGAGCGGAAGATTCATTTTTATCCAAATTCATTCCCTATATTTTCTCTCTCATTTTCTTTCAGTTATCTCTAAAAGCTCTTC
CCAAATCAATTATTTTTAATTGGTTGTGGCCCACCCTCTATTTTTATACAAATATATTAGCTATCTTTACTCTCACAATTTCTTTCAATTTTTTCTAAAA
TATCTCCCCAAATCTGAATTTTCTTTAAAAATTATATATCCTTATAAAACACAAATGGATAAAATTTGTTTGTGTTTGTATAAAGCGAGAGGAAATTATA
TAAATACATATATTTTTGTTCCCCTCTCCCAGATCTCGCTCGCCACTCTCCCTAATCTCGCTCGCCACCCTCGCTTATACAAATAAAAACGAATGTATAA
ATTATGTTTCTGTTTGTAAAAAGTGAGAGAAAAATGTATATACACATGCAAATACATATATTTTTTTATATACACTTATAGTTATACAATAAAATACTCC
CCTGCCCAGTTTCTTTTGCCTTTCTCTTTTTCTCATTTAATACAATTTTAAATTGTATATAATTTCTCTCTTTCTCATTTTATACAATTTGATTCAATTG
TATATTCCCTGGCCAAGTCTCTTTTGTCTTTCTTTCTTTCTCATTCTATACAAATTCAAATTGTATATAATTATTTTATACACTTATAATTATACAATTC
GTTTTATACAATTCTCTGCCCAAGTCTCTTTCTCTTTCTCGTTTTATACACTTCATTTTATACAATTCGCTTTAATTATATATGTATAGCGAATTATACA
TTTATATGTTTGTTGTGGAGTGTAATTATGCAAACTTTGCTATAGCATACAAATATGAATTTTATGTTTGTTATAGGTGAAAGTTTCCCTTTTAACCATT
AAAAATAAGTTCGAAAATAGCAAACATAATAGACATTATAAGGTTATATAGCTATAATTTCGATAATTACGCTCTATAACTATAGTTTCATTTGCTATGG
AGGTTGCGATTGTATGTTTTTGTTCGTTTGGATATTTCATTTGCAAATATACAAATAGGGGAAATATATACAAATTCTGCATTTATACATTTTAGAAATT
TTCAAAACTCCATTTATATATTTAACTTGTCAACATACAAACAGGTTGATTTATTATGAATTTTCATAAATCGTATACGAATAGATATGGCAAGCATATA
CAAAATTGTGAATTTATACAATCAGAATCCAAATTATACAAATTATGGATCTATACAATATGACGAATTATATAATTGTGAATAGCAAGATTGGGCGAAA
CTATAGTTGTCAATTAGAATTTCCTTAAACAATAGTTATAGCATTTAATATGATTTAAATGTTTGTTATTCTAAATAATTTTCCCATAAAAAACTACTAT
AGTCGAGCATTATCATACTTCCAATAGTATGATTTAGGTATCCTAGTTTTTTTTTCTCCAATGTGTATTAGTATTTATTGTACACTTGTTTTTTACATTG
TTTGTCTCTTTTCTGATTTATTTACGTTAGAAAATTTGATCAAGGGTGTCATATAAACAACTTCCATAGTCCACAAAGATAGCGATAAAGTTTGTATATT
TATGTTCTAAACTCTCAAATCACGCTTGTTAGATTACACTGAGCTTATTGTTATTGTTCTTTAATAATAATAAACAAAATTCAATAGAGATACCACTCAA
ATATAAAGAAAAGTCTAATATAATATATTGAAATTCAAAAAATTTACCGGTGAGACTATTATATTATATTGGAGTTTGAAATTCTCGATATGTGAACCTG
GAAGAGGATAGATAGGGCGAATAATGAATTTCGTTGAACAAAGAAAGACCAAAGGAAAATTCTATTTACATTTCACTTGTAAAAATTCTAAACCTCCATA
CACTAATGAAGTTGCACATATTAGAGGTCTCAAACTCAAAGAAGAGTCCTAAAGTATGTGGTTCTATAACTCGAAAGGATTTCGTTATGAGATTCGTGGT
GAATTCAAGAACAAAGTGAATCATGTTTCTAGAATTTTGTCTTTGATTTCAAAATTTTATTACATCGTGTTGAAATATCACATTTAAAAAAATTGACTTT
GTTGGAGTTTCATATAATTGAGATTTTGAACTCTTACACACTGTACTAAAAAAATCATATTTTAGTTGAAAATATTATTACTCAAACATTATTTTCGTGT
TAATATTGACTAATTATATTATATATATTCGTTACATTTAAAATAATCACTAAACTTAGAATTCTAATCTAAATAATAATAAACCCACCCAATTTTCACT
CTATAGTGTGTGTCATCATTATCCATGACCAATAATTAGTCTTATATTATCACTAATTAGCAAAACTAAGAACTTTCTGAGTTTGAATTATCATTACATC
CAATTAAAAATAATAATTTGATTCACAAAACATTTCATATTTACGTAGAGTTATAACTTAGTTCTATAATAATTTATATTTTAGCCTCTCTTTTTTTTTT
TGGCTAGGTAATAAGCACATTCTATAGTTTATGAATGTTAGGTTGTATTAAGTAAACATTTTAATACGAAAAAATAAGTTAAAATTATTAAATTCTGTCA
AATTTGTAACTGTAACGATGATTCCGCCCTCGATATAACTTTCTATCCTCATTTTGTAATCTCAAAGACAAAAGTACATTTGTGAAGTGTCTCCTACATA
ATTTTGGTATGATTTTAGCGTATGATAAACTCTTGATTTAAAGAATTACATAAATTCATCATCTGGTGTTTAATATCTATATTAGGATTTAATTAAATTT
AAATTTACATCGAAAAATCTATATTAAAAGATAAAACACTTTAATTTTAAACATAGACAATTTTATATCTAGAAAAATTCGAATTCAAAATATTTTATCG
AAGATAATTATAAAAAAATACTTATAATTACCCCACCACTACTTTAATTGGTTTGAAGACATGCTTTAGCTACAATTTTTTAAGTACTTAAAATGATTGA
GATGTTCATTCATTTATCCAAAGTATGACTACACATAATTACTCAAAAATAACAATTATTATATCATATAGTATTCTCATCATACATCTCTTATGCCTCA
AGTTTAAAGAATATATTTTTATAAATTCGTTCATCTCAATTTATATGATAATATTTAATTATATATATGAAATTTGAAAGAAAGATAAATTTAGAATTTG
GTATTTTAAAAAAAAGGTCATAAACATTAATGTGACTATAAATCATGTTATCGAAGAAAATTGGGAAGAGAAGTATAAAATTAATTAAATAGTCTATAAT
TAGAGTACATATTCTTTCTAAGAAAGACTTTTTTCTAAAGAAAATGACACATAATTTAAAATAAAGAAAATATAATTAACTTACGAACAAAAATAAATAT
ATTCATTTTGAATTATGATCATGTCGAGTCAAACATCGTCAAAATAAAACAAAATGGTTAGATAGAAATAGCACTAAAGGAAAAATAGAACAAAACTCTT
TGTTATAAGGCATGATAATATTTTAACACAAATTCGAATTAGTCGAATTTTAAAGCGATTTTTAATTAATTTCTCATTTAGTGTTCATTCTTCATTTTAA
AATTTAACTAATTCAAATTACATGCTTTTATATATATATTGAGATCGAAATTAAAAAATTTTTGATTAAAAATATAGAGATCTTAGTTATCCTTCGCTAC
TAAGCCACTTACTAAAAGTATTTTTAAAATTTCAAAATTTTGAATTATAAATCAAAGGTGGGCCTAAATTACTTCTAGCATAAATAATTACTTATTCAAG
AATTTTTTTCATTTTCAAATTTTAATATTATATGCTCTCAATGATTCATAATTAGAAATATTTTCATCTTAAAGAATAAAACTACTTTACATTATTTTAG
TCTTCATTTGGTCCCTACCTTAAAAGAAAAGGAAAATCTAACACACAAAAAAGAAGAAGAAGCTGTCATTAACCTTAATCATGATGATTTAATTTTTAAA
AGAAGATTCATAAAACAAAATACCACTTTTAAAAAATTAAGGAACACAAAAAAGAATTGTTAAGAAAAATGAACTAGTATATAAAATGTTTCAAATTTGT
TTGCAAAACACACACATATATATAATAACAATATATACAACGTAACTGTAATCTCATAAATAAAATATGAGAAAGAGTTAAATATTTACATATCTTATCT
TTATTTCTGTAAGATAGAAAATTAATTTTTGATAAACTATTCGATCAGACGACAACACGAAAAAAGTATAGTCAAACTTATGAAATGGTCCAATTTTTTT
TGCCTTTTTTTCTCTTAACACCTGTCAAAAGGAGGTGTGAAATTGAAAATATATGAAAGGTAAAAAAAAAAGTTATATATATTAGAATAATTAAATATGA
AAAAAGGTAGCCAGCAATTTACACTAATCTCCTACTCTGTCTTGGACCCTAAGGCTCTCATGCAAAAAAAAAAAAAATTATTTTTTATTTTATAATTAGG
TAAAGACTTATTATCTAATTTGTAAAGAAAATCTTGTAGGCCAATCACACAAATCTTTGTTGGAAAAATATATATATATATATTACACCAAATACTTTTA
AAGACCCCTCAACCAATACCACTTATCCACTAAAGTTATTTAAGTTGGATAATCACTACTTAATTTTAGCTTTTCATGTTTCACAATTTTTCAAACTTTT
CAAAAATATCATTTTATTACATAAACTATGATATTTGTTTTAGGAAATCTAATACGAGTGTGATATTAAAAATGAAGAATTCGCGATGCAATTAATTAAA
CTATTGATATTCAAATTGTGAATAAAGTTTAGATAAAGTAAATTATATCATAAGATCTGTATACAACACATCTCGTACTCACTCAAGATCTGGATGAATA
GGCTGCATTTTGTAAGCAACTTACATAGAAGGAAGGATGAATGACTGAGTTTATAGCTTAAACTCGTAACATATAAACAAATATTTGAAAGTAAATTTTA
ACGATAAAAAATTATCAATTTTGGCAAGAACTATTGTGGTTTCATGAATTTGCCAATGCACCAAACTGTGGAAAAAAAGTAGTACTAACTATTATAACAA
ATAAAACCCACTAAATACTATAAAAAATTATTTATCGTAAAAGTGTAAAAAGTATAAATTCTTCGTAATAAGGTCTGCATATATTGTACTCGATCGGTCC
TTTCCGAATCACACTTATAGAATATATTGTTGTATAAGTGGAAAAAAAAAAGTACAAGTTTAATTTTCTTAGGCAAGATGTTTAATTAATGATTAATCTT
TTAGGAGGGTATTTTGGTCATTTCACTTCAACCAAAATTTGTTTTAAAGAAAGCCAGATGTTTTAGGTACCTTTAAAGTCCAATATAATCATCTTACAAT
AGTACCTAACATTTCATTATTCCAACCTAAGAAAACTCAAAGAGAAAAAAAAAACAAAAAAATGACAACTCCTAAGCAAATGGAACAACAACAACAACAA
CAAATTATAAAGATGAAGAACTCAGGTATGATAAGCTACAATGGTAGCCCGATGATCGATGATCGAGACGAGGAGATGACACGATCAGCATTGTCTGCTT
TTCGCGCTAAAGAGGAGGAAATCGAGAGGAAGAGAAAAGAAGTTTCCGATAAGGTTCAAGCTCAATTAGGTCGCGTTGAGGAAGAAACTAAGCGTTTAGC
TGAAATTCGCGAGGTAATACAATATATACTTTTGCTATTAACTTATCATTCTTCTTTTAAACTGAACGTCTATAAGAATTAAACAACATCTCAACATACT
GTCTTTCTTAAACTGCACTTATAGAATTTTACTGATACATTGTTATGGTTATTGTTGACATATTGACTATGTTACTTGTAAGAGTTTATCATATTTTTTG
TATTTTTTTTTTTAAAAATGTTTTTTTGACAATTTTTTTTTATTATGTTGAAAATGGAAAATCAAGTAGAAGCTTGAAACATTTGTTGATCCAGCTGGAA
AAGAAGTAACAATTGTGAGGAAGAAAATTGACTTAGTCAATCGTGAATTAAAGCCAATGGGACAAAATTGTCAAAGAAAGGTGAAACATTTTTTTTTACG
ATAAAGTTATTTTCGTGTGATTTACTGATTATAAGTTCAAGTCATGAAAATAGTTATTGATATTTATAATAAAATAGACGATATTATATCAAACTCCTTA
AAACACGATCTTTCTTCGAAACGAACCATATTTTTGTCCACTAAATTGCTTCTTTTTTTAAAAGAATTACTTTAGGAAAATTAAGTAACATTACTTTACT
AAAAGACAAAGACAGACATATAATGTTTGTTTTATATCAATTGGTATTCTAAAAAAGACATTGGATTCTATGTTTGACTGGTGGCTAGGACCACCAAACC
AATACATTTCGTCGTACGAACTATAGTTATCTAGTATTGATTTGATATATAAATTAAAAAATAATAAATAATAAATGTAATTATATCGAATTATTCTTAT
TAAATGTAAGTGATATTACTATTGACTAATATATAGTATTTAATATCAAGAATAAAATAAAAACAACATGATAAATTACCCAGTAATTTTATAATTTTAA
TAAATATGATTAGACATTTCAAAATAATACGCTGAACAAGTGAAGATAAATATATAAAGTAGCAGAGAAGAACATTTTTTGAGTTGAGTGTATCGAAAAA
AAATCTATCTATCTTTTAAGATGAAGGGCTAGTGGTGTATAATCTTACTTGATGGATTGTATTAGGTATATGATATTATTTTTTGAGTGGAGAATAATAT
TGCTGAGGCATAATACGTAATGTGTTTTATTGTCTTACGTGAACATCGATATTGCTTGGATTTTTAAAAAAATGTTATCATATTTTGGTTGAAATTCATG
AAAAGATGTATTTTTTTAAAGAACTTAATACACGTCAATAAGTATTTTAAAAATCACTAGTTTCAAAATACATAGTTGAATAAAGAAACGAATTCAAGAT
TTTAAGATAGTGATTTAGAAAAGATAGTTCAATCTTGTTATATGCTTACTAATTAATTTTTTTCTTTAAATATATTTCGTTTTAACTGAAAATAGTTGAT
CGAGTTAAACTAACGAAACTCGTTCTAAACCCATCTCTTAACATATCCAATTATTAAATTTTGATAATTGGAAATATATAATATGATGAAATTAGTTAAT
ACTGAATCTTGTAATTATATTTATTTATTTTTTTCCAGGAAAAGGAATACAAGGAAGCACTTGATGCATTCAATGCAAAAAGCAAGGAAAAAGCTCAGCT
TGTTACCAAATTAATGGAGGTAAGTCTTTTTTTTTTTTTGGCTTCGTTTAGCGTTTGATCATAAATTTAAAATTTATCTCTAAATATTTTTAGTCATGAA
ATTTGAAAATTTAATCTTTAAATATTTTCAAGTTGAAGAACTGACTTAGATCAATTTTTTCCAAGTCAAATGCATGTTCAAATATAACTTCAAATGAACA
AAAATTACAACTTTAAAAACTCAAAATTTTCAAGTTTCAGCGTCAAAATCTATAGTCAAATAGAAGCTACAAGATAAATAGAAATCGACTACGAACAAAT
TCTACCGCTAAACAGCAAAACTCCGTCGTTATTCCTATGTAACGATAAATTAACAAAAAAAAATATGTTAACTACGTGCTATTTCACGATCATATTTCTA
AAATGAATATATTTTTACTTTTAATCTTTTTTTTGAATTTTTTTTTTATGAACGATTGAACAGTTGGTGAGTGAAAGTGAAAAACTGAGGATGAAGAAAT
TGGAGGAGCTGAGCAAGCATATAGAAGCATTGCACTAATTAAAACTACTTTTATATAACCAAAAAAATTGATGTATTAATCAATTGAAACTCTCACATTG
AACTTTTTTAGTTTGTTACATTTTTTTCTATGTTTGTTGTATTTTTTTTTTTTTGGTTTTAAGTTTGACAAGTCAGGTCTAATTTGACATCCTTAAATAG
GATAAATGATGGTTTGGTATTTTTCTAATTTGAATTTCAGATGTAAATTGTGAAGATGTGTTTTTTTTTTAATTTTTGTATGATGATCATAATTCATGGA
TTTTTCCTTCATAAATTTCACTATATTGAACTGATTTTTTCCCCTTCCAATTCTCTTCATATTATTTCTTTTATCAACTTTAAGAGTAACAAAAGGTAGA
CGGAGTAAAGTTTTGACGCTATTCATTAAGGGCGGATCAAACAGGATTGAAAGATTATAGATTTGATAAAATTTTCAAGAAAAGATATATATAACACTTC
AAACGAATTCCACATAAAATGAAGAGTTTTATAAGGTATAATAACTCAAATTCATATGATACACGTGCATTTAAGACTCGATATGACGTAGTCGAAAAGA
TAAATTTGTACTATTTTAAACCCAAATAGACGATATTTTAACTAACAAAAAGAGGGTACTTATATATGTATATACACTTGGTGCTTCTTTATTTGGCAAA
ATTATTTTCCGGACAATTATCTATCACATCAAGGGCTAAAAATTTAAGCAAAAATATGTTGTGTGCGTGTCATTTTAAGGATATTTCATCGATAAAGATA
TAGCCTTGAGATAATTCACTTATTTGTTATGCTTCCATGTTTATTTCCAACATGCACGAGTCGCGAGCCTAATCTCTTTTACTTTCATTCAACAAGCTCA
ATAAAGGATGAGTCACTTCCTTTTGAGATGCTATTTACAATTTCAATTAAAAATTGAATTGAGAAATAAAAAATCATTTTATAAAGTCTATGCAGGACTT
GTTCGAAACTAGCTAGTGGAAACGATCTTAAGAATGAATAATGCTATGGATCAATGACTTAACTCCAAGGATATCTTATTTAAAGCAATCTCTCGAGTTT
TTCTTTATTCGAACCAGTCTTGCAAGAAAATAAAATTTCACGCATTTCTAAATTTAGGATGGAAGGAGTGAAAATGATTAGAACTAAAAACAAGAAGATC
TAATTCTTTCTTTCTTAATGTTTGATATCTATTTAGTCGATTGATTCAGATTCATATCAAAAAATTTATTTTAAAGAGGCCTCTATTTCCGTGTCGGAAC
CAAATGAGTATTTATACTTACTTTTTCACTACAATCTTTCGCGATAGAAAACATAACTTTCGAAAACATAGAGGGTAAAAGTTGCAAATAGAAAAACATT
GAGATGCTAAACTATTAACTATCTAAACATAATGAACTAGTGTGACAAAATACATATTATTATTACTCTTTTAACTTCTTGTCACTGAAAACATTAACCC
TTTGAAGCTCAGCAATGGAGATTGTTGAGAAACTGCAAAACCCTAACAATGGAGGTGAAATTAAGCTCAATCCCACATCAAATTCAAAGCCAAAAGTAGT
AGTAATAATGGGAGCAACAGGTTCTGGAAAATCAAAACTTGCTATTGATTTGGCTTCTCACTTTCCTATTGAAATCATCAACGCTGATTCCATGCAGGTG
TTGATTGTATCTTCGTGTATTCTCATAAAGTTGAAATCTTTTTGTGTTTACTGCTAACCCTTTTTGTTTCTTGGTTAGGTTTATCAAGGATTGGATGTTC
TTACCAATAAAGTTACTCCCCAAGAGCAAAAAGGTACTTCGTTTCCCTGTTTTTGCAGTGGAATTGTTCATGTATGTCAAAGATCAAACGCTTACCATTA
TGCCAATAGTCATATTAGATATAGCAAAGGGGAAACTAACTGCACCACACACCACACAAGCTCTATGTTTGATCATGACTCCAATTCGAGCCACCGAGAG
CCCTTGTGGGCCTTGTCATAGGCAGGACGTTGTCCTTATCCAACAATTTGTATAATTTTAGATGCTTGTGTTTCCAGAGTAGAAGTTTACGTTTTGTTTG
AATGGTTGTTATCAGGGACAGAGCTTAAGTGTAAGCTACTGGTTCGGCTGAATCCAGTAACTATGGTTCAAATTTTTTTTTTTTAAATCATTGAATATGT
ACAAAGTAGTATCTAATTTAGAACCTAGTAACTTAAAAATATTAAAATCAAGAACACATAAGGTTCGAATTCTGATTCCACCTCTTGTTACCTATTGTAT
TGTATATCGTTGTATTAATCGAAAGCCGGTTATAATTGTTTTTTAATAAATTTTATTGTATTTGTACTGTGAAATTCGTTTTTATGTAACGATGAATAAT
GCCAGGAACAACCCATTGGGTGGTGTCGTGTCGTTAGCTTATTTCTTTTCATCCTACTTTTATCATCTAAAAATCTTATTTTACCCTATTCCCTATCTTT
GTTATAATAACTCTACTTTTTCTTTGTAATACTATAAGCTTG