BAC Sequence – LE_HBa0129L05

>C07HBa0129L05.1
AAGCTTAAAATGTTGAAAATACAATACTTTTATTTACTTAATTATGTCTTTAGACGTACCCAAAGCCATTGCAAGCGGTGTCACATGCCTGAATAATATC
GGAGCAAAGTGCAATATCATCGATGTTTCGAGTAATTTGATATGATTTGAATAGTATATAAGCAGTCCCTAAAGTTCCAGTGTAGAGTGTGTAGTCTTTT
ACATGTCTTCCTTTCGCTGACCATGTCTCCCTCACAACCTTATAATTTAGGGAACACAAAATTAGAAACACACAAAAATTAATGAATTTCAATTATTCAA
ATGTAGACAAACTCATAAAAATTAAGTATGAAAATTGCAAAACATAAATAAATACTCCAATGTTTCAGTTTATACTACACATATTTTTTTAATCAATCTA
AAAAGAAAAGATCTTTTTTGGCCAGAAAATTTGACCAGAATGAATTTTTTAAATATAATTTTACTTTTTAAAAAACATTTTTACCCTTTTAGCACTAATA
ATTTTTTGACCAAATTCTGATCAAATTTTCTAACCATTTAACACACCTAGAAAATTATAATACATTCTTTTAAGTTCAAGGGAGGAAGTAGTAGCATAGT
GTATTTCTATCAATAAAAATTCATTAGATATATAAAAATATTAGTAGCAGCATAGTGTATTTCTATCAATAATAAATTCACTAGATATGTAAAAATATTA
ATTTAAAGCCCAATAATTACCACTTGTCAGATAAAATTCACAACAAGTTAAATTAAAATCCTAATTTCACCTATAGCTAAATCTAACTTGTTTAGCAAAA
AGTCCATCCAAGTATACTCAATCTTTTTTTTAAGGATAATTTTAAAACATGATGAAATCTCTCTACATTAATTAAACTTCATATACAGGGATATCACATA
AATTGAAACGAAACGAAAAAAAAATCCCTAATCGGTCATGAATTTACGGACTAAATGAGTTTTTCATTTATTAAACAAGTGAATGTTCGTTTTATAACAC
ATGTTATGAATTTAAATGAACCTAATAAATATGTAAACATATTAATTAAATTCAATAGTGATCTCAAATCGATAAACTTTAAATTCTGAATCCAGAAAGA
AGATAAAAGGAAAAGAATACTTCATCTTTGAGGTTTATAGCATCTAGCTTGAGTCTTTGAGTAATAGTATCATAAGGAAGTGAAAGAAGTTTGAATAAAG
AGTCTTTTGTATTTTCAGGTACCAATTCTTCAATTGAAAGCTCATCCATTTCATTAGGATAGTAACGTTCTGTCATCTTTGAGATTTTTTTATTTCTTTT
TTGTGTCTAAACTCAAAATAGTATATTTTGTTTGTGTAGAATCAACTGAACATATATATATATATATATGTATAAATTTTAAAGAGTTATCTACATTATA
AGATGTATCTTTTTTTTTCTTTGGATACTTGTAGAAGCTAGTGAGATAAGTATCTACAAGAAAAAACAAGAATGCACCGCTTACATTGTTTATATGAAAT
TATTTGATTAAACACGATATTTAAGTTTTTTTAAAAAAGAAAATTGTGATCTAAAAAGAGTCGTAAATATTTATAAAGGTGAAAGGAGATTTTAAAATTA
AGTTATTAAAATACTATATATAGAGAGAGAATTGATTAAAAAATATGTTACATGAATCGAAATAGAAAAAATATCAAATATAATCTAGGTCAAAGGTATA
ATTTAAATCCCATAGGCCATATTAGTCTACCGAACAAGTTTAGTACTTATCCATCTTAATAACTAAGTTTTTGAGGTGAAATTTTTGTAATTTACTTTTC
TATACAACTTATTAGAGTATGATAAGATAGAATGTTTCACGTTACCTTTTAACAATACATCATATGATAATACATCTACCTTACATAAAAAAGATTAACA
TAGCCAATTCTACAACCCACAACATGTTCATTCTGTATGTACAAAACTAGAGTGATTGTGTTCATTTTCTGTATGTACAAAACTAGAGTTCATAAGCAGG
GAACCTTGTTTCTATTGGATCTATCATGTCGAAAAAGAGATAAGCCATTCCTCCCATTCCTTCAAACAACGAGTATGGACGATCACCTCCATGCATAACT
CCCTCTGATATGAGTGTTTGAGCTCTAGTGTGCAGAAAGCACGCGAAGGCCTTTGCCTTGTACAAGTACTCAACTTTACCTGTCAAACGATACAGTGAAA
GAAAGACATAGGAATTTCCACTAACACCGTGACATATTCCAACTCGTTTGAGTAAGCCTCGATTCCAAATCACCTCAGCTGCTTCTATAGCTGCCTGCAG
AAACTCGTCATTGCTGAAAACCTGAAAAGTTACGACAATGATGAGCAGAAAGCCCTTCCAGGATCACGCATTTCATCTCATGTCTACGCGGATTGAGGAG
TTTTATATAGTAACTATTAGGAACTAACATCAAGATTACTGTGTCTGTGCAAGGTATTACTCCATAGTCCATACCTTAGCTGCTTTGATTAGAGTAAGGG
CAACACCTGGAGCACCATGACACCAATGCACAAGTCGGTCAGATTCACTTCCTTCACTTGAGGGGTAATTTCCACTAGGAAAACGATTTCGGATCATGTA
ATGCAGTGTAGCCTTCACATCCTCGACCTCATCTGCTTTCAGTTCCATGTCCATAAGTACATGCATTATCCCAGCTAGTCCATGAGCAGCACCCCAGTAT
CTTTTTCCATGCCATTCATACATCAGTGGACATTTTCCTTTCCCCATTTTTCGTCCGGACTTTATAACCTCAGCAACAACTGCTCGCTGCATAAAAAAAT
TCCGAAGAAATAAAGAGCCATTCATAATGAGGAAGCATACGTGATCGAAATTTGTGAAGTTTCTTACAATTTGGGTTGGAGATATTGTTTCTCTACCAAT
ATTTTTGTTTAAGAATGAACAAGCCCACAAGAAACCAGCCCTCCCATACAACAACTCATTTGGAAGATCTTTAGGAAGCTCAATCTGCATTTGTAGATAG
ATAATGAGAAGACTATTGACATCAACAGAAAAAGCTCGAAACAATGAAAAAAAAAACCTCTTTGAATTTCGTCAGATAGTGATCACACAATTGTTCATCC
CCGCTCTGTTTGGCCACAACTGCACCAAGAGAATAAACACCAGCTTGTCCACATATGAAAGTCACACGCCTGCAGTTTCACAAATTAGAGTTCAACTTCT
CGTTATGTAATTTGCCTAAAACATGTTTCTATGTGGGAGGAGATCATGAAACAGAAACTTCGATTGGATTGTCTGGTCGGATCATTTGACCACCGCCACC
GCATCACTCAATCTACAAGGGATCCAACCAACTTTTACAGGTCTACTCCCATCTGATCGGAAACTAGTTTACTTCATGGTCTTCCCTATCCGATTTATAT
TAACAGATTACTTGATTATTGAGTGAACGGTTTAGTAAAACTCACAAAAAATATAGAACATTTAACTTGAAACTAGAACTAAGGTTACATAAAAACAGAC
TATGGCTTTCCCTAATACTCAACCCATGTAAAAGGACAGAACCTTCTAAACGCATCAATTTCCTCTTCATCTCTTCAACTTTTTTACCTTCTATTTCCTT
ATTCATAGGGTCTTTTTTATCCAGTCATCTTCACAGACATGTCTAATTAACCGAGCAACTCACCAATACAGTGATCAGTTCGTTACACCTTTCATGTGGA
TCGAACTTACACTTAGCACCGTTATAGTTTTTGGTCGCCATTGTTTATCATGAAGATTAAGATGACTTCTCATGCAGGATAATTAAAACCAGAAGATATG
TTCATATACCAAAAAGTTATCATCTTTCTTCAGACAACACAAATCAAATTTTAGCTCAAATCATAGGAAAAAGAGTGAAATTTTGCAAAGGGAGTGTACC
CAGAACCACGGGAAGCAGAGTCACAAGCCTTGATAATATCAGAACAGAGAGCAAGATCATTCTTGTCAAGAGTAACTTGGTAAGCTTTAAATAACAAAAA
AGCAGTTCCTAAAGCTCCAGTGTAAATTGTATAGTCACTCACTCTTCCCCTTTTACATACCCATGTCTCCTTCACAATCTGAAACATATCAAAATCAAAA
TTAGAAAAAAAAAACAGGGAATTTACACAAACACCTAGCAGGCACTCTATACTCAAGAGAAGTGATTACCGTTTCTTTGAGATCAAAAGCAACCCTTTTG
AGCTTGTCGCAAACAGTACCATAAGGCAAATACAGAAGCTCTAACAATGGATCTTTTGCTCCTTCAAGAAATGATTCTTTAACTGTAGTTTCATCAACAA
AACTAGGCATGGTGTTTGGAAAGAAACGATCTGGCATCTCTTTATTTCCGGTTCTGTTGAATCCTCCGCCGGAACAAATTTATGGAAAGAACAGAGCTCC
GGTGGTTCTCAGAAGACAGAACAGAGCAAGTCTATCCGGGGTAGTGTAAGTTTTTTTCTTTATTCACGAATGTTTTAGTTTAGTGTATCAAGCTATTGAT
ATCGATAAATAGATGATTTATTCGATTTTATTGATAATAGACTTTTTAAAATTATCAGATGTGGTCAATATATTAAAATAACAAATATTATCCTTAATAA
TTCGAATAATTATTTAGCAAACATGACTATAAAATTGTTTTTACTTAATTGGTAATTATTTCTTTTACAATTTAGGAGAAGTCTAATATGCTCAATATTA
TTCGGGATCTAAAGCAAAATTTTAGTTTGAGACCACAGATATTAACTAATTCTCTGCCCTCTCTCAATCTCGCTCGCTATATATACAAATACATATATAT
AATATATACAATTATCAAACAGATATATACCTAAATTTTTTTTTTTGGTTAGAAATTGTACCTATGATCTAATGTTGTTTTCTGCTCTTCTGTAGCTGGA
ACGAGAAAGAGGCTGTAATGAACTTCAGAAGACAATAATGTATGATTTGTCTTTTTTGTATCATACAACAAAAAAGTTCTTTACAAAAGATCTAATCACA
AAACATTCAAGTCATTTTTTGAAATGTTATATAACGATGTAGAAACAATATTTGTTTGGTCAGTCAATATTTTGTACTTATTGCTTTCTCCATAAACATT
TCTGTAGGTTCAAGGCATCCCCTTACTGCATCATGTCCAAGTTGGGCTCTTTCGTTGTCTCCAAATCCAAAGACTCGTCCACAATTTGTAACAACTACTG
TGTGGTATAAGCCAGTGCTGATTTGAGATATGTGATGGGATCTCAAGCTCTCCAGGATACGAGGCTTCAAAACTTTATCTGATGCTCCTCTGTCAAGGAA
TCCGAGGCTACCAAAACCCATCCAGCCAAAGCCATAAACAGAACCATCGTCCACAAGGACAAACGTTTTCCTCTTGCTTGCACAAACCTACCAATAGAGG
CAGGCAAAATTAAGCTAGGACGAGGAAGACTGTTATGTATGTTACAAGCCTTGAATTACTTTGTATCATATTACTGGCGTTATACACTAATTTGAGTTAT
TTCATGTTTCCAAATGTTAATACTGATCTTTGTAATATCGACTAGCAAAAGTAAAAGAATGCCAGACCTGAACTGCTAGATGGCTCTTAAGGCTGGTCAA
GTGTGACGGAGTAGTCTTATCAGTCTCATCACCATGCCCCAATGCACCGCAATAACCTTTCCCCCAAGTATATACCTGAAATCACGAAAATCAATCATCA
GTCGTGACAGCACTTTATTCTTTTCTGCAGTTAACCAACTCTTAGCATACATCTTAAATGAAATTATAATATCGTGTTATTTTTTAGGTACTATGACTTA
CATATCCAGTGGAATCCAGTGCCACAACATGCTCATCTCCAGCAGAAACACGAGCCACATTAATGCCCTTCCTCTTAAACGACTGGATTGCACGTGGCTG
GAGTTCATTCTGCTGTTCTCCATGACCAAGGCAGAAATTAGTACCCGAACCAAAAGAGTATAGAGTCCCATCATCAGACACTGCAAGTGCATAACTAGGT
CCAGCAGCAATCTGAACTACAGAACCAATAGATGCGAGTAGTTCTATACATGTCGGTGTTGGCCTATCCGATGTGTCACCATGACCAAGTTGACCATGTC
CGTTCGTTCCGCATGTGAAAACATGACCTTTCCTAGTGAGAAACATAGTAAAACTGAGACCTGCAGCAACCTGAACCAGTTCCAACAGTAGTGAGCAATG
TATTATGACAAAACTTAACAGCTTCACGTTTTAGTATGTCTAAAAGAGAATGTTCTTTCCGTGTTAGGCAACTCTTTATTTCCAACTTTACCACATGGAA
TGTTTAAGGCATAAGATTAAAGGACATTTTAATACATTCAATATATCCTATTCAAAAATCTTCCTTACTTTCTTAAAATCCGTGTCAAATCAAAATCAGA
CAAATAAATTGAAATGGAGAGAGTACTTTTTCAAAGATACTACAAAATTAAGCCCAATTTTAAAGATAAACGAACCCAAAACATTTACAGACAATGAAAA
AATGCAGAAGAGCATCACATACACATTGCTGGGAACCAATTAGATCTGCATTAGCACCGTAACACCTACAATGGTATTTCCAATTTGCAACTAAAACTAA
TGGACATGTCATAGGTGTTGCCTAACTCTTAAAAATACCTCGTTTTCATTTTTAGCCTTCATTTATTCAAGAGTGGCTTGTCGATCCAATTTTATCAAAA
AGCATTTCAAGAAATGACAGAAAGCTTATTGCAATAAAACATAGGAACAAGAAGGTGTTTATGTCATTCACAGCTTGAATTATGCTATTAAAACTTAGTG
GAGTTTATCCTTCGGTTCCCTATTTTCTTTCGTAGTTGGTCTTGATAAGAGAGACCAGAAATTCCTGGCAGACTCTAAAATCCTCCTAAGTTGCAGATAT
TTCAAATCATCACATCATTTTTTTCTTAACCAGTACTCCTCCAAACAAACAAATAAATTTTGACGCAGTATCATTTATTCCCATAAATTGATCTAGCAGA
ACTAAAAGATCAACTTAATCGTAAACCATGTATAGAATCTCAATCTCTATTGAACTTACAGTTTTCAACAAAAACAACAACATCAAAAAAGAATCCAAAT
CTGTAACATGTATTGAGGTAATCCCGTCAATTAGATGGCATGACGTGATAGAAAGAAATTTACCTGCTTGACAGGAATATTTTTCAATGCTTCAACCATT
CTTGGCCTGAAGATTGGGCGTCCAGTGTCTCTATGCCCACAACAGAATGATGAGTTATCTCCACATGTGAACACCTATACCAAGAATTGTAAACCTCATG
AATAATATAAAATGCAATAGTATGTATATACATTCTATGTTGTAGAAGTAGACAAAACATGGCAGTTTTTAGCATATTTACAACAGAGAATGATTCTCTA
ACACACTTCGAATATTGCAACCTACTGTGGACTTTCGTAAGGGATATGTCTAAGCGGTACAAAACTTGAGAGGCTCTCTCATCGTAAGGTGCATCAATCT
GCTCGAAATATAAATTTTTTTTCTATCTTATTTTATTGCAGTAGCACTAGCCATTACAAATTGGCAGAATGATGACTGATTTTCCCCAGAAGGGATAGGA
AAAAGTGAGCAGAAGTATTTGATCAGCACTTAGATAGAAACATAGAAGTATCGACTAACATTGTATACTAAAGCTTAAGCAAATAGGAAGAATTCACCGA
GTATTTTTTGTTAATAGTCTCTAAGGTTAGCCCCATTTTATTGACCACACCATGCCGGTAAGTTTTAGGTCCAACTCATACTAAAATAGTAAGAATTATT
TTTTGCAGAGTGGCATGGTGTGGCAGTTCTTGCATTTTTCAAAGTCAATATATATTTCAACAATATTAGTATCAGTCTCCCAAAGGAACCTCTCCTAAAA
TAATTTCCCAAAAAAACGAAAATGTGATTGGATTGCTTGTCTCCATTTTCATTCTTCCTCTTTCACCTTCTTTACTTTACTCCTCAACAGAACGAGGATT
TCCACATCATGCATGCAAAAAACAAAGTGCACGTAAAAGGTAAATTACTGTAATAAAAATGAGAGTAGTTGATAATATACGCCGATTGCCAAACCTGTCC
AGACCCTGTGACAAAAGCAGCATGATTATGAGAAGCTGAAACTTGCGCAACTTGTACGGGAACAGGAAAGCTAATTCGAGTAAATTCCACACACTGAGTT
GTTTCAGGCCCATGACCAAGGACGCCGCATAAACTGGAACCACAAGAGTATGCTGCTGAATCATTGATTAGCAGTGTGTGATACCTGCCACTCCTTATTT
GCATCTGCCAAGAACTTTTTACAGTAAGTAATAACAAAAGATGAAGTCCTAGCTGCAGACTATTCTAGTAGAAGCGAGTAACTAAAATCTAGAAATATTA
AGGTAGAAATCAATCAGCAACTAAACCTCGATCATAAAACCGTTATCCATTCCATTCTATTTGGTCCCATTTCATTGCAATACTAAATAATTCACTAAAC
CTTACATACAATTCCTTAACCAAACAAAAAAAGATAGCCTAGTACCTACTGCTATATGTGAAGCAGAGGAATCACGCGCTCCATCCAGTTGAAGAGTCCA
AATTTTCACTAAGGAGTTCAAAATACAATAAGGTAAATACACGAAGAAGCCGAAAAGGGGTCGAGAAGTGTCATTTTTGGCCCTATCTGACTGACAACAA
CAAAAATAGTGTCTGAAAACATTTCATCCATCTATTTGATAAGTAACATTTCGACCATATATTATTAGTCCTAAAAATAGCAATCAACCAAACAAAGTAA
ACATTGATAAACGAATAACAAGTTTTCCAAAGAAATAGTACATTGCCTGCAGAAGTTTCAACCATATCAGAGGACTGTTCCACAGCCATCAAGAACCTCA
AAAGACGCTTCCAATTGCCGTTACATCGCGTCAACAGCTCTTCCTGAGCATTACAATGCAAAGAAGCATAGATTGAACTCAATCCACAAAGCTGAAAAGC
AGCATAATCTACCAAAGACTTGAACTTTTTAGGAAACAAACCATGTGTTCCCCTAAAAGTCCTTGAAGTTAGCTCTAAACTTATTAAATCAATAACAGCT
AATCGACCGCACATCAATATTTCAAGAATCAAATGTACTGGCAAATCCTCCATTAAAGTTGACCTCAAACGATCCCCCATTTTCCCTTCACAAAAACAAT
CTTTTATACGAAAATGGAAACAATTAACACACTTTATCAAGAAAATATCAGATGTAAGAAAATTTGATGAAATTGAATAAGAAAATGAAGGACTTGGTGG
GGAAATCTTATAATCTAAGTCGAAATAAATCATCAAGAAACAACAACCCCAAAACACAAACTTGAACAAACAAAACAAAATTAAACTCTTTTTCTACCAA
ATTACAAGAAAAAACTCCAAAACCCCACAAAGATAGGAACTTTATAAACACAAATTTGAGCAAATATCGGATCTATGAATGAAAATTGAGTTGAGGGGTC
CTTGATAAACAAGAAATTAAGCTAAAAGTAGGTAAAGAAACAGTCTAATAGTGGAATTTTTTTCTTTATATAGAAGTGGCAAAAAGATGAAAGCGACTAA
AAGTTAAAGCTTTAATAAACCAAAATGCTGACTGAAGAATAAAGTATTAAAGATTAACAAGCAAGGCAGAGAAAAAAAAAAGATTTACAGACAAAAATGT
CCAACTAGGAAAGACACCAAATTACAGGCAATGATTTCTCTTTTTCTTTAATCGTGCTTTCTTTTCTTATTTTCGATAGGTACAATTAAATTTAAATTTA
TTTTTAAAATAATTATAAAAATTAACCGTAATTATGTATTATAATTACAATATTTTTATATGTATTTGTTGTAAAGTCTTGTCTTTCTAATGACTTTTCT
CATCCAATGAGCCTAGCGAGCTCACGTCGTCAGTCACTCGGAGGATTTTATCGATCGAAACACACGATGAAGGCTTATTCTAGCCTTCATTGTCCACATA
TACATACACATATAATTAGTCTTACATACATACATACATGCATACACGTTTGGTTATGACCAGATAATAAATTCGTTCGATTTTTAGTTAGGATGAGGTA
TTTTATGCCATAAAAACATGTATTTTGCTACACTTTAAAATCAAAGCATCGTTATGTTTTGAATATACTCCTATCTTTAAATTTATTTGTCTGGTTTTTA
TTTGACACATAACTTTAGAAATAAAGAATACTCTTGAATCATGTGCTTTTAATCTACAGATATGTATAATATACTGAAATATTGTAATTTTATACATATC
ACGTGAAATAATTAAATTAATGAGTTTATCTCACTATTAACTTGAAAAAAATACATAAATTAATACATTTTAAAAAATAATTACTTATTTTAGCGATACT
TTTGTTTATTACCATTTATAACAATTATTTGTTAAATCTGTAATATGTATTAAAAGTGAATTACGTATGCAATATATATGAATTATAATTATTTTTTGAA
ATATGTCATGTTTGTTTGGTAAAAAATTGTCACATTGTGTTACAACTGTATTAAAATGTGTGATAATGTATTATTCATCATGAAAATTTGTATTATACGT
GAATAATAAATTGTTCTTTGTAATATGTATTAAACTTGTATTATAAATAAATTAAAAGTGATCAACTGAAAAGAAAATACTATTGTTATAAATGATAAAT
ATTTTTTTATTATATTATATTTATGTAAGTTTCCCATTAATTTTTATGTTTTTTCAAAAACTTTTAGTTGAGCCCAATGCAATCAATACCCATAAGCCCA
AGACCAAGCCCAAATTCTTAGCCCTTACCCGTTTGCCACTTACCACCCGGTTTCTCTATCTCTGTCTCTCTCGATTCCGGCGAAATCCAAGCGGCAGGCG
GCAGGCGGTAGCTTATTTCAACTGGTAATTCTCAGCTCTTTCTTCTCCTGTTCCTTTTCTTATCAATAATGTCGCATAAACTAAAAAATATGCATTAACG
TATCAATTTTTTCTGAAGTATAATAGCTTATTTCTGATTTTTTGTACTAGTTCCTACTGTAATGCAGCACCACACCTCCGTATTGCTTCCATGAAAAATT
ATCTTATCTATTAAAATTATTGTTGTATTTTCATCTTAGAATGAAACAGATGAAGTGCTCTCTGTATTCCTAATGTTTGAAAAGTGTAAGCACTGGCATG
AAAAAATAGAGAAAAAGAGAAGACTGAGGAATAAAAACAGAAATAGCTTGAGATGTTTAGCTTTTACGGTCGGAAACTATCTTTTAAATGATCATGTGGG
ATATCCAGATCCTACTTGCGGGATTTCACTGGGTATGTTATTGTTATGATGTTGTGAACCGAGTGATCATGCAATTGCTAGATTATTTAGTTTGATTTAC
TACCTCAATTCAGCAGGCAGAGTATTAGTAATGGAATTTCGTAGACGCCTTTAACTAGAACTCGAGTACCTAAATGTCAGAAGTAAGGAGATGGAGAATT
GGATTTCTAAGCCCCTTGATTTCCAATACATATGTTTGAGCAAAGGAGAAAATCCCATAAAATTTGTCTTTATTGTGATGCTGTCGTAAAGTTACTTTTT
TTCGTTCCGTCATTCATATTTCCTGCCTCTTAGCTTCTCCCTCTTTTTTTTTGTTATTGTTATCTTTTCTTCTTGAAATGTTTTTTATGTCCTCTAGTTC
TTCATATCTTATATGAAATATTATACCATTTCACCCAGCAAGGGGGAAAAAATGAGAATCTGCTTCTTCAATTGACTAAATTTCCAATATGTTCATTTTG
ATTAATAGGTTTCGTACATGAAATCATTTACAATAGTATTCACTATTTAATATCTGGTGGCATTGATTTTGCTGATCTGTTGGTCCCTTGAAGAACAATT
TGACAGTGTCATTCTCTCACACATGAGTGTTTGAATTTCATTTAATTATGTTGGTTGCTCTTGTCTGTTTCTTCCTTTTTGAGCATTCTGTTCTTTTACG
AAGCCATTTTCTGCGAAATAGTGTGATCATATGTTAAAATGATGATTAGTTTTTTCAGTTTGCTCTTTTACAGTAGAAAGTGAGGAAAGAAACCAATTTA
AACAGTAAGAAAATATTGAAACCATGTCATACCAGGATTTCCAAGACTTAGAAATATGAAAATGATATGTCTCGTTGTACACCAGTTACATTGAACAATA
TGAAAGCAATTAGAGCTGATGAAAATTCGCATTCAATATGTGTTTTCCTTGCTAAACTGGACTTTACTGTTGTAGTTCATGGTGAGAAATTCACATTCTA
ATATGTGTTTTCCTTGCTAAACTGTACTTTACTGTTGTAGTTCATGGTGAGAAATTCACATTTTAATTTATTTCTCTCATAAGATAGAACAATAATAGAA
TCTGAATACTGATTTTTTGTTTGTAAAATATATCCTGGTCGGACGAAGGAATGCTGACATGACTCTTGTTGTTTTGACTTTCACAATTGCTCAAATATGA
GGAGATTTTAAGAAGTTAACAAAATTGATGTTCTGAAGCACAATAGTAATGCACAGGGTGATTGTAAGAAGAATGTGTCTTGTTTACTGTTTAATACGTA
ATACATTTGCTGCATTATGTCATTGATTGAAGTTTATGGGGCAATGTGACATCTATATATAAAGTTGTTGTACAATTAAAAAGTAAGGTATTCCTACGTC
GTTGTTTTACACGTTCTTTTTTTTCTTTTTCAGCTTTTCTCCTTCACTTCTTTCCCTCCTCTGTGTATCATCCATTGCAATTCTTGGTGTTGTTACTTTC
TGCTGCGCTGTATGATGGAAAACCAGTCACTTTGTGATGATAACATGGAGGAAGCAGAGTATGTATTGCTTGATCTAGATGACCTTCCTTGTGAAGTTTA
CATTCCCCCAAATGCACCATACGTTCTCTCGGTATGATTCCAAGTTCACCTTTCTGTTTCAATGTTTTGATGTTCTTATAGATCCAAAACTAAGTGATAA
CCCTTTTGGCTTTCCTTTTATTTCTTGACTTGTTAGATACTCATTGATTCGAGTAGTTCTTTAATTCTATACAACTAGATTGTTCTTGCAGCTTCTTGAA
AACTATTGCAATTGCTTTGTTTCTTTAATTTTGTAACTTGTTTTTGCAGGGTCTTGACACATTGAACCCCATCTTGACCATCGATGGTAAAATCAAGCTG
GTGAGTGGGTGATTTTCGAGGCTGCTTCAAGTTCATTTTTGTTTTGAATTTATCAATCATGTTTACAGAATTGTAATATATCTCCTTAATGAGATTAGTT
GTTAGTGTGGTAATATTCTTATAAAGGTATGTATCTCCTTAGTGACATTAGTCATTACATTGGTCAGTCATCTTGATCCCCGCTAAACATCCTTACACAC
CAAAAGGCCGCCTCACTTACATCAGTGACATTACACTCACTTTATTGTCTAGCTATTTCTTGCAAAATAGACAATAATGCACTTAAATGAAACTTTATGG
CTGATAGGTCTCTGTCCTCACAGTTTTGTCTTCCATTTGTGAGAGGATATAGACAGATTGTGTCCATTTCAATCCCCTTGTTATTTCTGGCGAGTCGTTA
ATTGAGATCTTTCTAGAACAAAAGAGTCTGTGAAGGGAAAACAAAGTAGATATAATGGAGAGTGGGTGTAACAATTGTGGTTATACAATCCAAATATGTT
GTATCTTTTGATTATCCTCGCATGCATATGAACCCCCATTGGGCAATTAAGCTGATTAGTTCGTATGCTATTTTCGTACCGTAGAAGTGTGTTTATCAAC
TGTTGTTTATTTCTGTTTTGCAGATTGGACAGTATGATGAGACTATTGGGACATGCCTTGTTTTTGATGAAAAAGGTAAGCCATGTTCCTCTCCGCAACA
TATTATAATAGAACAAGAAAAGGAATGAGCTACTTTCCTGATTACTTTAATCTAGCTTCAACGGTGCTGGTGATGTTCCATCTCATCCCAAAAAATATTT
TTTTTTAAAATAAGAGGGAGTTCTTCTTTTCCTGTTTCTACCATACAAAAATTTGCCTGGGGTCAGAACTTGGTTCTTTATAACTGACACTGGGCTGCCT
CCTGGTATCCGTGAATGATAATTTGTGACAACATTAGGCACATAGTAGACTGTGATCCAGGGAATCTGTCATTTTTAGGTTCATATGAATAGAGTACGTT
TTTTCTGGAACATGTCCTCTAACATAATGTGCATTCGACACAATGAAACATAAGTATAGGAGGGGGCCTTCAGAATTTTTTAGTCCACGACTCCTTGCCT
CATGTCTTTTTTCTATTTAGACTTACATTCAGTTTTCTAGTTTCATGAGTTTTGCATATTAGTTGGATAATATAAAAGAACAATAATTCTTCAAATCTAT
CTGGAATTTTATCACCAAGTAAACGTTCTGGCAGATACCCCTCCTGAAGAAGCTGGACCTTCTGAAGCTAACCTTTGCCCAGGAAGGCCCACGTTAGATC
CTAAGCAAACCAAGTCGAAACAAGTCAAGCCTGTAACACAGCTTCAAAAGATACTTAAATTCAAGCTGTTGCAGAATAGTGAAACTGAAGATGCAAGAGA
GAAGCCAAAAGAAGATTAGGTAACCGAGTGTTTTAGCAACTTAGATGCTACTACTCGAGAATGTACAGTGGAGTCGAAACAGAGCTATTACGACATAGCA
TTGGTGTAGCATGGATAATACTATCATTTTTCTTCATAGCTGGTTCAGAACTTAGACATTGCACAATGTGCAGCAACTGAATATGGCAGGTAGAATCAGT
TGGATACACAAGGCTATTACTTTATAATTTTCTCCTTTTATTATTATCCATGGAACTCTCATGCCCTTGTTTACACAATTATTTCATTGAATGTAAATAA
ATACAAGAAAATACTTTGAAATCTTAATCTGAAGTAAATGACAATTATGTTGTTTTGGTTTTCAAAATATCGCTATATCTCAATGACCTTTGGCCCTAAC
AAGGGTCGTAATGGAGTGGTAAGTAAGCCTTCATCTTTAATCAAAGGTTTTGAATTTGAGTTTCTATTGGATGTGGAATCACCTTTTTGTTGGGCTTCAA
TGTAGGTGGGAGTCCAAAAAATTCTTTTCAACGTGAATTCAAATTTAGTCGGATTTCAATATACATATCAGATATTGCCGAAAGACCAAAAATAAAAAAA
ATGACATTGACGTATTATTTTTCCATTTTAATTTGTCATCAAATGCAAAATTTTAAAGTAGAAAAGTAAAAATGAACGAGCAAGTAAGGTGGTAGATTTA
TTTCTTCCAAATAAAAAGAAAAATTTCAATAGCGGGAAAAGGAGTAAATATGAAAAGGTTTAGTATGCAAAAAGACAAATAAGCTAAAGTTAGAGGATCT
TACAGTAATTTTCAGAACAAAATCGCAATATATATTCTATTGACGTTCTCCGTGCATGGAGAATTATTTTTAAAACCCCTTTTTTTATTTTATTCACACA
AAATGGCGAAGAACAAAAGCGGCAACCGTAGCTCCGCCACTACACGGCGGCTGAAGATGTATAATTCTAGGCCGAAGCGTGACCGGAAGGGCAAAATATT
GAAGCACGAGTATCAATCAAAGCAGCTTCCGTCAACGAGGATACAGCCAGATCCCCGATGGTTCAGTATGTGCTCTTCCCAAAAAATTTTATCGTTCGTG
CTTCTATATTTTTTACTAGATTTAGCGCATGTGCGTTGTGGTTGCCTCGTCTTGTGATGCTTAAAAATAGTGGTCCTATGTGTATAGGTGAAGTGTTGGT
TTGAAGTTAACCTGTGTATCATCAAGCGTTCCATCCATAATATTGGGTAACATCACTTTTGTGGCCTTTTTCATTGCCTTACTTGGTGTGGGAGGTGATT
TAACTGTAGCACGTAATTGAGAAAATCTTTGTGGGTTTTAAATTGGTTAGATTACATTTTAAATCGATTGGGACTGGTGATATTTAGTTTCCGCTAAGTA
AATGGTGGCTACGTTGTTCAATTGTACTTTGAACATAAGTTCGGGCAGTGAGGTTAAATGAATAATGCCTAGCATATTAGTAAATGAGGTTCCATACCAG
GCGCGAAGATCTAGTGATTATCCAATCACTATTTATTTTTATTCCTCACATCAAACGACCTTTTATAGTTTGAGACTCTCATGTCACATAAGCCTAGAAT
AGGTTGGTCGTCTCTCAACTTTTCAAGAAATAAGCCAATCATTTTCTGCAAAACCTCCCCATAGATTAACAGTTGTACGCTCCATGTAGATTTGTCAATT
AGACGAGTATTGTGAAAGCACTGGAGAAATAATTTGAACAAAGAATGACGATTTTATGCTTTTAAAGTAATATAGATATAGATATATAGTTTATGATAAG
AAATTGGTCGAATTGATGACTTTATTAGTGAAAACTGTTACATACTTTGATTTGGTTCACGGGAGCAGGGTGTATTAGTGTTTAAATTTAGCTGAATATG
TTTTGATTTTCTTATTGTTCAATTGCTATTATGGTGGATTAACTTGCTCATAATGGATGCTTAGTTTTGCTTATGTAAGAATTATATGTGAATCATCTGA
AATTGATATGATTTTCGGGATTCTACAGTCAATACTCGGGTGATTAGTCAGGAGAAATTGGAATCATTTAGAGAAGAGATTCAAGATCGGCTTTCTAGCA
ACTACAATATCATCATGAATGGAAGTAATTTGCCCATGTCCCTTGTGAATGAACACAAGAAGGTATGCATAGTGACTTTTCCTTTAGTCTATTTGTTTAA
GAACTTGCTTTGTTTGTCAATGTCTACCTGACTCGTTGTAAACTTTTGTATTGGTCCTGGGATAATTTCTTACCATCGAGCTTGGTGGACAGAGTTACTT
GGTGCCTACTAGCCTGGACACATTACAACAGTTTTGAGTTTTTGCAATAAAAATAATTATTAGTGAGCTTCATATTATGTAAGCACGAGCTATATGTTTA
CTTAACTTGTTTAGTTGGAATAACTTGACTTCATTAAATAATGATGACGAACTTTGGTTCCGTTAGCTCCCTGGTCTTAGTCTAGTTTGTTTCTGATGTA
TTCGATCTAACACACTTTTTGTTTGCAATTTTGCATCATCTTGATACTTTTTTAATTATGACCCTGTTATTACTTCATAGAAAAATAAGAGAACTAGCTT
GGTCTTGCTACACTAGTGCTTGATTCCTCATTATGTTTTACTAATTTCGTCCTCTTTTATCTTTGTGAAGAAAGGAAAAGCTCATCAACTTGGCAGTAAG
CCTTCTGCTGGAACAGAGAAAAAACACGCAAAACATTTTAAATCATTAGCCAAGAAGGCCGATACACCTTAAGGTATGAAATGAGAACGCACAAATTTAA
GAGTTTATGCTTGTTGTTTCTGTGTATGCACTTCTTATCTATTTGAAACAACCTCTCTATCTCAAGGCAGGAGTAAACTCTGCGTATATCCTGCCCTCCC
CAAACTTCATTTGTTGAATTATATTGTGTATGTTGTTAATCATAAATTTCTTTTGCAGATCGCCCTTCCCACGATTCATGAAGAGACAAACCATCTAAAT
CCGACCTTTTCTGCAAGTTGATTCAAGGGAGAAGCCAAAGATAAGATTGGACAACTCATATTTTAGTTAATCAGTAGATACTTCAGTTTATTCAAGAATT
TTAGCGAAGTAAAAGTTGAGTCTTATATAAATATCAAGAAGAGAACTATGGTACTTATTTTTTAGGATGTTTGTAGAACAACGATTATTGACAATTGCTG
TTGATTTTGGCTTTTTTGAGGAGGAACTCCTCTATGAGTTGATTTTATTTAACGCTCACTTTCCAGAGATGACTGAATTTAGAAAATGTACGGTTATTTT
GTTGGTTGTCGAAAACTTGATCAAATGGTCATTCTTAGCAACAAATTATGCCTTACAATGCCAAATCCGTATTGTGTACTGTAACACTTTTGAACTCGTT
ATACTAGACTTGTTTAGTGTTATTTATCTCTCCTATAGCTCGTCATATTAGACTTGTTTAGTATTATTTATCTCTCCTATATAAGTTACAGGTTATTATA
CTTGAGTTTACAAAATGAATGAGAAGGTATAGACGTATGTGACAGCCATTTGCTTATATCATCAATTTATCACTAAGCTTTAAATATAAAAAATTCACTC
AACAATCAAATACTTATAAAACATCTTTAACAAAAGTATTTTTGGTAATTACATTCACTTGGTTTGTAAATATATTTTAATTCATCGCATTCTGCTAAAG
CTCTCTAACCCATCCTATTCCAGACAACATAACTCGTCCAGCTCAAGTTCTGAATTTCTAATTATAGGAAGAAGAGCGAAATTGAAGAGAGAAAAAACTT
AGTACGTAACACGTATGCCTCTATTACCATTTCCGATGAAGAAAAACTTAGTATACCAAAACATAAATAAGCTAAAGTTAAAGAAGCTTAGAGTAATTAT
CTAAACCAACAAATTCACACATATTGAAAAAGCTAGGTTTTAGCTCTTAACGCCTCCTCTTCTTTGTGGAGTGTATACTACAAACCGGCCTAGACGACTG
AGGTATTAACGTTAATCGCCGATTCCTAAACCCTAGTTTTGTTCTTCGTATATCGGAGATGGCGAAGAAGAAAGAGAGGTCGGTGAATGTATCGGGAAAG
CCAAAGCATTCATTGGACTCCAATAGGGATGTCAGCGCAGCCAAAAATGGCCGTAGCGCCGCTACTGTGCGGCGGCTCAAGATGTACAATACCAGGCCGA
AGCGTAATCCTCAGGGTCACATAATTAAGCACGACTTACAATCAAAGGAGCTGCCATCAACAAGGATACAACCAGATCGTCGTTGGTTCGGTATGTTCTG
AAAAGTTTCACACTTTTCACTTCTACGTTCTTACTAATTACAAAATATAGTCTTTTGCCAGCAGAGATAATTTGTAGTACTCCTGTAGTTTGTGTTTCTG
AAGATTAATTTGACAACCTGACTTAATTAGGTTGCTGAAATCTATTTAGAATTGGCGTTGGGTTAGTGCGGAAGTGTTAATATTGAGGTGGAGGGAGTAT
TAATGATTAAATTGAGCTGAATTTTTTATTTTCATCGTTAAAAATGTCATCTTTGGTTAGTTGATGCTACTTTTCGTGTATGACTGAATTTTGTTGAAAT
AATTGAATTGGGAATTTATTTTCCAACTTCACAGGTAATACTCGGGTGGTCAACCAGAAGGAACTGGAGTTTTTTAGAGAAGAGCTCCAAACTCGGCTTT
CCAGTAACTACAATGTTATATTAAAAGAAAGGAAGTTGCCCATGTCCCTTTTAAATGATCATCAGAAGGTATGGGAGATTCTTTTTCCTTAGTTTTATTA
TTTAACAACTTGTTCTTATGTTCCTGCTGAGTCACCGTGAATCTCTTTACTCTGCTATTGTAATTCTAATGTGCACTCATTATTGTATGATTTGGGGGCT
TCCTGTGATACGCACATGTACTATTTGTGTGTGTATAGAATAACTTGGCAAATTGAGGCTAAATCTTGTTGCTTTATGCTTCATACTGGATTTGTTTGCT
AATATTTTTCTCTTTTTCTCTTTTTGATTAAAGCAAGTAAAAGTTCATCTGCTTGACAATGAGCCATTTGCTGATGCTTTTGGACCAAAAACAAAGAGGA
AACGCCCCAAACTTATGGCATTAGATTATGAAGCTT