BAC Sequence – LE_HBa0137J06

>C07HBa0137J06.2
AAGCTTAAGCAAATAGGAAGAATTCACCGAGTATTTTTTGTTAATAGTCTCTAAGGTTAGCCCCATTTTATTGACCACACCATGCCGGTAAGTTTTAGGT
CCAACTCATACTAAAATAGTAAGAATTATTTTTTGCAGAGTGGCATGGTGTGGCAGTTCTTGCATTTTTCAAAGTCAATATATATTTCAACAATATTAGT
ATCAGTCTCCCAAAGGAACCTCTCCTAAAATAATTTCCCAAAAAAACGAAAATGTGATTGGATTGCTTGTCTCCATTTTCATTCTTCCTCTTTCACCTTC
TTTACTTTACTCCTCAACAGAACGAGGATTTCCACATCATGCATGCAAAAAACAAAGTGCACGTAAAAGGTAAATTACTGTAATAAAAATGAGAGTAGTT
GATAATATACGCCGATTGCCAAACCTGTCCAGACCCTGTGACAAAAGCAGCATGATTATGAGAAGCTGAAACTTGCGCAACTTGTACGGGAACAGGAAAG
CTAATTCGAGTAAATTCCACACACTGAGTTGTTTCAGGCCCATGACCAAGGACGCCGCATAAACTGGAACCACAAGAGTATGCTGCTGAATCATTGATTA
GCAGTGTGTGATACCTGCCACTCCTTATTTGCATCTGCCAAGAACTTTTTACAGTAAGTAATAACAAAAGATGAAGTCCTAGCTGCAGACTATTCTAGTA
GAAGCGAGTAACTAAAATCTAGAAATATTAAGGTAGAAATCAATCAGCAACTAAACCTCGATCATAAAACCGTTATCCATTCCATTCTATTTGGTCCCAT
TTCATTGCAATACTAAATAATTCACTAAACCTTACATACAATTCCTTAACCAAACAAAAAAAGATAGCCTAGTACCTACTGCTATATGTGAAGCAGAGGA
ATCACGCGCTCCATCCAGTTGAAGAGTCCAAATTTTCACTAAGGAGTTCAAAATACAATAAGGTAAATACACGAAGAAGCCGAAAAGGGGTCGAGAAGTG
TCATTTTTGGCCCTATCTGACTGACAACAACAAAAATAGTGTCTGAAAACATTTCATCCATCTATTTGATAAGTAACATTTCGACCATATATTATTAGTC
CTAAAAATAGCAATCAACCAAACAAAGTAAACATTGATAAACGAATAACAAGTTTTCCAAAGAAATAGTACATTGCCTGCAGAAGTTTCAACCATATCAG
AGGACTGTTCCACAGCCATCAAGAACCTCAAAAGACGCTTCCAATTGCCGTTACATCGCGTCAACAGCTCTTCCTGAGCATTACAATGCAAAGAAGCATA
GATTGAACTCAATCCACAAAGCTGAAAAGCAGCATAATCTACCAAAGACTTGAACTTTTTAGGAAACAAACCATGTGTTCCCCTAAAAGTCCTTGAAGTT
AGCTCTAAACTTATTAAATCAATAACAGCTAATCGACCGCACATCAATATTTCAAGAATCAAATGTACTGGCAAATCCTCCATTAAAGTTGACCTCAAAC
GATCCCCCATTTTCCCTTCACAAAAACAATCTTTTATACGAAAATGGAAACAATTAACACACTTTATCAAGAAAATATCAGATGTAAGAAAATTTGATGA
AATTGAATAAGAAAATGAAGGACTTGGTGGGGAAATCTTATAATCTAAGTCGAAATAAATCATCAAGAAACAACAACCCCAAAACACAAACTTGAACAAA
CAAAACAAAATTAAACTCTTTTTCTACCAAATTACAAGAAAAAACTCCAAAACCCCACAAAGATAGGAACTTTATAAACACAAATTTGAGCAAATATCGG
ATCTATGAATGAAAATTGAGTTGAGGGGTCCTTGATAAACAAGAAATTAAGCTAAAAGTAGGTAAAGAAACAGTCTAATAGTGGAATTTTTTTCTTTATA
TAGAAGTGGCAAAAAGATGAAAGCGACTAAAAGTTAAAGCTTTAATAAACCAAAATGCTGACTGAAGAATAAAGTATTAAAGATTAACAAGCAAGGCAGA
GAAAAAAAAAAGATTTACAGACAAAAATGTCCAACTAGGAAAGACACCAAATTACAGGCAATGATTTCTCTTTTTCTTTAATCGTGCTTTCTTTTCTTAT
TTTCGATAGGTACAATTAAATTTAAATTTATTTTTAAAATAATTATAAAAATTAACCGTAATTATGTATTATAATTACAATATTTTTATATGTATTTGTT
GTAAAGTCTTGTCTTTCTAATGACTTTTCTCATCCAATGAGCCTAGCGAGCTCACGTCGTCAGTCACTCGGAGGATTTTATCGATCGAAACACACGATGA
AGGCTTATTCTAGCCTTCATTGTCCACATATACATACACATATAATTAGTCTTACATACATACATACATGCATACACGTTTGGTTATGACCAGATAATAA
ATTCGTTCGATTTTTAGTTAGGATGAGGTATTTTATGCCATAAAAACATGTATTTTGCTACACTTTAAAATCAAAGCATCGTTATGTTTTGAATATACTC
CTATCTTTAAATTTATTTGTCTGGTTTTTATTTGACACATAACTTTAGAAATAAAGAATACTCTTGAATCATGTGCTTTTAATCTACAGATATGTATAAT
ATACTGAAATATTGTAATTTTATACATATCACGTGAAATAATTAAATTAATGAGTTTATCTCACTATTAACTTGAAAAAAATACATAAATTAATACATTT
TAAAAAATAATTACTTATTTTAGCGATACTTTTGTTTATTACCATTTATAACAATTATTTGTTAAATCTGTAATATGTATTAAAAGTGAATTACGTATGC
AATATATATGAATTATAATTATTTTTTGAAATATGTCATGTTTGTTTGGTAAAAAATTGTCACATTGTGTTACAACTGTATTAAAATGTGTGATAATGTA
TTATTCATCATGAAAATTTGTATTATACGTGAATAATAAATTGTTCTTTGTAATATGTATTAAACTTGTATTATAAATAAATTAAAAGTGATCAACTGAA
AAGAAAATACTATTGTTATAAATGATAAATATTTTTTTATTATATTATATTTATGTAAGTTTCCCATTAATTTTTATGTTTTTTCAAAAACTTTTAGTTG
AGCCCAATGCAATCAATACCCATAAGCCCAAGACCAAGCCCAAATTCTTAGCCCTTACCCGTTTGCCACTTACCACCCGGTTTCTCTATCTCTGTCTCTC
TCGATTCCGGCGAAATCCAAGCGGCAGGCGGCAGGCGGTAGCTTATTTCAACTGGTAATTCTCAGCTCTTTCTTCTCCTGTTCCTTTTCTTATCAATAAT
GTCGCATAAACTAAAAAATATGCATTAACGTATCAATTTTTTCTGAAGTATAATAGCTTATTTCTGATTTTTTGTACTAGTTCCTACTGTAATGCAGCAC
CACACCTCCGTATTGCTTCCATGAAAAATTATCTTATCTATTAAAATTATTGTTGTATTTTCATCTTAGAATGAAACAGATGAAGTGCTCTCTGTATTCC
TAATGTTTGAAAAGTGTAAGCACTGGCATGAAAAAATAGAGAAAAAGAGAAGACTGAGGAATAAAAACAGAAATAGCTTGAGATGTTTAGCTTTTACGGT
CGGAAACTATCTTTTAAATGATCATGTGGGATATCCAGATCCTACTTGCGGGATTTCACTGGGTATGTTATTGTTATGATGTGGTGAACCGAGTGATCAT
GCCATTGCTAGATTATTTAGTTTGATTTACTACCTCAATTCAGCAGGCAGAGTATTAGTAATGGGAATTCGTAGACGCCTTTAACTAGAACTCGAGTTAC
TAAATGTCAGAAGTAAGGAGATGGAGGAATGGATTTCTAAGCCCCTTGATTTCCAATACATATGTTTGAGCAAAGGAGAAAATCCCATAAAATTTGTCTT
TATTGTGATGCTGTCGTAAAGTTACTTTTTTTCGTTCCGTCATTCATATTTCCTGCCTCTTAGCTTCTCCCTCTTTTTTTTTGTTATTGTTATCTTTTCT
TCTTGAAATGTTTTTTATGTCCTCTAGTTCTTCATATCTTATATGAAATATTATACCATTTCACCCAGCAAGGGGGAAAAAATGAGAATCTGCTTCTTCA
ATTGACTAAATTTCCAATATGTTCATTTTGATTAATAGGTTTCGTACATGAAATCATTTACAATAGTATTCACTATTTAATATCTGGTGGCATTGATTTT
GCTGATCTGTTGGTCCCTTGAAGAACAATTTGACAGTGTCATTCTCTCACACATGAGTGTTTGAATTTCATTTAATTATGTTGGTTGCTCTTGTCTGTTT
CTTCCTTTTTGAGCATTCTGTTCTTTTACGAAGCCATTTTCTGCGAAATAGTGTGATCATATGTTAAAATGATGATTAGTTTTTTCAGTTTGCTCTTTTA
CAGTAGAAAGTGAGGAAAGAAACCAATTTAAACAGTAAGAAAATATTGAAACCATGTCATACCAGGATTTCCAAGACTTAGAAATATGAAAATGATATGT
CTCGTTGTACACCAGTTACATTGAACAATATGAAAGCAATTAGAGCTGATGAAAATTCGCATTCAATATGTGTTTTCCTTGCTAAACTGGACTTTACTGT
TGTAGTTCATGGTGAGAAATTCACATTCTAATATGTGTTTTCCTTGCTAAACTGTACTTTACTGTTGTAGTTCATGGTGAGAAATTCACATTTTAATTTA
TTTCTCTCATAAGATAGAACAATAATAGAATCTGAATACTGATTTTTTGTTTGTAAAATATATCCTGGTCGGACGAAGGAATGCTGACATGACTCTTGTT
GTTTTGACTTTCACAATTGCTCAAATATGAGGAGATTTTAAGAAGTTAACAAAATTGATGTTCTGAAGCACAATAGTAATGCACAGGGTGATTGTAAGAA
GAATGTGTCTTGTTTACTGTTTAATACGTAATACATTTGCTGCATTATGTCATTGATTGAAGTTTATGGGGCAATGTGACATCTATATATAAAGTTGTTG
TACAATTAAAAAGTAAGGTATTCCTACGTCGTTGTTTTACACGTTCTTTTTTTTCTTTTTCAGCTTTTCTCCTTCACTTCTTTCCCTCCTCTGTGTATCA
TCCATTGCAATTCTTGGTGTTGTTACTTTCTGCTGCGCTGTATGATGGAAAACCAGTCACTTTGTGATGATAACATGGAGGAAGCAGAGTATGTATTGCT
TGATCTAGATGACCTTCCTTGTGAAGTTTACATTCCCCCAAATGCACCATACGTTCTCTCGGTATGATTCCAAGTTCACCTTTCTGTTTCAATGTTTTGA
TGTTCTTATAGATCCAAAACTAAGTGATAACCCTTTTGGCTTTCCTTTTATTTCTTGACTTGTTAGATACTCATTGATTCGAGTAGTTCTTTAATTCTAT
ACAACTAGATTGTTCTTGCAGCTTCTTGAAAACTATTGCAATTGCTTTGTTTCTTTAATTTTGTAACTTGTTTTTGCAGGGTCTTGACACATTGAACCCC
ATCTTGACCATCGATGGTAAAATCAAGCTGGTGAGTGGGTGATTTTCGAGGCTGCTTCAAGTTCATTTTTGTTTTGAATTTATCAATCATGTTTACAGAA
TTGTAATATATCTCCTTAATGAGATTAGTTGTTAGTGTGGTAATATTCTTATAAAGGTATGTATCTCCTTAGTGACATTAGTCATTACATTGGTCAGTCA
TCTTGATCCCCGCTAAACATCCTTACACACCAAAAGGCCGCCTCACTTACATCAGTGACATTACACTCACTTTATTGTCTAGCTATTTCTTGCAAAATAG
ACAATAATGCACTTAAATGAAACTTTATGGCTGATAGGTCTCTGTCCTCACAGTTTTGTCTTCCATTTGTGAGAGGATATAGACAGATTGTGTCCATTTC
AATCCCCTTGTTATTTCTGGCGAGTCGTTAATTGAGATCTTTCTAGAACAAAAGAGTCTGTGAAGGGAAAACAAAGTAGATATAATGGAGAGTGGGTGTA
ACAATTGTGGTTATACAATCCAAATATGTTGTATCTTTTGATTATCCTCGCATGCATATGAACCCCCATTGGGCAATTAAGCTGATTAGTTCGTATGCTA
TTTTCGTACCGTAGAAGTGTGTTTATCAACTGTTGTTTATTTCTGTTTTGCAGATTGGACAGTATGATGAGACTATTGGGACATGCCTTGTTTTTGATGA
AAAAGGTAAGCCATGTTCCTCTCCGCAACATATTATAATAGAACAAGAAAAGGAATGAGCTACTTTCCTGATTACTTTAATCTAGCTTCAACGGTGCTGG
TGATGTTCCATCTCATCCCAAAAAATATTTTTTTTTAAAATAAGAGGGAGTTCTTCTTTTCCTGTTTCTACCATACAAAAATTTGCCTGGGGTCAGAACT
TGGTTCTTTATAACTGACACTGGGCTGCCTCCTGGTATCCGTGAATGATAATTTGTGACAACATTAGGCACATAGTAGACTGTGATCCAGGGAATCTGTC
ATTTTTAGGTTCATATGAATAGAGTACGTTTTTTCTGGAACATGTCCTCTAACATAATGTGCATTCGACACAATGAAACATAAGTATAGGAGGGGGCCTT
CAGAATTTTTTAGTCCACGACTCCTTGCCTCATGTCTTTTTTCTATTTAGACTTACATTCAGTTTTCTAGTTTCATGAGTTTTGCATATTAGTTGGATAA
TATAAAAGAACAATAATTCTTCAAATCTATCTGGAATTTTATCACCAAGTAAACGTTCTGGCAGATACCCCTCCTGAAGAAGCTGGACCTTCTGAAGCTA
ACCTTTGCCCAGGAAGGCCCACGTTAGATCCTAAGCAAACCAAGTCGAAACAAGTCAAGCCTGTAACACAGCTTCAAAAGATACTTAAATTCAAGCTGTT
GCAGAATAGTGAAACTGAAGATGCAAGAGAGAAGCCAAAAGAAGATTAGGTAACCGAGTGTTTTAGCAACTTAGATGCTACTACTCGAGAATGTACAGTG
GAGTCGAAACAGAGCTATTACGACATAGCATTGGTGTAGCATGGATAATACTATCATTTTTCTTCATAGCTGGTTCAGAACTTAGACATTGCACAATGTG
CAGCAACTGAATATGGCAGGTAGAATCAGTTGGATACACAAGGCTATTACTTTATAATTTTCTCCTTTTATTATTATCCATGGAACTCTCATGCCCTTGT
TTACACAATTATTTCATTGAATGTAAATAAATACAAGAAAATACTTTGAAATCTTAATCTGAAGTAAATGACAATTATGTTGTTTTGGTTTTCAAAATAT
CGCTATATCTCAATGACCTTTGGCCCTAACAAGGGTCGTAATGGAGTGGTAAGTAAGCCTTCATCTTTAATCAAAGGTTTTGAATTTGAGTTTCTATTGG
ATGTGGAATCACCTTTTTGTTGGGCTTCAATGTAGGTGGGAGTCCAAAAAATTCTTTTCAACGTGAATTCAAATTTAGTCGGATTTCAATATACATATCA
GATATTGCCGAAAGACCAAAAATAAAAAAAATGACATTGACGTATTATTTTTCCATTTTAATTTGTCATCAAATGCAAAATTTTAAAGTAGAAAAGTAAA
AATGAACGAGCAAGTAAGGTGGTAGATTTATTTCTTCCAAATAAAAAGAAAAATTTCAATAGCGGGAAAAGGAGTAAATATGAAAAGGTTTAGTATGCAA
AAAGACAAATAAGCTAAAGTTAGAGGATCTTACAGTAATTTTCAGAACAAAATCGCAATATATATTCTATTGACGTTCTCCGTGCATGGAGAATTATTTT
TAAAACCCCTTTTTTTATTTTATTCACACAAAATGGCGAAGAACAAAAGCGGCAACCGTAGCTCCGCCACTACACGGCGGCTGAAGATGTATAATTCTAG
GCCGAAGCGTGACCGGAAGGGCAAAATATTGAAGCACGAGTATCAATCAAAGCAGCTTCCGTCAACGAGGATACAGCCAGATCCCCGATGGTTCAGTATG
TGCTCTTCCCAAAAAATTTTATCGTTCGTGCTTCTATATTTTTTACTAGATTTAGCGCATGTGCGTTGTGGTTGCCTCGTCTTGTGATGCTTAAAAATAG
TGGTCCTATGTGTATAGGTGAAGTGTTGGTTTGAAGTTAACCTGTGTATCATCAAGCGTTCCATCCATAATATTGGGTAACATCACTTTTGTGGCCTTTT
TCATTGCCTTACTTGGTGTGGGAGGTGATTTAACTGTAGCACGTAATTGAGAAAATCTTTGTGGGTTTTAAATTGGTTAGATTACATTTTAAATCGATTG
GGACTGGTGATATTTAGTTTCCGCTAAGTAAATGGTGGCTACGTTGTTCAATTGTACTTTGAACATAAGTTCGGGCAGTGAGGTTAAATGAATAATGCCT
AGCATATTAGTAAATGAGGTTCCATACCAGGCGCGAAGATCTAGTGATTATCCAATCACTATTTATTTTTATTCCTCACATCAAACGACCTTTTATAGTT
TGAGACTCTCATGTCACATAAGCCTAGAATAGGTTGGTCGTCTCTCAACTTTTCAAGAAATAAGCCAATCATTTTCTGCAAAACCTCCCCATAGATTAAC
AGTTGTACGCTCCATGTAGATTTGTCAATTAGACGAGTATTGTGAAAGCACTGGAGAAATAATTTGAACAAAGAATGACGATTTTATGCTTTTAAAGTAA
TATAGATATAGATATATAGTTTATGATAAGAAATTGGTCGAATTGATGACTTTATTAGTGAAAACTGTTACATACTTTGATTTGGTTCACGGGAGCAGGG
TGTATTAGTGTTTAAATTTAGCTGAATATGTTTTGATTTTCTTATTGTTCAATTGCTATTATGGTGGATTAACTTGCTCATAATGGATGCTTAGTTTTGC
TTATGTAAGAATTATATGTGAATCATCTGAAATTGATATGATTTTCGGGATTCTACAGTCAATACTCGGGTGATTAGTCAGGAGAAATTGGAATCATTTA
GAGAAGAGATTCAAGATCGGCTTTCTAGCAACTACAATATCATCATGAATGGAAGTAATTTGCCCATGTCCCTTGTGAATGAACACAAGAAGGTATGCAT
AGTGACTTTTCCTTTAGTCTATTTGTTTAAGAACTTGCTTTGTTTGTCAATGTCTACCTGACTCGTTGTAAACTTTTGTATTGGTCCTGGGATAATTTCT
TACCATCGAGCTTGGTGGACAGAGTTACTTGGTGCCTACTAGCCTGGACACATTACAACAGTTTTGAGTTTTTGCAATAAAAATAATTATTAGTGAGCTT
CATATTATGTAAGCACGAGCTATATGTTTACTTAACTTGTTTAGTTGGAATAACTTGACTTCATTAAATAATGATGACGAACTTTGGTTCCGTTAGCTCC
CTGGTCTTAGTCTAGTTTGTTTCTGATGTATTCGATCTAACACACTTTTTGTTTGCAATTTTGCATCATCTTGATACTTTTTTAATTATGACCCTGTTAT
TACTTCATAGAAAAATAAGAGAACTAGCTTGGTCTTGCTACACTAGTGCTTGATTCCTCATTATGTTTTACTAATTTCGTCCTCTTTTATCTTTGTGAAG
AAAGGAAAAGCTCATCAACTTGGCAGTAAGCCTTCTGCTGGAACAGAGAAAAAACACGCAAAACATTTTAAATCATTAGCCAAGAAGGCCGATACACCTT
AAGGTATGAAATGAGAACGCACAAATTTAAGAGTTTATGCTTGTTGTTTCTGTGTATGCACTTCTTATCTATTTGAAACAACCTCTCTATCTCAAGGCAG
GAGTAAACTCTGCGTATATCCTGCCCTCCCCAAACTTCATTTGTTGAATTATATTGTGTATGTTGTTAATCATAAATTTCTTTTGCAGATCGCCCTTCCC
ACGATTCATGAAGAGACAAACCATCTAAATCCGACCTTTTCTGCAAGTTGATTCAAGGGAGAAGCCAAAGATAAGATTGGACAACTCATATTTTAGTTAA
TCAGTAGATACTTCAGTTTATTCAAGAATTTTAGCGAAGTAAAAGTTGAGTCTTATATAAATATCAAGAAGAGAACTATGGTACTTATTTTTTAGGATGT
TTGTAGAACAACGATTATTGACAATTGCTGTTGATTTTGGCTTTTTTGAGGAGGAACTCCTCTATGAGTTGATTTTATTTAACGCTCACTTTCCAGAGAT
GACTGAATTTAGAAAATGTACGGTTATTTTGTTGGTTGTCGAAAACTTGATCAAATGGTCATTCTTAGCAACAAATTATGCCTTACAATGCCAAATCCGT
ATTGTGTACTGTAACACTTTTGAACTCGTTATACTAGACTTGTTTAGTGTTATTTATCTCTCCTATAGCTCGTCATATTAGACTTGTTTAGTATTATTTA
TCTCTCCTATATAAGTTACAGGTTATTATACTTGAGTTTACAAAATGAATGAGAAGGTATAGACGTATGTGACAGCCATTTGCTTATATCATCAATTTAT
CACTAAGCTTTAAATATAAAAAATTCACTCAACAATCAAATACTTATAAAACATCTTTAACAAAAGTATTTTTGGTAATTACATTCACTTGGTTTGTAAA
TATATTTTAATTCATCGCATTCTGCTAAAGCTCTCTAACCCATCCTATTCCAGACAACATAACTCGTCCAGCTCAAGTTCTGAATTTCTAATTATAGGAA
GAAGAGCGAAATTGAAGAGAGAAAAAACTTAGTACGTAACACGTATGCCTCTATTACCATTTCCGATGAAGAAAAACTTAGTATACCAAAACATAAATAA
GCTAAAGTTAAAGAAGCTTAGAGTAATTATCTAAACCAACAAATTCACACATATTGAAAAAGCTAGGTTTTAGCTCTTAACGCCTCCTCTTCTTTGTGGA
GTGTATACTACAAACCGGCCTAGACGACTGAGGTATTAACGTTAATCGCCGATTCCTAAACCCTAGTTTTGTTCTTCGTATATCGGAGATGGCGAAGAAG
AAAGAGAGGTCGGTGAATGTATCGGGAAAGCCAAAGCATTCATTGGACTCCAATAGGGATGTCAGCGCAGCCAAAAATGGCCGTAGCGCCGCTACTGTGC
GGCGGCTCAAGATGTACAATACCAGGCCGAAGCGTAATCCTCAGGGTCACATAATTAAGCACGACTTACAATCAAAGGAGCTGCCATCAACAAGGATACA
ACCAGATCGTCGTTGGTTCGGTATGTTCTGAAAAGTTTCACACTTTTCACTTCTACGTTCTTACTAATTACAAAATATAGTCTTTTGCCAGCAGAGATAA
TTTGTAGTACTCCTGTAGTTTGTGTTTCTGAAGATTAATTTGACAACCTGACTTAATTAGGTTGCTGAAATCTATTTAGAATTGGCGTTGGGTTAGTGCG
GAAGTGTTAATATTGAGGTGGAGGGAGTATTAATGATTAAATTGAGCTGAATTTTTTATTTTCATCGTTAAAAATGTCATCTTTGGTTAGTTGATGCTAC
TTTTCGTGTATGACTGAATTTTGTTGAAATAATTGAATTGGGAATTTATTTTCCAACTTCACAGGTAATACTCGGGTGGTCAACCAGAAGGAACTGGAGT
TTTTTAGAGAAGAGCTCCAAACTCGGCTTTCCAGTAACTACAATGTTATATTAAAAGAAAGGAAGTTGCCCATGTCCCTTTTAAATGATCATCAGAAGGT
ATGGGAGATTCTTTTTCCTTAGTTTTATTATTTAACAACTTGTTCTTATGTTCCTGCTGAGTCACCGTGAATCTCTTTACTCTGCTATTGTAATTCTAAT
GTGCACTCATTATTGTATGATTTGGGGGCTTCCTGTGATACGCACATGTACTATTTGTGTGTGTATAGAATAACTTGGCAAATTGAGGCTAAATCTTGTT
GCTTTATGCTTCATACTGGATTTGTTTGCTAATATTTTTCTCTTTTTCTCTTTTTGATTAAAGCAAGTAAAAGTTCATCTGCTTGACAATGAGCCATTTG
CTGATGCTTTTGGACCAAAAACAAAGAGGAAACGCCCCAAACTTATGGCATTAGATTATGAAGCTTTAGTGAAGAAGGTTGATGTGTCTCATGGTATGAA
TTGAGAAGTATCTTCTGACTTTTAAATTCATGTAGAAGTTGATCTTTGTTTACTAATCACTTAAGTAGCTATTTTGCTTCAACAAAGATTTGTTTTGAAT
TTTTGGCAGATGATTTTGAAGACAAACATGGTGCTAGCACCTCCATGGATGAAAATGCTGATGGATTCAGAGATCTTGTTAGGCACACAATGTTTGAGAA
AGGACAAAGTAAACGAATTTGGAGTGAGCTCTACAAAGTCATAGACTCTTCTGATGTCGTTATTCAGGTTTGTTTCGTGGCTTTAAACTCCTGCTATATC
TAATATCTAAAATGAAGTATGTTATTTGATGTTGATGTTCTTCCAACTAAATGCTTTTCTGGTGAAAAATGCAAAAAAATTTCTCTTGTATCCAAGTGTA
AAACAATCACATCTTACTTAACCAAGCATACCAGGCTCAACTTGTCTGTCCTGATTTTTTCCTTGTTGCTTATTTGGTGGGCCCATGAAGTTTCAGTTAG
TGTAGAAGATTGAATGTTGTGTTTACTTAGAGAACCGTGTTATGTTGTAGAGTCTATACTTCGTAGTCTGCTCCTTAATTACAGGAGAGTTCCCCATTAT
TAATAAAATTGTTTACTTTATTCAAAAATCACCTGTCTGCTGTGTATGGACGGTATAATGTTCTGATCTAGTTTTCTCTGTCTAAGGAGGAAAGTATAGG
ATATTTTAGATGAAAGGTATACTGCTGGAAGTTGTAACTTACTGTGGTTAACCTGGATTGCAGGTTCTTGATGCCAGAGACCCCTGTGGTACAAGGTGCT
ACCATTTGGAGAAACATTTGAAAGAAAATTGCAAGCACAAACATATGGTCCTTTTGCTTAATAAGGTTTGCTATTATTATTAACATAGTAGACATTTTTT
CTTTATTATATATATTTCTATTTCCCCTTCGGCCTCTCTCTTTGAGTTGTCTTGGCTTCTTTTTTCAGGATGTCAGTTTTAACTTCAGGATTTGTTAAAA
TTGATAATTTGTTCTGCCTATGTAGTGTGATTTGGTCCCTGCTTGGGCAACAAAGGGATGGCTTAGAGTGCTCTCTAGGGAATATCCAACTTTGGCATTT
CATGCAAGTGTCACCAAGTCCTTTGGAAAGGTATTCTTGTAGTGCCTTCTGATCTTGCCCCACCTCTGAATATAGACATACACTAAGTACCATAGTGATT
TGTAAAATTATGGCTAATTGTGCATCCATGTGCTTGTGCCCCTGCGGGTAACTTTTTGTCTGTTACTTATTTTGTTTTCTTGGGCATTCAGGGTTCTCTT
TTGTCAGTGCTGAGACAGTTTTCTCGTCTAAAGAGCGATAAGCAAGCAATCTCTGTTGGTTTTATAGGCTATCCCAATGTTGGCAAGTCATCAGTTATTA
ATACATTGCGCACAAAGAATGTAAGTTTTCCCATATGTTCTCCTGCCTTTCCAGTCTGTTGTGATCTTCTTTGCTCATTTGTTTCTGTACTGAGACAGTT
TGCAATTTGTCTCCTTGAGAATCGTCTTTTCCGTGATACTTCTTTGTTAGACATGATTGGTGAATTGCACAATTTGTTACTTCAATTTTTGCTCTTATCT
TTATGAGACTCTTTACCTGATACAATTCTTCCTCGTTATCGAAAAATTGTGATTGCCATTCAAGCTGTTCCAAATTTGATTTTAGCTAATCATGTGATGC
TGCTTTTAGGAAGATTAAATGCAGGATAGTGAAGAGTAAACTTGATGTTCCAGACTATATTCACGAGTATCAGATATTTATACAGCTCTAAAACTTAATT
TCCTAACCTTTCACCTTCTCTGTTAATATTAAATAAAGGAAACTTGTTTTCTTGTCGGATAATGACTGTTGTTTTTCTTGTCACCTGTACTTGACGTGTA
AAAAGTCAAATCTTGTGAAATGTAATCTCACTTTGAGTACTATGCTCAGACAACCACATACATTTTGATATGGTCGTGGAACTAACCTTTGCTCCTTTCC
TTTGGAATAGGTTTGCAAGGTGGCTCCTATCCCAGGAGAGACTAAAGTGTGGCAGTACATTACACTCACAAAGAGGATATTCTTGATTGATTGTCCTGGT
GTAGTTTATCAGAATCATGATTCCGAAACAGATATAGTCTTGAAGGGCGTGGTATGTGTCTTCTACTTTGCTTTATCAGGCTTTTGCTTGTGCTTGTGAC
TTGTCAAAGTCAAGCTATATTTCTTGGTTTATTTTGATACCTACCGCTTTATTTAAAGGACTTTGGTATAAAAAGGACTTTTAAGGCATAGGTGGCCTGA
TTTTACCTAGATAATCTTGCTTGCAATATTTGTGGTCCTCTAGAGAAAAATTCCAGAGATGTGTTCTTATGGTGATTTGAGATCAAATATCCTCTTGTGT
TCACTTTTTATAAGTACTTCAATTTTGTTTTCCTAGAAGTTCTTATTGTTGGCATTTTTTTAAAATGAAATTTTGGTCGCCAATGTTAATTTAGGCTAGC
TACTAGGACAGCGCTTCTATGACTGGCATACATAGGATGATCTCATATAGTTATGATGTCGGAAGCATTTAGTCATGAATACATTTGGATAGGGGAAGAT
TGGAAACAAATCAATTGCAATGATGCTGTTGTGTGGATGCTGGTCTTCCCTACTTTGGAACTTCGATGATATTGCTCTGAAAGAGGTCCTACTCGAGCTA
TTAAGGAGGGAGAGGAGTTTTGGGTTCCTGAACTTTAGTCCAAACTCCCTAAGAGTTGTGCTATTGTCCTGTTTCCTGTTGGATATGTAATACACCATGA
ACTGGAACGTACTAGTATCAATAAAGAAAGATTTATAATCTACATAGCCCTCGATTTATGTGTTATTTATCCATTGCTACTTTTTTTATGCCAATGTTGG
TGACTGGAGATAACTCTCTTCAATTAATCCTGGGGACCTTTATAAAAAAATTGAAAGATTTATCTTGTTGTATAGGATATCTTCCCTTTATTACAGATTC
CTTTGCCTCGTCTCAGTTGATGAAATATCTTCTTGTCTATATCACTTTGCTGTAAGCATGAGGTTCTTTGACTGACTACCTCAAAACCTCAAAATTTGGG
GTTCCATTTCCAGGTACGAGTGACAAACCTACCTGATGCTTCTGAACACATTAGCGAAGTGTTGAATCGCGTTAAGAAGGAGCATCTTAAAAGAGCTTAT
AAGATAGAGAATTGGTAAATTTTCTCATCATTTGATTTTATTTGTAGATTTCATCAAGTACTCAGCAAGACATTCTTCTAGTTTGTTTAGCCTGCTTCCT
CGTAGATAGAAATGGGAACACATTGTAGTTGTATCTGCTTCGTCATTTGTTCTATTATATATGTACATTTGGTAAATTATCTCACCAAGTAGAATGAGAA
TCATGTATTCTTTCGGCAGTTTGTGTTGACACCCCCAAAATTCCATATCTAGAATCTCTGTTCTGCTTAAATGATATTTTGATATTCCAGGGTTGACGAG
TATGACTTTCTTCAACAGCTATGCAAGTCTTCAGGCAAACTTCTGAAGGTAAATTGAAAATTTATAACTTGATGATTATATTTTGTTATACTTTTCATTA
GTCTCTCGGGTATGATCTGAAGTGTTTTGTGCTGTTTGTCAGCTCATATAGGACGATCACTTAAACCGGTTCCTTTTATGTTTTTTCATTAGTTCATGTA
GGACAAAGTGAAGCTCACTAGACGAACACTTGGTAGTCAAAGTTAAAGTTATGTAGCAGTATTGTTGGACAAAAATAATTGAGAACTCAGTTGGCCTCTA
ATAAGTGTTAATTGTGAAGTAGCACTTTCAGGTTGAGAAATGATTTCCTAAATGATAGAAAAATTGTAATGTCAATTTTATATATATCTTTATTCTACAG
GGATTTTCGATAAAATTTGCATATTTGGCTACAATTCTGCAATGTGCTTGACATCCTTGTACTACTTTTCTTTTAGTGCTTATGGCTGTCCAGAGAGTAG
TATAGTTGGTATAAAATCTTAATTTGTGCTATTCAGGGAGGTGAACCTGACTACAATACTGCTGCCAAGATGGTTCTCCATGATTGGCAAAGAGGCAACA
TTCCTTTCTTTGTTCCACCTCCAAAGCTTGATGATGAGCCAAATGAACTTGTCGCAGAGGCAGACACAGCCGTTGATAACGATCAGGCCACAGCTGCTCT
CAAAGCTATTGCTGACGTCGTTTCATCACAACAACTGAAGGAAGTTCCTGTTCAGGAGGAACTATTTAGTAAGGCTGAGCTGTTGGGTGAAAACTAATAT
GGGCGGATTATCCTTTAGACTTGCAACATCCACAGTTCTGGAATCGAGTTTTCGTATATCGTTTTTACAATCTTTTAGTTGGGTCCATTGCATTCCCAGA
GTTTTCTAGTCCTAGAAGAGATTGATATACTGGTCGAAAATATAGATACCTCGTATTTTTGTTTTAACGTTTATTTCGAATTGAGTGTTAATGGAAATGA
TTAATATCATCTAGCTCAACTTGTTTAAGATTGAAGCTTCTTTCTGTTCTATACGAGTTACATGAGATTTTGCCAATTTCACTTTTTTTTTTTCTCTATT
GTTATTTGGTAAGCATTCGAAAGTGAATCAAGTAATATAATTTATAAAAAATAGCATTTGAAGTTGAAGAAAAAGATAGATCGAAGTTGAATTTGTGTTT
GGACATATAATGAATTTCACTTAAAAATTTAATTGAATCTCAACACAAAGCTTTGCCAGTCCATGAATATGCTGCACCCAGCAGTTCGAGGAGTTAGCCA
GATACGGGTCGAAGCCCTGCCTCGAAAAAGTCAGGACTTTTGGGCAGATTCCAGTATCCGACCCATCTCTTTCTGCCGATTCCCCGGGTTGTCGGAATCT
CTGGTTCGATCAGGACCAGGAGCCCCATTCATTCGTTTGTGGGAGCGACTCCTCCAGAGTCTCCAAACGGAGAGACGCCATAGACCCTACTTTCGGAAAG
TCCAAACGAATTTCCGAAACTTACGGGGTTCTGGAGGTACGGAGATGCAACTGCGGGATACCAAATGGAAACTACCTAAAAATGTTATAGATAAATTTCA
TACGACGAACTCGATCGAGTTAGAAAATCAAGCCTAAAACATCCCATTTGGGAGATTCAATATTTCCTACCTTTATAAATGAGATGTGCATGTGCATCTA
ATAAATGTCAAGTATACAAGTCAACTAAACCCTAACCACCACAAAGGTTACTTCAAAATAATCATGTTTGTTTTGCAACCTGCAGTGAATTGAATTGGCT
ACATAAAATTTCCGACTTAAAGTTTAATAAAATGGAGAGAGATTTTTTGATAACAGCCTAATCGAGATGATAGATCATCTTATGATCGATTTGATAAAAA
CATAGAGCTTATCACCAACAAATTCCAAACTCAACAAAAGCAACTAAACACGAAGGAACTTAACTCAAAACCTTATGACACGAGGTGACGACTCGATACT
AGTTTAACTCAGTCAATTTTGAATTACTAAATTTATAATCATACTAATTACTATTTTATTTTATTTTTAAAAAGGATTAAAAAAAACTAGAAATTAAATC
TATCTCAATTTGAAACTCCCTTAATTTAATTAAATTGGCACGTAGGGAGTAGAGACTTAATTATTATTTAATATATTTAATTGTGCCTAACATGCAGCTG
TCCCTACGATTTATTATAGGTAACATCCTCAATAAGTTGAATAGTTTGTTTGCTTAATTATTTTGTGAATTTTGTTAGCAAATAGTGACACCCATTATCC
TCATGTGCCATGTTCTAGACATTGATATTTGCCTCCAATCATTTAAAAATTATAATCGATCTCCCAGACTCATGATGACGTAATTATTTTTTACTTAGTT
ACAATAATATTTATTATAATTTTATAAATGGAGTTTGAAAAGATACGTTATATGCAGAACTTATCTCTATCTTTAAAGGTTTAGAAATAGTTTTCGATAG
ATCCTTGACTAAAAAATAAGCATCTTTTAGTTAGTTTTACTTATTCATTTTAATAAATTAAGAAGATTTTATTGAATTTCTTTTCTATGCTGTCTTTTAG
TATTGAATAACTACGTAAAATAATGTTTGATCAAATTTAGAGTTCAAAGCATTAATTTTTATAAAATATATTTTTTATTAAAGCCTTGATAAAAAGTTAT
TAGATTAACATGTGTCAAGTAATATAGGACGAGAAAATATTTACTGATTTTTTCTTGTCCCTACTATTTTTGAATTATTGAGTTATTAGAGGCTTTATGC
ATCAAAAGAAGCACTTGACTTTGTTTTTCATAAAAAGAGGTTTGAGTCTGTCATTTGTGTCTTTTTTATCTTATATATACTTTATGAATGTTTACACGCA
ATTAAAAATAAGGAAAATAAAAAAATATAGCTTGAATTATCGTAAATAATATATAGATATTTTTTATTATATTTTTGAGACATAGCTATTATTGTTATTA
AAAAACTAGAATATATATACCCTTCAAAAGTAAGGAAAATGGACAAATATAGCTCAAACTATCGTAAATGGTATACAGATAGATACCTTCCATCATATTT
TTGAGACATAGCTATCATTATCATTCAAAAACTAGAGCATATATACCCTTTATACTAATAGACATACGTGTATCATAATCTTATTCACCGATTCGACATC
GGATCAAATAATAAGATTGCGCCACGTGTTCCTATTTAATCTTCCGTTAGAGTGAAGGGCATATACACTCTAGTTTTTGGACGGTAAGACATCAATATTT
CGAAAGTATGACGAAGGATATCTGCACACCATTTACGATAGTTTGGGAATATATTTAACCTTTTTTTCTTGAAAGTAACTGTGTTTCACGCACAAAATAA
TAATACGATATAATATTTAGAAATTCATAATTTAAAATGTATGAGTTATAATAATTATGTTTATGTAAATATTTTTTTTATCGTTCTTTAGCTTATGTCT
TATGCTATTTGTTGTCATAGAAGCTTTGACAGTGAGTAGCACTTACTCCATCCACCTATTTTTACATATTCGATATATTAAAACTAGTCATTTAATTTTA
CTTTTTTATTAAAAAAATTAAAAAATAAATTTAATATTTTTTCGTGTATATTATCTTGCTATTAAATATTACAGGAAATCATTTTTTCATAATTAAATGA
CTTATAATTAATATAGATAATATAATTTTAAAATGTATTAAATCGATTTAAGATTGGAGTAACGTTCATACTTCATCGTGGATGGACTTTATTATATATA
TATATTTTTTTTATCTAAGTCAATCTAATATAAACATACCAATATATATATTTGACATTTCTATATAAATTTTTTTTTGAAAAAATTATAAATACCAGGG
TTAAAATCGACCCGTCTTAGGTATTAATTTGTCAAAAAAATTTATTATAAAAATATATAAAAAATATAAAATAATATTAGCGTATAATATGCAATTTAAT
TTATTTCCTGATTCAATCAATTAAATACATTATTCATTTAAGCACGATAATTAAAAGTATGAAAATCTTTTTATTTTCTCTTCTTGTATAAATATATATT
GGTGATCTGTATCATGATTAATTAATCAATAATAATAATCATTAACTCCCCTTATCACCAAGTTGGAGTAACTAATTATCAAATGGACCTTATCATTAAA
TTTGTAGCTAATTAGCTTAGCTAAGATCCACAGATCAACAACTTCCTTGATACACTCATCATGTTTTTTTTATATTATTTTTTCGACGTAAAATTAGAAT
TTTCATTAGGAGAGTCGTCTGAAATATGAAAAAGTTAATATAATTGAAAAAGTTGAAACTCATTATCTATTAATACTATATATACATAATAAATAAATTT
AACTTTATATATACAATATAATTTTTTATCGTATTTTGATTTTAATCGTGATAATTTTCGGACACAATATTATTATAGTAATAAAATATTATTAGAAGGT
AGTATGCTAGATATTTAGTTGTTATTGTTTTGTGTATCCACGTTCTTGCATACATCATCTACCCAGTGAATCCCATTTCTTATTTTTCTTACACAATAAA
AAAAACTATTTACATAATCAAACTACTTAAATAATTATTAAAGTAATTCTTTCTAATTTTTACGTTAATTAATATCTTAGAATAAATATTAGTACTTAGC
ATACTATGACATGATTAAATTGTTTAATAACGTCGAAATCATCATATTTTGTTTGTATTTAATTAACTTAAGCAATTACTTATGAGGTAAAAGTTAACCA
GGAAAATTATATATTTTACCAACCATCTAATAACGTGAGATATATTATTGGTCCATTAATTAAATTTTAAATACTAAATATGTTAGAACTAATGAAAAGA
TATGTACTCAGTAAATTATTGTTGACTTGATAAGTAAAAGACTATCTAAAATCTATTCCTTTTGTCTCAATTTATATGACATATTTTATGTTTTGAGAGT
CAAATAGTATAAGATTGATCGGAAATTCGCGCATGAAATTGTTAATTTTTTAAAATAATATTTATATATTTGTAAACTACGTAACAAGACTATGAGTCAC
AATAGTTGATAACTCAAAATGTTTATAAGAATTATGAAAACTTTACGATAAAAAATAAATGTATTTGACTCTTAAAATCCAAAAAATGACATATAAAATG
AGACGGAATTAATACCATTGACAGATTTTTTCATTAGTTTTTTTTTTTTACTCGTAAGCTCAAACGTCATGCTCCTCACATTCAACAATTAGTAACTAGC
TAGGTTGATCAATTTATTTTGTTTGTGTTCACTAAAGGTGAAATGTTTTTTCTTAGAAGTGACATTATTCTCTTATAATTTAAACTCGAAATATATAAAT
AAAAAAAAAATATTTAACGCGTCATTATAATTGAATTGATTAAACACGTGATTGAAATTCAAAATTTAGTTACGTAGATCATCAAGAGTAGACTTTCGTT
ACTGAAAAAGAGTTAATTAAGTTTTTTATTTTATTTGATTAGATGATCACATTCAATTTTTAATATCATAATAAAATAAAAATTAAATAATCATGTACAA
AATTTATATATTCTAAAAAAACACGAGGTGCTAAAATAGTACATCAAAATTTTGTGAAACCAAAAATTCAATAAGTTCGAGAAGGAAGCATGGAAAAAAA
TGTTTGTTCAAAATAGTTAATGAGACAAAAATATTTATTTCAAAGTGCTTGATTATCGCCTTAATTTACTTTGAGGAATTGACGTAACAATTGAGCCATT
TTTTTAAATAAAAAATAAATTATTTAAGGTTAGTACAGTATGATAACTTTTTTACACATAAGAAATATTCACAAGAAAGTATATCTTTTTCCCGTAATCA
ATCAGCTACGTATTAAAAAATAATATTTCAATCAAAATAAAATAATTAAACTTTCAAAATCTTAATTACATTAGTCGATTTTTTTATTATACACAAAATG
ACATCAAAGGTGTGATTAATATGGAGAAAAAAAATACATATATTCGAGTTACTAATCAAAAATCATTAAAATTTTTTTTTTCTAAAAATACAACTTAAAT
AAGATAATTTCGTAAAAAATATTATTTTTATATATTTGTTAGTAAATTGTAGTATATTTCACACCCCTATTCATAGAGTTTTTGGATATAGGGTGCGCTA
GGGATTCATCGAAGACTTTAAATAATAATACTACTAGTATACTCTTCTCAATTTATATATATATATATATATATATATATGATATCGTATTAAAATTTAA
TTAAATTTAAATTTGTGTGAAAAATCTTACAAAGAGAACAAATCACTCAGGTGATTTCATGTATGTGGAAAATAATATTTGAAATATATGAAGAAATATT
TATCAGTTTGCTACGATACTAATTGACGTGGTATATATATATATTTTTTTACCTGAACTGGTGGAGGTCTATCTGTCAGTATTCAGTACGAAGTAGCAAA
GAAATTAGAGTAGAGAAACTACAAGGAAGCTAATTAATCCTGCTTGCACCAGCTCATTTTCAGACATCAATGCCCAAAGAAGCTCCCACACTGTTTTTTT
TCTTCAATTTTTTGCACTATTATTTAGTTAACCAAACCATGTTTTGTCTTTTTATTTGGTTCTTTTCTGTAGTAAGTAGTGTTTCTTTCGTTAATTAACA
TTTTTCCTAAAAGACACACACTTTACTCAGACAAAATCAGCTATTTTAAGCTCAAAAACCCCATAAAGATTGGACCTTTTTGCTATTAGTGAGAAAAGAG
TAGTTGTTTTTAGTTTCAAGAATCATTTTGTTACCTCAAATTATTATTTGGGTCTTAGGTCTAGATATCAAATCAAATCTGTAGTAGTTGCACTGGCAAA
TCAAGAATTGTGGGTCTAATAAGCTTTTTTTTTTTGTTTGTTTGCTGGTTTGAGTTTAAATCAGAGTCAATACATCTTTTTGAAAGTTTGAGTCTTTGTT
GGAATAGCTAAAAAGAAACATACCCAAGTGGCGGATTTCACTATTTTAGAATGTGAAAGATTATACAAAAGACTCACAGTAGAGGGACAATGATATTTGA
TTTATTGTACTATGGGAAATGCAAGAAAGGTTGGGTTTTTATGTTGCTAGTAGAACTTATCAGTCAAGTGAACTGATAGAAAGTTTTGATTTTTGTCTGT
AATTAGTAGAGTTTGATTTGATTTGAAGTTCTGGTAGATTAGTTGGAAAGACATTTGGCTAAAATGTCTGGAGAAGATACACAAGAACTTCGTTCCTTGG
CCTTGACACCAACATGGTCTGTTGCTTCTGTATTGACTATATTTGTTGCTGTTTCACTGCTTGTGGAACGATCCATTCACAGGTTATCTAATGTAAGCAA
GGTTTTCTTTTGCACTGTTTGGCTTGTGTAGTTTTGTTGGTTTTATTGGAAGAATTGACTCGAGCATGTATCGGAAATAGCCTCTCTACCTTTGAGGCAG
GGGTAAGGTTTGCGTACGCTTTGCCCTCCCTGGACACCACTTGGTGGGATTACATCGTTATGTTGTTGTTGGTTTTATTGGGAGAGTGTTATAGGAGTCC
GGTACCAAGGAGTTCATTGTCTACTGTACATACAAAAGAATCAATGTTGGAATATATAGTGTAATTTTCCGGGCAAAGGAGTTCATGACTAACTTTTGTT
CATGTTTCAATCTGTGTTATTCTGGACTTTTGTAGATATTCATGTTGTATGTTCTCAGAAATATAGGGTTTTGATCCCCTTGTGGCACCCTGGGAATTCT
CTCTGACATTATAGGAACTATGAAGGATATAAATATTCATCATTTCTTTTTCATATACAAACTTCCTGTTTATTACTCAAGCAGCTTAAGAATTGGATAT
GGTTTGAGTTACTTGTCCTAGATTTTACAGTTTTGGATAGTTGCTTATATTAACAAGCTCCCTCGGATAGAAGCGAGCATCCAACCTCTTCGAGTCTTCG
TGTCTCGAGGCCTCTGATTTCGTATGAGATTGTATTCGATTGATTATGTCTCTTGTAGAACCATCAATTATGGAACTTCGAAAACTACCAGTTTTCATCA
TTTTATCATGTCAGTGGTTGAGGAAAACCAATAGGAAGCCATTGTTAGCTGCTGTGGAGAAAATGAAAGAAGGTATTATATGTCTATGGACATTTGAACT
TGGGACATACATACGAAAAGAAAAAAACTATTTGAAATTTGGATACCCCTCCTTTCAACCCCAAATATTACTTTTCCTGTCATAACCGTTTTCGACATTT
GGTGTACAGAGTTGATGCTTCTTGGATTCATTTCTCTCCTTCTCACAGCAACTTCCAGCATCATATCTAATATTTGCATACCTTCAAAGTTTTACAATAA
TGCATTTGCTCCATGTACAAAGTCTGAAGTTGATGAAGAAATGGAGAATAAAGATTTGAAGGAGCGTAAACTTTTGATGGCTTTTGGTCTTCATAGGAGA
GTATTAAATTCCTTCAAACAAAATACGTGTGGAGAGGTAAATTCGATTTAATATGTGACATATGAATCCATTATTCCAATAACTTGTATCAATTCTACTC
TTGTTGCTACAAGATGTACCTGCAATTGATTATCCTGCAAAAATGAAATAACTACTTTTTTTAGTTTATTTCCTCTGAGATTCTTAGGTTCTCTCTCTTT
CTAAAGTTGTTTCTGAATTAGTGTCAATAATCTGAATCAAACATTTTGTCAGAACCATGAACCTTTTGTATCATATGAAGGCCTTGAGCAGCTGCATCGC
TTCATTTTCGTCATGGCCATTACTCATATATCTTATAGTTGCTTGACAATGCTGCTGGCGATTGTTAAGGTAAAGTTCTCTTTTACTTGAACTTGATAAA
CTGATGCACATTGTTTTGGTGAACTTTACAAGTCCACTTATTTTCGAGTATATGTTAATCTATTGTCCATGGAGTGGCAAGTTTGATTGGATGGAAGTAA
ACTGTGATGTATTAATCTGACTTGCAAAGTTTACTGTCATATGTGGTGGTAATGCTATACATCCTCATTCAATGGCCCTATTACTTGTTACCTTGTGGAC
AACAGATTTGGAGTGAATTTGCTTTCTGTGTGAGCTTCGTGATATGCTTAATTTATAGACTGCTGGAGAGGCATAGTGTGTGATAACCGGAGGCATCTGA
TTTGTTGCTCATGTTCTGATAAAAGTATTTTGATGCCTATAGTGTTGCGGGAATTAATCTCTCTGTCAACAAGATTTTTTGCTTTTACTTCAGCATTTAA
GCATATCCTCTCTAGTAGGGGCATTTGCCACTTCCTTGCAGAAGTTGCCATGCCTGTCCTACGAAATGACCACGTCTGGTCTTTATCCTCATTATCACCA
CTTCTCTCTTCTTCTTTACTTCTGTAAACTCTATTCACATGTTCTGCATTGCTAGCTGCCTGATAAGTGAAAATCTGGACAGGTCCACAGTTGGAGGGTG
TGGGAAGATCAAGCTCAGAATGACAGGCATGATGTACTAACTGGTAAGTTATACTTGCATGTGATTTATCAAAAAGTAATCTTGTTCTCTAGCTTCTACT
GTTTGTTGTTCTCTTGTAATCATTGTGGATAAAGTCTGCTGGTTTTAATTTCTTATTTTAACAAGAGATGTAACTTTAAATTTGTTCAGAACAAGAAAAC
ATAAGGTCTTAATATTATTTATCTAAAAGAAAATTATAAGGGCCTTTATAATTAAATGGAAAGTCGGTTGTGTGATTGTGTCAAGAAGCGTGCATGTATT
ATGATGGAGATGGAGCAAATTATCAGTTGTATGACTCTTTGTACATGAAGTATAAGTGGACTCTAATTACCGAAATCTCCAGAGACTTGAGAATGTACAT
GCATCGGATGATTCCTGAAGTTGAGAGTTCGGAGACAAGCTGATGGATTTTCTTCAACTTGTGTCAAGGGGATTCAATATTTCATATTCAACCAGAAAAT
CTCATTTTTACGCTTTTTGAATTGAACGACTTACTGATGAACGGGGATTCAATTGTACCCCCTTGGCTCTTCATAGTTCTTCCCTTGTGCACCACGAAGA
TTAATTCATTCTTTTCTCGTCATGTGTGGAGATGACAATGTTTGTGCTAATCTTTACATCAGTATCATGTTACTTTGTTTTCCAATATTATTATTATCCC
ATTGTGGTTTTTCCTGGAGCAAACATGTATTTGCCACTTATTTCTATTTCTAGACATCTATTGCTTCGTATTTATTGATTAATGCATTTAGAAATTCTCT
ACCTTGGTGTCTATCAGGTAGCTATCTTCAGCTGTTATGTTTGCTTTTCTCCTTTATTTTGGGTGGGGGGGAGATGCATGAACCGGGGTAATATATATTT
CATTCCTGCTTGGTATTCGTTGAAGAGATCAGCCATTTGTCCTCTAGAAATGTCTCAAAACCTCAATCAGTGCCCCTTTGAAATGCGAAATGTGGAGAAA
TCCATCACGTTGTTTACTTTGATAGAACTTTGAAAAAACCTACAAGAAACTGAACTCGTTTCTATGGCAGAAATTTCTAGAGCCAAGACATTCCGAAGGC
AGTCAACTTTTGTCAGAGTTCACACATCAAGTCCACTTGCCAGAAACCATTTCCTTGTTTGGGTGGTTAGTTCTTATATTGTTCTTACTAGATACTGATT
TCCCTAGCCCTCACATAATTTATTCATCCAAAGTAAATAAAGTATTTGCTTTTTAATAGTTATGCTCTTAGATGAGATGGTTCCCATAATTACTCGTATC
GACTTGCACTTTATTTTCCCTTTCACAATTGGTTTGAGTATAATGTGTGTGTATTTCTATCATCAAATTTTGCAGACCTGTTTCTTCCGGCAGTTTGGCC
GCACAGTTGTTCGTGCTGATTACCTTACTCTGCGCAAGGGTTTTATCATGGTATGGATCCAATCATGGACCACTTCCCTTCAATTCGCTTCTTGCATTTT
GAAAGAACTAATCTCTTGCAAAACATTAAGGAAAATATTTGAATGCTTTTGAAGGCAGTACTGTGGAGTATCTTAGAAGTTAAAAAGTAGTTAGGATGTG
AAATTTGTTAGTTTAGTTTTAAGGAAATTACTACGTCACAAAAAGACATCATCTGATTAGAAGCAGCTCATATCACAGTTTGACAAACAACAATCTTGAA
ATATACAATCATGATAAAAGTACAACTGATGCACATTATGAAGAATGGAACACTGTCTTTCAAAACTAGACATGAAACTAAGCCTGTGTTAGTTTATCGA
AAAGATTAGGACGCTATGTTGCAAGCCCGGTTCATTTTGAACTCTAGTTTAGGGATCATTTTAAGTTATATTCATGTTTGCATCACTGATTTTCTTTTCC
ATCACAAGAGTGTCTATATATGATACAGATTTCTGTTATAGATTACTAGTTACGACCTTTCTCCTCTTATTCGTGGCAGAATCACAACCTTACATCAAAC
TATGATTTTCACAGCTATATGATTCGCTCGATGGAAGAAGAATTCCAAAGAATAGTTGGTGTAAGGTAAGAATAAAAGTACTCCTTCCCCATTTTCATCC
TCTTCTTTGAGTAGGCAGAGAGTTAAAAGTTGTTTAAAGAGAATTAGGCCAAATGTGGAGAGAAATTCATTTGATTTAGTTCTAAGATTTGATGAAGAAG
TGAATCTCATCTAATTGTTGTGTTAGCATTAAGCCCAAGTAATGTTTTCTCCAGTTCATTTGGTCCTTAATCTTTGCAAAAATTTTGAGGGAGTACATTG
AATCGGTTAGTAAGCTCCTGATGGAATGAGTAATGAATTTAGGAATTTTTGTTTCTAGTTGTTTCTCCATTTACGGTGGTTCATGTATCATCTTTTGTTC
AGTGCACCCTGTCCATATAAATGATCATTGGATAGCACAATAGTCGTGGAGAACACTAGAGTAGATCAATTTTACTTTGAAGTCTGTTACTACAACAGTT
CTTACTTGCTTTCCATCATTTGTTTCTTGATTGAACCTTCCTCTCATAACTTTTGTGTTGTATCTTTGCAGTGGCCCTTTGTGGGGATTTGTGGTGGGAT
TTATGCTGTTTAACGTAAAAGGTAATTCAGCCTTCATTGTTTGAGATGAGCAACATAAGCCACTTTTGTTTTTTATCATTAGATAAGTTTGCATATTTCC
GCTCCCCGACATTTGTGTTCTGGTGAAAATAAACTCCATCCACAAGCTTATGCATGACCAATTGAACTTTAACATGCAGGATCGAATCTGTATTTCTGGA
TAGCGTTAATCCCTATCATTGTAAGTGCTTCCATTGCAATTATGTTTTGAAACTCTTCATAAATGCATGAACATATACTCTTACGTATATAAAGCGATGC
CTATTTCCCTTTCTCTTTATTCCTTACCGTGTTGTGTTAGACTTGACTGTGACCCTGCATGAGTCATCTTTCTTAATATTTACCTCTTCCCTTGCATTCT
GAATAATCTTATATATTATATGAACTTATGGATGTGATAGAAGATATAATTAGTCGTTTACTTGTGCTTCCGTGCAGCTAGTACTACTCGTGGGTACAAA
ACTGCAGCATGTGATCGCAACCTTGGCATTGGAGAGTGCTGGAATTACTGGCTCATTCTCAAGGGTCAAGCTAAAACCACGAGACGAACTTTTTTGGTTC
AAAAAACCAGAATTACTTTTGTCCTTGATTCATTTTGTCCTTTTCCAGGTTTGTTTGTACAATCATACTTCATTTTTCATTTGTTTCGTCTATCTATTAA
CTTTCTTTAATGTCTATATACACTAACTTGTTTTTGCATAACTCTTGCAGAATGCATTTGAGCTAGCTTCATTTTTTTGGTTCTGGGTATTCACTGCTCC
CTTTCTCGTAGCTTAAAAATTTTTTTCCTACCAAACATTTAATACCTAGTCAAAGCATATCCTTTTAACTGCATTAAACATTTGCAATCTCTAGTATTCG
ACATTGGCACATTCCCTGAAATATCTGAGTTTTTGATGACGTTACGTCTTTATTCCAGTGGCAATTTGGGTATAACTCATGCTTCATAAAGAACCACACA
CTTGTGTATCTACGACTCATTATGGGGTATGTGTAATTACAAACTGTATTTGTATGTATTGCTTAAGGTTTCAGATTTACCAACACATATTTATTAAGCA
CAACGGTCTAAACCTATGCTGTTGTTCGTCACCCAGGTTTGCTGGACAATTCCTTTGCAGTTATAGCACCTTGCCACTCTATGCCCTGGTTACACAGGTA
TTATGTCACGACGGATATAGCTAAATTGAGAAGTCAGAATAGTATGATCCTCTTGTTAACGTTCGACTTTGTACACCATTACCTCTCTGGCCTTCTACAA
TATTCTCATAACCACCTTAAGGTTATGGATGACATGTCTCAAATTTTCTAGTTCCGTCTCCCTTTCTTTTTCCGCTTCTTGCTCATGACAAGGAAATACT
AATAGATGGGAGACAGTAGAGACTGGAGTAGGTGAGGTAAATGAGCACGATGGCGTACGGGAAAGGGAAGACGCTCTACTCTTAAATGTGGTTTACTTTA
AAACGTCAACGATATGTCCAGAGACTATAATATCTTCTTGATCATCGTTGAAATGTTAAACTTTACGAACTACTTCAACTGTGCTAGTAACTCTGCATGT
TGCACTTCCACAGTAAACTCGTGAATCGGACTATTAGATGAGATTGTAGATATTTCCAAGAACAAAGCTTTGAACATATTATACTTGCCTCTTTGCAGAT
GGGTACAAACTATAAGGCTGCACTGATTCCACAGAGAATAAGAGAAACGATCCACGGATGGGGAAAGGCAGCAAGAAGAAAAAGGAGGATGCGTATGTTC
CCAGACGATTCAACTGTCCACACTGATACAAGCACCGTAATGTCACTCGAGGAATATGATAATGACCAGTTGGTTGATAGCCCTCGAACAGTGCATGGTG
CAGGTACAGAAATTGAGTTGCAGCCACCACCAACTGTCACGGAGGATCATCATCATTCAGTAACAATTAACGACACTTCAAGTCGTATTGGTACTCCTCT
CCTTCGTCCCTGTGCTTCTATTTCTTCCGCAACTTCTCCAACTCTTCCACCTGAAGTAATATCAAGATCATCTTCAATGCCTGCTAGAGGACATTTGAAT
TTGGATAAACAATAACCATTATAGTGAAATAACAGAACAACACGAAGTGAAGTTGGTGTTGATACTTCTGCAGGTTTGTTTTAACGTTGCATATAACATA
TATACTTGAAGATGTTTGACATGTAAAATTCAAAGAAATATGCAGGTAGGAAAGAAATAGTTTCTGTAGTTACGTTGCAAAAATATTTGTCCAAAAAACG
CTATGGATTGAAAAATCTATAATAACTGTTTCTCTATGTGTAATCAGTTACACACATGAGCTATCTAGGTAAGATAGAGCATCTTAAAGAAAGCTTGTAT
GTTTTCCTCGTCAAATAGTTAAAGAGTTTAACTAGTATACATCGACAGTTTGATGGATTATACACCATCAATGTACTTTAATATGTCGCAATAGATAACT
TGTCTTGCTTTTCAGATTAGTAATTACAGAAATGAGCATGTCTAGTTCAGCAATGTCTTTTCATTTACGAATATCACAAGTACTTAATACATCAAAATAG
TTTCCAGAGTACTGTCAAACGATAAGAAAAAGACCTCTAATGGAAACGTATAAGCATTATCACAAATCCCATAATATTCAACTTTTCTCACTGGCATCTA
TACTTGATCCTGCATCAGCCAGTGCTTCAGCCATCATTTTTGCTCTATTCTGAGTTTGTCTTTCCACAGCAACCATATAGAAACCTAACAAGCAAGATAC
AGATTTTGAACAGCATCAAGTATTCAAACAGAAAAGCTAAAAATAATTAAAGCACTCAGCAGAGATTTGTCCCAGTAACACATAAACCTTTCAAAAATCT
TGGTGTATCATTAAACTATACATAAATTTTCATTTGTCAAAGAGAGTCATTGTGCATACTGAGAATGGAAGTAGATCATCTCAGAAATCCATACCATAGC
ACCCCTCAAAGCATTCTGGAACTAAAAGAACCTAAAAGTTGGCAGGTGAATCAAATTCTACAGTATCAAAGTAATAATATGATCAAACTTTGGTGACCTC
TATAAAAGGTGAAGAGTTGATCCATTCGCCTAGCGGGTTATTGGTTCAGTGGTTATCCTACTTTTCAGTTAATCAATTGTAGTTCACACAAAGATAGTTG
AGAATCAGTTATTCCAAATGTAAGAAAAATTTAAAACAAAGCTATAACATTGAACGAGTTCTCACTTAACCTGGAAGATCTCTATGTTTTAACTGGTAGA
GATGTAGAGTTTCTCTACCTAGTAACTTTTTTGAAGCTCATTGGGTTTTTCCTATAAGCTCTTTCCCTATAGAGCAAACACCTTCAGAATTTAACAAACA
CTTAGTTGATAAACACCACAACATGCAATATCTTTTGGATGAATACGGTAAGCATTTGGCAGTCACTGGGTACTTCTAGCTTTGTGGTGGAGATTTCATA
TGCATAGTACCTAATTCGTTAATAGTTGACTTTCAGCCAGTCCAGTACATGCTAAAAATAACCATTGCTCGTTAGAGAGAAAAATCTCAAGAGAAAGTCA
GAGAAGATCGATGGTATACCAATTGCACTTCCAATTGCACAGACCCATAAAAGCCTCCCTGACCATTTGTCAGCAACGATTCCTCTATTCCCAAATCCCA
TCAGCTAAGACTGGAGCAAAAAGAGCATGTATTAGAATGTGAATTTCTCACCATGAACTGATAAGTAAAGCTAACTTTAGCAAGGAAAACACATATTAGA
ATGTGAATTTCTCACCATGAACTGATAAGTAAAGTTCACTTTAGCAAGGAAAACACATATTAGAATGTGAATTTTTCACCAGCTCTAATTTATTTCATAC
TGTTCAATGTACCTGATGTACAACGAGACCTATCATTTTCGTATTTTCAAGTCTAGGAAATCCCTGGGATACATGTTTTCAATATTTTCTTGCTGTCTAA
ATTTGTTTTCTTTCCTCACTTTCTGCTCTAAAAGAGCAAACTGAAAAAAACTAATTACATTTTACCATATGGTCACACCATTTTGCAGAAAATAGCTTTG
TAAAAGTACAGAATGCTCAACAAGGAAGAATCAGACGAGAGCAACCAACATAATTAAATGAAATCCAAACACTCATGTGTGAGAGAATGACACTGTCAAA
TTGTTCTTCAAGGGACCAACAGATCAGCAAAATCAATGAATGCTATTGAAAATGATTTCATCTACAGAACCTATTAATCAAAATTCAGGCATTCTGACAT
TCAGGCACTCAAGTTCTAGTTAAAGATGTCCATGAAATTCCATCACTAATACTTTGCCTGCTAAATTGAGGTAGTAAAGCAAACTAAATAATCCACCAAT
TCGATGATCACTGTGTTCACAACATCGTAACAACAACATACCCGGTGAAATTCCACGAGTAAAATCTGATATATCACTTAAGAACTAGTTTCCCACAGTA
AAAGCTAAACATCTCAAGCTATTTCTGTTTCAATTCCTTCTCTAATTCTTCATGCCAGTTCTTACACTTTTTCATTTAGATCATAAAATCAGATCATTTT
GCCAAAACATTAGGAATATAGTAACCACTTCATCTGTTTCACCTGAAGTGAAAATATAACTATAATTTTCATCGATAAGAGGCGGTGCTGTATTACACAA
GGAACTACTACAAAAGAAATCAGAAATAAACTATTATACTTCAGAAAGAATTGATGCGTTAATGCATATTTTTAAGTTTCTGCGAGATTATTGATAAGAA
AAGGAACAGGAGAAGGAAGAACAGAGAATCACCAGTAGAAATAAGCTGCCGCCGGTTGCCTGATATTCTACGCTTGGTTTTCGCCGGGATCGAGAGAGAC
AGAGATAGAGAAACCGGGTGGTAAGTGGCAAACGGGTAAGGGCTAAGAATTTGGGCTTGGGCTTGGCTTGGGCTTATGGGTAAATTCATTGGGCTCAAAA
AAAGTTTTTTGAAAAAAAAACAAAAATTAATAGCGAGATAAACTCATTAATTTATGTTGGGCAACTTTCACATATAGCAAACAAAAAATTCATATTTGTA
TGCTATAGCAAACTTTGCATAATTGCGCTCCATAGCAAACATAAAAACTGTATAATTCGCTATACATATACAAGTGTATAATTCGCTGGCCTAAATTGTA
TAATTCGCTGGCCTATTTCGCTGCAATTGTATAATTAGCTTTGCATACAGTTGAATCGAATTAAAATGTATGTATATTGCATAATTATAAGTGTATAGCA
AGAAGATATATGTTTTTCTCGCTTTATACAAAAACAGAAACACAATATATACACTTCTGTTGTATAAAGCTAGAAAAAATTGTATTTCACTGCAATTGTA
TAATTCACAATTGTATAATTCTTTGGACTTTTCTCTGCAATATTTGAAGTAAAATGTTTGTAAATTATATAATTAAGTGTTTAACACGAAGATATACATT
TTTACATGTGTATATACAATTTTTTCTCGCTTTATACAAAACAGAAACAGAAATTATACACTTCTGTGTATAAAGCGAAAGAGGCGAGAATGGGAGAGTG
ACGAGCGAGACTTCTGGGAGAGAGAGGCCTGGCAAATTTTTGCCAACGTTTGCTATGGAGCACAATTAAATCAAACCCTAGCTATTCCATTTAATTTAGG
TTATTAGTTTGCTATTATATACAATTTTCCCATTTATCCTGGTGATATAAATAGGGAAAATTTCATATATAGCAAACATAATTTATTAAATAACATTATA
TGGGTGTAGTTTACATAATTATATTTTATGGGTATAGTTTAGTTTGTTATGTATCTTTTAATTTGTATAAAGCATTTTTTTAAAAAAATATTTTAAAAGG
AGGGATTATTTTCAAAACATAACAATGCTTGATATCAAAGTGTAGCAAAATACATGTTTTTTTGTGGCATAAAATATTTCTTTCTAACTGAAAATCGCGT
AGATTTATTATCTGGTCATAACTACACGTACATATATGTATGTGTGTGTGACCAATTACTATATGTGTGGGCAATGAAGGCTAGAGTTTTTAAATATATA
AATAAGTCTAGAAGTATTGTAAGTAGCATATGTGTGAAGTTCTATAATCTTGTCGTGTTCATGTGATGTTTTCAAAATAACACTATAAAGAGTTAGGTTA
ACATGATTATTATTACTTGTCGTTCAGCAAAATACTTTTCAAATTTACAATTTTAGTTTTGATTAAACCAATTCAATATATATATTAAAACATTATCAAT
TTTAAAAGAAAAAACATCAATATAAATAATCATCGAATCGCCTATTTATTGGCAAAAAAGAAACCGTCAAATCAAAAAGCCCACTTTGTCCTCTTGGACA
CTTTCGAGGGTCAAGCAAATGTGGGGACAATGATAATGTCTATGAACAGGAGAAAAACGCGTAAAAATGTGTTTTTTTAGATTCTTTAAAGTATATATTG
AATTATTTTAAATAATAATTAAATTTATCGACTAAAAATCAATAAGGAACACCAATAATTATCTATTGAATTGAAATTTTCATATTCTAAGTAAAAAAAT
TTGACTTTCAAATTTTAATAACTATAATATTCTTGATAAAGTAGAAGTGAGCTCAGGAAGAAATGTAAGAATGAAAAAGTATGAATATTATCAATAATAA
TGCATTTAATTAAAGTACGCAAAATAATAATAATTAAAAAAAAAACTTATTTTGCGATATACCAAAAATGGAGACAAAAAATAAGCATCAGCTTGCTTAG
AGGATATATCATACAATTTTATAATAAAATAGTTCAATATTTTAATTAATCACAATATTGATACTTTAAAACATATACGTGAACACAATCAAGCTTTTAA
AAAATCAAACAAATAGCTTTTAAAATAAATAAATTACTCTTTTCGTTTCATTTTTCTATAAATAGTTAATCCATATTACTTGTCATTTCATAAAGTCAAT
GCATATATTGTTTCTTTTTTATTTTTGTAAGTTATTAGTCTTGAAAATAAATATTTGACCACTTTAGAAAAGATAACTAAATGATTCATGTTCATTGGTT
AAATTAATTAATCAAAATAAATTGATTCATACTCACTTATTGAAAACTTGAGATCCAAAAAAAATTAAATAAGAATAAAAGAATAAAGTTACATTATTTC
TTGATACGAGTATAAAGTATAAAGATGTTATATAAAATAAAACAGAGAATAGAATATCAAAAATAGTACAATAATATGCCTTTAGAAATATTTATTTAGC
AGTTCTTTTGACCATTTTTTAAAAGTAAACTTTTCTTTTTAAAAGAAATTCTTATTTGATATCCAAAATCCACTAGCGAATTCTCTTTATTTGTACAACC
TTGGAAATGGACTATTACCATTCTATTACTCCTTCACAAAATTGAGTTAAATAAATAAATACCAATTTTAGAATTATAATTTAAGTTATACATATAATAT
ATATTTTTATTTTATTATTATATATTATTATAAGTGGAAAGCTCCAAAAGTAAAAAATTGAATTATCAGTTTTGCCTCTCTACTAAATTAAAATTTTTAT
AATTTTCATACATGTATTTAATCTTCTTATTCTCATTTCAAAATCTTGACCTTTTAAATTTCTCGTACAAATTTTAAAAAAATATAAATGACTAACTATT
TCTTAAAGAAAATAAATTAAAGTAGATTCATGTATCTTTAAAGTTAAATTTCATCTCTATTTTTTTTTATATTTATTTTAATAGTATTTGACCTTTCAAT
TTTCCATATGTCTTTTCATGTTTCCGTAATTTTATTCTATAAATTTAACTTTGTCAAGAACAATTTTATTTATTATTCGTGCAAATCTTATGTGTAGAAA
CTCTAAAATTTATTTCACTCATTAAATTTTCTTTCTTTCATCTTCTAATAGTAATAGAAACTTCATCCTACATTCTTCATTTATATTTTAATATATAAAA
TTTCTTTGTTATTATTGGTTGTACATAATTTAATTTTCTTAATAATATTTATTCTGATCAATCTTTTCACATTCATTAAATACTATATAAAATGTATCAT
AAGGTGGGTTTGTCCGATTCTTTCATTTGTCTTTTTTTATTAGATTTTTCCTCCATAAAAAGTCACTTCAGATAAATCTATTCTAATATAATTGATTTAG
CTATAAATATTAATCAACATTTTTTATATTATTGCTAAGCTAGCAGCATATTAACTTCTTTTAATATAATATCTATTTATGAAAAACTTCTATTGCAATA
AAACTTAAATTTAGATATAAGTTAATTTATGCATGCCTTTGCATATTTAAACTATAAAATATGGACATAATCTATATTTGGAACACAGTTAACTATGTGG
TTCGAGAAATAGTAAGCTCATAAGTTTAAAATAACTTCACATAAATAGTTTCTAAATTTCATATGAATAAACTTTTATATCTTATCTTAATAAATATGTA
CAAAGTTATTTTAAAGTGAATGAACATACCTTCTTTAAAATTAAATAATAATATCCAAATAATACCTTCCAAATACTTTAGTCAAATTCAGACTCGATAA
AACTAAACAAGTGTTTAATGGATGTGATGGAATAATAACACTATTTATCTATATTTAATTAAAGGCTATCATATTCGAAATTAAAATTAAAATTCCATAG
AGCAAACATACCAAACACACTTTGAGAATCCTGTCCATTTGCTTTAGGCACTTTTAGCATGACTCGATCGATTCATCATCAAATAATTACAAAATCCACT
TTTAATTTGTCTCTCTCCTCACTCTTTCTTCTTTTCTCCTTCCTTCATAGTTCCTTCCTTCCTTCTCCGAAAAGCTAGCGGTTGAGTCTGAAGAGTGAAC
AATATATTGTTCGAATGGAGAGAGCCGATAAAAAACTTCATTAAAGCTACTTCGTTTGGCTCTCATTCTCTATCTATCATCGGCCGGCAAGTTTATACAG
TAAGATTTCGTTTCTCTTTTCTGTTCAATGATCAATCACACTGTTTATTGTTTCGTTGGCTGAAAAATTTGGTTCGGTTTCTATCATTGAATGATCTCCA
GAAGTGATTTTGTAATTCGTATGAACCGAATTGGATTTTGCATTGTTTAGCATTTGTAGAAGTATGAATTATTATTAGTTTTTGGATTGGTTGCTTTTTG
ATGTTTAAATTTCAAGCTGAGAATGTTCATCTGGATGTTATATTCGTTGATTGATTTTGTTTTGTGTGAGTGCATTGTTGTGTTAGTTGTAATTTTTGGT
GTGGAAAGTGATGGAATGAAATGCCTGATTTTAATTTGTGACCTAGACGTTTAGTATTGTTTCATTTCATGAATATTGTTTAGGAGTTCGGCTCTTAAAT
CACAGTGATTTTCTTCTCTTTTTTTTTCGTTCATTGGAATAGACTGAGTTATAGTGTGTCAGCATCTTTTCAGGGGTGATAGTTGTATGCTTAATGTAAT
CTTCATTGATTTGAGGAAGAATATCAAATTTTGTTAATGTGCTTTCATGCTGCATCTGAATAGTTCTAAACTTTGGCATTACTAACGAGATTCGTTTGGC
CGTGGATGATTAGAGAAGTGGATTAGTTTGTTTCAGTTGTAAATCATTTGTTCAGACCAAAGGATTTTACTTACACACGTGTATGGCAGTGTAAATACTG
TATAGACTAGTTCTTTGATCGCTTATGTTAGTTAGATCTAAACAACCAGTTAGTAGGAGTTCTCAATTTTACTTATCAAAAAGTAGTATTTCTCCATTTT
TACTATTGTTATTAGTTGCTTTTCTCCTGTCACAACTGTTGGTTCTCTGTACATTCTGTTATCCGTGAAATGTTGGATTCTCTTGTTGTTATGCCATCCA
ATCTCTGCCATTTTCCTTTATTTTGCGGTTTCTGCTATTCTACAAATTGTTAAAAAGCCTTTGATTAATAAGTGATGTTCTCAATATGGTTGCTTCTTTA
CTTCTTATCAGCGGTTCTTATTTCATCTTATACTGCAAGGATGAAGATGGAGGCACCTCCTTCGACAATCTTGTTTACTGATGATGATAGCAAGAACCTG
GAGCAATTGCTTGATGTCTTTGGATCTGTTGTCTCTCTCGATGACATCGCTGCAGCTTATTGTAAAGCAGGTCGGGATCCAATTATTGCAGGTGATATAC
TTGGAGATCAGAAACCTAGCAGCTCCGGAACTACTAACTCTGAGATGGAAGAAAACATAGAGGATTCCGTGACTCTGACTTCTGAATTTGAGGAAGTAGG
GGACTCTATGATATCGACATCTGCATCTGTATCTGAGATTGATGCCAAGAGAGTTGGTCCCAGGTCATCAAAGCAAAAAAAGTTATCAGTGTCTATGGGG
ACTGTCTCAAGCATGATCCCAAAAGACTATCTGACGAATAGGCCACTAATTACAGAAACTTCTACGAGAATCAAGCCACTGAAATTAAGCGCAGATGATT
TCTTAACCCCAGAGCTAAGGGAGGAGAAAGCTCCATTAGGTGCTGCAGCTATGAGTGAAACCCTGCCCAGCAGTGTAGAGGAGTTCCTCTTCAACATGCT
GGGAAGCGGATTTTCTCTTGACAGGAGTGTAATTGGAGATGTTGTTGGTGAGCACTTTACCTATGTCTACACTTAGTGTTTGTAAGATTATTTGATAAGT
AGTGCTGCCACATGGAGTAATTCTACTTATACTTCCAATGACCTGAACTTGTGTCATTTCTTTCTTCACTTCTTTTCATTGATCTTCTAATGAAACTTGC
AAAAGTTGGTTAAATGTTTCTTTATAGTCTGTTTTGAGACTTGATTTGTTAAGTAGAATGCAACTTGAGGATGGTCCACTTGTTCAGTTTGTCTCAGATA
TCTTTAAATTCTGTTCCCTTTTTTCTTCCTTATAACTGCATTGTAATTCCTATGAGCTTATAACTGCATTCTAATTCCTAGGAGCTGTCACAACTTTTGG
ATAATCTCCTTCCTAATTTGGTATTGTTGGATATACAGGTCAATGCAGCTACGATCTGAACAAGGTTAGTGATATCAACTCAACCACTTTGTATACTTTA
TATGTGTTTTTCGAGGCATCAAATGCTAATATTATATTTGGCTCAATTTTATGTTTACATTCAGCATATGCATGTTTGCACTTAACTCTTATGCTGTTAC
TCCGTAATTGGCACCACATTGTTATATGCTAAGCACATATGTGAAAGTTGCTCTTCTAAGCACCTGCAAATACCATTTAACCTGCTTATTCTCCGCCCTC
CTTTTATTATTACCTATGAAATCTTGAAAGTAAGTCCTCAAAACGCTTTTCTAGGTCCTTCTCAAAGTCAATCCCGTTGCTGGTTTGGTTTTTGTGGCTT
AAGTTTAAGTAGTTTTGATGTATGTGGTTTGAAGTCCACATTTAACTAGAAAATAAATTATGCTCCATTCTACTTATCAGAATAGCTATTAAGCCTCTAT
CACAGTTAAAGTAATTACCTCATGTACCTAAATTTAGCTTGTGGATTTAGGAACCAATGAATGAATTTCTTGCTAACTGTGGTTAACTTTCATGGCGAGA
AACCTCAATGCATGTGTGGGATCATACATAAATGCCAGGAGGATGAGGCCAGGTTGCAGAAGCTTAGTTCTCATACTAAGCAGAAAAGACAATGCTCGGT
TATTGCTGTTTGATCTTCTGATTCCGAATATATCAGCCTGATAACAATTTTGTAGTTCCTGCTTGGGTGCTTCTATCTTTTCGTTTCAGAATTTTTGCAT
GCACACTAGACATAGATTGGCTTACTTCTCTACAGAGATTTATATATCGCTCTAATCTTGCATTTTCATTATATTACACCCCCTTTCCGCTGAATATGCA
GAGTATGGATAAGCTGCTAGATATGTCCGCATCAACTTTGGGAAAGAGCGATGATATTATAAATATAGGTGTCAAGAAAGTAAGTTTTCTTGTATGTCAC
TTGGTGTTGCTCATGTCTGCTGTAAAACTAGATACATCACTTACAAGCGAACTGCTATTTAATGATAGTGATCTTAGTCAGGCAATCTGCTTCCTAGCCA
CGCTCTTGAAGGAAAATGAGACAGCTTTTTCACAATAAAATTCTAGGAAAGGATAGTGTCTTATCTTTCTCTTTATTCTCCTTTTCCTCTCCCTTAACCC
ATTCACTCCTCACCCAGTTTGTTCTCTCCACCATGCTCACTCTGTCACCTGACCTGAGAAAAGTCCTTATGACTGGAGTTACTACTGTACTAAGGATCAG
TTTTGCTTTGAGAAAAGGGTTCCACATCTATACAATAGGTTGATATCTTGACAGAACAGCCAAAGACCAGATATGCAGTAGAATTTATTTTCAAAAATAG
ATTCAAGTTAAATAACCTACTGATGTGACTACAGACTACAAAAATGAGCAGTGTATTCCTTTTGGGAGGTAATTTTGTAAGGGATTCTATTCATAAAAAA
TAGGTTTCTATGAGGTAGCTTCTCTAGAACTGGAAACAGTTTTGGATCTGTAGTGATGCAGTCCGCTTGAACTACTTGACGTTGCATCTAGCTGTAAAAA
GAGCTTACAAGATTAATAATGTTCAATTCATTCACCATATAAATATCCACATTCCTTTGAATTGTAGGAATTACTTTTGTATTTTGTTGGCTACTATACT
GCTAAGTTAGGTCAGACCAGATTTCCCCGTCTCTGAAATCAAAGGGAATAGATAACCAACCACTCTTCTCCTATCCCTGATTACCTGAGGTGCTGCAGCA
TTAAGAATTTATTTTTAAAAGTAAGGATCACAAACTATCTTTCAGGCATTATATTTAGACAGCCTTTAAACTAGTCCAGATATTCTATTCAACCACTTAA
ACTCAACCTATGACCATTTGAACACCTTACCTGTACTAAAAGTGTCATTCAGCCCCAATTTATACAAAAAAAGCTGTGTAACTCACACACATATGATGTG
GCAGAAAGACAAATAAAACCATGACATGTGCATATGGACTCAAATAATCATTAAAAGAAAGAAAAGCTTAGTTTCTATAACGCATTCCTGCCCACTCAAT
CCTCCATTTCCTCTTTCTTCCTCCTTGGAGATTTCCTTCGACCCCCCCATTGCTTTCCACCCATTTCTTTCTCATTTTTCTCTTTATTCCTTTTGCTTTC
AAAAAAAATTCCGCCAGAAGTTTCTGCCCGACTCGAAAAGTATGAAGATTGGCTGAAATTTTTATGGATATTTGTCAGAAAAAAATTCTCTCTGGCCAAC
CTTTTCGTTCATCTATTTAATCTAATATTCTAGTTTAGCATTTGCATGATAAATTATGGACTAGAGTCATGAGAAAAATGATTGTTTATAGAACATGTGC
GATATAGCTGAGGTTTATGATGGTTGAAAATGGTGGTCGGGTGGCAGACCACCTGAAAGAGAAGAAAGGGGGGTGGGGGGTGGACTATGTATTACACCTA
TCTTTAATGGTAATTCTATAGTAGTTCCATATGCAATTTAAATTGTTTAAATCACATAAAATAATTTCCTTACTTACTATGCTTTCTCTAATTTACTATA
ACAGTCTGTGGAGAGTTCAGATTTTGCATCAGTTGTATCAAAAGAGACATCTTCAATGACAGATCCAGCCATCCGGTACTCTGTCCTCCAGAAACTATAA
TTTAATGTCCAGGAAGTTCTCTTTTTTTTTTGGTTAAACTGATTTTGTAGATTTTCAAGGTGTTGTTATGGATTGACTGTCATCCTTCTATTTTTGCTGA
TGCAGTTCCAAAGCAAATGAGAAGACTAAAAATGGGCTCAAGTTATCTATGAAGGAGCAGGAAAGGTATGAGATTCAAAAGGAAGTTCTGCATGCATTGT
TTGATGTACCTGCAGCTTCAAGATATGATAATGTGGATGAAGTGATTCGTCCGGTGAAGGAAGTTGGGAAGTCTAGTAGATTAAATCTCGTTGTAGATAA
ACCATTACAGGAGACTTTAGAACGCCAGATTCTTATCAGGACACCACAAAGTGATGCAAAAAGTAAGCAGCACTAACTGCTTATTACTTGTGTTGGACAG
ATGAAAAAGTGTTTATGGTACATTTGGCTTTTTCTAAAGGTTTCATATCTTCTTTTCAATTGCCTTTTTTTCTATGATTTTGTACTCTTTTATGGCAAGA
TTGCTTTTTCCAGTTGAATCTGCCGTTGGCAACCAGAAACTGGAGAACTTTTTTTTTTCTTTTTCTCTTCTTAGTCGTATAAGTTCTATATGTTGGAGCA
AGTAAGAAATAGAAAAATGCTCCCCCTCTTTATGGTTCGTCTTTTACTTGAGGTACCTTGAGCTTTATTTTATGGAAGTGAAATTACCATTTAACTTAAC
TGGACCCATAAAGACATCCATTCGTATCGAACCATATGGATGTCGGCCTGGAACAAGTGCAAGTATATTCCTGTCTTAGGTATACACTTATCCCTTGGAA
ACAGAGACCTAAACCTCAAAGTACCCTATACATTCACAGAAAAGATATTAGAATATTATATGTACTGGTGAAAAGAACATACCCAGGTAAACCTCACTAG
TGGGGTCTGGTAAGGGTAGGATGTATGCAAATGCATGGATATTTGTAGCTATCCAGTACTCCTTTAGGATAGCTATTTGCTTCATTTTCTCATGTAAAAC
ACCTCTTGTTCTTCAATTTTAGATGGTGAGGAGGATGAAGAAAGCTACGAAGTTCTTCGGAAAGCTGTAAAGGAGTACTGGATTACAATGAAAGAGTACT
ATAATGCAGTGAGTCATGGATACCTCTCTTCTACAGTTTCATGATCTAAATACCATTAAGATGCTTCATTCTGTGTCGAGCGAGAAGAAGAAAGTTTAGT
ATGTTAAATCTTGACTGGTATTACAAACTTAAATTGTTACCCAGGCTTCTGAAGCATTCTCCAAAGGAGATCATGATCAAGCACGCAAATTCCTGGAAGA
GGTAGGGTGTTTGTTCCTTTATGTAGAGTGTCTTGACTGTTTGTATTTGAAAATATAAGTGAAGAAATAACTAGCCTCCATAGTCTCTATGAGATATTCT
ACTGATTGGTGTCGGCTGAGTAGGTGGTGTAGAGTTACTATCTTAATTAGCTCCATTAGGTGGTCAGAGTCTGAGCATTTCGTCAACTTCCTTCAAAGTA
TCCAAATATTTTACTTGCTTCTTGCTTTACACCTATCAAGGGAGGTTTTAGCTTCAACTTAGCCTACAAACATCGTAAAAAGCAAAGTAACATGCCAGGT
TCAAGTTCTTCATATTCATCGACAGCTTTCACTTCTAGCACAATGAAAGAGAAAATACTCATAACATCACCTGTCACGGGAAAAAGAAGAAAAATAGCTC
CAAATTGATGCTGGGTATAAATGTCCAATTTGTGCAAACTGTTCTCTTCCCATAAAGTTGACCTTGCCTTGGCTGATCCACTTGTTTAAATTTTCATTAT
GGTGGTGTGCTGGCATTTTACTCATTATCTTCTCATGAAACAGGGACAATTTTTCATGACGAAGGCGCAAGTGACGGATGAAAAATCCTCTCAAAAGCTT
CTTGAAACCAGGTTAGGCAGAAGTCTGGCTTCCTTTCTCTTTTCTTTCTCTACTCATGTATGTTGCTTACAGGGCTTGTATTTACCGAATACTCCAACCT
TAGTTGCAGTTCCAGCAAAGAAATTGTGACACTCGACCTTCACGATTTGGAGCCAAAGGATGCAGTGCGCTTACTCAAACTTCAGTTGACTTCTCTTTGT
GGATTCTCGTGTAGGTTATCGTCATTATAGGACTTCGTCAATTGTTTTTATATAAAAATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCTTGGTGCTGATATGTTTGAATAATTTGGTCTATCTGC
TGCTGTTTTTCTCACGGGTATATGTTACTGACAATTGGAATATTGTAATCTTCAATTTTTTGGGGCAACACTGTAAATATTACTATTGACAAACCAAGTC
AGCATAGAATACAAGCCTAAGAGCACCTAGCCATTTCCTTCACCTCTTATGAAGGTAAAGATGATCATAGGCCTCAAAAACGAGTCTAATTACATGTATA
TTCTCTCTTTAAGCCCCCTAGATCTATCCAACTTCTTCTGCATATAAGGTAGATTTGATCTATCTATTAACTCCTTACTCTGTGTAATTGCCCTCTCTAT
ATCTACAGTTTGTCCCTTGAACAGGTTCCAGTTCTGGGCCCTCCAAGTATAAATGACCATTGCCCCCCACACAGCAGCTACTATCTTCTTCTGGATTAAC
TTCTAATGCTTCCTTCTATTTCCTCCCTTACATTTTTAAACCAGTCACACTCAAATAACAGATGCTGAGATGTCTCCATATCAGCAGATCCACAAAGACA
GCAGTGCAGGTCATCCACCTGAATGTTTAGCTGAAGAAGTCTCCTTTTCTGATAGCTAACAATAAACTTGTGTTTTGGTTGTGCAACATCGTTCATCTCT
GTTCTGCAGCATTTTCCTTTTTTTTCCTACAACATCATGTAGCTTCTAGAGATTGAGTACCTTCCTCCAGGTGTAAGATTATATCCCTGGGTAAACCAAG
CCCAAACTGTGGAATCATCCTTCATTTCACCCTTAGTGAGCCCTTATCCACCACTAATTGCCATAACAGTTCCCTACTTATGCAAGATTCCAGATTCTGC
TGCCCTTGATATTAAAGCCTTCATTACCCTTAGGTACGCAAACTGTATCCCAAGCTACAAGGCTCACTTTCCTCTTTTCTTCATTGCCCCCATAGGAACA
TTCTACATCTTCTATCAACCTTTTTCAACACACTCTGGGGGCTGTATTAACACCATACCCCAGAAGTTATGAATGGAGAACAACACATCAACAATCACTT
GTAATCTCCCAGCGTAGGACAATTGCTTAGAATACCCTGTACTAATTTTATCTGATATCTTATTAATCAGAGTGGCAGGATCTACAGAGTACTTTTGAAG
AAAATGGTTGTTTTTTATTCTTCCTGCCTCTGCCATGTTATACACGTATGCCTCTGCCATTGTTCAGAAAATTTGGCCTCAAGTCTAAACAATTCAGTCC
AGATTGGTAACTCAAGAAGATAATAGACCTTAAATCTGACATATGAGAACAATTAAGCTGTGTATGCCAGTTTATCTTTTCACCTCTTAAAATATGCAAG
TGGAAATTCCATCTGCATCTTTCATAAATGTGAAAACCACAATGTTCTGACGTCGAAACACTGCTGAATGGACAGTATTAACTATACAGTCAAGTACCTT
CTAGTACTCTACTATAGGTGTCAGTTTATGGTCCTTGTAACCAATTACAGTAGTATAAGTTACGAAAAATTAATGTGATATCCAAACTGTTTCTTTCTTC
TAGGAAATAATATATAATCTATTTCAAAATGTACATATAAGAAACAATTGTGGTTTAGAGAATGTTTTAGTGTCGACTCTTCTCATTTTCATTATTTTGA
TCGCGAATATTATCTGTATAGGACTTTGGATAGGTTAGGGTTGAGACTTTCTCCCATGCTGTAGGATTAACAAAAAATTCATTATGAACTTATTCGATCT
CTGTTGTTTCATATCCCAGATAGTATGTCCAATTGAATTATTTTTCTCCATTCTATGTCTATTACATCTCATTTCTTTAGCTACTTGAATCGACATTGGA
CAAATAGAAGTATGAGACAGATATTTGTAAACAGGTACTGAAATTTTTGGAGAGGGATTCCATACCATGGACGGAGGAAGAAAATGGCACAGTGCTTGTG
ATAAGAGTGGATGTGATAGATCCGCGGAAAATGACTTTTGCTAAAAAATCAACTGCCAGAGTCCGATAAATACATCACTGAATAGATCATTGTTCTAAAG
CATGAATTTTGTATCAACTTGGATCTTGTGAAATGCTTTGATGCTTCTGCATTTTTTATAACCACAAGGAACAACCTTGGCCTTGCTACCAAAAAGACTT
GTATTTGATTCTTTAATTTCTCTTCTTAATTCTCAAGCCGGTGAGCAAGTTTTGCTTAGGCACCGATTTACTTGGTAAAGACTAATAGCAAATTGATTTC
AGAAGTACATTATATGAAACATGCAATGCTTTGACTTACCTATGCATGTTGCTTTCTGTTTTTAACTTAGAATGCACTGTACTTGTATAGTTGTGCTCCA
TGATAGTTAGCATCTGGTATTAAAGTGGATTACAGTCCCACGTTGGTTTGGGAATGTAATCGTGGTTTAGTTATATGGACTTCGGCAAATGGACTGGCAT
TGAGTTGAGTCCAAATTCTTCCTCGTTTAGGCTCCAAGTCCACATTCATCTCAGGGCTGGACCTAGTGGGTGTTAGAGTGGATTACATTCTCACATTGGT
TGGGGAATGAAAAACAATCCAAAAATCGCATGTTATAGTGCTAAAGCAAACTCGTAATTGACAAAATGTGGACACTCGATCTAATTTAGAATTAAATTTA
TTTACATGTAAAGATGATACAAATCTATCAAAAATAACTAAAACCAAGTTAACTGACAAAAAAACACAGAATAAATTGAAGTGATCATCCATTCATTAAC
ACTTGAAATGATAATAATTCAAGCTAATGCATGAGACACCATTGATCATTGTGTAAGTCTTTGCATCTCAGTTTGTTCATTCAATGTCTCAAGAAGAAGC
GGAGGGGCGTATTGAGCAGTTCCTTGATGCTCCTCTGAATCTTGACAAAATGAAAGTATTATGGTATCAATTGACATCTCCACAACTGCAAAGAAGAGAG
TTGCCACGACGTATCCAAGAAACCAGCACACCTGCATTAGAAACACGAATCTAGCTTAGAGATACAGAAGAGAAGTTCGACCCAAAGACAGTTCCATCAC
GGCATGTTCTATATCGTTCTCTTCTAGTAAAGGGGTCACAATCATGACTCAAAAAGAGATGCGTGCACATACTTCTAGTTAAAACAGTTTGTAAATTCAT
GGAAACACACTCATTTGAACCTCTTAATCATCACCATAAGTACTCATCAAGTGAAATCTTCGAACACTTTTTTACTAAATGAACTACAGAAGTTCACTTA
TGTAGTTCTTCACTCTCTATATTTCTCTATGTTGCATCATTTAAGGTGGTAATAAAAACTTCTCAAAGGAGCTGGGCTATTACTTAGTTCAGTTTTGTGA
AATTGATGGTTGCATCTGCTTAAATGAAAAATCCGTCCAGAAGAATTAGACTTACCAGAACCGGGAAAATTGGTGACGAGATCTTGTTATGTCCAATGTT
GTACTTGTGAGTATCCAACATGAGAAAAGCAAAAAGTGCACTTGCAAGACTGACACACAGCTTCCCAAGAAAGAGAATAACATCACCAATGACGTTCACC
TTTCCAATCCGAAGGATGTTACTGATAATGAGATCAGTTGCAATCTCAGAAGACTTAAAAAAGCCTTTTCCTGTTATTGCAATCTGCAAAGCATCACAAA
CACTATCATTTCTGATGCTGTTAAGATAATCACTATAAATCTAGATCACGTGTAACAATGATGACATGTTCTCGTTAATTTAACGTTCTGAATTTACGAG
AAGTTGAGGAACATTGAATGGGATTGCAACATTTTGTACTCTTACCAAGATGTAAGCATTACGATTCACAGATTTGATGATCCAACCAACACACTGCAGG
AGACACTGTGAGGAACTATATACCATTCTTCCAAACCAACTTTCTGGTGCAGAGTTAGTAACTTTAAGTTTACGCCGGAGTGCTTCAAGTATAAACCTGA
TAGACTCTATAAATGAAACAATCAGAGAACCAAGAGCAACGGATCCAATGCTGTAACGTAAAAGCCGCTTCATAGAGGAGAGCACTGGGAGAAATGAAAT
TTCTGGCTGCACTTGCAAAAGTAAACTGATCAGTCACAAGTGCATACCGAAATACTATGTAACAAATCAGGATTTTTTTCTTCTGAAAGATATACGAAGC
TGGCTACTGAAGCTGATTGCATACAAGTATCAAATGACAAACATGATTATGAGAAGAAATAGCAGAAATTCAGAATATTGTGGAATGTCGAGATGAATTT
TTTCCCCGACATGGACTCGATGGACTTCATTGGTTTGTTCAAAATGAATCTGTCTAGAAAGTAAAGCAATTGGTTTTTGACCAGCATTGCTGGAAAAATG
AGGAGGATTTATGACTCACCGATGTTCCACCTCGAGCCCAATAGTATGTAGCGACAGAGCCTGCAATGACCGTTGCAGAGCTTGCCACAAAAAACTGAGT
GGCCCAAAATCCGCCAAACAAATGAAAAAAAATTGCAGCAGCAATATGAGAAGTATACTGGATGCTGTAACCGCAGCAACGATCACAGCTCACCCTTTTT
GATTTAAGATCATAAGCACAGCAGTTGGTGTTGCAATCATTCTGGACAACGCGTCCAGAACTAAAAAGATGAAGAGCAGCTGAAAACCAAAACATGTAGA
AGATTGCTAGGATAGCATACGGAATGATGGGGAAAATTATTAATGCTTGTACTTCTCCAATGACCTTAGCAGCTACCTGCAATTAAGATTATCATTCATA
ATCTCAGGTTTTAAGTAAATATATCTAGAGATAAGAAGCTTTATGATAGACTTACCTTCAGGACTGAAGTAGCCATAAGTATACGACGCACTATAGCGAT
GGATGACAAGACCGAAATAATCATTACAGCAGTCATGATAACAGCAGCAGCATGGAGATGACTTATTTCCTACCAAGCAGATAATCTAATTTAACGGTAC
AGCAAACTATTACATAGAGGATGATGAAACTGACAAAAGGCAAGCATACCCTTGCAGATACATGATAATACGGATCATGTTCACCAATGATGGGGGAGAT
AGGGTCGTTCCCTATCCATCCAGCTGGACAGGAAAGAAGAATAATTTTGTTAGTATACTCAATGGAAATATATGATGTTCAATTACACAACAAACATAAG
ATATAATGCAGGACTACGTGAGATCTTCACGAACTGTAGAAAAAAAAAAGATCTTTGCATAAGACAGAAAGACTTGAACTTATCAAAAAGAAAGAAAGGA
TTACATCAGGAAAAGTATCTATCTTGGTGAATGGGCGCAAAAGAGTGCAGCATACATTAAACAATAGGCATCTTGTCGGCCTTTTTACTAATTTTTGTTT
GATAAATGTGGTGTTTGGGCTAGCTTTTGCGCACCTCGACTAACTCCAAGGAGAATGGAAAATGGAAATAAAAGGAAAGAAGATATGTTTCCCATGAATC
ATCTTAGTACAGAAGTCGTGTAGTTTTCTTTAAACCCAGGGAAGGGGGTGTGAAGATTAAAAAAATCCAGAATCACAAGTACTAATAGTGCTATGAGACT
TTTGGACATAGAACAAATAATAGAAAGTATAAAGTTTGTCAGAGGGTACTACATCTCAATCACAACTTGGACATAGAACTGAAAATTGACATGAATTACA
ATTACTACGTAACGACAGAGGGAAAACACTAGGGAACAGTGCCTACCTTTTAGATAGTAGAACATTGTGACTGAAACTATGAGGCCATTAAAGAGGACGA
CAGTTATCCAAGGCATTGCAGCCACAAAGTGACGAATCATCAGAAGCCATATCACTGATAGAAAAACTGGCAAAATTCCTCCACAAACAATCAACACTCC
CCATGACTTGCCAACATCAGCTACATATCTCTGAAAATGTAACTCAAATGTGAATTTTGAACTCTTAAATAAAGAATGTGATACCATAGAGAACACAATC
AAGGCACATTGTTATAATATGTGTTACTTGAGCATTTCAGTGTTCTCTTGTTTTAGTCATCGTTAGACCATTGACACACAAGTCAAATGAAACATTTGTT
ATTTATGAAAATGAGTTACACTTGTACCGTTTGAACTAAAGATTTCGCAGAATTTGTGGGTATGAAAAGCAATTTTTTTTACACGTGGTTATGTATCCTG
ATGCAGGTCCAAGAGAAAATGTCATCTACAGCCAATCAAACGAGCAATCTACACTATACTATTGAGTGTCTCATTTTCTCCCGGCAAGTTCCGATGAAAA
GATTCTATCTGCGTACTTTACAAGCAAAACAAGAGAAGTGTTAAGTCACTCAACCTTTAAGACCAAAGATCGAGAGTTAATTAAGCCATGGATAGACTTA
TCAACTGCGATATCCTCAACAATGTTTACACCACCCATCTCCTTCCAATGCCGCAAAGATACATTTGATGCACGGGCAATAAGCTGACAGCTCCAATAAA
CTGTCACAAAAGGTTAGGATATTGAAAAAGAAATTAAACATGTCAAAACACGTGAACTTCCAACAGATGGGGGGGGGGGGGGGGGGAGTATGTTCCATTT
TATCAGGTGTGGAGCTGAAATCATCAAAAAGACCTTTAATTAAGCTGGTTCCCAAATCAATAAGAAGTACTTAGCAAACAATATGATTGACATATCATGC
CGCAAATGATACTTTCACTTACCATTAACACTTGGAAATATGACAGGGTAGCAAGGACCTTGTAGCTGAAGTGAAGTGTTTCTTAGGTCTGGAGTAAGGT
CCGCAAAATAATCATAATTTCTATCGATCCAGTCATCTACTGACAGACGAACCTCGCCTTCTGGATAGTCACACACCCAATTTAGAGAATCTTCAGATGG
GATAGGACAGTCCATCAAGCAAATAGTCCTAGCATTAGAAAGTTTGGCCTGATTATCCTTTGAACCACTTTCATAAACTTGATTTGGGTTCACCCAGTAT
CTGAGTTCCAATTCACGAAGATCAGGATCAGCATGTCTATCACCACAAACATTGCCCTTATAGTCCAGCCCAGATGTAAGCCTGATAAGCCATAACAGAT
GCATCAGCAATACAACAAATGAGTGAACAGATATATCCATTGAGAAAGGGAAGATCTTTTTCCTTTTTTTCGCATGGACAAGCTGAAAAACTCTTAAAAT
ATAATTTCATTTAGAGAAAAGAACCTTTCACAGTTATGTGACCAGAATATAAAAGATATCACTGAAGACATATTATCAAAAAGAATTTCTACATGTTTAG
CCATGAAAAGATGAATCAGGCCACATGTGAGGGGCTAGATGAGAACATTCTTGAGTTGATTTCACATATGGTCACTCAACTAATAATTATTATCTCGGAA
GGTCACTTTCTTTGTTGAAGAAAATTGAAGTATAAGAAGAAAGGTGTATTCTTTATGAGATAATAACTATTAGTGGAGAGGCTATACGAGTAATCAACCC
TCTCACAATTCCTTATTTCCAACAAGAAGTTCACATATCCATACCAATCTTTAACTTATAACATTGGCCATAAAATCAGGTTCTTTAATGACAATCTCAA
TAACAAAGAGCCAAAAAAGAACATTCTTTTCAACTTGTGGCAACAATTGTGCATTTTTCCACACCCTTCAGAAGGTTAAGTCTTAAAGAAGATAACTTTG
TACCTCAGCAAGACAAAAACAAAGCAACATCTAAAATTTACATTCAGCCAAAACAATAAAAGACCAACCTTTCAAAGAAAAGTAAATCAAACCCACATTA
CACTACCACAAGATATGAACAAAAATGAACACCTTACACAAAACACATTAAACTAACAGATCAAAATGCCAAAAACAGCACAGACACACTTAGGGTATGC
AAAAACAGCAAAAAAGATTGCAACTTTTTCATTTCTTGATTTTTTTTTACCTCAAGGGGTTTCCTTGGTTGAATCCAAAGCTGGAATTAACAATCATAGC
AACCCAAAAAGTAATAAAGATAACAAGAAACACTACATCTCTACATTTCCTGTTGTGTTTGATAATTCCATCCCCTTTTTCAGCTACCCCACCATCACTT
GAAGGGTACTTCCCTATTACAGCTCCTAAAGGTCCTCTCATTTCCACTACACCTAAATCTCTCTGTAAAAAATCTTCAAATCTTGAAAATGAAGTAGCAA
AAAGGGTTCATAAAAATGGGATTTTTTTTTTCTTCAGAAAAGATGAAAAGGAAGTGAAGAGTGTGAAGAAAGAAGCAAAAAAGGAGTGTGAAAAAGGGAC
AGGGGTTTATGGGAATATGTTTCTGCTAATTCAGTAATTAGTCCCACTAGTTCTGATTAAAAATGTATACTTTTTTTTTTTAATGTAAAGTTTTATTTAG
TGTTAAGACAAAGATTGTGTATTGGATATTTTTTTAAGGGTAAGAAGACAGAATCTAATGACAAAGTGCCAACAGGTGAAAGTGAACTGGTTTTGAGCTT
CATTTTTTTCTCTCTTGTAAAGTTTTAGAAATACCCTTGTAATTTTTGTTATAATACAAGAATTGCCCCTCAGATATAAAAATAAATAACTTTTGATATA
TCTGAGTTTATAATTTGAAGTTTATGTATTTCTATGATAATTTCAAATTTTAATAATTGAAATTTGAAAGAGTTAATAGAGTTTTTATGTGGAGTGTGTG
GATGCAAAATTTTGGTAATAATTTTTTTTTTATCAAAAATTAGAAAAAGAACTTAGATAAACATGAGAATGTTTTAAAGGAAATAAGGAGTTAGTATTGA
CCAATTATCATAGATTCTTGTAATTAGATTGATTAACTTTAAAATAAGAGTGATTATTTATGGAAATAAATTTAGATTTTATGTAAAAGTAGGTAGTGTA
ACAACATTTTAATTAAATGAAAGAAAATAATATATGAATAAGGAAAAAAAAACTATGAGATGAGTGTTTTTTTTTATTAGAAAAGCTTTCACTTTTTCCA
AGAATAGATCATTTAACATTTTTTTAGTTTAATAATAATAATAATAAAAAAGAGGATATTCACTGCAAAAATCTGGACTTTTATATGTAGGCATCCGACA
ATAAAAACTGTTAAGAAAAGATGGACTATAACGTGGGATTATAATAATGAGATTAAATATAATGATATTTTTAATATATTTTTTTTCATTTTAGTTGTAT
GTATGTGTTATTGAATTAAAAATAAGATATACAGAATGTAATAATATAAAACATATGTTTGTTTACATATAATTGATAAATTTAGATAAAAAAATTATAT
ATGCTCCTTAACTTGGCTCGAATCACATTATGCTCTTTAACTTTGAGTGTGTACAAATAGACACTTAAATTTATATAAAGTTGAACAAATAGACACACAT
GTCATTCTATGTGTCATTTTTTATCCTACGTGTGTTGTGTCATGTAAAACTCACGTGTTTATTTATTTAAAAGTTGAATAGTTAAAATGTCTGTTTGTGC
ATTATGAAAAATTGGAGGTCAAAATTAAAATTTAAAGTCAAATTTAGGATTCAATATATGTATTATACCATTCTTTTTACAATTTAATCTTTGTTCTTTA
AAAAGAATTTAGAAGACAAATTATTTTATTTCGGAAACTTCAAAAAAGAAATTATATTTTATTCCCAAATTATTATTATTCAAGCCCTCTCAGCCACAAT
TTTTAAAAAGAAAAAAAAAAGAGTACTAAAATAGCCGCCGAAGAGTAGATACATTTTCCATAAAATCTGGAGATAGTTTGCTATTAGTAGAAATAATATA
ACATCCAATCCGATCGAACTCATTAACTTTTATTTAATACTTACATTAGTTTTCAGAAATTTTTTAAATATATATAAAATTTAGTAATATTAAAAAATTA
AAATCTAGATTTCATAAATTTTAAATTTCGAAAAACTTGTTTGATTTGCGTGTATTAAATTATCACACAAGTATAATTTAATACAATCATATATAATATA
AATTTGTTCAATGTTAATTAACAAATGAAAAGTATATCCATTAAGATTATAATTTAATATCGAATAGATTGAGTTTAATTTGTAATGCTCAACAAATCAT
ATCAGTAGACTATCAAGATTTCATTTTAGCTGGATTTTGACTTACTTCACCATATGTGACATTGATATATCATTGAGGTCTTAATCATACAGTATTTCTT
TTTTTTTTTTGAACATATCAATTGCAATTGTAAAACTGTTTATTCAAAAATTACATCCTTTTTATCTTTTTTTCAAACTCTAGCTTTAGAGTGAAAACGA
ATACTACTAAATAATAACTGTAAACACCTGGGTAATGCTGATAGATCCGAACAAGGTTGCAAAATCGCCAGTTTTCTCCTCTCGTTTTGACAGTACAAGA
TGCAAGCTTGTTGCAATCGTGTACCATTGTTCATCACTGCTCTTCACATATCTTCAAGCACAGATAATGAATAAGTTCACAGTATACAAAGCTAGCCTCA
ACAGTAATAACAGTGTGGCTTACTCTTTTTATCTCCCTTTTTCTCCAAGCATATGGAGGTGGATAACAGAGAAAACGAGACAGGCGCATGTTCCTCCAGG
CTTTGAGCAGAAGTTTACTTGCTCTGCTCATAGCTGAGAATTTCTTCGTTTTCATTCTCTTCTTCTATTCCACTGGCTTCTGTGTTCCTTGTCGCATCAT
GCACGTTTTTGTTTCCAGTAACTACTGTCTTTAATGAGCTAAGGAAAGCCTCTACTTCTCTAGAGTCTTGTTGGTCACCGAGCCATTTACTTATGCTTGA
CACCAGATGGGGTTTTGGTCTCCATGCGGGATTTTGTCCTCGTACAGCTATGGCTTTTTTCATGCATTCAAAAGCCTTTTCCATATTATTCATATTCAAG
TACCCTGCAGCGATGATAGCCCAACTATTTGGGATTGGTGTCTGACCTTTCTTGATAATATCATGCAGCATGGTTTCAGCTTTATCAACTAAGTCATTCT
GGCAATATCCAATAAGAAGGATATTTGGCACTCTAAAATCATAGGTGTGGCAAGAAGACTCCCACTCTTTTAGCACGGTCTCAGCTGTCTCTAGTTCACC
AAGCTTCACTAAGGAACCTAACATGGTGATGTAGTCCCTGTTAATTTGCTTTTTACACACAACCTTATGTACACCCCACAATCGCAACATCTCTTCCTTG
TTGCCTAGATTTCCGTAGTGGGAGATCAAATGATTGTAACCTATTGGATCTTTATGTAGCCTATCTTCTAACTTTTTCAAGAAAATAAGAGCTTTCTCCT
TGAACTTGGCTTTAATATAAACATTAGCCATCATGGAATAGGTGATCCAGTCCGCCGATATGAAAGGCTGACTTTCCATTTCTTCAAGAAGCTTCTCCAT
ACCATTAAAATCAGCTCTTTCTCCACAGCAATTGATGCAGATCCGATAGCTGAAGTTATTAGGGGTGACACCATTCTCCTTCATCTCCGATAGCACTTCA
GAGACTTGCTCGAGTTGGCCAGTACTTCTGTAAAGGCACATGAGATTGTTGTAAACAAGAGTACAGTGAGCATAACCAAGTTCCTTCATTTTCTGAAAGT
GGGTTAGGGACTTCTCAACTAGGCGTTCTCTAATATAACAGTTAAAAAGAGCACCGGAAGTCTTATCATTCTTCTGTTCATCGGTAAGGTTATTAAAGTA
GCACTCTGCAGCTTCCCAACCATGCACAACACCAATAAGATCCAAATGCACAGCACAGTCTCCTGACTTGAAAGGGCAGAGACCTCTGACACTCATCCAC
TATGAAACCTACATGGAAACAAGCATGCACCACCAGCTTTAGTAACAAGGGAAAGTCAGATGTAGCAGTAAAATTCAGAGACCAGAAGTTGAAACATGTT
CCTTTCTCCCCTTCTACATCAGATGCACAAGCATTTCCTATCATACTCAATTTCTTCTTTGTAAGAAATAGGGTTGTCTAAGAAAACTTCATTTGCAATC
CATTTTTGTTGAGACCTGAATCCCATCTTGCTTGGACTCTCCAAAATGTTGTCGTACCTATGCTCAATCCACTAAAAATGCACAACTTTTGGAGGATCTG
ACACATGCCCATCGACATTTTTGAAGAGTCCGAGCAACATAGCCTGAATCAATTAAGCAGAAAATGGGTTGGTTGAAGTCACGTGAGCAGACTTAGCTTT
GCACCTCAGCTTTTCCATGTCTAGTGTTCAAACTTAGTCCATCTATATACGGATGAGCTATTACAGCAAAGGACGTCAGATTCCAGAATTATCTTGAAAC
TACTCCCCTTCAATCTTCATCTATCCTAACCGATTTCTCCCTCTATTCTTTCTACCTCTTATCTTTTCTCTGCTCCTTTATCCTTCTATCTTCCTAGTTC
CTCCTATTATATCTTCCATTTCTACCTTGCTTCATATCAAGTAGAGGTTGATACCAACTGCCAAGAGCTTGTAATAGTATTTCCTTTAGTTTTTTTCATT
CATTATCATTGCATTTAGTTTGTTATCATTCATATGAGTTGGATTTAGCGACTGTTAGATAGCATTGTCCCTGTTTCTCATTATAATCTCAATTTCAACA
TAAAAACTGCGGTGAAGCTGTTAAATTCTATTGATAGATCCACTAAGATCATTATAATTTATAAGCCTTTCGCTAAAGAAGATTAAAAATCAAAGAAACA
CCAGCTCAATCTCAATCTCATAACTCAAGTTCCGCATAATCCGCCTCCCCAAACAGAATTCAATCACTCAATCAACTTAGGACCCGATTATCATTAGCAT
AAGATATCACTTTTGTCAAATTTTTCACTCAAAACTTGAAGAAGAAAAAAACACGTATTTTCAAGAGAAATGCAACTTCAAACCTACATACTCTTACATC
AAAATACCTCTCTTTTTTCAAATATCACTCAAATTCATATCGAAACGCCTACTAAACCTCGATCGAAAATTAACTGAGTCTGCTATTACTAATCATTCAT
ATCTATTCCCCTCTATTCAGGACCTATCATATTCGAACACTAACAAAAACAACATCATACCCTACGGTTACATTCCAATACCAACTAAAAAAAAAGTGCA
GGAAATGGAACCTGGAGAGCTTGAGAAAACCGTTTACGGCTACGGAGATCACGAACAATGCGTTGAAGCTCGAAGCTAGTGACTTTTCTGCCCTCATCCA
CCCATTCATCCAAAACTGGAATTATGAGATCCGCATGCCTCACAGGGCTAATTCTGGAAAACAAATTGTTACGCTTTGAATTTGAAGAATACACAGTAGC
GCAATAAGCACGAACTGGAAAAGCTCTTTGAAGAAGATTGTAAGAAATTGATCTTCTCAAAATTGCGAAGTTCATTGATGAGCTTATTGGCTTTGTTGAT
TGTGATGATACTGAAGAACAACAATGGTTTAAGCTACCCAACATTGAAATTGAAGTAAGCTGAACAAAGAAGACAGTTGAGATTTAGGGTTTTAGAAAAT
TAATAATACCAATTTGACATTAATGATAAAGTAATAAGGAATATAAATTTTTCCATCTTTTATTTTCGATTTACATTAAAATACTACACATATTTCCTCA
TAACTTATACATATGTTAGTTACGAGGGATTTTAAATTACAAATCAAATGTCAAATTAAACTTATATATATGAATAAGTTACTCGCTAATTAGCTATCAA
ATGTTATATAAGATATGTACGAATAAGTTGTCTTTCTACTGGCTACCAGACAATTTCGAGCTTTTTCATTAAATTAGGCAATATATAATCATATCAGTTA
AAAATTTAAGTGGAGAAGTAACTAATTCCCGTGTTACTAATTAATACATGCATAATTATTTCATTATTTCACTTTTAATTGTCATATTGCGTCTTTCAAA
AGTTAATTTAATTAATTTTAAAATTAAATTAGATTTATTAATTTGATATTTTAAACAAAATTATATATATGTATATTTCACTTGTACTTCCGCATTTGTT
TAGCTAGTTCTTTAGAATCCTTTTTGAAGTTTTATTATTGTATGTTGTATGCTTGTTCTTGCTACACTGTGATACTTGTATATGCGTAAATGTTGCAACG
TTGATCACACTTATTGTAAATGAGATTTGGTACATTAACTTTCAGGTTCTAGGTTGTTTACTTCAGCATTTGTTTAGCTAGTTCTTTAAAATCTTGTTGA
AGTTTATGAAAATCTTTTACTTAGTTTATTTAACTTGCTTCCGTAACTTAAATGTCTTAATTTTTAGATTATTTGCATTAGTTTGGATTGTTGTAATGAT
TCACCCACCAAAAAGTTAGTGTGAGTGTCAATCACAACGATTTAGATCGTGACAAAAAATAACTATTAGGATTGACAAAATGAAAAAAAAAAAAAAGGAA
TCAACTATATGTTAATTTTCTAAATGAAAAATAATGCAATCAACTATATGTTAATTTTCTAAATGACAATTATTTGAACCATCACATTTTTTCCCCAGCT
CATTCATAAGAAATAATACATTTATTATTGAAATTAGTAAAATATAATAAGCTTTGTCACGCTCTTAAAATTCAAGAGCATAACAATTACATCGTGTTAC
ATAATACATACAAATAAAATCATAAACATTATACATCGTATCGACTAATTCCAATAATGAAATTGCCATGCAAAAATAAAACGTAAAAATACAAAACAAA
ATAATTTAATTATTATTTTTTTGATTAACTTACTAGCATGTCCATGAACCATCTAAAAAAAATCTTAGGCCATGAACATGATGTAGGTTAAATACAAAAT
TTAAAAGTATACTTTCTATTTAGGTTTAATTAATTAAATTGTCTGCGTGAGGCAAAAGTTTGTCCAAATTTCCATACAGAAGGTACAACATTGATGAATT
CTACCGTCTTACCATCAACCAATGTGATTCTAAACGACAACGTTTGTGATCGAAGATCGTTTCGACTTTGCCAATTGACACCCCAATTTCTATACATTGG
AATCCAAGTTTTTGTTCTTGAGCCTCTAATGGAAACACTCTTAATATCACCACTACCTCCCACATTAGATATCATCACCATGTTGAAATTTGATTGTCCT
TTTAATGTGAAACGTACTCCTCCACTCCTCTTACATGCCACCCTGAAAAAATAAATCATATTTTTTATATCAGAGAGCGGAGTTACAGTTCTATTTATGA
TTCGATAGAATACAAAATAACTTTGAATTTTAACTCGACACATGATACAATCATTGATATAACATCATTCCGTTATACGTAACAATTAATTATACCTGAT
TAAATGATGTCGTTATAAAAAAAGTTTAAATATTTTATCTAAATATATAATTCATTAAAATATCGTAGAAATAAAAAATTCAAAATTTTAGGAATATATA
AAGTAAACGTGCCAAAAGGTGTTTTATATATATATATATACACACACAAAAGTTGTTGATCTTGTTGTAGTGTGATTCTTAATGTCTATAGGCTTTATTT
TTGGACATAAAACAAGTTGCTCACATGCTAATTATTCTTTTTCTACATATATTGTCTTTTCTTTTTGTTTAGTCTTACAAGTTACAATGTACGTAGCATC
ATGATTTATTTATTAAAACAAAAAAAAAAAAAGAGTTTGACTTTTATTAACCAAAACATCTATAATAAAGGTATAATTAAATTTAAAAAAAAAAATTTAT
AAATTCTGTGTACGTCACTGATCACTATAATTATATATACCTGGTGTAGAGAACGGGAACAACACCTTCATTGCCTTGTCTAGCAATACGAAGGAAAGCG
GGCAAAGACATGTCAAAATGTTGACGTGGTGCGTCGCACCACCCTCCGTGGTTATTTGGAGGGCAGAAGTTAGTGGCCGTCACAGTGACGGCCCCATGTG
GGATGCACCACCTGCGATCGAGCTGGCGGTTGCATCTCACTCTATAGCAAGCTCCACATGCTTGTCCATTTCTGAATAAGGCACTACTTAATGCCGCTGT
GTTAACTCCAAATCCAGCATGATAAGGGTTATCATAACCACAAGCTCCACCTAATGACCAAATTTAATTAGTTTGTACTTCTTGATACGTCTAAATAAGA
TATTCAACAGGTGTTTCAGTTAGACAGAGTGAATCATGACTCATGATCTAGTATATTGAAATCGACGTGTTATAATATCGATTAGTCGAAAGTAGAGTAA
AATGCAACTCAAATATAGAAAAGTACAAAAAAAAAAATGATAGAGGAAGTTTGATCATGTTGAACAAATTGAATTATGACTCTTTTATTGATCGATCTTG
ACAATAAATGTGTCATGATCAAACTTTTGAACAAATTAGGTTATATATATATATGACATGTTTATAATTTGATCTCTTTTCTGATTACATATTCATATTT
GACTCTACACATTCGTTTACTGGTACTATAAAGTAAGCTATGTTTAAAGCTAATTTATTCTAGAAACAAAATAATTATGTTGTTTCAATCGATCGTAATC
TTAATTCAACCTATAAAAAGCTAGCTCAACATGAGTAAAAAACGCTGGTGAGAACTTAACGAGATGCTTACCAAAAGTGCTTGGATCTTGATTGACTCCA
TAAAAAGTAGCACGACCATTAAGCCAATTTTGTGCGTTAATCTCCACAATAAACAAATTACAAGTAGTAAACAACAAAACAAACCTCAAAATCTTAATGT
TAGGAACAAAATTCTCCATAATTAAAATTTTGAAATTTTCAAAATGGAACAAAGAATATAATGTAATAATATATTTCTTAGAATTGAAGTGAAAGATAAT
GAGTGGAATATTAATGCATGAATGAACGTGCCTATTTTATAGACTTTAGGATTCTATAATTTTTTTCAAACAAATAATTAATGCAGTAATAAGAAATACG
CGTTTGTCGGTGATTATACTTATAATAGAAACTTTAATTAGTTATTCATCTTACAAAATACTATGAATTAGCAAAAATGATTAGAACTACTAATTGTTTA
ATTAGTATAAATTAGCATTTCTTATATATTATAAATCCACGAAACTGCTACTAGTACATAGTATCATGAATATTATTAGTCATAAACGATAGGTTTAAAT
CTATAATATTTTTTTAAAGTAAAATGGACTTAATCAACCATCAATACTAAGAATATTAAAAATTGAATATTATTATTAGGAAATATTTTGTATTCACACG
ACTTAGAATTACCTCTGCAAAAATTTCCATCATTTGAATTAATTAGAAAATTTTCTTCTTTTTTTTCCTCTCTTTTTCTTAACATCGAGATACTTCGGTC
CACCTCTATCAGATACAGTACATTATAACTTAATTTGTGTTATGAAATTATATAAATTTAGAAGAAGAATAAAGTAGGGAGAAGAGAAAATACTTCTTAA
ATTCTATTGAAGTATATTTATCATTGATCTTTCACAAATCTTGTTTACGACGAAGGAAAACCTTTTATTTATAGGGAAAACCTTACTTGGTCCCCAAGTA
GGATTTCTAAACATATCCTACAAAGACTCCGCGTAATTAGGCATTCACTGTAATACAAATTGTTTATAACACTTTGTATATAATATAAATATTATTGTCG
GTATATATTAACCTCAAAACCCTAATTATTTCTAAGATTTAGTTTATAGTTGTGTGTAAGACTGTGTATTTGATACATAACTCATGTATTTGTTTGATAT
GTACCGAGCGAAGGAATAATGTATCCGCAAATTCAGAAAATTCCAAACTTATTTTAATTTAGAAAACTTTCGAAATAAGATGTAATTACCGCCCAAATTA
TTGAGAAATTAAAGTATAAAAAATACGCGTTTTTTCTTTTTATTATACGGAAATGTACGTAAAAGTTTGTTCAAAAAAAGGGTTGAAAATAGACAAGAAA
AGACCACATGTCACAGTTTATGAAAAAAACTGTTTTTATTGCAATTCGTCGGTGATTATCCTATTTTTTCGGTCTCTAATTATTTATCGTTATTTTTTAA
AATTATTTATGATGAATTAATATGGTTTTAGAAATTTAAAAAGACAAGACTATCGTTATTGTTCTTATCATAGAAGATAAAAATAGTTAAAATCGTCTCT
TAATTAACGTTTCTTAAAAAATGTATAAAAATGAGAATTATGATAAATAATTTGAGACGGAGAAAAGTATATGAATTTATTCATGTTATATTGACTTTAG
GATATATCTAATTAGTCAGTCGATTGATACAATTTCATTAACTTAATATTGGTTGTACGGAGTACGACTTTTATCACTTTCCTGGTACTTTCTTTCTATT
AATTTGAATTTAAAAAAATTAATACTGGTAGACAGTAGCAGATGGAATAACTGAAATCTTGTTTGTCTTTGCTGTAATGGATTATCCACATGTTCATACG
ATAATGATGAGGTTGTTTTTTTTTTAATTAAAAGTTTCGGATATAAATTTTGAATAGAAACCCTATTTCGATTGAAGCCTTAAGCGGCGCAAATCCAAAT
ATATGGATTCCTTATTTGTTGTTGTGTATATAGATGTTAAATTCACCTAGTATGTTCACTTCTTTATTTTTTAAAGCTCGTTAGAAAGAAAAAAAACCTT
GTTGTTGTTGATACGAATGCAAGTATTGTGACTATGCGCACGGTTCGGAGAGCACTGAATTAGAATGAGAGGTTTACCACCACATCATTGCATGCAAGGG
GAGCTCGCTCGATTCGCAGATTGGTCCGACTCGTAATTCACTTCTGACCCCGTGTTCGATAGCCCGACCGTAGTGATGTTAATTGTGGTTACATTCATAA
GTAGCTTGGTCCATCTTTACCTCAACTATGTTATTTTTCTATTGAATTATTGAACCACCCATAATTTGTTCCTTTTAAGTATCGTTAGCTCATGTGAACC
ATAATTTGTGAGAGATATTGATAGAGGATACATATGTTGTCCCAGAACTCATTAGTCCAATTAATAGTGAAATTGTTCGAGAATAATTGTGTTTTACTTC
AAGTCATTTGAACACATTAGAAAACAAATGAAACCAACACACGGTTTGTCTTCATTCCTTTAATCAAAAAATCTTTACAATACGAACATAATTGAAGGCA
TTTACAATTGAAAAATTGATCAAAACCAGTCAACAATGTTTAAAAGGAACAAATTATGGGTGGTTTAATGATTCAATAGGAAAATAGCGTAGTTAAGGCA
TCTGAAGGAAAAAACCCGTCAAGTTTAGAGATGTATTTATGAGTTCGGTCATTTAGAATCCTATTATTAACACAAGTATGAAATCTCTATGCAGAGATCC
AGAGATCGAAAACTTAAATTGACTTATGAAAATCCAAACAATATTAAAACAAAAATAAGATGAAGATCAAAGAACACAGAAAAAAAATTGGAAAGTAACA
TGTTCATTATTCATATTACATTGCCAATTATCACAAAGACCATTCTGGGCCACAAAGCAAAAGGTTCACTGGGCTCCTTACAAGAGACTACCAAAGTAAC
AGAACAGATAGCCATGGCTATGTCTGTTGCCACTTTCTCAAGGGCAACAAAGTTCCGCGAAAGAGAAGGGAATGCACAACAATATAACAGTAGAAGGAAA
AAAAAAAAGCAACCTTTACGCGGTATGAAGCTTTTCTTTGGTGGTTGTTCAATGTCTTATATGCCTATGTATTTCTACTATCTACTAATCGACTGTTAGC
GACAACAGTCTGCATAATTTTCACAACTATACATCATATGTTAAACGCTCAGAATAAGAGAAGGCATAGGATAATGCAGCAGCAAAGAAAGATGGATAAT
CTGTTAAGAGATTTTTCCACTTGCCTCATTCTAAAACCGCCACTTCCTGGAATGGTGGAAGTGTTTGGGTGAGGATAAGCAAATAAACTTGTGTCTGAGT
TCCCAAACATCCTTCCCAAAAACATTTCTCCGAATACCCCAACTGTTGGGCTGGACAAACTGATCGTTGAAGTACCCCCAAAGCTGGATGGAGCCAAAGC
AGCATAGCTACCAAAGGCAGAGGGGACGGATCGTCTGTGATGAAGTTGCTGACTCACGTGAGAAGCTGGAGACAATGAATTAACGAGAGTTGCTATCTCG
ATGGCTTGAGGCCTGCGTGGTACTACAACATCCCGTTGAGACTTCTTGGATTCAGATTCTGGGGATGATGTTCCACGGCCATAAAGAGGTACCAGCGATG
AGTTTGAGATGTGAGCCTTACAGACTGGACATTTACATTTCTCTTCTGATCCCGGAGTAGATCTATCAACTTGAAGCCACTTGTAAATGCAAGGCCAGCA
GTAGAGGTGTCCGCAGAGGGTGACAACAGGATCGTGTGCCGAGTCGAGACAAATATTGCAATCATAACCTCCTGTTATATTGTCAGAACTTGATGTTGGA
ACTGGAACTGGAATTGCACTCCCCTTCTCAAGGGAAACATCTTCTTCAGATACAAAAGTGAACATATCTTCATCAACAAAATTTTGTTCCACAGCCATGA
GGTCTGTTAAAACGGAAAAATTTGCAAACAAATCAGTCACCCTATAAAGTTCATTCAGACACTCCACAAATAAATCCATAGGAAGTAAATGACCATCGAT
ACAAACTTAACCTGAAAATCTACAAGGACAGGATCTATAAAATAGCTTAAAACAAGAAATGAACCATTTGAATGAAAAGATACACATTCATCAACACAAC
AACATGATTGAATGTCAACAACTTCTATCGAAGCATGAAATCGGATATCCAAAAGACTTATTATATACAGTTGGTCCATTTCTGATGAGTTGACCATTTG
GAAAGCAAAATGAAGAAGACAACTTAACAAAGCATCTTCCAGTTCTTCCTTTTTTTCGTTTTCCTTTTCTTTTAGAACTTAGCCTATAGGGAGTATGCGT
GTGATTAGGGAGCAAGGGTTGGAAAAATTAGAGTCCCAACTCCCAAGTAAACACGCTTTAAATACTAAACCATATAATTGCATCCATTCGCTAGAACCTG
TCTTCTTCAAACCAGAAGTGGCGGGGCTGAAAAATTAGATCACAAAGCTAGAGTGTGGCTAAAACTGCAGTTCAATTCGTTTTGATTGACAAACTCCAGT
CTACATCTCCAAGCCTACATTTCAAGTCTAAAAGACGAAAACACATAGAAACGCAGTCGGAAAGGTTAATATTCTTATGCCGATAGGAGATAAAAACACA
AAATTTTGATGGCACAAGTTTGACATATAACAAAATTATCTCCTCAATTCCTCTTTCCATTTCTCCATTTCATAAATGCACGCAAAACTTTCCCTATCAT
GCATTTGAAACGAAACAAATAAAATTCTTCAATTTCTGAAACAAAATAGGCATTGCACAAAACTAAAATCATCAAAAGAACTCACTTACACAAACAGTTC
AATGAATATAAAGATTTTATTTTACACAAAACTAATCAACACCATTAATTCTTTCTGTTTTTGTTTCCACCCTGATCCAACAATACCCGCATTAGAACCC
GACTAATTCATAGTAATTTTTTTCATTTCTTTGGCTCAAACCCGATTAAAACATGTAATTCATCCCCGATCCCACAACATAGCAACACTAACTACTCCTA
CCCATAACCAAAAAAAAAAATTAACCAAAAATTAAAGTAAGTTGACCAAATTCCTTCACAATGTCAAAATCCAAAATTAACAATCTTAACCTCAAATTGA
AAATTTTCCATTTTCTCAATCAACACAAAACTCAAAACAAACATAGATTACAATGAACAGAAATCATAACAAATAATTCAATCAATAATATGCGAAAACA
AAGATCTCAAAAACATAAACACAAAAACAAAAAATAAGATGAAAAACGTACCAATAGATGAAAAACGTAAGGACGAAGTTTCAACAATGGCGAATTGCAG
AAAGCGAAGGTAAAGAGACGGTGAGAAAAAAGATGAAAAATTGAATGGAGGAGGATAACGGGTCAGTTTCGATATTTATTGGGGTTGATTTTGTATTTAT
AGAAAGTTCAGTTCTCAATTTTCATTTCTTATTATTACTTCTCAACCGCGTAATTTGAGAAAAATTAGGGACGTGCGTGTAACCCTATTTTCTCAGTAGT
TACTATTTTTTTCGATATCTATTTTGGGACTCGATATATTTAATTTCTTATCCAAATGTTATTTAAAAAGTAAAACAGGTTATTGAAAGCGATTTTATAT
AATAAAAAAGTTATTACTCCGTTACTAATTGACAATGCGCTTTAGATTTTATTTTTTCGTTTAATCGAATTTTATTATTGATAATGTCTATTAATGTCAA
CATACGAATCTTTGAATCGAAACCCTTTCCAACTAAATATTTGTCTATTTCAATCTTTAGGGTCAAACTTGAAATATTTAAATAATACGAAGAAATTTCA
GTTATTATATTATGCTTTATGATTATTATTTCGAATTCGATGAACGTAGTGGTTCATGATTTGGATTCTTACATGTGATATTATTCCTAAATATAATTAA
TTGTTGTGTATTTATATTACTTTATTAGTTTTAAGATGAATTTGAATATGAGTAAGATTTTTTGTTTTATATTTGATAGATATATTAAATGATTTTTCTT
CATACGACCTAATATTGATTGACAAGATTAGTTGAAACCTATTATTTATTGATAGGAAGGAGTAAAATATTGTGTAACTAAAAAACATATATTTTAGCTG
ACTCAAATATTATCATTATTAAAAGAAAATAATATTTTTCATTACTTTTTGCAAGTTGTATGAACTAGTTTGCCAAAAATAAGATCATGTTTGGAATGAC
ATTATGTTGGGAGGATAAGGTAAAAAATAAAAACTTTAACGTTACGATTAAAAGACACCATTTTAAGAAATTTTGTAATAACTTAATCATTAGATAAAAT
TTTTAACTTATGTAAAAAAATATCAATACTTATATATATATTCACAATTTAACTTATATACAATATAATTTTTTCGAAAAAAGAAGGATATATTCACAAT
TAAGTTGTATTTTCCTCTTTCTTTCATTCTTCAACTACCAAAAAGAAAAAGGGAAAATTGTTGGTGGAATTTTAAAATCACTATACTATTATAAAGAGTG
ATTGGCACGTAAAGTGTGTTTATTTTTCTATTTTTTCTTATTTCAATGTTCAAAACATGTTTCAAAACTAAACATATTATATTAATTATCTTTTTCTCGT
CTTTAACCTGATTTCTATCTAAATATTTAAAATATATAAAAAATACGTGAAGTCTTAATTCTTTTTATATTAGTATTCTAAAAATATATATATTTAATAA
TTAATCAAAATTTATATAGATTTATTACCGAAAAGTGAAGTATGACAAATATCATAAAATGGGTGTAATTCTTCTTAAACTATGTTGGTGTTAATTTAAT
TGATACTTACATAGAAGATAAGTATACGTTTCTTATGACAATGAGTGCAAACTACACATGTTTAAGTGTTTGATTAATTCTTATAGTATATAATTAATTA
TAGTTTTAGTTTGAAAGTAATTAATGTTTTCATGTGCACCGTCAAAAAGTTCATTTAATCACGCTAATTTAATACAAGAGCACGTTAATATTTGGAAAAA
CAAGAGAAAGCATGATCGACTCATTTAAATTTGTGTAATGACAAGGATATATGTGAATCTCTAAATTTACGGGAAGGTTGTTGCACTCTTAACTTACAAA
TACATTCACATAATTTACTCTACATGATAAATAAGTTAAAAAATAACAAGATACACAAGAAAACTTATGATCATGGTGTTCAGACCACCTTTCACACACC
TTGATTGATTGATTCCACAAAATAACTGCCACCTCCACCAACAATAACTCTATCCACCAAAACTAAGACAGATAAAAAAAAATCATATAAATTTTCATGA
TTCTCAACAACTTCGATCGATTGATTTAGATGTGTATTACTATTATTCAAGATTTCTGATATCTTTATCCCTAACGAAAAACACATGCAACAACCTTCCC
AATATATTTGAGCAAATAATCAATGCTAGGTGGGCTTTGAGTAGAACTTATCCACAATATGTTTTGACAGTTTAAGAGTATCTTACAGCCTGTATGTCCA
TTATCTACAGAGACATAATAAAGTGGAGCACATTTTTTTGCCCTGTAGGTATATCAGAGGGATGGACCAATTAGTTTTTTAAACATACTGTTAATGCCAT
GTCAGCTGAGAATTATCATCCACATATCGAAGGGCCTGATATACCATCGTTACAGAAATGACTTACATATATTCTTACCATTACACGAATGCCCGGATTT
GCTGCCATGAATTGCAGCTCTATCAAACACAAATTTGCTATCAGCAGTCGGCAAGGTATTGAACAGCCCAGAAAACTCTAGCAGTGAGTACCTGAACTCA
CAAAACCAAAGATTACTGAAAAACATATATAGCATATGTGCTTTGCCTGTGATAGTTTTGATGCTACGGGCACCAAATATTCGAGTTTTTAATCAAAGCA
TGAGTAGTATTATGCTTTGTTAAAAGCATTTATAAATAAAAAGTGAATTTCTAAACATGAGAAACGATCAACGTAACGTTTAAGTAAGGGGAAACACACA
ATGCAACCCAACTATACAGGAGCATTACTGGTTTACTTAAACCATCGCCGCACTAGAGGGTGAAAGGGAATAATACGAGTAAATTCCCAGATAATATATC
TATATATGCAACATTTTACAAGAATTTTTCTATGGAGGTGGTAAGTGTTGATTTAGGAACTGCACCAATGATTGCATCTTTCTTCTCTCCATTCTTGAAT
ATCATCACGGTTGGGATGCTTCGGATTCCAAATTCGGTTGCAATGGAAGGACTTTCATCTGTGTTCAGCTTTAAGCATGTAAGCTTGCCAACATATTCCT
TCGCTAGTTCATCAATGACGGGGTGGATCATTCGGCATGGACCACACCACGGAGCCCAAAATTCAACCAGTACAGGTACAGTAGACTCAACTACAAGTGT
CTTCCATGTTTTATCACTAACAGTAGCCACTGCAATTTCCAAGAACTGTGTTAAACCAGCAAATGATGCTAACTATAATGATTAATGAGAAATCTACAAC
AGCAATTCTCTCCACAATTAACTAGACAGGAAAAGGTTGTGTATCCAATTCTTTAAAAAAACTAATCATATTATGGAAGCTAAAGAGAAAAGTTGACAAC
AGAACTTCCCATTTTCCCAACTAACCATGGCTAATATAAGTACATAACTGGTGCAACATCTACATCTCACACAAAAGGTCTTAAGCCATGGTGAAACATG
AAGATTCCGCAAGGCAAAGGAAGCACTGATATGACCAACAATGTTTAGGCAGTAGCTTCACATGCTAGCAACCAATATTCAATGAATTCTTAGCAGGTAA
GTGAAACTATGAAAGCAACAAAGCTTTGAGGGTATTATACCATAGCGGCCCAATGACATCTTTTACACTTTATTGAGCTTATTGTCTTGACAAACTAGTT
CGCTTATATAAATTGTTAAAGAGCACAGACCAACATAGTTCTTTTTATAGCTGAGAAATGCCCAAGAGTCAGTGGCGCATGGTTCAAAATTTCGTGGATA
TAAACCCACCCACTGCCCTTCTCCACTTAAATACCATGCATACAATGCTATTAACTGCAGTAGGATGCAAACCATTACATGCACCTAACATACTATTTCC
AATAGAAAAGGAAACAAAGTAAACAAGCAAACAAGAGGAACTATGGAAGAGCTTAGCGCAGGGAACATTACAAGGGTCTTGTGGGAGATGTCAGGTGGTT
GTGAAAGGTGAAGGAGCACATGAACGATGTTCCCAATATTTTTACACGAAGGATGTTTCAAATGTTTTGCATTCTCTTGTTTCCTTTCTTCTCTTTCGCA
GAGTATCACAACATTATTCTTGTCTCTAAGACTCCTAAAGGACATCTAACACAAGTAATCGACATATTACTAGTGGTTTTCCGGGACAAATTCCAGTTAT
ACTGACCTGAGAGCTAATCCAAAGTTATTAGCTATGTGCACAAAACAACAAACGGCAACTTTGAGGCTCTTACTTGCCTTCGATGTATCAGGATTTAAAC
ACGAGGGAAGAGAAAACACAAAACTTGAGCATTTTCTTCCCTCTCTTTCTACGGAAAGTATCCAAATGTTCAACATTTCAACTGAGAGAGTAATAAATGA
CAAACACCAGCTCACTATTCAAGGAAAATATAAAGCATACTCTGTTCTCAAATCTACCAACTCTCGCACACTACATAAATCTAATTCAATTAATAAGGAA
ATTAGGCAAGCAAAGTAACCAACACCAAAATACCGATACTCACAAGCAGAATACAAGGAAAGACACACATATTGTTCACAGATTTCATTTCCCATTCCAA
GTAAATATACCTTGAATGCGAAATAACTCAAGTTATTACTATTACTATGAGAACTTATTATCTATTTAGAACAGATGAAACTAAAAATTAACTCATCTTA
ATAGTAGAAACTTCCACCGTTAACACAATTCAATTTCCTGGAACTGAGTTTTCAGCTAAGGCATAAAGGAGCATGGAGAATTTCAATATAAAGAGTAGTA
ACAAATACTTTCAGTTACAAAATACCTTCCACGGCGGTATCCTGAGCTTCGCAAACGACTCGTCCTCCTCGGGGAATGATTTTAGAGCATGAGCTAGTGG
ATACAGATGAGCGAATTGGCTGGATCTTAAGGCCGCTGAATTGAGAGAAGCTAACAGAGAAACGAGGACCGGAGAAGGAATAACCGGCGACCTGAGCAAG
CGATGACGACGGCAGCGCCGATGCGCGTGGGACTGTAATGGTTTCCAACACAGCAGCCATGGAAAGAGAAGAGAGAGATAGAGAGTGTGTGTGGATAGTG
GGAGAGATGGGGAGGAGAGCGAGAGCGAGTGGATATTTACACAGAGATAGTGAGGTCTGTGGCTGAGGCGAAAATAGTTTGGTTATTGAGTTTTTTTTTT
TAAAAAAAAGGTTAGCTAATGTAAGATATATCTTAATTAATTACTCTCTTCGTTTCATAGTTTAATTTATAACGAAATTTTAAAAAAAATTAATTTTGAG
ATTTTAATTTAAAATTTTATTAAATGTATTAAAATACTCCTTAATCTTGTGGTCATAAATATGCTACGTAAAAAGTTAAAATTAAAATGTAAAGAGATCA
TTTTTTTTTATAAAAATTAAAAAAAAATACAAAAAGAATATGAATTATGTATTTTATATTAAAATCTTCAACTTAAAAACGAATTATGTATGACTATAAT
AAAAAATTTTCATATGATATATATTCCAAATTAACTACGTTCCACTGTATCGGAGTTTGGTAATCGAGTTGAGTGGAGTGGAGCGGATGGATGAGGAGTT
TTGTGTCTCTATCATCCACGTGCTCTCAGTAATGTTGTTATACATTTTTATTTGATTTGGGCCATTAGATACTTGGGCTGATTACCGTACTCCTAACAGG
CCCATTTTAAAGACATTCTTTGAGAAAATAGCCTAATTTGTCATGTACTATTTGATAATTGGACAATTTTATTCTCTGATAATGATTCTCTTAGGATAAT
CATATCCCTTAATAGGAAATAAAAAGTCTCTTTTTTATATTTCAACTTCATGATTTTCTGTTATAGTTAAAAGTTATGGAGTAAATTTTAACTTCTATTT
TATGGCAAAAGTATGAATGAACTAAAAGTCCAGATGAAAAAGTTGAAGCGTGATAGTAAGTATCTCTTTTATTTCTAATCAAATATTTCAAATTCAAATC
TTAAAAATAAAATCAAGTTTCACTTTATTCCAAAGCAAAATTAGTCAGACTTTAAAATAAATATTATTCGGAGGAAACAAAACGAAAAGAAAGTGTTATT
GGAGTTGGTAGAAAAGGAGACAAAAAGTGTGAATAATCCATTGGGAAGCACAACCTTTAGGAATCAATCTCCCATACCATCCTCGTGTAGTCAGAGTACT
ATTAGCACAAAGACTTAGAACTTAGAACCTCCCACCCAACATGCCCATTATTATTCTCCCTAATATAAGTATATCACCATTTCCACACCTATAACAACGG
CACCAATTAATACTTTTTATGCGATATTAAATTTTGTATAAGTAATATCGTATTAGGTACGAAAAAAATTAGTATATTCAGGTAGTAGGTCAAATGGAAG
TTCAAACGTACCGGCACTGGCCCTGTGGTTGGGTCTGTCTGTTTTCTCTGAATGGTCAAAAGTTTCAACTCACGTTTTTATGAATAGAGACAAATTCAGC
CCAAATCAATATTGGAAACAGTAGCTTAGCAGCAATAACTCCTGGAAAATGCCCATGCATTCATCTTCTTCGTCTCTTTCACGGCGCCAGAAGCCTAATA
ACAACAATGAAAATGGCATTAGCAAGTCTATGTCGGCAGAAGAAGAAGTGAAGCTTGCAGCTCTTGCTATCAGCTTTAACATACGGCTCAGATCAGCAGA
TATGCCTTTCGCCATGCAAGCACATGCCCTTCGTTACGCCAGAACTCTTCTCCTCCAACCTGTGAATCACCGTCCTAATCCCTCCCTCCTCGCTCGCTCC
CTAAAAAAGGTGAGTGTGATTCTTCCAATCTAGTTTTCAAATTTGAGTTCGAATTTGAAAATTTGACGCCGGTGAAACTTTTGTGGATTTTTAGGAGTTT
GATTCGATGTATGGACCGGCATGGCACTGTGTGGTAGGGAAGAGTTTTGGATCGTTCGTGACTCATTCACCTGGTGGATTTGTGTATTTTTCACTTGAAT
CGTTCTCGTTTCTTCTGTTCAAGACGGAGGTTCAGTTGATCACTGAAGCAGTAGTACCAACACCTGCTGCCCGCTGATTGGTTGCTGCAGCTGGCGGAGA
CGGTTGTTGCTTGGTTGACGCCTGTCGGTGGTTAGTTTCCCAATCTCCATTCTGAAACAGATATAGTTGCGAACTTGTTTTGGAGGTAATTTCACAAGCT
AATTATGATTGTACATAATACTATTGATATTTCTCTAAGAAAAAAAATACATGTAGCACACTGTTTCCTATTTCTAAGTTCTTTCATCTTCGAATACATA
ATTCAGCAATATCAATGGTGCACTAATTCCAATTGAGATGGTTCCATAAAGCTCAACGTCGCTCTAGACAACACTAAGTCATCTAATAGAATCTTACTCT
GCTTTAAGACAAGTTTCTTTCTCTCCCACATGAACTGCTCTACCTTGTCTACATCTTCCGGGGTGTCAACACCATGAGTCTCATGGTCAACTTTTTATCA
CCTGAATACAGGACGAGATCCATCCAAAATAATAAAAACACTGATAAATTAACCGGAACGAGTAAACGGTTAAGTCAAGCTTGCAGATTTAGTACCTTCA
TCTATTATCTCAGGTTCAATAAGAGGTTCATCTCCTTGTATGTTAACAACAATGTTACATTTCTTCCCAAGCTTTTGAAATGCTTCATTACAACGCTCAG
TTCCTCCAATTTAATAACTGAGCATTAGCAATCTCACCGACTGAAATTCTCATAAGTAGCAAAATTTAGGATTAAGAAAACGACGGATGTTCTGTTTACC
ATTTCTACATGATTCAGAGCTCATTATTACTTCAGCACCAAAACCTTGACAGCACTCTAGCTATCTTTTCATCATCTGTCTGAAATTCTCTCTTCCTTTT
CTATTTTCTTCCAATAGTTCGACCTATCCATAAGTAGCAAAATTTAGGACTAAGAAAATGACGGATGTTCTGTTTACCATTTCTACATGATTCAGAGCTC
ATTTTTACTTCAGCACCAAACCTTGACAGCACTCACATATCAGCATTTGTGATTACTACCACCAACTATTGCTACTCTTTTCTTTCCTATTTTTCTTTGT
CGAAGGTTGGGGTTGGGGTTACGAGAAGTAGTCAAGTTATGTGAAATGGAGACGTACCAACATGATCCAATGTAGCAGCAAGTTTAGCCTGTTCCCATGC
TCTCTGCAATAATTCCGATGACCCAGCTCTGAAACCTGACGGATTGGACAAGGTACGCACGAGAACTGAGAACGGCGGCCATTGCAGCTCCTACAGCTAG
ACCATTTAGGATTTATGATTTTAGGATTTATGATTTTGAAGAGCCAGACGATGATGAATGGAGAGTTGAAAAAATTATGGCAGATCTAGTTTTGCTAGCT
CCATGTTCAATTGAATAGGAGGTGTTACAACAAATAGGAGTAGATATTGTATTTAAATGGCTATAAAGGTCTTATTAAATGTGAAATGAATTACTATTAA
TTATAAATTAAGTATCACATAAATTATAAATTAGAACCGATACAAATGATTGATAGAATAGATAACTCTGTATCCAAGACTGCTCAAACCTAAAACCTCT
TTAAAAGTTAGTAAATTAAAATGTGCTCTCTTATCTGTATTGTTACATCTATAATCTTAATTTGGCACAGATTTAGAGAGTAAAAATTATAAGAAATGTA
AAAATGTGATGTTAAATTTATTTGCATGGAATATTGAAACTAAAAAGTAAAGCAAATAATGCAAATTGAAAATGTAACATTTGGAAAAGAGAACGAACCA
ATTACTTTGATCAGCAAAGCAAAAATACACTGATACTATTAGCCTATAGCAAAAGAAAAAAGTGCAAATCGGACTTGGTCCAAATTTCAAGCTGTATAAG
CGCCGCCGCCACGGGAACCACCACTACGGCCGCCGCCACGACGGCCATAGTCATCGTCATCCTCATCAGAATCATCATAGCTTCCATACACATCATCAAA
TCCCTTCGATTCATCATCATCAGAATCGTCAAAATCATCTTCATCATCAGAATCGTCTTCGACATCTTCTTCCAGATTAGGACGTCTCATGCTACTGGTC
GATCGGCTTCCACGAAGCTCCATCAAAGACAAATCAAAAACAGGCAAACCGGAGCCGATACCAATCGGGAAGTTCCAATTCAGAAGAAATTCATCCGCAT
TTGACACACTCAACTTTTTACTATCAGAGAAATGCCCAGTCAGAATCGACTTTGGTTGAAATTGAGGGGAAATGATAGATGAGCCTACAGAGGCGGCGGC
GGTGGTAGCTCCGGGGCGGAGGAGCTGACGGTGAATGATATTTTGGAGTGAAGTTTTGTTGGTTAAGCTTTGAAACCTAGATACAGCAGCCATGGTTGCT
AAAGCTGTTTAGCTTCACTGAAAACGAAAGGGTTTTATAAGGGTTTAAGAGCTCTAGGGTTTTGGAGGGTTCTAGAGATTTATTAAAAAAGAAGGAATAG
TAGACTTATAAAATAATTTTAAGCTGCCGGCGAATATATAATTTTAATATATATTTACATATCAAATATAATAAATTCAATGTTTTAAGAAACGACTATA
GCTAATAACAAAGATAAATATAACTAACACACAAAATTGAACAAATATTCATAGGACAAATATGAGAGATAATAAGAGATACAAGTAATACAGTAAAAGC
CAAATACTGTTATACAACATGAAAGATATAAAAACGAAAGCAATTTGTTTCTTAAAAAAAACTATGCCCTGTTTATTCTGAATATGTAAAAACACTGTTT
TTGTATATTTGATCAGTAAGAAAATAGCTAACAAAATTTTCGTAATGATAACATGTATTGGACATTCTACATAAGTATATTAGCTTTCTTCTTTTTTTAG
AGAATTAGTTCTGTAACCAGTTTCAGACGTTGAAGCCTTCAGCTCGAAGGCATTTAAGATGAGCTTCGATCCATTTCTCACAAGCTGATTCACCGTGTTC
AACAATGCATTCATCTCTCACCTTTTTAGTCTCTGGACAAGCACAGCAGATCTTCTTCTTTGGCTTTGAATCTGCCGGGACTGTAGCGGGGGCTAACTTT
TCATCTTTTGGAAGTTGTGACGAAGATGTGGTTGTTGAAGTGTTCTCTTTTGATACTCCATCCCCCAGTTGCGATGAAGCACCACCCATTCTCAAAGAAG
GCTGCAAAGAGTTGGGAAACAAAAGATCGATGATAGCTATCAGATTAGCATTATAATCAGCCAACAGAAGGGCAAAAGATATTCATACACCAAATCGTGT
TAATAGAACCAGCCTTCCGAAAGACAAAAACTACAACAAAGGTAACTATCTTCTTTTTTTGATATAAGTAATGAAGAATATTTCAGATGGTAAACTTGTA
CTGAGGCAACGAAAAGAGATTACAGATTATGCAACTCCTTTGTCGTGCCTAACAATGCATGTACGTTATTTACAAGAGACAAGTTGCACCAAGAAAGCTA
GTAAAACAACACATCTCTGTTTAAGGCCAATTATCTACGTCCTTAGCCTCGAAAAATTGTACTGTTCCTTTCCAGCCAACAGTCCACCAGATGACATGTG
GTATAACGTTCCAAAGTTTCAATGGACTTCTTGTTCAGACTCTTTCTTTTCCAGCAATGCAGTAAACAACGGTCACTATCTAAAGTAGTGAAACCTACAA
ACTATAACCTTGTCAATCAGATATGCTCCCCTACCAAAAATGTTACCCACCAATTATCATTTCAAATTAAACTTCCCATGGTAACACTTTAAAATGATCA
AACTTCTAATGACGCACGATGAATTGAGACAGAAAAAGTGCTATGAAATCCAATTCAAATACCTAACCACCACACCACCCATAAGAAGAGAACATGCAAG
AGAGGAGAATACAAAGCCATTACAAGAATTTTACAATCTTCTGCAAATTTTCTTCTCTTTTTACTTCTTTCAAAGGGAACGCTCTAGAATCTACAGTACT
TTTGCCGCATCTTACTGCATTCCAGTCATCAGAAAAACACATCCTATGTTACCTACACCAGTAGTAATAAATCTTAGTCTTTAGTATTCTTAAGTATCAC
CTCTTCTTCGTATTTTCTCCTTATTCAAGAGCTATTCCAGCTACTATAAGTAATGAAACTTTCTGCGTATCAACACACGCTCTAAAAGTTCCAAGCAATT
TCAATAAACAAGGCTCTCATATGACATGATTTCTTCTTTCTACCCCTCCTTATTTGGCACCGTTTCCCAGTTAACATCTTTAAAACAAAAACACTTAGAC
ACTTATCTATGTCTGCATATTAATATCTTCTAATCCTTCTACTCTCCTCTTTCCGTTACTTTGTGTAAATCACAGCAAACAAAAGTAGGGCTAATGCAAA
TTCCTTCAACAATATAAGAGACCTTCCGTTGGATACGCTACTTCTTATCACAAGATGTACTGTCCATCCAGGTCTGCATGATGCAGTCTAGATGCCTTCA
TCAAGTGAAATCCTAATAAACACAAATAGTACGCGTCCTATCTAAAGAACTTTACACTTCTGACAAGTGACAATACAACTACACACCGAGGCGGATCTAT
AGGATGAACCTCTCGACACAAAAATCACATTTAAACAAAAAAATTATGTATATATAGAGATTTTGAACCTCCTAAACATAAGATTAGAAGTTGACTTAGT
AACTGAGAGCGTTCAAAATTCACCTTGAGGTTCCTAGTTAAAAATATCAAGCACTACATTTTTTCAATTTTTCGAATCCCTCGCTAAAGATCCTGGATCC
GCCACAGACTACACAAACACAAACACAAACTGACACTGACAATACAGAAATATACAGCAATTGACACACAGTACATCATATAATAAGTATAAAAATCAGT
AAGAAGATTTCATTACAGTAATCCTTTAACTTGTGAAGCTCAAATAAGCATCTCAAAAATTGTCTCTAACCCTAATATCCAAAGCGACGATGCAAATAAA
AAAAATAATCAAGGATTTAAGCGTGTTACAAGAGATAATTGATTGAAAAACACCATGTAAGAGCAGTTGTAATCGGCAAAATAAACTGAAAATTCATAAT
TTTTACGTACCTTTAAGTTCGTTTTTTTCTTCTTCTTCTTCTTCTCGGAGAAGAGAGGGTTTATGAAAAGGTTTATGTGGACAAATTCCTTGCTACGTTT
TACATCAATGGCTGCATTTATTGGCCTCGAGTTTATATGAAATGACAAAACAGCCCCTAAGTTTCCAAATAGACACCCCCACCCCTACTCTTTGTGTTAT
TACACAATTTATGTTCGCGTTGAAACGTGGTGTGTAAATTGCGTTTCGTGCTTGTACATCTTACATTCTCGGATGTGGTTTTATAAATTACGATTTTTTA
AATAAGTCTAGAATGTGACTTGTGAGTTACGCTAATGTAATTTGAATTTTACATTTTACTTCTCGGTGCCCACCCCATTAAAAGAACTAAGAAATTAATT
GAGAATAAAACTTATCTTTTACTTTTATCTTAGTCTGATTGTTTAGAGTGTGATTGCCGAGTCACTAAACGAAGTCCTCTGTTTCTTCCGAAGGTATCTA
CCAGCAATGAGAAAGAGATAACTAAGTACTAAATGAAGTCCTCTTTTTCTATCGGTGGACCAACAATGAGACATAGATGACTAAGTGACATGGAATATGA
CAACGACAACAACATATTGTAGAGGTGGAACCAACGACCCACTATTACTAACCTATCTATATTTACATGCCGAGCGATAGTCAAACGGGAGTAGTGTGAA
TGTGAGACACCAGCGGAATGATCGGCCAGAGAAAGGCTAGGGCTGCTTCCTTCCCATCACGTCCCTTTGAGTGTATAAGAGATATAAAGCGACTGTAGAG
AAAAAAATTTGTGTCAAAATGAAGAAAAAAATGTGAATATTAACATTTTCTTTATGTAAATTTGTCTCGCCTTGGTTATATAGTTGTTTGTACTTCAATG
GATTCAAAGTATATATTAACACATACATTTGTTACATTTATATAAGGTCATTTATAGTCATGAAAGTCGAAATAGTAGAAAATTTGTTTGACCAAAGTGT
GGCGCATATATTACTAACTGTTTTTTTAATTTATAGAATATTAATTAAATCATATAATTTATTTATTTATATTATTTAGTGATAGTATTTAGGGAAGTTT
TAAATGACTTATTCTACTGGTTATTAAAAAAGCATGTGTTTCCATCATAGCAAACTTTTTCAAGAACAAGTTGCGGACACTACCACATATTCTTTTCTCC
ATTTGGTGGTCTAAGTTTACAACATTACTGGAATTTCCGTGCAAATTCAAATTTAATCAAGCTTCAGATATCAAGTTTTAATATAGATATCAAATATCGA
GTAAAAACCATAAAGAAAAAAGTTTACAACATTACTATCCTGCACTTGATCATCATGGCTAGAGGTAACACTAAATTCTGCTACAAAGTTAGTTATTTGT
ATGCATATGTTTCCGTCTATAAATTCTAATAGCAGTGAAAACGAGGGTTCAGTAGACAAAGTCAGAAAAAGGGCAGTGAAGTCTACAAAACAAGAAATGA
GCAACCTATTATTTAAAAATTAGTGATATCTACAATGTTAATTGAATTGATATTCACAACCTCAAAGGCAAAAACTAATTTCTTTCTTCTCACATCGGAC
AAGTACCTATCAAAATTGTCCTAACCTTTTTGTTCAATCAATAGTGAGGAACAAAAACAGGTTTGTATAAATAGATTCTTCTCTTTTTGCTTCCCAAAAA
AATGAAAGGCAAGAATATCAAAATGTAGTACTGCTTCCCTTACTCCCAGACCCAACTTTACGATGTCGCCTTGAGTTAGACTTCCTTTCACCTTTTCCGC
GCTTTGGAGGTCTCCTTACTGGAGGTTTACTAGAAGAACTATCACGAACCAAAGCCGGTGGAGGATGTGCACGACTTCTCACTACTGTCATGTGAGCCCT
TTGCTCCAGTAAATCTCTGTGGTATGCCTGCATAGATTTGGTATATGCTCTTTTACTATGCGAAAGTATTGTATGTACTGAACAGCAAAAATTAAGGCAA
GTAACTAAGCTAAACCGTAAAACATTGTATCCAACGTAAGGGGGGATTTTCCCTTGTGGATGGATACCTGTATCACGAAATTTCGCCTCTCACAATCCAA
AAACATGTTGACGTTCCAGCTAACTTTTGCCATCAATTTGTCCCTGACAGTGGAAAAGCTCAGTTGGTCCCTAGAGGTAAAACGGTCAACTTCATTGAAC
CACAGACAGGTGAACAGATTTGTGATGGGAATATGCTCCTTTATAATAACACATCCTTCGGGAACATCTGCAGAATGTTTAATGAGCTAAGTAAATTTTG
AGAGCGAGTGGTCAAATGAAGACAAGGTGTAAGTGTGGACTCACCACTGGTAATAGGAAGCTT