BAC Sequence – LE_HBa0128E05

>C06HBa0128E05.1
ATTTGATATGATCACACTTCCATCAAATTTATAAAAAATGTTGTGATTTATACAAATGATGTCTGTAATTTATACAATCAAATGTTGCTTATGATTTTAT
ACAAATCTGATGCTCCATAGTGAACATAATTTGCTATGGAGCGCAAATCACCAAACTGTAGTTATAAAACGCTAATTTGATTTTTATGTGTTGCTAAATT
CAAAGTTTACTCATATTAATAAGGGATAATGAGGAACTAATTAAGTGATGAATGATATGTCTTTTATTCTTCTTTTATTTTTCAAATTGAATAAACTTGT
AAAAATCAACATCTATTTTAAATATAGTCGACAAGTAAAAGTAAACAAAGTACTATCAACTCCTAATTAATTCAAACACGCCAAAACACTTTATTTGTTA
CATTTTTGTTTACACACCCTTAAAAAACTACGTGATTTGATTATAATGTCTTTATTTATTATTTTTTAATTATTTAAAATGTTAATCTATCGAGTATCTT
TTGGAAACAATTTTTTTATCTTTATGAAATAATAGTAAAGTCTGCATTTATAACTCTATCCTCCTACTCCCAAAACGTCACTAAGTGAGATTTACTAGGT
ATATACATTATTGTTGTATTTTAAATGTTAGAATTCGTATAAGTAATATTTATATAACGCTTACTAATAAACACATATTGTAAGTGATAAAAACTTTTGA
AAATATGATTTTGAAAGTAATATAGATATATAGTTATTTACGTAGTTATAAATTGGCAAATTAAAAATAAAACTAAAAGTGTTTTTACATATAAAATATA
ATAATATACTCACTATTTTATATGGGACAAATATTATATAAATTAATACATATGAAATATTAACTTTTTTTGAAAGAAATGTAACGCTATGGGTAGAGAT
AAAGTATACATTTGCCATCGTCAATTCACATTTAAGTTATAATTAAAGTTAATATAACTTACAAAAATAACTTTTGAGGTATGAATTTCAAAAAAAATTT
AAAAATTCCGATATACACATATGAAGTTTGAATTGTATATCCGTTTTAAATATCTAAAATTTGGTTCGTATTCTATGAATTTTGTTAATGTGATGTGTTT
ACCCTTATGGCTCTTCGTTGCTTTTAAAGATTAACAATTTGCTTTCGGATTATTGTATACCCTCCAGCTCATCACGATGTTTAAATAAAAGTCGTAATTA
GTAAATGGTAATTAATAATCATTTAAGCTTTTTCCAATATAATTAATTGTTTGATATTGTAATATAAATTTAATGACCACTAATCTGAAGTGTACATGTC
TATTGCGTTACTTTGGATTTGGTCAATTCTTATTCGTTAGCAAGTCCGTCCTAGCGAAGTAAAGTCTCTATACCTATCGCTTGATTAATCTGATCAGACT
CTTACTCTTTCCTACTTTTAACAAAAGAATAAGAACTCAATTCATCCTTAGTAGTATTCTATAATATCCTATATATCTCTTTATCTTGGCTAACTCTTTC
ATAAAAATGTCTTTATTTTTATTTATAAGAAATGACTAATAGCTTGTTTGGTTAAGTTTTTTGAGTGATTAAAAATATTTATTTAAAAAGAATAGCGTTT
TTGGTTAAGCTTTTGAAAGAAAATAAGTGGTCGGGTAGAGTAGCAAAGCTAAAAACAAATATTCTTTCTAACAAAAAATACTTTTAAGTTTACAAGTAAT
TTTAGAAAGCTTGATCAAACCGCTCAAACGTTGATTGTTATCCAAAAGTATTTTTAAATTATCGATCAAACACAAATGGCTTCTCACTAATTTTATCTTT
TTTTTAAAAAAACATTTTAAAAAGTAGGTTAATTTTAGAAGTTTATTAAAACAAGTTATAAGAAATAAATAAAAATTTATTATATTTTAAAAAGAAAAAA
CTTATTCGCTAATTCGCGTATCATGATATCAATCCCCTATCACCAAATCAATCACTCCTTGTCTACTCCACCCGCCACCGCGATCCCAAGGCCCCAACGG
TCTTGCTACCTCACCGTATTTTCTATATTATATATAAATATTTTTAAGAATATGTATTTTTATTTATTTACTAAACACTAAAAAATAATAGAATAATCAC
TAATTTTACAAAACTTATTTCTTCATATTTACAAATTTTAAATTTTTCATGTCGCTCTTATTTTATTTTGTGAGATTCAATGTATTAGTAGAGTCTTAAA
TCTTAATTAATCTGCATTCAAGCAAATGGACCAATATAGGGCCGTTTGGATCAGCTTAATAAAAACAGCTTTAAAAAAGTACTTTTGAAAGTGCTGAAAC
TTATTTTTAAAATAAGCAGTTATGCGTTTGGATAAAAGTGCTGAAGTTGTTATGCCAAAGGAAAAATGGAAGAAAGAGATGTTAGGGTATATGGGCAATT
TGGAGATTGTATAAAAATATTATGGGCAAAAAGATAAAAATGTGGTCAATTTAAAACAACCTATAAGCTAAAAAAAAAAAAGCACCCCTACCCAGCTTTG
AACTTTTGACTTAAAATAAGTTTTTTTTAACTTAAAATAAGTTATTTTGAATAATACCAAACAGTTAAATAAGTCAAAAATCAGTTTTTAAGTCAGTTTG
ACCAGCTTTTAAGCTGAGCCAAACAGGCTCATAGTCTTTCAGTATTAGTACAATAAAGCTGTAATTAGAGAACATTTCAAAGCATGGATTATAAAATAAA
ATCTCAGTCATTAATTAAAAATAATCCCACTTAAGTATAGTTGGTGTTTAAATTAATTAGATGCCAACAAAAACCGTTGACCTTAATTATAAATATGTAC
CACCTCTCAACTTAAATAGCCAAGAATCTAGCAAAAAGTCTTGGTGCTGTGATTTTTTTTAATTATAATTAATTCCCTGTTAATCAATTATACATGGCTG
CCACAATTCATGACTTAATTTATTAATTTGTTTCTCTATTATCTTAATTTGTTTGTATGACTGGCGAGAAACCAAGTCCTATATTGTACTATAAATTTAT
TTAGTTTTATTATTATTAGTTCTTAGATCATGTTTGAAGAATTAAGAAAAGCAAATTGATAAAATATCTGCATGATGGAACGGATGACATGAAGGCTACA
ATGTGTCAAAATAATACAATAATAATAAAGAAAAAAAATTCATTGACCTAATTAGCATTTTAATTATTACTCTAATAAAAATTGAGGTATTGTTGCTTAC
ATGTTTGGTATAACAACTGCCCTCCCCCCCCCCCCCCCCCCCACACACACAAAATCCAAATTGAGATAATAAAAAAAAATTGTCAGACACCAAAAAGAAA
AATTAAATTAAATTCATTTAGTTATGATCCACAATGTCTTTCATGAGTTAAATTTTTTATATATGGATAATAAATAAAATTTTAATACACAATCAAATCA
TTAGGTTATAAGTAATCATCTTGGATAAATTTGTAATTTAGAGAGGGAAAATTAGTGACTACAGTTTTGATGCTGAATTATTCGAAATAGAATAATTTAA
TTGTAGATTTAATTATTTTTTAATCAAAAAATTCTATCGCTAGCAAAATAGCTCAACAATGGCCTTCCGACTAAATGTTATTTGTATTTGAATGAAAAGG
GCTGATTTTGTCCTTCGTCTACACGTCAAAATGATATCATCCCAAACAAATTGGAGTCAATGAAATTAATTAGATCTCTAGTAATTTAATCAAGTTTAGT
ATTACTTAATAGTTATCTCGGTTAAATTTACCATATAAATTATGGGTTGAAGTCCATGAAAGTCAAAACTTTTGATGAATATAATTTCTGGTTATTATGA
TCCACAAAATATATAAAAGCTACAAGAAAGGATATGAATGTGGATGGGAGGTTCTTCGATATCAAGAGTGTGTTAGGGAGATCAGTGAAGATGGACTGAA
TCTATGTATATTTTTTATTTTTATTTTTTTGGATAGGATTCTCATTATTATGATTATTTATTTGTTTAATTTGAAGCTACCTCTCCAAATGATTTTTAAT
TGGGGTCATTTGGAATCCTTAATGTAATTATATGATTTAAGGAATTAAAGGAATAACTCATTAAAAGCAAGCTTAGCTAAGCTTATGGAAAACTAAAAGT
AATGTTTATTTCTTTTTAAAGAAAATCTTATTTTAACTTTGCTTTCCGCAACTTAAATTGTTTGGTCTTCCTATTCGCTTTGGATTGAGGTGTTTAACAA
ATTTTTTGAGGAACACTTTTGATATCTTGAGCAATCATAAATTGTTGTTCCAATATTAAAAAAAATATTTTTCAAACAAGCTAGCAAAAAATTCAAACGA
TTAGTATCATAATATAAGAGATTTTGAAAATTTAGTCAAATAAACTATATAAAGTCTCTTTTAATAACATCCTCCTCAATCCACACATCACCTCGAGGCA
TATTTTTTTGACGTGCTAGTAGAGTTAAGTTCTTTGTTTTGACTTTTGAGAGGAAATGAATAGTTGAATACAATGTATATAAATTGGAAAAACAATAAAA
TACAATGTATTTAAATGGAAAATAACCACATCGACGAAGAGCCTGTAGCAAGTTGCACTTAATTAGAGAAGATGTGCCTATCTAATTTAATATGAAAATT
TTAAGGAGGATTTAATTTTAATTTTTGTAAAAAGGCTCTAAGCCATTTTTAGATTTTTAAAAGTTAAATCCTTTATAATATCTGTTAGATTAGCAAATAT
GAAAAGCACGCAAAAATCAATATTACGCTAAACAAATGAATTTTAGATCAATTTTTTTTGAGTTTTAACATAGGTCATATAAAGAGATTATCTATCTCAT
ATCGGTATAAGTGTAATTTGTGAGACTTTTTTAACATCTTCTTATATTTAGAATTAAATGTCTGGAGCGTATAACAATTTTAATATAAGTCATGTTCAAT
ATCATGAATCAAAGATTTTAAGGGTCTTTTTTCGACTCCAATCTAATAACTAGCTTAAAATGTGAGAATTGTTCAATTCATATAAAAAGTCCACTCAATA
TTTCATAATTAATCGGTGTGAGGCTTTTTCAACCGTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATGATGATAATCCCTGAACAGTTCTGGAAAATTTCAATGGAGAGTAGTGATTTTTTACTAG
TATACCCTTACATATTTGAGGAATAAATATATATTCTTTCATCCCTATCCATTCGTTTCATTATATATATATATATGATAAAAAATTTTAAATTAGTTGA
AAAGAAACATATTTTTGTCCTAATTTAGAAACCATTTAACTTAATGTCATTCTTAGCACACAAAATGTAATACATGTCCAAAATTTACATGTTTCAAAAA
CATTACAAACGTTACCTATTTAATACGGTAAGTTTTAAATGTCTTCACTTTCTTTCTTAAAATTCGTAGGACGATCAGCTAGCATCAGCCAAAGATGAAA
TGCGAGAAGTAATGGAAGAAAATCAGAGGCTTCGAATGCACTTAGATCGAATGATGAAGGAATATCGAAATCTCCAGAACCAATTTCACGATATCGTTCA
AAAAGAAACTGATCAAAAATCAAGCAGTACTACTGTCAACACTAGTACAACACATCATGATCATGAATCTGATCAAGAAGCTGATCAACTTGTGTCCCTC
AGCTTAGGAAGAACTACTAGCGATATGAAGAAAGATGATTTATCTAAAATCTTAAAGAAAGATAAAGTTCATGACGATGAAGGAGTTAGTAATAATAATA
AAAGCCTTGATTTAGGATTGGATTGCAAGTTCGAAACAACGCCAACTGAATGTTCACCAGTGAATTATAGTCCGGAGAATAGCTTAGATGATATTCAAGC
TAATAAGGATGAAAATGAAGAGACGTCGAATAAAAATCTCAAGACGATGAGAAATAATGGAGATGGAGATGATGTTTCGCAACAAAACCCTACTAAAAGA
GCTAGGGTTTCTGTTAGAGTCAGATGTGATGCCCCTACGGTAAGGATTTTTCAATTTTTTTGTATACATGCATGCATATTGTGATATTAATTATAATTAA
GTAAAGAATGCAATCTAATCTATGTATTTAATTATGTTAATAATGATTTTTCTTTAATTTCAAATTTTTTTTGGTAATATTATTGATCAGATGAATGATG
GATGCCAATGGAGAAAATATGGTCAAAAAATAGCAAAAGGAAATCCATGCCCTAGAGCTTACTATCGTTGCACCGTAGCACCAAATTGCCCAGTTAGAAA
GCAGGTAATATATAGAGGGATGATTGAAATTCCTTCATTCTTAATTAGATATGTCTCGAGTTTGAATACAATGCATGAATCCGAAGTCAATCAAGCTCTA
GAACACCAAATAAAAAGTTATGTTCTATAGTAGCTTATTTAATCCTCATAGATTAATTTAACTTATTTATTAAAAGTGTAAAATCTTATTCCACTTTTTA
TAGTAATTTAAGTTAATTAGTTTTGTTTTATTCATCATAGTTTATCTCGATACAATTTTTTTATAAAAATAATAGAAGATTTTTAATATTTGTGATCTCA
AATACACTTTTATATTTGTGTGATTATAAATTTTTTAAAAGCGTCTTATTAAGAAAATATGCATAAGATGTAATAGTAAAGAAGTAGTATCAAATATAGT
GAAAAGGACTAAAAGTATTACTCATTTTTAGGCGATCTGATAAATTAAATTTTATAATGAATCAATTTATTACTAGTACTAGTACTACATTATCATGGTA
ATGATACAATTGTTGCTTGTTGGTTTTGTAGGTTCAAAGATGTGCCGAAGACATGTCAATATTGATCACCACATATGAAGGAACACACAACCATACCCTT
CCTCTTTCAGCCACCGCAATGGCTTCTACCACCTCAGCGGCCGCTAGCATGCTGTTATCCGGTTCATCTAATTCATCAGACCCAAACCCACAAGTAACTG
CCACCACCACCACTACCCCTACTACCACTACTTCTGCCAATATCAACGGACTCAACTTCTATCTCTCTGATACCTCAAAACATCATAAATCGCCATATTA
CTTTCCTAATTCATCCATCTCAGCATCCGCACCTAATTCCCTCCCTACAATTACACTCGATTTGACTTCCACCTCGTCCTCGTCCCCGTCCTCCTTATCT
CATCTAAACAGAATGACTCAGAATTTTCCTCCTAGATATAATTACAATAACAATAATTCCACCACAAACCTCAATTTTAGCTCAGTACTTGAATCCAATT
CCCTTCCCATTTCTTGGACCAATAATTATCCAAATCAAACCTATAACAAAAATAACCAAAATTTTGGTCCACTTACATTTTCATCAAGATCAAGTCAAGA
TAACATTTTCCAATCATATTTACAGAAAAATACTACACAATCTTCTTTACCACCAGACACAATTGCAGCTGCAACCAAAGCAATAACATCAGACCCAAAT
TTTCATTCCGCATTAGCTGCAGCTCTTACATCGATCATTGGAAATTCTCCAATTGAAAACAAATCCGTCCATAATTTAAATGTTACTGAGCCATTTCCAA
TTTTATCCAGTCTCCCTTCAAGCTCAAATCCGAATAAATGTTCGTCAAGTTTTTTAAATAAACCAACCTCTTCTGCTTCCGCGAATAATAATAATAATAG
TAATAGTAATAGTAATAGTACACAGCAGCCTGGGAATAATAGCATGGTGTTTTTCGGGCAATCTTCTTCTTCGTTACCATTTTCGACGTCTAATAAGGGT
AAATCTACCTCTCCTGGTGATAGTAAGTTTGATTGATTAATTTTTTTTTTCTTCATGTTTTACCTCTGAAATTGAACTTTGTAGTTAGAAGGATTAATCA
TCTGTATAGTCTGTAGATATGCTTTAGTGTCATTAACACAATTGACACTTTGGAATTAGCATTTGTAATTTGTTGTTGTTGATTAACTTGACTATGGTTG
TAAGATTTTTGTACAAAATGTAGATTATTTATTTAGTAGATGGCTTATTTGCTTCTTTTTTTTTTGGTGTTTAATAAAAAAGAAGATAGAATGGGATATT
ACAAACAGTCCTGAATATTTAGCAAAAAAAAAATAGAATAAGAATTGATGTAGAAATTTTCGTTTATATTGAATATGTTATGGTTATTATTACGTTGTTC
AGTTAATCAATGAAACCTATAGCAGCAAATAGTAATGGTACTATTTAGGTTGGTCAATTAACATTTCATCGGAATATTAATCAAACAAATTGATAAACTT
CTGGTATATACTATCTCTAATTTGATACAATATTAAATAATTTTAAAAATGTTTGTGTAAGTGGCTTTCTATGTTGTTTTTTTTTTCGAATCTAATAATT
AGCACAATAATTTTAATTTCTAGCAAAGTGGAATAGTAGATAGTGGGTTGTCCATCGATCAACTATGATTCAATTTCTCCGATAAAATATACAAAATTGG
ACTATAGAATATACATTGACTAACACACATACGAATACGCCATAAATTTCGCTCAAATTATAGATAACTTGCAATTATGTTAGTCTATTTTAGATCTATT
CATTTAAATTTATGTAACTTTCAACTTATTTTAACCCGCTCAAATTCAACCGAACTCACTTATTTAATACCGCTATTTTGTCATTGCAAAATCAGTTGTT
CCTCAACTAGTTAACATCATATCTTTTTCATGTTGGAATATATTCTATTTCTTGTTTTGTTAGGTTAGAATGTCTTACGCGTCATGAGAACTTTTTTTAA
TTTTCTTCAATCATATTTACTATTTGTTGTATTGTTGATGTCAATCTTATGATATTTTTTGTTTGTTTGTTGGGTATTAATTGATTGTGTGACCCACTAC
AAATCTTAAATAAGATTGATATGTGTCCCATTTCACATATAAAGATTTCTAATATTGTCAGTGCTGTAAGCATCAATCTCCACTAATGCCTGAGGGATTT
ATATTGCAATTTATATATGTATATTAATTGTCCTAAATCTACTTTTTTTTTTAAAGAAAATGTATAATCGACGTTTGAAATTAAGTTAGGATTTTTATAA
AAAGCTTAAACGAAGGAAAATAATTTAAAGAGAACACGAAAAAATATGTCCACTCGCTAATTGTATCACATACATAGATTTATGATCGGTGCTATAGTCA
CAATTTTTATGACGGAAACAAAATGTTGAATATTAACATTGCATTATACAAGTAGTTAGTTAGTTATGAAAGTTAGTTATCACATGTTTTAAATGTGTAT
TCTAGATGCTTCTATGTAATCTATAAATACTCTACTAATGCATAAGATCAAGTTAAGCTTTTGCATTTTATAAAATCAGCTTCACTGTTTCAGCCTTGGC
TCTTCTTTGTTTGTGATTGCCATTGTTATGAAGCTTAAGCTTCTTGATACAAAACATGAAAAAAATAATAATCATATTGATATACGTAAAATAATTTTTA
TTACTTATTTTTTAGCTAGTTAAAATATATTCTCATATTATCTGATTTTATATATCACATACTCGCATTGGTTTCCTTTATTCAACTTGTCCGCAAATGT
ATATATTCATATTGTCTCATTTTATACGGTAATGCAATCATTAAGTGATGCATTTCCGAATGAAAAGCTGAAACAAAACAAAACATTAAAGAGAAAAAAT
TATTCTCATTCGTCACCATTACATACATAATTCGTTTCTAATTGGGGACAGAGTCATAATTTTTATTAAAAAAATAAAAAGATGAAATCGCAACATGTTG
ATGTGCAAACATTAATACATAATTCTTTACTAGTAGTTAATATATGTTCTCATATCTTCTCATTTTATGCATCACATTTCCTTTATTACTAAGTTGTCTA
CAAAAATTATCTTTTTTTTTTATAAAAATAACTTTAAATTTCTTATTACTTGTAACGAGACAATTTAAAATAAATTTCAATTTTTTTTCTCTTTATGTTC
TTAACTTTGTGCTTAGGATATATACATTTATCTTTTGTTCGTAGTGAATTAAATATATCTTACTAAGGAGACAATTAAATTTAGTATATTTATAATTTCT
TATCTAATTATACACTTTCACTTAAAATAATCATGGAGTATAAATTAGCATAAACGATGAATCATTTGTCTTTAATTTGTGTTAGTCTGTAATTATCGTC
CTTCAAAATGCATAATTTTTTTTTATTAGACACAAATTTATAATTTAATATTATAATATCATATAAGCTATGTTCTATGTTTATATATAAGTTTAGCTAT
CATAATTTATTTAAAACTAAAAATTTAAGATGAATCTCTAAATCGCGCAATTAAGGGTCCGTTTGGATGGGCTTAATAAAAGTAGCTTTAAAAAAGTACT
TTTAAAAGTACTGAAACTTATTTTTAAAATAAGCAGTTATGGGTTTGAATAAAAGTGCTGAAGTTGTTATTTCAAACGTGAAAAGGGAAAAATGGGAGAA
AGAAATGTTAAGGTTATATGGATAATTTGGAGATTGTATAAAAATATTAAGCACAAAAAGATAAAAATGTGGTCAACTTAAAATAACCCCTACCCCAGCT
TTTAACTTTTGACTTAAAATAAGTTTTTTTAACTTAAAATAAGCTGTTTTAGTATTGCCAAACAGCTAAATAAGTCAAAAACCAACTTTTAAATCAGTTT
GACCAGCTTTTAAGCTGAGAGCCGAACAGGCTCTAAATGTATGGTTGTGATGCAAAGCCAAATACAACGAATGAGATACTAGTACACGTAGGGCCGGCTA
AATTGGGACCAACTCAAAGCTCATCACGCAATAATACACTATATATTATTCCTCTCTGCCTTTATCTTTCTCTCTCCTTCGCTTTGCGAACTCCAGGGGC
AGCTACGAGAGAACACAAAGCACAGGACCTTAGCTCGGAACCCTACCTCACCGCCTTGTTACCGCCGTATTGGTAAGTCCTTTGATTTTATATCTTCAAT
TTCCGATGGATCTTTGGAGTTCAAGGAAACTGGACAGGAAACTGATCTTTTGTTAAAAGCGAAAGCGGTTAAATTGGATAATTCTAATTTAGTTTGGAGA
GTGTTTAAGAATTTTATGTGATTGTGCTTTTGCGACAATTAGCGAGAAGTTTTTGATCTTCAGTAAATAGTGTTATATTAGGGGAATTGTATGTGCGAGC
CCTAATTCATGTGTGCTACAGTTGATTATTGTTATTTATTGTTCTGGAATTTGAGCTTTGTTACTTGATTGAGATGATCATAATTAGATCATGAGTTAAG
CCAAATGAGAACTTGATTTATACCTGGATGACTGTGTTAAAGTGATATAAACAACTTTTACATACTTTTAATCCTGAAGTGGTGTTTAGAACTAAAATTT
TTGACTTAGGTCATAAGTTTGAACCATGCACCAAGCGAATTAAAGTGCAGTATTTAAGTGGAGGAGGGTAGAGGGCTGGGCTCATCATCCCCAAGTTTCA
AAGTGCGTAAGGGTTGGCTCTAGACAGATTTTATGGGTCATTAAATATAATAAAGGGCAAACAGAAAAAGCTCAATAGTAGTTCTCTTTTGTTGGGTTTG
TTAACTAGTACTCGAGCATGTATTGTAGCATGTGTATCTCTTGCAAATTAGTATTAATGTTTTAAAATGATATAAAATATTAAAGTATGTATGTGATGGA
AATCATAGGAGAAAAATACAAGTGCGGATTGATGAATGATTAGCCTATTGGACTGATATTTATTGTCATCGCAAAGCGCTAACGCCATCGCCGAAATGGT
TTCTTTGGGGAGAAAAAGGTTTCCTTTTGTACCTTCTTCTAATATCGTTGGACCATGATAGTGAGTGGATGAAGCAGAAATTACCATTTGCGTTGAATCC
ATGAATAAAAAAAAGTAAAATTACAAGGATAGCAAGTTAATAAGGAAGAGAAACAAATAAAATTAAGGCGGACTGGCTTGGGAGTCTCTTGTAATTGGCT
CCGTTTGTCATTTGAACCCTCCTACTTACTACTTCCCAAATGAACTCCTAAACTCGACAGAACTCTACTTTGTAGACCCTTTTCTCATCCTCTCAGTGTG
TGTATAATACAATTGCTTGCATGTCGAATTCCAAGTCATTTTATAATGAGACAGAAAAAGTTACATATTAAAAATTAAATAATATACAACAAAGTAATAA
TATTTTTTCTGATTGTACCTCCTTTTCCCATCCCCCCCAAAAAAAAAAATAAAATATCCAAACCACCTCCCACTCCTATCCATTTTTTTTTTGATGACAA
GGAAAACCCGCAGCCGCTACCCTTTGGGTGCGCACAGGTAAAACCCCTGCTTCTATGCAATAGTTTGCAAACCACATTGGAGAGGATTCCTACTCCTACT
CTTTCTCCAATCATTTTTACCCCCAAAAACTTACTCAAAATTCACCAGCCACTATCTTTATCGCAAGATGAACAATGATTAGATTTTTAGGTACGTGTGT
TCTTATTTATAGAGCTAATGCAATTTATAGGAAAAACAATGGGTGTTGGAAAGAGATTTTGGGTGTTTTATGTTTGATATGAGTGTTTAGTAGTTGTTGA
ATGGTAGTTTTTCCTTTTTGTTGGAAATTTAAGTACATAGAAATGGTAAATGGGTCAGCCGGCAAAGATTGATTCTTAGTGTGATACCAATGGTTGCAAA
TTACACTCGAGGTTTTTAAGAAGAAGAAGAGTAGAAAATTTGGAAATTTCATAGTTTGAAAATGAGAGGAAACCCCTCTATTTAGAGACAACAAATAGTA
GTATGAATAGTTGTTAATTGTGCTTTATTAGAAAAGTCAGAATCTTCAGTAACGTCACAATTCTTCAATATGAAAACGTGTCTATTTATAATATAATATA
GATAAATATAAATTATAAAATATAGAGAATGCTTTTAAGGTAGTATAGATAGATTAATTTGACCATGTGATTTGCAGGTGGTTACAATGTCGACTCCAGC
TAGAAAGAGGCTGATGAGGGATTTCAAGAGGTTGCAGCAGGACCCTCCTGCTGGTATTAGTGGTGCACCTCAAGACAACAACATTATGCTTTGGAATGCC
GTGATATTTGGGTGAGTTGTGTAATTAAAATACGCCAAATATGTGTTTAATGTCTGTTTGGGGCAGTTGTTATCATATGGTTTGAATAATCTACTTTCTC
CTTTCTCTTCGTTTTGGTGTAACCTGCAGTCCTGATGACACTCCTTGGGATGGTGGTGAGTTATCCTTGCATTTGGTCGTTAGTGCAGTGTGGCAGAAGA
ATGTTAAAGGCTTAAAGCGTTGTAGTTGGTGCACATCTACTGTTTATGCATTGTTGTCTGTACAATTCAATTATGTTTTAATCATCTCAGTCTCTCTTTT
CTGTGATTTGAAATTCTGAATAATCAGTTTGGAGAGTCGCACCCCTCGTCCCCTCCCAGGACATTCCTTGCCTACGAATAAGTAGTGATGAATGTTATGA
ATCATCTCATAGAGGTGATGCATATTCTAGTTTTGGAAATGCTTGAATCCTTTCTTTGATCTCCCAGTCCAAGCATTTCCAGTCCTGGCTTTCCAAGTCA
CTTTTGTATTATCATCTCTTGTCAGTTTATTACTCTCTGCCAAAAGTTAAGGTTGTTGGTGTTAGCAAGTGCGTCCTGTGGCTTTTGTTACCTTCGCCAT
CCTTTTCTTTTGACATAATATGATTTCTTTTTCATATCGCCTTAGTTTTGATATGAATTAATTAGTTCGGTTGTAACTATACTATTTGAGAACATCAGGT
ACGTTCAAGTTGACTCTTCAATTCTCTGAGGATTACCCCAACAAGCCACCAACAGTGCGGTTTGTTTCTCGCATGTTTCATCCTAATAGTAAGTTGGAGT
TCAAGATTTGATTTTTATTTGTCAACAGTGGATAGGAATAGTAAATTTTATGTCTGGAATTGTTCTTCGTTTTTTTCCAGTTTATGCAGATGGAAGTATA
TGTTTGGATATTCTTCAGAATCAATGGAGTCCAATTTATGATGTTGCGGCAATACTTACATCCATTCAGGTATAGAACTGTAATTGATTTTTAGACATCA
CATTCTCTAAGTTATCCATGTCTTAATCCTGAGTTTTACTATTAAATCTAATGGTTGAAAGCATCATTAAATGAAAATATGTGTTGCAAAGGAGTAGTTT
CTTGTTCCTCATTCTATAGGGTTGGAGATATCATCCTTGTGACAGCTTGACTTATCGTTGTTTTAGTTTTAGGCTACGTAGTTACATTTGCATATTGTAT
TGTGCGTTTCTGTTTCTTTATGATGATGAAGCAATTGTTAAGGAATCACATCGATTGATGCTAAAAGAATGCCTTGATCTGGGAATTTTCGAGAAGACTG
CTGTTTCTCAAGCACTTTTGCCCAGAGCATGGTTTCTATTTCTAGATTTTAGAAAAGGTTGGTCATGGTCCAAAGACTCAATCAGATAAAATATTATCTC
ATGGTCAAGTACTTTCCCCCCTTCATGTGTTATCAATTGGAGTGTGGACTCTCCATGTATTGATAATTCACATTGCGGAGATAGAATGAGAGGTTTGTTT
CATTGACTACAATGGAGTGTACCAGTCTCTCTATTGAGTTGACAAGTGGCATGAGAAGATGGAGGGTCAGAAGTGCTCCATGGAGTATGAGAGTTTGCTG
ATTTCTCTTAACTTTATACTTGGTGATTATGAATAGACATTTAAAACTAACTGTGACTTTGAAGAGGAACACCAATCGCTACATGGACAAGTTTAGTGAC
ATGACCCAAGTTGTAAATAAAGTATTCATATAAAGCCAAATCATCTAACTGAATTGTGTGTGGGGGAGCCAATTAATTATTGGCCTGAAGCTTCTCTATA
AACAGAGACCAACTTCCCTTATACCAGTTAAAAAAAAAAAGAAGACCAACTTCCCTTAGCTATTGTAAGAAGAACCTAAACATATTTTGCTTCTTTTAAT
ACGTAGTTAAAGGCGTGTGACAATTCAGTTGTGTTAATTCTCCCAGTATAGAGAGAGAGTGGTAGTTAGCAGCTGTGCAAGTTACGACTTACTTGTCGAT
TGCTACAGCTGCTGGATCATGGAAAGAAACGGTACGTTTGTTTAACCTTACCTCAAGATTCTGCTCGTATTTGTGTCAATCACTTTATATTCTGCATGAA
GATTTTTACTCAATCCCCTAACTGCTGGTGCTTGACTTAATAAGTTCCTTGCACAACCCACCATCCACCCATACAAGAAGAAGAGAAATAACATAGAATT
GTGTATGATGTTGGTGCCTGAATATTCATTTCTTTATTACAATTACATCCAATAATGAGATGATCGATCTTTGTGTAGATTAAGATGTTGACTAGTTTGA
AGTTGAACTTGCCGAGTAAAGGGGGTAGTAGACTTATGTCTTAATGTATGCAATTCAAGACATAGATACCCAAGCAGAAGTAGAAATTGTTACTCAATGG
ATGATATGCTTAAGACGCTAGACGTACTATCCTCATGCTTTGCCGGATTCTTGATGATGGAAGCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAATATCATGAATCAAATACCCTTGTTCAATTT
AATTGGTCAATTCTAACAACTTGCCTTATACGTCGTCCAATAATATGACTAAAACTCTCATTTATCAACTTATTCTAGTTTTCTTCAAACCTAAATAATA
GGATGTTCTTAATGTAAGATTGACCTTAAAGTATTTTAATTAGAATTTATGTTATAATTTTTTTAAAAAAAATTGAAAATGTAAAACGAAAGATTACACA
TCAGAAAAAAAGATAAAGAAAGGTTTCTTAGAAGTGTTTGTTACTTTGTTAAAATTAATTAAGAAACTAATGACAAATGGAGATTAATCTATCAAATTAT
TCAAAATCATGGAATGAGTTTAATTTAGGTTATATGTTGCACCTTGCCAACATGCCATTTTATTAAGGAAATAGCTCCGTGAGACTTGGGATGAAGAGAT
CATAAATTAAGTAGTGTTACATACTCAAATAATTTAAAAAACACTTAACAACTATTTACATTCGGAGTAGGTCAAATGGTAAGGTAAGATCATATATCCG
TTTGACTCCTCGTGGGGTACAACTTATATTTAGTCATTTGATTAGGAATAGTGTAAAGTTTGAAATAACTGTTGATCAGGGCGGAGGAAGTGTATAATGA
GAAGGGTTCATCCGAACCACTTCGACGAAAAATATTACTTCCTCTATTTCACAAAGAATGATCGAATTATTTTGATACGGAGTTTAAGAAAATAAAGAAA
ACTTTTGATCATGTGATTCTAAATTAAAGTTATGTCAAATGTACAAAATTGCTCTTTAATCTTGTGGGCTTAAACATACCACGTGGAAAGTAATTGTTAT
AAAAAAAAAAGAAGAGGTCATTCTTTTTAAAACATACCAAAAAGGAAAGGAGATCATTCTTTTGTAAACGGAGGGCGTACTATTTATACATGGTTAAAAT
TATTTTTTAGGTATGTATAATAAATGTCGAACTCCCTCCCACTAGTTTGTATGTTTACTTCTCAAATTTTGAACCCCTATTAAAATTTCTGACTCCGCCC
CTGCGGTTGACTAAGTGACTGTTACCATTTTTGGGGTTTCTTTTTTCTTTTTCTTTAACTTCTGTATTGTGATTGACCAATTGATAAAGGGTGGAAACAA
ATATGAAAATTATCACGTTAATAGAATCTCAACTTAGTTAGTTATGATGGTTTTGGAAGGAGTTTTGTACATTATAGCTTTGTAAGAAAATAGCAGAATT
TTTTAAAAATCAAAATATGAAATTTATAGATTCTTTTAACGTCATCAAATTAATACTTTCTTTGTCCATTATTAATTTTTATATTTTTCATTTTTAAAGT
TAAATTATAAAAAAATTGATTAATAATATTACGATATATTTTTTCATCATATTGATATAAAAAAATGTGATGTATAGTACTTTTTGAATAGTTTTTAAAA
ATCTAAATTTTTTGTTTAAAATATCAAACTAATATAACTTTTAAAATTAGTCAAATTAACTTTCGAACGGTATAATATAACACACAAAAAGAACAGGAAA
AAAAAGAAAGATGGAGATGCGGGGTATCGATCCCCGTACCTCTCGCATGCTAAGCGAGCGCTCTACCATCTGAGCTACATCCCCATGTTGTTTACTTTTT
CTGCTTAAAAAAGTAAAATTCTAAAACTAAATGTCAAAATAAACATGTACAAAAACTTTTTCAATAGCTTTATTATGTACTACTGAGTTAATATTCCATT
TCAACCGATTTTCAGTTATACTTGGTTCATGAATATTTCCAGATACTCTGGTACTTGATGGTTTTTTAACCGATTTTTTTTAACATTTATTTGCGTAAGC
AAGTTCTTATGCCATCATCAAATACTGCTAAAAAAGACTTATAATGAAAAAAAATCATGAAAAATATCAATTTTATACTTTTATTAAAGCTCAAACACTC
ATTTATAAAGTGATTGGAGTCCACACACTCAACTTTCGTGAGCATTTATAAAATTTCAAACATATTATTAGCCTTTGGAGATTTATGAATTCTTAAGAAC
AGGCAGTTGATTTTTTATGATATTCCGTTACAAATGAGATTAAAATACATTATTCAAAAATTATGTAGCATAGTAATTCAATATTACCTTCTTCTAGCGT
GACTCAAATCCTCAACCGTTCATAGCTCAGTTCTAATCACGAATTTAATATAAAAGTATTAGTAGTATATATTTAAATATGAGGAGTGAGTGGTGTTGTT
CCAACTTCCAAGACATATTTTATAAAAGAAGTAAAAGAACTCTATTAATACCATACAGAGTGACTTGAGCAGTGACGTGATTTTCCTACCTGCAACGCCA
TGGTTTCCGTGGCAAAAACTTCATATATATTTCAGCAATTTTGCAGTGTCTTTCACAAAACTTCCATAGCAATTAGTGTGTTTTCTCTTCAGCAATGGCA
GCAGAAAACGTAGCCCAATCAACCTTCCCACTCCAAGATCGTGTGGCCATTGTTACCGGTTCTTCTCGCGGAATCGGCAAAGCAATTGCACTTCATTTGG
CCTCACTTGGTGCTAAACTCGTCATCAACTATTCCTCCAACTCCACTCAAGCTGACGACGTCGTATCCCAGATCAATTCCACCTCCGGTTACCCACGTGC
CATTGCGGTCAAGGCCAATATCTCAGATCCAGATCAAGTGAAATCCCTCTTTGACGCTGCTGAATCGGCTTTTCAATCGCCGGTCAACATCCTGGTAAAC
TCCGCCGGGGTACTCGACGGAAAATACCCGTCAATCCTAAACACAACCCTAGAGGATTTCGACAGGACTTTTGATGTGAACGCTCGTGGAGCTTTCGTAT
GCTGCAAGGAAGGTGCTAAGAGAATCAAACACGGTGGAGGAGGGAGGATTATATGCTTATCGACGTCCTTAGCAGCGGCGTTTAGACCTGGATACGGAGC
GTACATCGCTTCAAAAGCGGCCGTGGAAGCAATGGTGAAGATACTGGCGAAGGAACTGAAAGGGACAGGAATAACGGTGAATTGTGTGGCGCCGGGACCC
ATAGCGACGGAATTGTTCTACGAAGGGAAAACAGAGGCCATGATAAAGAGGGTGATTGATGATTGTCCACATGGAAGACTTGGCCTGCCGGAGGATATCG
CGCCGGTGGTTGGGTTTTTGGCCGGCGACACTTCTGAATGGGTTAATGGACAGATCATTCGTGTCAATGGCGGCTTCATCTAATTTATTTATTTATTTAT
TTTGCCAAGAGTTTTGTTTTACCTGCAGTTTTCTATTGTGATATCTATTTGATTTTGTTTCATTTTCCCTTATTATATAATATAATATAAAATAATAACC
AATATACATAAAAATCCCCCTAAATTCGAAATAAGAACTTCCTTTAGTATTTAAAATATACAAATATTTATATATTCCTTAATATTTTCTGTGTGAATTA
TTTTTAACTCTCTCAACACCCAACTCAATTGAAGGCTGGGTATTGTTACATATCACGTTTTTATTGGTCCACGTCTCTAAAAATTTAAAAAATATGTTAC
TCATTTTATAAAATTCATCTGTTCCAAAAATACAACCCGATCCATTTCTAAACAAAAATTCCTTATAAATCTCTAAGCCCGATTCTCATTCTCCCAAATC
TACAAAAACTAACGTGAAGATTTTTCTTTCGTTAGCGTGAAGGATTTGTTGAGTTCAAAATTTTCGTGAAGAAACAAAGAATTTGCGAAATTTTTTATTG
AAGAAGTAACGACAATCTTGAAAAACTGAAAAGTAAGGAAACAAAATCAAAATAATAGACGAAGAAGAATAAGTTTGAATCTTATATTTCGAAAAACAAT
ATTTCTTTCAAAGATTTAACTTTTAGGTTTGAAGAGCATAGATTTGAGAAAAATTAAGAAAAATATGATAAATTAGGTCACCATTTTTTGGATGATTGGA
TTGGTGAAGGAGAAGAGATAATTAGGATTCTTATAAAAGCGAAGATTGTTCTTCAAACGGGTAATGGGATGGATATTACCGTTGGGGGGACAAATTTAAT
TTTTTAAAAATGTTGAAAGATGACAAATGCGTCGTTCTAAGCTGTAACAACACACGCACAAGGCTGGTGTTCGAAGAATTGAAAATAGTTCACATCAAAT
ATGTTAAGGGGTATATAAACACTCATAGAATTTAAGTATTAAAGTAAATTTTCGTGTCAAGTTTAGAGAGATAAATCAATTTGCGAGTATTGTTTTACTT
CCTAAATCCTAATTAACATAACTAAAATTCAACAATGCATTAAACATGTTTAACGTTGATAACGATTACTCATGAAAACAAATCAAGCATTCAAATTCAA
TCACCATTGTATTTGGGAGATCACATGGAATTGAAGTAATTTACACAATTTCAAGTTCATGCATATTGTAAATAAATAAATCATAGTAATAAGATGGATG
TCTATCAATATTTTTACTCACATTATAAATAATTGATGAGAAAAATTAGCATGTCATTCCACAAAAGAGTGGTGTTCAATAATTTTAAATCATAAGCTTC
CATTACAAATATTAAAATAATGTTCTTATCATATCAATTGAAATAGTACTGCAGAAAAGAAGACCAACATATCAGATTTTATTTTAAAATATAAATTTTT
TAAAGACAATAGATTATCAAAATTGCAAGAACCACAATTTCATGCTAATTTTTATGATTTTGTTTTATGTTTATAAATATGTAATTTCTAAATTGTATTT
AAGAGCTAATTTTGCTGTTTGGAGTTTTATCTATTTTCAAATCATCATTTTCATTTTCTTAAATATATTTGTTTACCTTATTTATCATTTTTAACTTGGT
CCAAAATATAAATAAATACTATATGTTATCTGAATTTATGACTTCCTATATTACTTTTTTTTAATCATTTATTAAAAGTTTTATATTTGTGATAAGATTA
ACTTATGTTTTAGTTATTTCTTTAAATTTGAAGATGTTTCTTTCCCAAATATAGCAGACATATGAAGTATCTCCATTTAAAATTTTTGTCCTACAGTGTC
GAGCGATTTATTTGACTATGACCAAAATTAAAACCGATTTTCAAGTTTGACTATCTCTTTCATTAGGAAAAAATCTAAAATAGTTTTAATCTTTAGGTTC
AACCTCAAAGTCATTCTTAAACTTTTATATCATGATCCTTCATATATTGTAATATTCATACATATTTTATTCTCTCTCAAACTCCGGCCTATTTTTAAAT
ATTCATTTTATCTATAATTTTATGTGTAGAACGTTAAAAATTTTTAAAAATATTTTTGATAGAAATAATACTCAATGTAAGAGAAGGTGTGAAGAAAATC
TTATTTTGTTTGATAGTAATATTAATACGGCTAAACTGAAAACACTTTAACATTTGACTTTGCAAGAAAAGAAAAAATGTACAATTGCACGTGACAACGA
TAAATAAATCTCTTGATTTTAACTGTAAAAATGTACAATAAAATAAAATGTTCCTTTCTTTACATGAAGCTATTATTTCTACTAAATATATATAAAAAAA
TAAAAATTAAATTCTATACATAAATTATGAATAAAAATAATATTACAAAATAAGAAAGAATTTGGAAATTGACCTAAAATGTAAACATGAGGAACTATTA
TAATTTGTGTGAGAATTCAAATATGATTTTAATTCTTAATAGAAGATAAAGAGACTATTTTGAACTTTTTCTCCTCTTTTAATTATTTGTTATGAGTATT
AAATATTATCACACATTTAGCACCACACCAGCACTTTTCGTTTGTTTATCCACAAAATTCCATTTTCTAGCAATTTCAGTGCTTTTCTTCAGTGATCATG
GCGGAAACAAACGTAGCCCAAGGCCAAAGCCTCGGGAATCGTGTAGCCATTGTTACCGGCTCTTCTCGCGGAATCGGCAAAGCAATTGCTCTTCACTTGG
CCTCTCTCGGAGCTAAACTCGTCATCAACTACACTTCCAACTCTACTCAAGCTGACGACGTCGTATCCCAAATCAATTCCACCTCCGATTCCCCACGCGC
AATCGCCGTCAAAGCCAATGTCTCCGATCCAAATCAAGTCAAATCCCTCTTCGACGCTGCAGAATCAGCCTTTCAATCGCCGGTCAACATCCTCGTCAAT
TGCGCCGGCGTACTCGACGGGAAATACCCGTCGATCCTAAACACAACCCTAGAGGATTTCGACAGGACTTTCGATGTGAACGTGCGTGGAGCTTTCATAT
GCTGCAAAGAAGGCGCTAATAGAATCAAGCGCGGAGGAGGCGGAAGGATTATATGCTTAACGTCGTCGATGGCGGTGGCGTTGAGGCCCGGATTCGGGGC
GTACGCGGCGTCAAAGGCGGCCGTGGAAGCAATGGTGAAAATACTGGCGAAAGAACTGAAAGGGACAGGGATAACGGTGAATTGTGCGGCGCCGGGACCC
ATTGCAACGGATATGTTTTACGAAGGGAAAACGGAGGAGATGATTAAGAAGGCGATTGATGAGTGTCCACATGGAAGGCTTGGACTGCCGGAGGATGTGG
CGCCGGTGGTTGGGTTTTTAGCCGGCGATGCTTCTGAATGGGTTAATGGACAGATTATTCGTGTCAATGGCGGTTATATTTGATACTAGTATATGTTCGT
TTTATTTCGTTTTTTATTTGGCATTTCCTTTGAAATATTGTTATAATCAATATTTTTAACCTGAAATAAGGTAAAAATTAAATAATACAGTTCAATTTGA
AGTCTAAATTTTGTGAATATGCAATTTTAATTTTTTATTATTCATTAAAAAACTACTTATTTATTATAAGAATGATATATATATAAAAAAAACGAACGTA
CTATCATAAACTTAACTTATAGATAGTGTCTACATGAGTAAAAATTAATGTAATTTATTTTAAATACATTATATTTAAGTGGATTTTTAATCTATATGAG
ATACACAATAAATCTCTTTCGTATCTTTTCATCTCGCTCACCACTCTCCCATGTATTTTGTAGCCGAATACATAAGAACCTCGCTTACCACTCTCCCATG
TATCTTGTATCACAATACATAAGAATCTCGCTCGCCTCCCTTCCCAATATCACTCGCCTCTTTTCCTATCTTTGTGTATCTAGTGGCAAATGTAATTTAT
TTTAAATACATTATTTCAAGTGGATTCATATGTATATATCTGAGATACACAACAAATCTCTTTCGCATCTCTCCCATCTTGCTCACCACTCTCCCATGTA
TCTTGTATTCCATATATATAAGAATCTCGCTCACATCCCTTCCCAATCTCACTCGTCTCTTTCCTATCTTTGTGTACCTAGTAGCAAAAATATATGTATT
TCTTCAATATATGATAGAAACCAAAAATATATGTATTTCTTTAATATATGATAGAAACTTTTAATAAGTGATAAGATACGAAATATTTTGAAAGTTAAGT
AATAGTGCTATATATCTAATTAAGTAATTCTCCCTTGCTTCTTTATTACTTTTATCGCTACTTCATGAAGTCTCTTCGAATGATTTGTGTTTGCTTAATA
CATGCGTATCAATTATTGTTGAAAGAAAAGAAAAAAAAGACAAGAATAATAACAAAAACTGAATAAATTATACACTTTTCATAATCTAATATTATTTCTT
TTTAAATCCACTTTATTCTACTTTTGAACTATCTAAGCCATAATACTCATATTCTACTTCACATATGCATTAATATTTGGAATTTTCGATGTTATCCTTT
TCATAGATGGATGGTTGTAAGCAAACAACTCATTTTCAACAGCATATTGGACTTATCTTTAGTGCATATAAGTTAAATTTCATTGGAATCAATAGAGATG
CCCTTTGAATTTAAACGCAACAATTCCATAAAGCCCTATTAATTCCCCATATCAACATGTCCCAAAATCATTTTTCTAAATTCATCCACACACAGTGCAT
AGAAAAAATCATTATTCTTTTGTTTGTAAACAGTATCATGATCGCGAATCGAATAGGATTCTATTAATAACTGTACGTTTCCCTATTAGTACTCATATCT
ACTGGGGAAAAAAAAGCTAGTAGTAACAAAGAACCATAACATTACTAGCATCAATGGAGGAGATTGACAGAGAAGCAACTAAAAATGAAATAAACTACAG
AGGAATCAGAGCCATGCCCTTTGTCATAGGTTTTTTTTATATATATACACTAAACTTGTATTAGTGAATAGTCTCATAATTTTTCCTTTTCTTGACACTA
TTTTACATATAGCCGAGTCTAACTTGTTATTGTATGCTAAAAACTGCAGGGAATGAGACATTTGAGAAGCTGGGAACAATTGGAAGCTCATCAAATCTGT
TGGTTTATTTGACAAGTGTTTTCCATTTGAAGAGCATAACAGCTACTAATATTGTCAACATCTTCAATGGCACTTGCAACTTTGGCACCTTGCTTGGAGC
TTTTCTTTCTGATACTTTGGTCGTTACAACATCCTTGGATTTGCCTCAGTGTCTTCCTTCTTGGTAACCAAACGCCAGAAAAATGACTTCCTCGGACAAA
AATTGTCTAGAAATGATTCTAATTACCAGATCTCTTCTTTAACTTACAGGGAATGCTAGTTTTGACATTAACAGCAGCAGTCACAAAGCTTCATCCACCT
GAATGTGGAAATCAAGAACCTGCACCAATATGTGTTGGTCCAACACCAGGACAAATGATATTTTTACTAGTAGGCTTTTGTTTGCTAGTAATTGGTGCTT
CTGGCATAAGGCCATGTAACTTAGCATTTGGAGCTGATCAATTTGATCCCAAAACTGAATCAGGAAGAAGAGGAATCAGTAGTTTCTTCAATTGGTACTA
TTGTTAGGATATACTATTAACCATGCGTTTTGATATAGTATTAATATTGAACAATTGTTTATTTATTTATTCAATTCAATAAAGTGTTACATTAAATAGA
TCAATTGTCATATATGTGTCCTTAACTTATATAGTAGATGATTTGGTGTATAGAGTTTAAACTTATACACAGAAGATTAAATCATCAGTTCTTATAAGTT
AAAATTTATAGTTCACAATCATAGATGGAAATTTGGACAAAATCATCAGAAAGATTGTAGCACGAGATTAAATGTAATTTATCTTGATTATGAGAATGGC
ATAGTTCTAACTTCTCGTGCTAGTGCATTTGGTATGTATTGAACGGGACCAAGCAGAGATAGTTGTTTTAGACTGACTGATAAAAACATATTCTCTAAAC
TATTAAATGTACTTATATTCTTAATCTTGATATAACGATTATGATCTGTATATATTATTTATCATTTAGATTTATTAAAAGATGAGATTCTGAGATGGGT
CAATATGCCTGGTAAATTGGATGATAATAATATATATTGGTGAAATAATTAGTTAGTTGATGGAATCCATGTCTCAGTATAGAGATTGATGATACACCTT
TTATGAGAAGCTTGTAAGTTTTCATGTGTAAACCCGGCTGGTAGATTTATGAATCTGGCACATGAAACAAGTTAAGTATTGCTCTAAAAGAATTTAATCA
TTGAATTAAATTCATCAGTAATTTAATTTATTGATTAGTATCAGTAATCTTAACATGGGGAATCAAATAAGTGTTTAGTGGTGAATTTCGAAATAAATAG
AGGAGTTCAATTACGAATTTTTAGTGGAATGGTTTGTAATTTATTATGGTAAGAATAATTTAAATTAATTATTTAGAATTATTTCCATAATAGGAAGCCT
CAGTAATAAATTCTATGGTCCCTCCCGTGCCCAATTTAACTAGAACTCAGAATCCTATTTTCTAGTAGAAGATGGAAAAGTAGCCTTCTCCTAAAAGAAA
AAGAATTGGTTTTTCCTCTCCTCTTTGGACTAGGAAGACATCTCTATAAATAGGGATTTTTCTAACCTAGATTTGAAAGAGTATTCTATACAATACTTGC
CCACCCAAGTATTGAGAGAGTTCAGTTGTTGATTGGGATCACTGTAGAAGACTATAGAACTGGAGTTGGATTTACTTCAAGATATCTGCACACGCTTCAA
GAGGTAATCCTGAGTTAATTTTCAGCATACTTTGTATGTGATAACTATTTGTGATTGTTATTTATATTCATGCAAGATGTATGATTCTGAAATGCTTCCG
CTGTATATGCTATTTTCCAACAACTATTTCACTCACACATTTGCTGTGATGGTCTCATTGACTGTCATTGTGTATGTTCAAACAAGTGTCAGTTGGTCAT
TGGGATTAGCAATCCTCACAATTATGAGGTTCCTTTCTTGTGCACTTTTCTTTGTGGGCACCAAAATTTATGTCAGGCTTGTGCCAAAAGGTAGCCCTTT
ATCAACTGTGGCACAGGTCTTAGTGGCTGCTATCAAGAAAAGGCACTTGCAGCTGCCAGAGCAACCATGTTACTCCCTATTCAACCATGTGCCTTCCAAT
TCCTTGACTTCTTTGCTTCCTTACACTGATCAGTTTAGGTAATTCCACTTGCCAGCATCAATGTTACAAGTTAATTTCGCGTAAACTGACCCTCAAAGTT
AGATAAACTACTGACTAACTAAAAGGGCTCATGATTTCAGATTCTTGAGTAAAGCAGCAGTAAAAACACCAGAAGACCAAATAAACTCATCAGATGGATC
AGCAGTCAATCCATGGAGGCTTTGTAGCATTCAACAAGTGGAAGAAGTGAAATGCTTACTAAGAGTGATCCCAATATGGGTAGCTGGAACTATCTATTAT
GTCTCTGTTGTTCAATCACAAAATTATGTTATCTTCCAAGCCTTACAAAGTGACAATCAACTAGGCCACAACAATTTCCAGCATCTTTCATAGGCATTTC
CATGCTCAGCATAACCATCTGGTTACCAATATATGACCGTGTTTTACTTCCATGGCTTCGGAAATTCACAGGAAAAGAAGATGGAATCAGCCTTCTCCAG
AAAATGGGAATTGGAATATTTCTATCGATCGTAACAATGTTCATATCAGGGATTGTTGAAGACAGGAGAAGAACCCTAACTATGACTAGGCCAATGCTAC
AAATGACTCAGGGGAAAGGTGCTATTTCATCTATGTCAGGACTATGGCTAATACCTCAGATGGCATTATCAGGTGAGCATTTGCAAATCAATGTTTCTTT
TACAATTTTTGCTCATCTTTTCAACTTTGACTTGAAATAGAGAATTTGTCCATCAATGGTGCATGTGTCCATGTACAATCCAACACTCCATGCACCAGTG
GACAGTCGGAGGCATTTATATTTCACAGAAAAGGTGAAATTCTTAGACTTATGAAAGATGAACTATGAATGCATTTGCCATAGATGTTTCATTAATCAAG
TACAAAAAATAACAGTGTTTCACTCAAGCTCCACTTCTACATACTATCTTTCAACCTTAACGTACTTCAAATACTCATAACTGAAAACAGGTCTTTCCAA
GGCATTTACATTAATCAGCGAGAATGAGTTCTTCTACAAACAATGCCCTGAAACCATGAGGAGCATCGCTGCATCTTTCTTCTTTGTTGGATTGGCAGGG
TCAAGTTATTTGAGCAGTATCATAAAAAGTCACTCAACTATTATGTATAACAAACAACTAAACCGAATTTTCCCAAGTGTCACATAAAGATATTACATAC
TTTCTTTCTCAAATTAATTTTGTTCCCTTAACTCTTTATTTTTGCATCCCTACATTGATGAATCAAAATGTAAGCTTCTGGTGGGAATTTATGAAAGATC
AATTGGTGGCTAAAACATCACCATATTTTGAGATATTTCTTGTAGGCATAGTTCTAATAGCATGTTAGCCCAAATATAATACAACGCTTTACCCTCAAAG
TGGAACTTCCCAGCACCAATCTAATTTACTCAAGCCCTTAAATGGGTAGTGATGGGAAACCAAAAAAAATGAACTAATCCATTCAACAGCAGGTTAAAGA
AATTCCCTCAAATATATTGAGAAGACACCATCACACACCAAAGCAAAAAAGCCAAACTTCTTTAATCAATGAATAGAGAGAAGCAGTACAAAAACCAGAT
GCTGCTAAACCATGAAATAAAAACTCTTGAGAATATAGATAATGAATGCTGTTATAGCTTAATATTCATTCTTGGTCAATTGTAATATATATAATGTAGT
CAAGACATGAAAGCAGGAAAAGATGAACCAAGAATTCAAAGCAAAAAAATGTATAAAATATATAAGGCACTTTTAAACGCTGAAGATGTTACTACTATGA
ACTTGTCGCTCCAGAGGTAACTCACACACTCATTATGTCTTCATTCTATCACCCACTCACCAGTTAAGTAGCACTAGTCATACTTGCTCCCACATCAAAC
AGTGTATGACTGCTGAATTGTCTCTATGTCAAGACCCTTCAACTTCACCACTGATTCCACGTGACCTTTAAGTGTGTGCAGCTCACGTTGCCTGCAATGA
AAAATGTAGTGTTCAATTTCCAAGAAGTCACGAAAAATCAACATGTGTTTAGCTGAAGAAAGCTTAGTAAAGATAAAGTGAAGCAAGCAATGGATATGGG
ATGTTGTAGCATGGCCATATGAGTAAAGGGAGAAGAATGAAATGCCCACAAATACAAGTTCAACTTCACACCCAACTAGAAACATAAGCAGAAACTACTG
TACTTCTGTTGTCAAAAAAAATAAAAAAAATTCAAAATGACAATCTTTACCTAGCGATTTCAGCTCTCCTCTTTGCTTCCTCAGCTAACTGATTAAGCTC
ATTGAAATTGGTAGCTTCACTAAACAATTTGGTGTCAGGAACTTGCAGCCCATGAAGGGTCCTCTGTGCGTGGGCCCATTGAAGCTCACGTTGTTCTTTT
CCGAAATCCTTCTTCCTGGTGAAAGCAATCTGTAATACAAAGAAACCCGTCACATACCGTTAGCATGAGAATGAATATATATCATATATGTATATCTCTA
CTGTATCACATACCCTTTGCTCAAGAACAAGATCCCAGGCCCTTCCACTGAGAGCATATCTGATTAAGAACTTGATGATATCAAGCGGGAAGTAGAATAC
TAAATTGTAGAGCCAGATCACTCCTGCCCAACCCCAGCCAATTCCTTCGATTGCAGCAAAGCTCCAACTTGCATAAACAGCAATCAAGGTGGCAACCTGT
TTAAAATTAGCAACCAAACATTATAGATTGATCAAGTTGTGGAAAGTTTGCCAGAATGAATGAGCAAATGGCTTACCAGTTGAGCAATCAGAAAAGCAAC
CACAAGCAACAAACCAGGACGCTCAACAAACGACCAACTTCGAGATCTTGTGACAAATATCAGGGCCTGACTGATAGTGCTCACTTGAAGGTAAATTGCT
GATGCAAGTTTCCTGAAGTCATCAGTTGCTGTCCTCTGAAGTGTTGATACCCCAAATACACGCTGGACAATCACCAAACTGAGTGAGATTACAAACTAAG
AACAGTTCATAATTAACGCCAGTTCAACTTTCAACAATCCAAGCAGCAAAGTCAACAGATCATTTAGTTTAATATACAGTTAGTTATCATAACAACACTA
TTAACAAAGTTCTGCTGCACAGGTAAGATGAAAGTCCTCCATAGTTTTTCACAGATAAAAGATGACCAGTCTGTGCGGCCAAACACTCTTTCATTAGTTC
TTATTATATAATACATAACCAGTCTGTGCGGCCAAACATTCTTTCATTAGTTCTTATTATATAATACATAACCAGTCTGTGCGGCTAAACATTCCTTCAT
TAGTTCTTATTACATAATACATAACAGCTACATCTCAAACTACCTGCATCTTTTTTGTGAATATTGTGTCTGTTCATTGTCATGTCAAAACTGAACAAAT
TTATTGATATTATACAGGAAACTCATATGCTCACCGGGAAGAAATCTGTCTCATATGCTGCCCAAAAGAAAATGACTGTCATCATTGCCAAGTAGCCACC
AAGAACAACCCCAGTAGTGAAAATCTCAGCCAGCTTCCAACTATCAGGCAGAGGAGATGGTTTGACCCTATCCTTTGATATTGTCATAATGGTACCTGAG
ATCATAACATTAGAAGTGAGACGTAGAAAAGACACTAGAACGGCAAGAGAACTAACTAAACACTGCAGTGGCAGATCATACTAAACTTTATAGAAGAGCT
TTTGATGAAATGAAAAATGATTTTGTACATGTGAGGAGTAGCCTCTTATTTCTATTTCTCTTTGGTGCATCCATGGGGTTCCGATTTGAATTAAAGATTG
GATGTCTTTTGTAGAATATCATTTTTTCTTTAATAGGTTTTTTACTTTTCTTATACCACATGAGTAGGTGTTATTCCCAACATAATAAATTACTATGAAC
CGGATGGGGGAATAATTAATTGGAAAAATATCACATGTTAGTATGTTTACTTTAGGTCCTATACTCTCTATGATCTTTTATTCATGTCAGAGATTTATAA
GCCATCAGAAAATATAGAGAACTTCTAGCCCTTTTTAATTTTAATTTTGTATAATACAAGCATGTTTCATTTCAATACCCTCAAATTTCATCTTACAGAA
AAATTAGTGGTTTATTAAAATGACGGAATGTTGAAACTAAACATCGTCTATGTTACTATTGGTGAAAAGGACCAACCGTCATTGAGGATTGCAATGATAA
GCACCATGAAAGGTGGAAAGTCAAACTTCCAGATAAGGGCCAGAAGCATAAAACCAAGCTGTAACAAAAATAGAAGAAGAATGTCAAAATATCATTTAAG
AATCATAAAATTAAAGAGAAAAGAAGAAGCAGCAGCCAAAAAACATACCACAATACGGATTGTGATGGAAACAGCATATATCTGCCGATGAAAAAAAAAA
GACAGATAAATTATCAATATTGTGCATCAGAGACAGATTGTAAGTGCATTAAGCTCATTCAGGAATACACTACCCTCAAAATAACAGCTGCTATGATATA
CCAAAAATGTAGGATGTATAAGGATTTAAATATACGCCTCTAGTAACCCAACAAGAAAAATATATACCGTATAGTTTTTCATCCTTTGAAAGATTGCTCG
ACTAGTCAGAACAGCACTAATGATGACACTGAGACCAGGTTCAGTAAGAACAATGTCAGAAGCACTACGAGCAGCATCAGTGGCATCATCAACAGCTATC
CCAATATCAGCCTTCTTTAAAGCAGGAGCGTCATTGACTCCATCTCCAGTCATTCCACAGATATGCTTCCTAGCTTGCAAGCGTTTTACAATCTCATATT
TGTGCTCTAAGGCAATGAGCAAGACAAGGTATCAGTAAAGACGAACATTCCGATAAACAAATACCCTATTGAATACCCAAAAGTAGAGAAGTAAAAGAAT
TTTCTGAGAGGGATATACCAGGGAATACTCCAGCAAAACCATCAGCCTTTTCTATCAGTTCATCAATTGGTAAAGAAGCAATTGATTCATCCTTAGTCTG
CCCCAACAGAGCAGATGAAGGATACATGTTGGTTCCCATTCCCAGACGACGCCCTGTTTCTTTTCCTATAGCCAGTTGATCCCCTGCCAAAAGAACAGAC
ATCAAGAAATTTAAGCAGGCACATAAACATGTCGAACTTTGATGTAGCAAAAGACGCAGTACCAGTAAGATGATACATGTCCAAATTACATCTGAGCTTT
TTACATCAAAAAGCAATATCTTGGTAAAACACAAGTTGACAAACACAAAGTAATAGTATTTAAAATTCAATTGTGAAAGCCTGAAATCCTTATCAACACA
ATAAATGAAAATGCCAAGCGACGGGCAGAGACATCACTTTAAGTCAATAAGACCAGGCGGTGCCTCTAAAATGAGACATAACCCAGTACCACTATAATAT
TGTCCTCACCAAAAATCAAAAACAAAAAGGCACAGTCCCAATATCGGAACGAATCAAAAGTAGTCTTTGATGCAACAGCCAACAAGCTCAGTGTACAAAG
AATTACTAGCAGACTGCATTACCATCTCAAGTTGGTGATAATTTTGGAAACCTCTACTCACTGGATACATTTTTCCTTTCTCTCTTCCTTTTATTAAGGG
GTTGGGTAGCCATTACTACCAAGTTGCCAATATAGCATGCAGTCTATTTGCCAACAATTTTTCAATATATTGATCATAAAAAATGAAAAAATTAGAAATA
CCTGTGATCATTTTAACATTCACTCCAAGATTCAAAGCCCTCCTTATAGTCTCAGCACTGTCGTGTCTTGGAGGATCAAACAAAGGCAGGAGACCAATGA
ATTGCCATGGTCCTCCGGAACTCTCCTTCCTTCCCTCTGGAACTTCCTGCATGGGAAGTTAGGGTATATGTGATTAAGCGAAATAAAGCTCTATTTTTTC
GACACAATGATAGAACTTGGAGACAGAGATAATTAATCCCTCCTCTCCACTATAATAGTATAGGTTATATGCTTAAGCTGCAAGATAATTGATTCTTTCA
ATTTATATATGACATGATGAGTTCCACAGATGATAAAAGGAAAGCAAAATACCTGGTAGGCCACACCAAGTGAGCGCAAACCCCTCTCAGCAAACTTATC
AATCACCGCATGAACTCTACGTTCTATGTCTGACTTGTTGTGTGCAAGATTTAGGATCTAATCCAAATTGCAGTGATTGGTTAGAAAATGCAATCACGGA
AAGTAAAAGCAAGCAAAGAAGGACTACTTAGATGATCACAGTCATACCTGCTCTGGTGCCCCTTTGCTGACCCTGTGCATTTTTCCTTCACCATCAAGAT
AAGTAAGCGCTGTACGCTTGTCAGTTGGATTGAAAGGAAGAAAGTGTATTTCACGAATGCCAGCACGAGCCTGCATTAATGGCAGCATTAGAACAGTTCT
CTAGCTAAAATGGATACACCAATCACACAGTCATGCAATTCTAAAGTTACCTCCTTCGGGTCAGACAACATCCCAACAATAGCAGTGTCAATGGCATCCT
GGTTCTCTGTACGAGACGCTCGAGCTGCCATCAGAACGACAGTATCTGCGTCAACACCTTTGGCAAAAACCTGATAATTTAGCAGGAACAAACAAGAAAA
TCAGAATCGGTGTGGAATAAGGAATAAACACAAGACTGAACTCTTATTCTCACCTCAACAAGGTTTTTGTCAACAGTAAGCTTGTTTAGTGTAAGGGTCC
CTGTCTTGTCACTACAAAGCACGTCCATACCAGCCATCTCCTCAATAGCTGTCATTCTTTTCGTAATAGCACCCTGAATAGTTAAAATGATGAAATATGC
AATCGCTTATCAGAACTGTTGAACTACAATAACTCACGATTGAAGACATGCTGAAACACCACATCCTAAGATCAAGATGCTAACTAACAAACCTGTTGAG
CGAGCCGATGAGATCCAATTGCCATCGTGACTGAAAGAACCGTTGGCATGGCAATTGGAATTCCACCAATGAGAAGGACAAGAAGATTGTCAATCCCAGG
GCGATATTTGCGGTGTTGGATAGGGTACATCACAATGATCTCTATTATCATCCCCACTGCAATAGAACAGATGCAGAAGTTTCCAATAGCAGTCAAAACC
TGATAGAGACATCAACAACATTGAATGTGAGATTTAAAAGAATGAGATTATCAACTAATATTCAAAACAAATAAGACAATACAAGTTCAACTTGCCTTTT
GGAAGTGTCCCACTTGATTTGTACTGTCAACAAGGTGTGCAGCCTTCCCAAAAAAGGTATGAACCCCAGTGGCGATGACGACAGCTTCTATCTCTCCCTG
CTTACAGGTAGAACCAGAGTAGACACCATCTCCAGGACCTTTAGTTACAGGAAGAGATTCACCAGTCAAAGCAGACTGCAAGTAATAGATAATATCAGTG
CCACAGTTAAACAAAATATTGAATGCAGTGAGCAACCACTTATTAAATCGTAAAAACTTAATCACCTGGTCAATTTTCAGGGGATCACCTTCAAGAAGAC
GAGCATCTGCAGGAATAATATCTCCCAGTTTAATACTGATAATGTCCCCAGGAACAAGAACAGCAGCATCTTCTTCATTCCATTTTCCATCTCGAAGAAC
CTGCATATATCACAAGAGCAAACAATTAAGACAACTTTCCATTAGTTTCTCAACCTCATACTTCCCATCAAAATTATGAAAGTTAACAACTTTCACATGC
TGTCTAATAGCAATTGAATAACAATGATGGTTGGTGAATCTAGAACCTTGGCTTTAGGAGCGAGACGAGCCATGAGAGCAGCTGCTGCATTGCCAGCATT
ATTCTCCTCAATAAAACTAATTGTTGAGTTAATCACTAGCAAGGTAATAATACCCACAAAATCTTGCCAATCCGGAGGCTTTCCCTACAAAATTCGACAT
ATATTCAATTTAAGTCAAAAGAACCAGCATATTGTCCAATATAAAGGTAAATCAGCTTGTTAGCACTTACTCCTCCATTTGCAAGAGCAATTGCCATAAT
AGCAGCAGCTTCCATAACCCATGAGAGGGGGTTCCACATAAACCCCAGAAATTTCAAGAATTTGCTCTCCTATAACACAGCAAACAATAACACTCAACAA
TGATAACAGTTCACTTTTAACTTTCACGTCAAAAACTTAAGCATCAAATTCTCCATCAATTCAGCTTAGTTCAACTAAAGACATCTAATTTTCAGCTAAA
AAGAGTCCATTCAAAGTCCAAACAAGACAGACAAGATATCCAAAGAAAACAAAAGGAGAAAAGAGGAAACATTTCAGCAACAAAAAAAAAAGAAAACTAA
CCCATCAAAGTACCAAATCAAAAAAGGAAGAGAATATACAGAGATTCAGTTCAAAGTGGACCAGCAAGGGAATCAAAAAAACAAGAAAAGGAACAATTCT
ACAAAAAGGAAAAAAAAAAAGAGTAATCATCACCACACCTTCTTCTCCTCTAGTTTGTTGTACCCAAAAATTGCCAACCTTTCTTGGGCAGCTGTACCAG
TAAGACCCTCTTTGGTACATCTCAAATTTTCAAAAACTTCTTCAATGGGTATATTCTCCTGCAATTACAACACCAACAAAAAAAGGAAACAAACCCATTA
AAACCAACGAAATATAAGTTCAAAAATTTGATCTTTTTAGTCAGATCCATTACCAAATCCACAGTCTCCTTTAATACAGCATCTAACACCTCAGGTTTCT
CCCCCATCTTGCTCAATTTCCTCTCTTCCTATTTCAAGATTCAACACAATTTTATTATATTATATCAATAAGTTACTAAAAAATCACCCATTAAAGAAAA
AAACAAGATAACTGAGCTGAGTTAAAAGAGTATGAAGAGAAGCAACAACTGCCCACCAAAGAAAGATAGGATTTTTCTCGGGTCCAGAAATAAGATTGGT
AAATCGCCCACCAAATCCAAAACAGAGTGTGGAAGACTACTATATAACAGGCTGCTACCCTGTTATGTTATTACTCTTACTCTCCCCGTTTCAAAATATT
TGTCATAATTTTTTCTTCAAAAAAACTAAATAATTCTACTTATAACCAATATTATTACAGTTTATTTTTTCCGAAAGTCAAATTATATAATCTTGACCAA
TGCTATCATAATTTTCACTTTAACTATTTTTGACCGATGTTATTATTATTTTCGAGAGTCAAATCATGACGAGTACTATCACAATTTCCATTTTAAGTTT
GAAAGTTAAATCATACAAATTTGACCGGTATTCTTAAGATATGATTTTTGGTGATTATTGTCCTAATTTTATATTTTGAATTCGAAAGTTAAATGATATA
TTGATCAATATATAATTTTTTTCATTATATTGATATGATAAAATTGTAACTATAATATTTTTGTATAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGCTTTGCTCGCTCAGGGTCATCAGACAG
TGGCATGTCTTCAGGAAGTAAACAAATCTTTGAACCACCATCTTCATCACAATCCATATAGTCAATATCTGAGATCTTATCATTTTTTCTGCTCTCAACC
ATATTTACATTGAGTCGATCCCCTACTTTCTTCCTTCTAGGGGACGAGTCCCATTCATCTACATGGCAGAAAGCCTCCAAATAGTCATCCTTAGGCCCCT
CCCCATCATCTCTTCCATAGGTCTCATCTAGAAAACCATGGCCTTGATATCTTGATTGCTTATCTAGCATTTTCACTGCCGCATTAATATCTAATGGTTT
CCAAGAACAGTTCAGAAGCATCTCAGCCCACTCATTCTCAACATTTTGAGGCAAAACTGACTGCATTTTAGGCAGCAAAGCTCCCATGTGATCATGCACA
ACATGATGAACGTGTGATTGAGAATCAGCAAAATTTTCATTGCACCGGCAACATCTCCAGAACTCCCATGTTTTATGGGTCTCGGCAAATGGAAGAGCAT
CAGAGAGTACTTCTATAGCCAAATGATCCTTAGAAGCAGTAAAATGTGTCTTAAGATCTGAAATTCTAATTCTAAGCAATTCTTTCTTCACATCCAAACT
TATGGAATTCCAATATGACTGCACCCACTTTCTTCTCTCAGTGGAAGAAGTATTCTTCTTTGCATTTCCGCTGGACCTCCTATCTCGTGCTCTCTGACCC
GATCCTGCAGTTGAATCCAAACCTTTGTCTACATCATTCTGTGATTTGACAGTTTCTGACTTCTGCTGCAACAGCCTAGCAGCAGCTACCCGAACCTCAA
TCTCTTTTCTTCTCTCTTCAGGTGTCTTAGTCGCCTTCTTAATTTCGTTTGGTCTTCTTCCCTGAACCAATCTCAATTCCATTGGGTCCTCAGACACCCT
CCTAATTGGAATTAACCTGAATTTCTCCTCCCCAGTACCTATATTCTTCATCCAAGTAGAAATGGAAGCAAAATTCGACTTCTGAATCAAGTTATGAAGC
TCACCATGTATATGAGATATTCGAGCTTCAGGCGAGGAGATCTTCTGTTGACTCTCCTCTTGTAAGCTCTCTTTTGCAGGATCAATGGGGTTTTCAATTG
CCAATGCTCTTTCACACTCCTGCACAACTTCCTCGTACTCCTTCCCGTCATTTGCTGCTTCGTACAACAAATTAGCATAGAAATGTGAAAACTCAACTGA
GTACGGAGACAGTGACACTGCTTTCCTAGCACTCTCAATTGCATTCCTCAAATGCCTCTGCTTCGTATTAGGATCATCAATAATAGAAGCCACCTTCACA
CAAACTGTGCCCTGGACGCGATGAATCAGCGCCGAATGAGGCGAATTTTCATGCTTAGTAGACAAGTCCTTCATCAACCTTAGTGCTTTAGTATGGTTCC
CACGTCGCAAGGACGTTAGGGCACGCTCACATTCAAGCTTAATTGAAGCATAAGAAGCCGAAGACGATGAAGTACTGTTCTCATAATCATTTACAGCTAG
GGCATCGTTTCTACTCAAAGATCCATTCGTAATTGAAGGAATCGTTGAAACTAGCTTTAGGTCAGCATCAATCGACGGCGGTGACCCATCTTCTGAGACC
GCCGCCGGTGAACTTAAGGGTTTGGAGCGAGGAGCGACGGTTCGCTTCTTATGCCCCATCAATAATTTCCCCTACGTCGATTTAATCGAAGGCATATACA
AAACCTATTTCATATCCATATACAGAATCTAGCAATTGCTCAGATTAAATATCTAACTATATACTCGTATCGATACACAGCAGATAGAGAAACTTACCGG
CGAAGAAAGCAACGTCGGAATCGGAAAAACAATCGATCGGAGAGGAATAGAGTGTAATAATTATAAATATGTATAGGGAACTACGTATGGATAGTGTCAC
TCTCGTGAAGGGGGTAGGGGTATATGTATAAGGTTGAAGATATAGGTAGGTGGGAAGGCGATGTTTGGGAAGATATGTACTGTTGGGGGAGAAAATCGAT
TTTAGTGGGACAAAATGCTGGGGTGGCAATTTTTAGGATTTTTTAATTTTTTTTTATTTTTTTTGAATAGTAATTAGTAATCATTTGTTTTAAGATTTTG
TTACCTTTTATGTTTAGGTTACCATATAAAAAGGAAATAATTTTAAAATTTATAAGAAAATCGGTAATTGAATTATGTCGTAATTTTTAATCCAGTTCAA
TTTAATTTGTTTCATCCAAGTAGTTTATGACCGTTATTGATGACTCTTCTAGTCATCAACTTTCGATTATTTTGACATGTTCAATTTTTTAATTATTTTT
TTATGGTCTGGAATAGTATTATTAGATAACTTTAGAATATTACAAGGGGAACTGAAATAGTACTACATTAGCATCTCTAATAGCAATGTTGTTAAAAGCA
TCAGTGAGGTAACTAGACTGCTAACATCTCTAATTATATCATTGTTTTTTGGTTGAAAAGATAGTTATATTATGACATATGTTTAAACAAACAGTGACAA
GTTAAGTTTTGTTCGTGGGCCTCCTTGTTGTAAGGTCCAGTGCTATTAAGTTTTGGGCCATATCCCAGCCCTAGATTATAATACTAGGAAAAGAAATTAT
TATAGCGAAGGATGTTCCTTGAGTATCCACCTCCTTATCTTGCTATACATATGTTGGTTGGCTAGTGAAAGTGTTGGGGGCGTCAAAAACTTGTCTTCAT
AGTCCCTCATTCTTTACTTTATCCACCACCCTATTTTGCTTCCGGTAGGTGTGCATTAACATAGGCGTGTCCAGCTTCAGCATCAATGATTTGCACTCAA
TCAGTAGGTTAGAGTAAGACATGTAATCATGCTTAACCCATTTTATGATATTTGAAGAGTCGGTATTGATAATCAAAGGTTTCAGATTAAGTTCTGCAAT
ATCCCAAGTTGCAGCCCTCTTCGCAACGCTTAAAGCTCTGCTATTACAGAGTTAGTTCGTGGAGTACTTTCGCTAAAGCCTACGATTCATTCCCTAGTGT
GGTCTCCGAACACTCCTCCAATCCTTCCCATGCTCGGATCGCTCACTGTTGCCCCGTCGATGTTCAGTTTATAAGTTTCCAGGGGGTTCCCAATTAACTG
CGATGGTAACTCGAGGTGCCTGTTAGTTTCCTTTGGTCTACTTGTATTCCATGGTTGATAGCAGCAACCCCATTAATGACTTCCTTTATATTGTTGAAAA
TGTTGTTGTTTCTTGTAATCCATATGTTCCAAAGGCAGAAAGGTATAAGCGTCTTTAATTTGATGATGTTATTGAAGGGTTTGTTATGTGTGTTTCTCCA
ATAGGCATCCCAATTGATGATGCTAATTATATCATTATTACCCATCACACTAAGGTTGCCCAAGGTTGCTAGTTTAGTACAAGTAGATTAAGATTAGATA
CTATTCCGTCTTTATCAACACGCAAAATGAAATTAGCCTTTTTCGTGGGAGCTATCAAAACAACAAGATGATCAGTAACACTTACATTTCATATTCACAT
AGCACATTATTCAACAGATTAAAAAGAAAGTACAAAAATGAATTGAGAATATATGAGCACAGTATTCAACTGATTAAAAAGAAAGCACAAAAATGATTTG
AGAACATATGAAGCTATTTGTATCAAGGTGAGTAGATTTTATAGTAAGGATGTAGCTTGATCGTCACCGTAAATTAATATATCTTTTACTTACCAATTAA
CGTTAATTAATAAAATACTTAACTTGAAGATCTAGTTGAAATCGTGTCATTTCGTGGACTATCTACAATGTAAGATTCTTTGTTTATATATATGAGGTAA
AAGAGCTTTGAGGAATAGTCACATCAATTGAAGATAGCAATGACCACTGACGCCTCTTCTTATTTTTCTGATGATATTTTTAGATAAGATTGTTGCTTAA
CAACTGTACACTTCTCTCTCTATATATTTTTAAGGGAAAAAGGATGAATTTACTCCTGAACTTTGATAAATGGTACGTATATCCCTGCCGTTACACTTTG
CATTCACCTAAGCCCCTATTGTCCAATTATATGTACACACATGCCCCTCTCACTAATTTGTACACATGTCTTAATCTTAATGAACAAACCGTTTGACTTT
TCTTTTTAACCCATAAACAGACAACCCGCCCCTATAAACCCAATAACCACCCAAATCCCTCTGAGATATATTCTAATTGAAAGAACCAAATCCAACAGGT
CCGTTCCTATCACACAAAACCCTAGCCTCCATGAAGTCCGTCGATTCCGTTGCGTCTTGCTCGTTGATTAGGGGTAATTTTCAGTTTTTTACTGTTCAAA
AAGTACTTTTTATTGTTTATTGTTTCCATAAAGTCGCTGGAGTTTCGTCGAAATTCGGCGAGTCCACCACCTAAAATCTCACTTATTTTTCTTTTTTTTT
CCAGCAGCCATGAACCAACCATCCCTTTGAATAAACAATCAAGAACCGACCACTTCATCACCAAATCTCCATCGGTAACAACAGCCAAACAACCTCTAAA
CACCCAAAAAAAATTTCAGACAAATAAGTTTATCATCGCTGCTCTAATAAGCTCCGACCACCAGTTCACACACAACCACTAAAACCCACTTGTTTTTCTC
GAAAACAACAATCGGAAAATCAGTCAGGAAACAATGTGCAATCAACTTCGTTTTTCATTTCCTCCGGCCACACCCAACCATCATTGTTGCCCTCCTCATC
GGACAATCAAGATACCAAAAAAAACCTTCATTTCCCATGATCATTGCCATCAGCGTGTTAGATTTGGGTCTTTTAATTAAAATATATTAGAGAGGGATTC
GGGTGGGTATTGAATTTATGGGGCGGGTTGTTGGTCTATGGGTTAAAAAAAATATCAAACTGGCAGCTCATTAGGATTAAGACACGTGTACAATGTCAGG
GGACCATTAGTAAGAGGGACATGTGTATACCTATAATTAGACGGGCAGGGGCTTAGGTGAACCCAAAGTATAAGGATAACATATACGTACCATTTATCAA
AGTTTGAGGGTAAATTCATCCCTTTTTCCATTTTTTAAAAGATCAAACTTTTTTATTGGACTGGCTTGTGTACCTTATAAGTTAGTTTGAAAATAAAACG
GATCTTGAGTCTCAAATCTTGTTTAGAAAAAATAATAAATTAATGTTAATCATGATAAATTATCCAAATGATATGATAATAAATTAAGAAATTGTTTATC
TTCAAGTTTAAAATTGTATGTTCACATCATCAAAATGTATGAAATTAATTATTTAACGGAAAAGAGTCTAAAATATCCTTAAACTATTGAAAATGGTACA
CAATTAACCTCATTCATCTATTGGTTTCAAAATACCCTCCTCGTCTACCTATTGGCTCACAAATACACTCCTCACCCACCTTTGGGTCCAATTTTAGCTA
CTTCATTAGTGGAGTAACATATAAAATAATCAAATAATTCTTTTAATTACGTGGCGCTCAATCATTGGTTGTAATTTAATTATTTAATATAATTTTAAAC
CTACCCATTTTTAACTGAATCCGCCCAATACTTGTTAATCCCATCCTAAAATATAATTTTAAACTCATCCATTACCCGCTCGATCGAACCAATGGGTTCT
TTTGGTATTGAATAGGACGGGTTAAATAAGTATTAAAATGTACTATAGTGTGACCATTATATTAATCTAAATTAATCAGGTCACAAAGAAAATCTAAAAT
TCTTTTAGAGAGACAAATTATATACATACTGAGTTAGAAATTTATATAAAAAATTCAAAATGTAAATCTAAAGCTATTAAGTTTTGCTGAATTAACCTTT
GACTTCGTTCACTACCAAAAAAATAAAGATATTTAATGATAATATATTTTTTTTCGAGAAAATTGAGTTAAAGTTATTGCATTTAAAAAGTTGCTAAAGT
CTTTAACATTATTTATATAAAATGTTGGCTAGGAATATATTTATATATATATATTATTGCCGTAAAAATATAATATAACTAAAATTTTATTATTATCGTT
AAATTCTTTATATGTCATTAATAATTGCCTGTTTGATTTATATAACTATAATTCTATCACCATTATATTTTTTTTCCAGATAATCAAGAAATATGAACTA
CATAGACATAATGTTAGCAATTCATATTTGACTTCACAAGAACCAAAAAACATATTTTGTCACGTATATAATGCATGTATTTAAAAATTTGTATTAATCA
ATAAACTCAAGCTTATTTATTGAATTTGTTCTTCTAAAAGATTTCTTGATGCTCATTCATGACATTAGGAAGTTGTTTCTAATGTCATGACATCAAAAAT
ATATTTTCATGCTCATTTATAATTTGATGCTCAATATTTTAGGGCGCATATAAAAAACATTGAGGTGGATTCAGTAAAAAATAGGTGGGTAATGAGTAGG
TTAAAAGTTATATTAAATAACTAAATTGTAATCAATGGTTGAGCGTCACATACTTAAAAGTATTATTTAATTATTTTGAATGGTGCTCCGTTAATGAAGT
GGCTAAAATAGGACCCAAAAGTGAACGGAGAGGGTATTTGTGAGACAATAGGTGAATGGTGAGGATATTTCAAAGCTAATAGATGGGTGAGGGATTGTTA
TGTACCATTTTTAATACTTTAAAAATGTTTTAGGCCCTTTTTCAATTATTTAATATTTTAATATAGTTGAAACAAAATAGTCTTTTTAATTTTCATTTGT
ACAAGAAACTGAAAATAATAAAAACATAATAATGTGTCGATAATCCAAAAGTAAATAAATTCATAAAGAGTTGATATTGCAAAGACTACAAAAACAAAAG
TGACATGACTAGTATAAGTTTACCTCAAAATGGGAGAGTTACAAAATGCATTTCTCAATAGGCCTAGTATAAAATCGTATGGAGTTGAGACCATTATGGA
AGAATAAATATATTAAATCAATTGGTATTTAACACCTATCAAATAAAAGATGTGATGAATAATACAAACATATAATTGTTTTTAGAGATTTTCATAGTAT
AATAATGTTTTGTATGTGTGGATTAATATCTTTTTTTTTATTCTTTATTAGTGAAGACAATTAATTTTTTAAAACAGAAATTTTTCTTTCATCAAGAGTG
GGAACAATAGAAGAGGGTTGTTGGGCGACGACCTAAATCGAAAGGCTAGATGTAGATCATCTATAGTTTGTTCAACATGAGGAATGACTAGCGGAGCATC
AGGATTATCTCCATATCATACCTCACGAGAGAAGTCGTCTTTGATTCATCCCTCTTTACAGTCCTGACTTTCCAGCACTTTGATCGGAGATCTTATTTTC
TTTAGTAAAGAGTTTTGCTAGCGGAGCAAAAACATGCTTATTGAATTCCATAGCATATGAGAATCAAAATTTCAATATTGATTTACATAAATTCTAACCC
ACATATAAACAAATTTATATATGTGTAAGAAGGTCATCAACTAAAAAGAAAAGCTTGATCTAATCATCTAAACAATAAAAAATTATTAGCAATTAACATT
TAATATCTTAACAATGATATAAGTCTATCACAGTTAAATAATAAATTTAAGTTGAAATGCATATTAATCAAATATAATCAAGTAATAGAACTTGTAAGTG
TATATCAAAGATACACGTCATACGTCATATATGCAATACTTCATTAATTTGATATAAATACTTAGTGGTATGAGATTATATTTTAAAACTTTTTCTTGTA
TGAAGTCATTTTCAACGACTTCTATATGATTGTATTTATTTTCATACCTAATTTGTTATATTTTTATTTTGAATTATTATTTTTTCAGAAGTAATTTCTC
TATTCTCATAAGGTAGGAAAAATGAAGTATTTTTTTATATATGACATATATGAAAAGATATTAGATATTACTATTGTGAGCTCTTTAAAAAAGAATTATA
TATATTTTAAGAGAAAAATAATGTAAAATTTATATCAATTTAGATTTTTAATCTTTAAAAATATGTTAGTTGACGCATTATTTGTGGATTTTGTAGAAGC
AATCACAGAAGTACCAACACATTTTTTTGACATGTAATGAAGTGATTAACTAGGAAATATAAGTTTTCGGCGGAATATCAATCTAGAGTTTGTTCAAATT
GACTTCTCATTTTTTTTAATAAGCTAAAATTTACAAGTTAGAAAATAAATGACTTATTTTTAACATTTTTAACTTAAACTAAGTGTTTAGAACAATTTTC
TTAACTTATTCGAACACTCAAAAAATATTTAAAAATTAATTTAGCTTAGAATTACTTAAAATAAACCAAATAAATCACTTCAAACGAAATCTAAATATTG
TGACTAGAAACTTTGTAATACAAAGTCCATATAAGTTATAAATTTCATAATACAAAATAAAATTTTATACAAAACCAGACTAATAAAATCCATTTTTCTT
AAAAAAATGAGCATTTCATCCGCAAACTATTTGATTGATTCTATGTAATACATATATACATGAACTTCATTTTTTTTCTCTTCCTTCTTAATTTGTTACT
ATATAATAGTGTGATTAAAATGTAAAATACATCAATTTGATTGTATATCATATAAATAATATGAATCATAAAATAATGTCCCAAAATTGGCTATACTATT
CACTTGCGCCAAAAAAATAAAAAAGCTCAAATAGTCCCTAGCGAAGACGAGCCTACACCACAGTGCCTGAAATTCCACACGCCCTTTTACCCTTCCAAAT
TTCATCATTTCAACTGAAGAAACAGCAATTGCTACCGGAAAAATGGGGGTCGATTACTATAACATACTTAAGGTTAATCGTAACGCCAGTGAAGAAGATT
TGCGTAAAGCTTATCGGCGGTTAGCGATGATTTGGCATCCTGATAAGAACCTTGGCACCAATAAGTATGAGGCGGAGGCAAAATTCAAGCAAATTTCTGA
AGCTTATGATGTTCTTAGCGATCCACAGAAGCGTCAGATCTACGATCTATACGGTGAGGAGGCGTTGAAAACGGGTCAGGTGCCACCTCCTCCAAGAGGT
GGACCCCACAACATGCGGAATCCTCATCCTAATCCTTCGTTCCGGTTTAATCCTAGAGATGCTGATGATATTTATGCGGAATTGTTTGGGGCATCGTCAT
CGGAGAATAATGGGAGGGCGAGGAAGACTCGAGATGGGTTTTTTAGGAGTACCACGAATGGAGGGGCTGAGTTTTCCGGTGCTGGGAACTCCAGTACCGG
AGGGTTAAGAAAGGCTGCGCCAGTGGAGAATGCATTGTTGTGCCGTTTGGAGGATTTGTATAAAGGGGCCAAGAAAAAGATGAAAATTTCTAGGACTGTC
TTGGATTCTTCCGGGTATGTTCAATTTGTCTGCACTAATTGTTGCAAATTTCTTGGTATTTGTAATGCTGTATGTTGCTGATGAATCAGGTTACTCTTGC
TGATTATATTTTTATTGAGAAATTCTTTGTGCATTTTGTTAAAGATTGGATTTTTCATTTATCGAGTAAGTATATGTGCATTTTGAGAATTTCATAAGAG
CAGTGCATGGGGATGTGTATGTTTTTAGGCTACTTTATCTGCTGTTATAACTTCACGAGAGCATTTTCAAAGTTGAATGAGGTTTGGGTGCGCATCACAA
TGAAATTTCTTTTCATGCCTAGTTTGTTGGTTAATATCTGGTGTGGTTGACTTGCATTGGTGAGATTGAGATACTTTGCTGAATGCATATAAAACATTAG
ATTTATAGTGCAGTGTTATCTTTACATGATGGAGTAGTACTTGCTTAGGGAACATAACCACCCTTTTGGAGTTTAGAAGATGGCTAGATTGGTTGGATGC
TGTGAATTTGTAGTTGGAAATTTGTGCATTTAGCACCAAGTGTGTAACTTGCAAAGGAATGAATGCTGTGAAGTTGTTAGTTGAAAATTGTTTCATTTAG
GACAAAGTGTATGAATTGCAAAAGAATGTGTATTATTAGGAGTTTCACTTCTAAGAGTGATTCTTTTGGAGAAAGTACTGCTCCATAAAGCTTAGTTGCA
AATTATAGTTGTAGTTGAAAGAAATTGCTAAGTTTGAACACAGATACTTGATTGACATACCAATGGCTTAAATAGAGTGATTAAAATACACAATTTGTTG
GAGGGGGGCTACACTTTGATGTAGTATAGCTGTGGATATATAGAAGTAAATGTTACCTTTCTCAAAGAAAAAAACTCAATTGTCTTGAAAACAGAAATGC
ACATAAGAGATTTAGTTGTAGTTGCAAGCTTGATCTAAGCAGAGAGCTAATCACCGATGAGGAGATCATCAACAATATCATATGAATATCCACTAATCTG
TTGAGGTCTTTAATTTGGATTGAGTCACTGGAGGATTAACGGGAAAGTCAGTCTCATCAGGCAAGTTTAAGCCTTTGTTCTTGTTCCTTGACTTGCTGAT
GATTGCTGAATTTGCAATTGATTTGGGGAAATGCAGACCTGGGAACTTGTTTTAGAAAGTTTCAGATCTCTGTAACTTGATGAATAATCAACCTGTTTTT
TATCAGTAAACGTCAACTCTCTTAAATAGAGGGCTGCAGTAGCAAAGTCCCAACAAATGAGAAATAACAAGCATCCTATAAATAGGAAATAACGTAAGTC
CAAATCCACTCCGGGAAGTTTTATTTCAAGTCAACAAAATAATTCAGAAAATATCAATCATTATCTTTCCTCTAGGCTGAACCTAAAGGATTGAAGACCT
GTTTAGAATCCTGGTAACGTTGCTTCACCGACAGTAGAGGAAAGTGACTTGCTCCAGTAACTCTTTAAGGAAGAAAAGGTTCTGAGAGTGATGCACTGTT
GCCGACAAAGATCTTGATCTTGATGGTTATTCTGTGGGCTTATATTAGAAATCTTGGTCTGTGGTATTTGACCTATTTCTGGCTATAAATCACTTCCATA
TGCATGAGCAACTTCAAAGGAGTTACATTGCTTATTAGTGTTAGTGCAGTGTTATGTTTCTATTCTAATCCTCTCAAAGCTGCTTACTGAAGGGTTGAAA
GGTGATTGGCAAACCTGTGGAAAATTTCTCAATGTATTTCAACCAAAGTAACTGATGCATCTGTTCTTCCAAATGAATGCCTAGATGCTAATGTCGAGTC
TGGTGTCCCTTGGATTTGCTAAATTTGTTCCTATGTAATCATCTTCCTTGAGCTTTCCTGGTATCACAATTGTCTTGTAGAGATGCCTGAAGTGATAACT
CCTGACCTCTTCATGCCTGGTGCTTGTCTTGTTGTCATTCCGATGTCCTTGACTGTATCATGGATCAGCATTGCGAGTCCATATACCATCAATTACTAAC
CAAACAAAGGTTTAAGGACTTTTTAAATATGTGTGGAATAGCCCTTATTAGTTGAAACTTCTAAATAAACCAAAGTAAACCTTATCAAAAAATATCCTTG
TTCTTTAGCAAATATTGAAGCTAACATTACGTCAATCATTTTGTAATATTGTACAGATGCTATTTATAACTTTATGACCGATTGAAATTTGTTATGGAAC
TTGTATGATTGAAACAAAGAGCTTGTATAGACGTGACCAACTAGTTGATAATAATGTAATCCACATAGAGTTTAAGGTTTAGGTAACTCCTACTTTTGAA
TTACAAATTATTTAGTATTAGAACAAAATAAGTTTGAATAGAATGGAACAGATTCAGAGGTTTCATGTGGTTGACTCGGTCTGATTTGGTTGAGCTGTAG
TTGATTGATCCGATTGAGGTTTCGGTTCCTAACTAGTCCAATGCCCAAGTTCTAATAGGAGGGAAGATCATTAATAATTTGAGCACGACTATTTGATGGA
GTCCGGAGCCAAAAGGGCAAAAAAATTGAGAGAAATTTCCGAAAAGGCAACAAAAAATAAGGTTCAAACCAGAAGGGCAATATTTAGATGGAAAGTGGGA
TGCCGTGAAATTTATGGAGTAAGGCGCAGCCTGACATGCGCCTTACAGGACGCAACCAACATGATACTTGTAAGTCGCATGCCGGCTTGCGCCTTATAAG
GGGCATTTCAGGCTGCGCCTTACTCCTTAAATATAATAAAAAAATGTTTAGTCACTGTAGTCTATAGTGGTGCGAAAATTATTCATTAAGAGACTTTGGA
GCTTATTAATTAATATTATTACTACTATTATCAACAATTTTAAGTTTAAAGAGTAGAAATAATTAAGAAATGGGAAGTAATGTTATAATGTATGAATTTA
CTTATAATAGTTTTGAGATATCAATTGAATAAATGGGGAATTTGTAATCGCTTTTTGGTGAAATCAAAGGATTTATTGTTTTCCATTTGGATTGTATATG
TGTATTTATTTGGAAATAATCTAACTATACACTAAAGAATGAAAATATTCTTTTAAATCTATTTCTTAGTCCTTGCAGAACATTAGGAAAAGAAAGTGTA
ACCCCACCCCACCTCAACTACCCCCACCTCCTCATAATGGCCAGATGCCAACTCTACTTTTCCATAAAAATGAATATGGAAAATAGTTTAACGTAAAAGT
GGGAATTAATAGAGAATTAAACGATGGTGACTGCTCTTTAAGCAAAAGTTGATGTTCTGATTAAGTTGTTTGAGTGAAGTAAAAAGTTACACAACTCTAC
TAAATGTTTTTTTAATTTTATTTTAAGGAGTAAGGCGCAGCCTGACATGCGCAAGCCGACAAGCAACTTACAAGTATCATGTTAGTTTGCGCCTTACTCC
ATCAATTTTTTTTGAAACAGGTAACATTACTCTATATATCCACAGGTAAAAGTGTAGTTCCCCTTCAAGCTTACTCCGTAAATTTCACGGCATCCCCCTT
CGGTCTAAATGTTGCCTTTTTGGTTTGAACCTTACTTTTTGTTGCCCTTTTGGAAATTTTGCTCAATTTTTTTGCCCTTTTGGCTCCGGACTCCTGTTTG
ATGTATCAAAAATAAATTTGATAGATCCTATCTTATCAAAAAATAATAAATAAACATGATAGATCCTCCAGTAAACTACTGTGGTAAATCTCGTGGCTAA
AGATATGCATAGCTTTTCTGCCTTTTCAAGCATTGTTACATATATGCAGCCCAAATGTGGTGCCGATTCTTAACCACACATAAGTGTGTCAATAACAAAA
TAGGTACTATTTTAACAAGAACACTCTATAACAAAATAGCTGCAATTGTCATTCTTCACTGCTGTATTAATAAAATCACATAAAAAACATTTGAAATCCT
CTTACAATCTATGGGTATTGTTTACAGAACTGACTATTCTAAACTCGTCTTTTGTACCTTCAATTTGTTCACATCTCTAGGTGAATTTTGGAATTTCTTG
GTTTAATTTTGTGATGTGAACGGGCAACTTTGATATACTGCTCCCTTTTTCCTTCCTTAGCTGTGATATACATCTTTGTTTGCAACCATAATTTCTAACA
AGTCTCGACTTTCTGCTTGGATGTATTATTGTTCTTTCCAAATACTTAATATTTGCAATTTTTAGTCACAGAAATCCTTTAGACTCTTAAAATACACCTT
ATTTAATTAAGTAACTTCTTTTAGAACCTTGTATAATTATTCGTTTATTCTCTATAACTTTATATTATGCACTCTTCCCTCATACACTAAGGGGTCGTTT
GGTTGCTGAATTATAAACAAGTTATCCATGTATTTATTTTCATATAACTTATATGATGTTAGGTAGGTAGATATGAAATAGGTTATTCATGTATAACATT
GATGCGGCGTTTAGTTGACAATTTGGAAACCCGCATAATTAATACATGTATAAGTTAAGAGGGAATCTATCTATTACATTATGCAGGATAAAATATGGAA
TAACTAATTCATGTATAAACTAATCCCAATCCCTGCATAACTTGTACATGCATAAATAATTCATAGATTCACTCATTACTAATCTTTGCATTACTAATCC
CTACAATATGCTGAGATTATTTCTTATCCTCTGTCTGGTTTGGTGTATCAAAGACAATTCTATTTTTAACTTTTCCCATCCATGTATTACCTTGTATTGC
TAATGTTATGATTTTCTGTATAAGTAACACCCTATAATATTAAGTAAGGTGTACAACTAATACATGTATTATTTATACATTGTAAATCCTACCAACCCAA
GGATTAAATAATACCACGTCTAATACATGTATTATTTATACATAGGCTGAAAATCTTTCAAAACAAAGTATGAAATAATAGCATGACTAATACATGTATT
ATTTTCTCTAATACATCCTACCAAACGACCCTTAAGAGTGAAATGGTTCTTTATAAGAAATAGAACTCGGGCCTACCAAAAACCTAAAGCTAGCTTAAGA
GGTAGTGAGTATTATCCGAAACCATAAAAGAAGACGACCCATTTCTTCCATTGATGTGGGACACTTAACACCCTCTCCCACACTTAGACATCTGGAGCAT
GGACAATATGATATGGGGGCCAAGTATTGGGTAATCTGTTGTTCTCGGAGGTCTTTTACCTGAAGTCAGCAGAGGAAATTGAGATTATGAGATAAGAAAT
ATGTGACTGTATGAAATGGTTTATGTTGCTTTGAATTTGGCTATGTGATCAGTATGAATATAAATTATTCGTTAAGTACTAAAGTCTCGGTTGGGCTTCT
AATCTTTAATTATTAGCCAACATTTTTGGTGTGTAGATTAATGATGACGGTCCATCAAGAAATGAACTTCCCTTGTTGGAACATAATTTTTGTAATTCAC
CAAACCCTGTTTTTGACATGAGCTGTTTGTATGTTATTTTTGTTTGTCATGTATACTTTAATTTATTTTGTATATCTTTCGACCTATAGAAAAGTTTGTT
GACAACTTGACTACTATGTGCTATGTGATGACAATTTGACCATACATTCTGTAATTTCGTTTCCTTTAGGATGTTCATCAATATAATTGATAATAATATA
TTATCCAGATCATGTTTTACTTTGTTATAATATGTATATACTTCTTTTCGCAGGAAGCTTCGAACTCTGGAGGAGATATTGACCATTGATATTAAACCTG
GTTGGAAGAAAGGAACCAAGGTAACTTTTCCTGAAAAAGGAAATGAGGAACCTGGTGTCATTCCAGCAGATCTGGTGTTTGTAATAGAGGAAAAACCTCA
TCATGTCTATGTGAGAGATGGTAATGACCTTACTGTCAATCAAGAGATTTCACTTCTTGAAGCTCTCACGGGGAAAACACTGGAACTGACAACACTGGAT
GGGAGAAACCTCATTATTCCATTGACCGACATTGTCAAACCAGGGCATGAGATAATAGTACCAAATGAAGGGATGCCAATCTCAAAAGAGCCTCGGAAAA
AAGGAAATCTGAGAATCAAGATAGATGTTAAGTATCCAACAAGGCTCACAGAAGCACAGAAATCTGACCTCAGGAGAGTTCTCGGCCAGGGGTGACCATA
TGAACATAGGTATTCAGATTACAAGGGGTGACTATATGAACACAGGTAGATAGAGCAGAATGCAGACGTTGGATGTAAATATAGGATATGCTTATTGCTT
GCAACTGGAACTGTGAATACTAGGAAGGTCTAGTAGCCTCAATGTTTTGGGGACAAAGGATTTTTGGGGGAGTTCGGATAGTGGTGGGATTAATTTTTTC
ATTGGTCGGGGACATATCCCTCCACATTATTTGATCGATAAAATATAGATGATGTTAATGCAAGCTCTTCTCTTCTGTTGCTTGTGATTTTAGGGGTCTG
ATCAAGACAAAAATGCACTAGGATCTTGCATTTGAGTTGGTTCAATGTTGAATTATGTCCATTATATGTTGACATAGAGCAAGATTTATGTTTTTCTCCC
TTGAGAAAACCCCCTGCTCTTTTCTTGGTCTCTTTTCTTCTTTTTCCTGCATCATGTACTGAAAAATGACAGCAGATCAGACATTCTTAAGTTGTTACAA
AATCCATTGTTCTTAAGCAGCACAATTTTGTGGTTGTTTTCCTATCATTTGGGTACTGCACTTAAACCTCTACAAGGTTTAGGACTGTCATAGTGAAGCG
CTGTTATAATGTATATCGACATTTGATATTTAGATCTCATTTAGCTATATGCGAAATTAGAAAGATTAGTGTGTGAAAAAGACAAGCATCAATAGCCTTT
CTTCGTGATGTTATGATCATAACTAATGGACATTATTTAAGTATAATTTTTCTTTTAGACATTCGTATTTAAAATTTACTATGTGCGTGATGATAACCAA
AAGTATTTTAGGATTTTTTTATTTTATACTTAATATATTTTTTACAAGTAGTATACGATATTTGGTAGGGAAGGTTTAAGGGAGGCTAATAAGGCCTTTG
CTTTACGCTCCTGGAAATTTGTGCTTCCAAAGTTTTTAATTAATGAGTTATTTTTACTTTTACTTAAATAAGTAAATTTAGATTTTTTTTTATATATAAA
AAAAATTATAATAAAATTGTCCACTCTTTATATTGGATATAATATTTTTTAATTTTAAATCAAACTATTTACATCTTTATATTAGTAAGTGAAATTTTAT
ATAGCATGATCTAGACAGATTAAATTGCAAACAAATGGACAATATCTATTAACTTGAATTAATTCTTATTAGTATAATTATTAGTAATTGTTATTAGGTG
AAGTTACACCGCTGCCTTAAATTTAAAATAAAATTTTTGATGGAATGTGCAAGATCATAATGAAATAGAAAATGATGATGAATTAATTGTCAATGTGTAG
TTAATGATATTGCTTAATTGCTTCAAAGTTATTATGTTTATGTGTCAATGTGTGATTTGAAGGTTCTTACGTATTGAGCTTTGAAATGGTATGATGAGTA
TGTCTAAAGTTGGAGAAGATAGTTCCTCCATAAATGAAATATGAAATAAAGATGATGAGATATGTGTCCACGTTGTATTTTGGAAATAGTTTCAAATCCG
CTTGTGTTGCTTGAAAATGATTAAGAATATGAAATTGGTGTTCTTCGTAAGTTTGATGCATTGACTGTGACGGATTATGTCCATGATTACATGTGTTGTG
AGCTACAGTTGAGTGCTTAATGTTCTGAAGAGACCTCGTAATGAAATATGAAGATCATCGAATATTTAAGCCATCAAAATAAAAGTTCAAAAAAATTGAT
TAAAATGTTAAAACGGTATACATATTATTATTAAATAGACAATGATAAAGGAATCTGCCAGCCATAAAAATCTTTTAATATAAGAATTTAAATGCTTTTT
AATAATATTTTGTATAAATAGTAATTCTTTTCAAACAAAAGTACTATGCATATTGATACTTACATTTATCTCAAAATTTAAATTTAAATAAATGAGATTG
TTGCTTAATTAGTTGTAATGGTTTTACAAAATGATTTTGCTACATCAAAACACTCGATAGAGTTTTACCTGATTATATTTTTAAAAAAAACTTGAAAGCA
ACCTAATACTGTAATTATACCTTACCAGTTTTAAATGATTATTACTGTCATCTTTTTTCTAAATTTTTTAATAATCTAATACCCCTCTACCACCTTCGGA
TCACTACCCTCCAAATTATTCGTTGCAGTAACTATTGATTTTCACTTGTGATTCTAGTTGTTTGGTAGTCTTCATCAGTTCTATGCTACAATTAGCAGTT
GTGGTAACATTAGTGGGTTGAAATGACTTAATCTGTGCTTTTCGTGAATTGTTCATTGGACGGGTCAAAATAACTTAACATGTAATAAATCTATTTAGAT
TGGTCTAGTCTCAAATGCGAGATAGTCTTATCGTTCTAAAATAAAAGCGAGATGAATAATGTTCAAATTCAATATGAATCTATGATATTATGTGAATCTC
AATGACGATGTGTCACTCTTTATACAAGTTGAAGAATGGTGTAAATGTGATGTGCTGATGCTAATGGCTAATTAAGATTGCAAGTTTCATGTCTAACGTG
TTGTTTAGTATTTGCTTAGTTATTTAGTGATTGTATACTTGATCTTACATCTATCGACTTAAATTAATTTTTAAATCTGTCCTTACATAAAACGAACTTC
ATTAATACCCCTCCAAATGAATATTGAATAGTTCCAAAGGTGCAATCAAATCTTAGAGATGTGAAAAGTAGACCATCAAATCTCTTTATGACATTCCACT
AACTAATTGTAAATATTGGTCCCAAACCGTGTTTACGTGAATATTGAATAGTAACAACGTACCCAACTTCTTATCTAAAAATTTTCAAATATCATTTGGT
GTATATTTCTAAGGTCCATAAAAACTAATCTAAGAAAAAAAGTATGGATCTCACTTGTCATTCCATGGATAGTAGTCAAGGGTGGACCCGCGTGGGATTC
AGCGGTTCACCTGAATTTCCTCAATAAAAAATTATCCGGTATATATAAGGTAAATTTTACGTATATCTGTAGATATGCAAAATTTTGAACCCCTTAATGA
TAAAGAGAAGATGATGTCGCAGTGGCAAGTTCCCCAGCAATTTAGCTTCACACCTTGAACAAAAATTTCGAGTCTGCCACTGATAGTAATAATAATTTGG
TTGAAGTTGAAAAAAAATATTTGAAAAGGTTGTGTCGATCATGAATTTTAATTTACTCGAAAAAAATGAAGTTTCATGAATAAAAAAAATACAATTTCAC
TTGAAATACTCTTTAAATGATTTTTTTCGACTTCAACTTGCAGATAATGACCTCAAACGATTCTATATATGATAGACTTCTTATGTTGATTATTTTTTCG
CTTGTTTTTTGCTCAGTGTATAATATCTATATTAAAATCATACTTGCATCGAATTGATAATTTAAAAAATCCTCTTTCTATAAAAGATATTTTTATACTC
AAAACTCGTAATCGACATCAAGATGAAACGTAGGTTTGGGAAGTAGAACCACTCATTGAGTTGTGAAAATGACAATAAATGAATGAATGGTAGTGAGCTA
CAATAAATAGAATAGACATACTGTTGAGAAATTAAAAGCAATAGCATGTGTTTCTGATTCCAACCAATTATTTCTATCTCCATGTTTCATAGCATGGCTG
ACCCCCTCTCCATGTGGATATATACATCCCCCAATATACTCTTTTGTTATTAAAATAGAATACATGATAAATATTCTATAAGTTTTATTTTAGGTATGAT
ATCATAATAATATTTTCACAATTAGATAATTTACAAATCAATTTTTATAGAATAATTAATAGCCAGAGGACACGTTGGAAGTAATAACCAACGTGCTACA
TATATTTAGTAATATATGATGTATATCCACACTAACTTATAAACTCTTTTTTACCCATAATGGAATAAAATTGTATATTATAGCAAATTATTAATTTCGA
ATTATATGTGTTAAATATAGTTTGATTTAACTGTACCATATAGTAATATACTGTTATTTTCGTCTCCCTTTGTGGTGGAATCTCGCTTGCCACTCTCGTT
TTTTGTGGCAGTCTCGCTTGTCTCTCTTGTTTTTATACAAACACAAATGTACAAAATATGTTTGTGTTTGTGTAAAGCAAGAGAAAATTATATATATACA
TATATTTTTGTTCCCTTCTCCCAGATCTCGCTCGCCGCTCTCACTTTATACAAACACAAATGAATACATATGCTTTTTGTTTGTATAAAGCGATAGGAAA
TTCTATACACGAATACAAGTGCCTATATTTCTGCACTATACATTTTATGATTATACAAATACAAGCTTCATCTGCCCAGTTTTCTTTTGTATTTCTCTCT
TTATATAAACACATATTATACACTTGATCTTTTGTATATGTATAACGAAATAAATTATACAACTGTTTTCTTTTGTATATGTGTAGCGAATTATGCAACT
GTTTTCTTTGTGTGTGTATATATATATAGCGAAGTATACATATTTATGTTTCCTATGGAGCGCAATTATGCAAACTATAACTATAGCATACAAATATGAC
TTTTATGTTTGCTACATGTGAAAGTTGTTCTTTTTTTAGCGGGTGTCCAGAGTCCACATTAGAGCATTGATCAAATCTGGATCACGCATTGCAAGGCTTA
TTCGAGGTGGCGCTCCCAATGAAATTTTTTTCACGCCCTGAGCTCGAACTCGAAACCTTTAATAAAGAGTGAAACAGTCTCACTGCTGCACCACAAGTAC
TCAACAACCCATGCTGGTATAACTGTACATTTGAAATTGTAACTAACTTCTTGTATCATATTTAAATGTCATGTTTCGCTTTTTTAGAGGACGAACTCAA
TGTTTCAATTTTTTTACAAGTAAAACTTATGTATTAAAAATTATATGAAAAATACTATAAGTTATAATTTTTCCGACCAAAAAAAATACATTTTAATATA
TTTTTGTAAGTTGTGCATGTGATGAATGATATATAGCCGACTGGATATCACTAAGTAGCAAGTGAATAAAAAGATGGTGTTGCTGGCCATACAGCTCTTT
GTCCACTGAATAAAACAAATAAATGACAAAGCATAGTCCACTTGCATGATTGAAATGGATGAAATTAAACAAATGAAAATAAAAAAAATATAATATAATG
TATATATTTACGAAAATTCTATATTTCATATACAAGTTGTATGGTTTTTAGCTTTTGTTTTTATTTAATTTTAGGACTTCTCGTTGAGATTCTCGATGAT
GAATAATTGTTTCTAGTACTTATGGAAAAACATATATTTCCAAATAAATCAAAATCGCATATATGCACGTACTCTCTTCGTCCATGATTAATGGTCATCG
TTTCTTTTTTATTAAAATTATAAAAACTTTAATTAATATTTTAAAATGTATTTTTTATTATATTTTGATATGGAAAAAATTGTAATTTATAATATTTTTC
ATTTTTTAATATCTAAATTTCTTGTTAAAAAATATCAAATTAATGTAATCTAATTTAACTTTTAAAATTAATTAAATTAATTTTCGTAAAGTAAAAATGA
CAAATAAAAATAGACGAAGGGAGTATTTTTTCTTTTGTAAGATTCAACTTGCTAGGAGGATGGAATAAATAAATTTATTCAAAATATAACAAATGTAGCA
AACTTATAACTCTTAGTTTTATCAAATAAAGAAAAAAGAAATGAGTACTCTCGGATTACAAATATTTCTTCTTTTTTATTACCCCTTTTAATTTTAATAA
TAAGTGTACTTTTTAAGAATTACACCTTTAGAGGTGGTTTGATAGGATGTATTTAAAAAAATAATGTGTTAATCTTTTATATTTACATACTTTAATGAAG
GAGTATTTGATAGATAAAACCTGTGATCTTTTATCTTTCCGGAAATTATAATATTTTGGTCACACTTCGCACATTTTTATTTATTTACTATACTATTTTT
GAATGTTCAATAACAATAATTTTTCGATTTATATATAGTGACGGGGTTAAATTTTCAATAAAATGATTCAAAATCTAAAAAAATAGACACAAGAAATATA
ATTGAAAGGAGCTCAACATCTACTATTTATATCTAAAAAATTATTTTAACCATATATAAATCATATAATTTTCTATCGAAGGGGATAATCCCCTCATAGT
AAAGTGGCTCTGCCATTATTTATACAACAACTGAATAAGTTATCATGTTATGTCTATTTTATATTAAATACTAGTATTTTTTTTTTAATGTTTGAATGTC
TTATATTTAATAAAAATGATTTGATAAAATTACTTTTATCATTTACTCTTTTTTTTAAAAAAAAATAAAAAATAATTGAATTAATAATGAATCACTATTA
TTGACATGCGATTAGTGGAATTTACATAGCAATTTCTTTAATTATATAATTGACTTTGTAACGGATGAATAATCGTAAACTTTTAAGGGATAATGTAAAT
AATAGCAAATTAATAATCTAAAATAAATGGAGTAGCTACTGTTTGATTTAATTGTGCCCCATAGCAAATGTTTGCCAAAGTTTGTCGGTCACCTCTCTCC
CAAAACTCTCGCTCGCCACTCTCTCATTCTCGCTCGCCACTCTCCCTCTGCTCGCCTCTCTCGCTTTATACAACAGAAGTGTATAAATTGTGTTTCCGTT
TTGTATAAAGCGAGAGAAAATTGTATATACACATGCAAAAATATATATCTTCGTGCTATACACTTAATTATACAATTTACAAACATTTTACTTCGATTCA
ATTGTATACAAATGCAAATTTTATACAAATACTGCAGCGAAAAAGGCCAGTGAATTATACAATTGTGAATTATACAGTTACAGTGAAATACAATTTTCTC
TCGCTTTATACAACAGAAGTTTATAAATCGTGTTTCTGTTTTTGTATAAAACGAGAGAAAAACATATATTTTCTTCCTATACATTTATAATTATACAATT
GCGCATTGTACAATTGCAGTGAAATAGGCCAGCAAATCATACAATTGTATATGTATAGCGAGGTCAGTGAATTATAAAATTTAGGCCAGCGAATTATACA
GTTGTATATGTATATCAAATTATACAGTTATATATTTGCTATGCAAACTTTGTTAGAGCATACAAATATAAATTTTTATTTGATATATATAAAAGTTAGC
TCATTTTTTAATCCTTTTTGTCACACCTACATACAATCACCTTAGATTCATCCGTAAATTACTTCAATAAAAAACAATATAAAAAACAACCAAGTATTAT
GGATAAAAATATGTATATGTGTGCACCTAGAAAATACTAAACCAAAATCAAATACTATCAATTTTTATTAATTTAACATCCCCTAAGCAAATCAGTAAGT
CAAAGAATACGTCGTCAGCCTTTTATATTAACTTTTATTTAATTTCGATTCGATTTGATTTTTTATATTTCTTTTAACACCCTAGCCATCACTTCTGTCT
CAACTATATACTTGCTGAAAATGAACATCAAAGAATAAGAACAAGTCTATTGCTAGTTGTAAAATATACTGTTTGAAAAGTTCAATCAATAAAACATTTA
AAGATTACAAAAACTCTTATAATAAAATGTTTTTGGCCATATATATGATTCTTAATTTATAAGTAATTATTAAAGTATATATGAGGTGTTACGGTATAGT
ACGGATGGTACCATTTCTTGGGAAATGGGACATGTCATCATGTGATATGTTTTTTTTTTCTTATATGAAGGTTTGGTGTTTGAATTATTACATACCTAGT
TTGATATCAATATTATTAAAATTTGATTAAATTTAGATCTGAATAGAAAATTTAAAGAGTAAATTATGATTTCTAATAAAAATAATTTTAAGCATTAAAA
TTAAAGCTAAAATTTTAATTTATAAATGAAAGATTACTTAACGCTCTGCTACTACGAAATTGTATTTATTGAATTATGGCCTTTGGTTATGAGAAAAAGT
CAGCCAAATAGCATATAGGTTTGTGAATTGATTAGGTACATGTGCCACATAACATGTCCTATGTCTTCTTTATTGTCTTTTAAACCCCATAATAACAACT
TGGTCAAGAACTTGTTTATTTTCTTTTTAAGTAATTTAAAGTTTGTGCCTTTTAGTTTTTTTGAAATATTCTATTTAATATTTGCATTCGTTTTCAATAC
TTCTTGCTCACCTAATTACACAAAGAACAAAAAGTATATGAAAAAAGTAGTTGGGGAGGGTTGACGTGATCTCCATATAATTAATATTTCATTCGTCACA
TTTTATGCTTAATTAATTTGAATTTAATATTAAATTTAAGATTTTTAAACTTGTGATCTAAAATAAGTAACAGATATTTGTGTAATTATAAATCATTTTA
TTGAGAATAAAATATGTATTATATAAAATTAAGTTGTCTTTTTTAAACGGACTAAAAAAATAAATTATATAAATTGAGACAGAAGAAATACTATATGATC
TACAAGTAATATGTTGAGTGTGTGTTACATATTGTTTGAGAATTGTTTATTATATATGTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAATCATTAAAAGGATGTGTGGACTTTATATATTTTCTT
ATTGACTTTTATAATAATAAATATTAAATTAATTATATATTATTATTTTAAAAAAAAAATTGCTCTGTAACAAAGACATTCGAACTCAAGACCCCTGATA
AATGAATACGAAGTACCTACTACTCTATTACAATCTTTGTACCTTATATTAAATAACTATGTAATCCCTCATTCAATTTTTAATTGTCATGTTGTGCTTT
TTAAAAATCAATTTTGACTAATTTTTAAAATTATGTTAATTCTATATTTTAAACAAAAGTTTAGATATTAAAAAATTATACAAAAATCACCGTAAATTGA
ATTTCTTTAATATTAATATGATTAAAAAACAATTAAAATTTTTATAGTTAAAACAATTACAATTAAAAGTGATTAGAGGAAATAATATATTTCAATAACT
AATTATATATGAATATATATATATAAAACAAATAATGCATTATATTTGTAACTTTAACCAACTGTCAAACAATTCATTAAAATTTTTATGAATCTAATAT
ATGGAAAAAGCCTGAGCTTTTTATGTTTTTAAATCTCAAATTATATAGCATATATTTTTTTAATCAGGAAAAAAATTACTTTTAAAATATATATTTTGTT
ATAAAATAATTTATTACAATACAAAATATTTATTTATTTATTTTAATTCAAATATATATATTTTTAAATTAAACTATATCACATAAATTTGTCGAAAGCT
TAAAATATGAGATGGCGATGGGAACGAGTAGCCAATCCAATTAATTTGATATTTACGAAGTATCTTCTCCTAATAATATTCGACTCCATTACAATTTCCA
CATACTTTCTTCTTCATCAAGTCTCTTTCCTCCATAGACTTATCCCCAAATATATAAACTCACCCATCTTAACTATCGAAATACCCATTTCGATTCTTCA
CTCCTTCGCTAGCTTTGTTGCTTCGGTATGTTTATGTACATATGCACATACTTTATACAATTTCAATTTTTCTATTTGTTCTTATAGTTTAATCGTTTTT
GTGTTAAGACCTAATGTGTGAAGGAAGACTTGCTTGCTAGTTTGATCTAGGTCAACTCTGTATACTTTCAAATTAAAATTTTGATATTTCGAAAAATGTC
ACATGAATTGGGGAGGGGACAGTAGTTATAAGCAGAAAAGTGTTGTTCTAGTTTCTTTAATGCCATGAAATTTAGTTTATAGCCTTGTTGGATTGGGTGT
TGGATTATGGGTTTGATAAGGTAAAGTGGGTTGAGAAATTTGACAGCAGAATTTAACTTTGCCTTTTATAGATGAATATTGAAAACAACAATTGAACTGG
TGATATTGTCATTTAATCTTTTCTTAGTTAACTGGGAGAGTTTATTGCTGATGTTCAGTAACTTTGTAAAAGAAACTAGAGTAGCAGTTGCTCCCTAAAG
TGTGACTTAACAGTTTGTAATCTTTAGTTCCAGGGAGAAGTTCGAGAATATTACCCTTTTTGGATTTGTGAACTTGAGGTGTCCCAAGTGTAATTTGTAA
AGTGTAAACTAACTATTGTGTTCTTTTCGTTTTAGAATTTGTTACTCGTTTAAATTGCTCCTTTATAATGACAGGTTCTGATGGTGTAATATATCATTTT
TTGAGTTTGTTTTATGGGTGACTTCTGTGAATAATCTTCCTTTTCATGCAATCGTTGCAGAGTATGGGCAATCTATTGGGCTGTGTACAAGTTGATCAAT
CCACCGTCGCAATTACAGAGCAGTTTGGCAAGTATCAAGATGTGCTTCAGCCAGGTTGCCACTGCCTGCCTTGGTGCTTCGGATTCCAGTTAGCTGGCCA
TCTCTCCCTCAGGGTGCAACAATTGGATGTTCGCTGCGAGACAAAGACAAAGGTCTATTCTTTATTCCGAAACAGTAATTCCATTGTTTTGACACAAGCT
GTGTTGGTTCGCAGCCAAATCATCAAAGTCAACCACAATTTGCACTTTAACAAACATAACTAGGTGATGATTTTTCAGTATTTATGCATATTAATGACTT
AATACATATTGCAACAAATGTGCAGGATAATGTGTTTGTCAATGTTGTGGCATCAATTCAGTACCGTGCCCTGGCAGACAAAGCAAATGATGCTTTCTAC
AAACTAAGCAACACTAAGGGTCAAATTCAGGCCTATGTTTTTGATGGTAGATATTTAATCTGTCTGTTTATATACTATTTCTGAGAATAAATTGATTTCA
ATGGGTAATGCTAACTTACACAAATCTATGTTTATATTTTGTCAGTCATTAGAGCAAGTGTTCCAAAACTCAATCTTGATGATGTTTTCGAGCAGAAAAA
TGAAATTGCCAAGGCTGTCGAGGATGAACTTGAGAAGGTAAGCCGATTCTTCAATGTTTTCTTAATTGATACAGGCAATTTGAATTTTTCATTGGATCTC
ATATGTATGTCATTATGATCCTTTATAGGCTATGTCGGCTTATGGATATGAAATTGTTCAAACACTTATAGTTGATATAGAACCAGATGAGAATGTGAAG
AGAGCTATGAATGAAATCAATGCTGGTATGGCTAAAATCTCATCTCTTTAGTTAAGCCTGATGCCTGCTGGTTCTCAACTGCTCTGACTAGTTAGTACTT
TGTCCAAGAGGACTATATACATCAGTTGATGGAGGGGGCTACAGTGGGATTCGAACCCACCATCACTAGTGTGAAGGTGTGGGCAGCTCCCCAACTGAGC
TACAAGCCACACTATAAAAGAGTATCTTTTCATGTCCTAATTGTTTTCAATTCTACAGCTGCTCGGCTGAGGGTGGCTGCTAATGAGAAAGCAGAGGCGG
AGAAGATTTTGCAAATTAAGAGGGCTGAAGGAGAGGCAGAATCAAAGTATCTTTCAGGGTTAGGTATTGCACGACAGCGTCAAGCGATTGTGGATGGTTT
GAGAGACAGCGTGCTCGGATTCTCAGTGAATGTGCCTGGAACCTCAGCAAAAGATGTAATGGACATGGTCCTTTTAACCCAGTACTTTGACACCATGAAA
GAAATTGGCGCTTCCAGTAAATCATCTGCTGTCTTCCTTCCTCATGGGCCTGGTGCTGTAAGAGATGTGGCAAGCCAGATCCGCGATGGACTCCTTCAAG
CTTCTGTGAACCATTAAATGTTTCTACTATATCAGAAATGTTAATTGTGTTTCACTTGAAGCAGCCTTTTTCATTTTGTGTTTACTTTCTGTTAGTGTGG
ATATGTTTGGCGAGTTTGACTTTGTATTTGTGAATGCCTCTAGTATCTTATATTGTAAAGAATTTAATATCCCAGACCTTTGAAGAATTATATACTATTA
ATAGATGGATGTGATATTTCTCCTCGTTAATTGTACCTGTTTATTTGTTCCTTTTACCCATTCTTCATCCTTGATGATTGATCTTTTATTGTTTTACTAG
CTATGATACCTAGACTCTTCAAAAATGTCAATGATTGTGTGTTAAAGTCGTCAATAGTAATGTATTTTTGGAGAATGACATGATGTAACATTGAACCTGA
AGAATCTGTGCAACTTAGCTTATTGGTGTGTAGTACAGGGTCATATTTTTGTTGTGTGCTATGCTAAAGGAAGGTGATTGATCCCTCAAAATAACAGGAA
AAATTCCAAAGGGAGGTTGTATCAATATTCTTGCTTGTTTTGGCATACACCTATTGGGCATTTCACCTGCTAGTTTAAGCGAGTCAAAAAGTTGATTAAC
ATTTGTGAAGGGACTTCTTGTTCACTCACATAGCTTTAACTTTTGTTTCGATTTTCAAGTGAAATGCATATTTTAACATAACTTTTAACGTTCAAAACAC
TATACAAATGCGAAGATTTATGGCCATCAAGGCCCTCCAATAAATCTATTGGAATTGGCTTTATATCAATGTAATATCATTATTCATACGTAATAAATTT
TTGGATACCCTTTAAGAAATTTCTGACTCTACTTATAGAAAAGAAAATAAATTTATAGATGAAATTAAATATGCAATATTTTATATACGAAAATATTCTA
TACCTTTAAAAAAAATTATGACATGAAAAACACGCTCTTCTCTTACAGGAGGCTTCCCTCATCTTTCACGTGCCTTCAAACATTATTTTCCTCGATATAT
AGCCGTAAAATCATAAATGCATTCAATAATATATTTTTAAAAAATACATCAATTGTATGAAATATATAATTTGAAATAATAATGAAAAACCCAAGTAAAT
GACCAATATGATTATAAATAAAGAAAAAAGAAAAGGCAACTAAAAAGAGTAGTTCCATAGATCTTGTATAATACACCCATTCACAAAATTCCTCCTTCTT
TACTGTTTTCCCCTTTGTCCTCTCTCTAAATTGTGTGTGCTCTTCTTGATCATCTGGTGTCCAGTTGAAGATTGTAGATGGATCATTCATGGCGTCCTCA
TCTTCCTCCACCACCAATTCAAGGTAGAATCTGTCCATCTTGTTCAATCTCACACTTCCCCTTTTGCCCCCCTCCAATCCCTTTCCCTTCAAACCCTAGT
TTCCGATATCCACCACCACATCCCAATCAACCCCTCTCCCGCCCTCCACTTCCTCCTCATGAGGCCGCTTACGACCCCTTCATCGATCATCGTGGTGGAC
CCCCTATGCCCCCTCCTCATCGTCCCACTGTTGATGGCTACGAGCATCATCCCCGCCCCTCAGATGTGTATGGAAATATGAAACCTACTTATGATTCACC
TGGTGCTTTCAATGTTGGAGTGAAGAGAATGAGAGTTGATGATTCATCGGGTACTTTTACGAATGAAAAGTTGACTAGTTTAGCTAGGTTTTCAACTGAT
AATGAGAGGAGATTGCAGCTGATTAACGAATTTGGTGGGGCAGCTTACGAATTAGACAAAGGGCGTGGAAGTTTTGATGGTGAAGAATATGGAAAATTTG
ATGGATTTTTAGGTGGAAAAAATAGCAATAGCAGTTATGTAGATCAAGGTTATGGTAATATGGATAGAAATCAAACATTTTGTGACCAAGAACGTTTTGA
GAGACAGCAATATCCACCGAGGGAAGGGAATGTACAGTTTGGACAATTAGGATATGACAAGAATTTGCCAGAGAGAAATGGTTACAAATATGGTAGTCCT
CGAGCTGATACTCACCACAATGTAGAACACAACCAACAGAATTGTGAAGGATCAAGGTACAGCTCAAAACTTGGAGGTGGTTATCTTCCAAGGCATGGAG
TTTCAGGGATGAATAAACTGTACAATGAACAGACAAGCCATTTGCCCGTGGATGGTCACAGTTACAACCATCATTATTCGCAGGCTTATGCAATGTCAAA
TCATGTGGATTCAAAATCAAATCATTATGGTTCCCCACATGACCAGAGGATTAATTCAGCTGACCGTAGTGGCACAAGCTTATATTCGGCACAGGGTTGT
AAGACATACGCTAGCCAGCCGCCACTTCCAGCTTCTCCTCCACCCCCTCTTCCATTGGAACCCCCTTTGCATGAACGTCTTGTCTCATCTTCACCTCCTA
GAACTTCGGCCTCATTGTTTCCAGGTTCTGTTGGTTCTTCAGCTCCTTTGTCATCATATTATCCTCCACTTCCGGAAGAGAAGTCCATGTCACGTTATCA
GCCCAATTTACATTTGTCATCTTGCACTACTATTGAGGTACTCCTTCAATTCTTTGTGGGATTTGTTTATGTTCTTCACTTTGCAGTCTGTTATTAAGTG
GCTCACAAGATAATATTATATAATAAAGGCCTAACCCATTGGTGGCCCCTAAAGTAGACACCTTAACTAAGTCATGCTTATTTTAGACACCTCATGTAGA
ATCATGTAGAATCTCGCTGTGTCATTTTGACTCTTTTTGCTTACATGGAATAGTGAGTGTGATACACTCATCGAGCGTGTGAAAAGGTTGTTTAGTTAAT
TTTTGAATTATTTTTTTCTTCTTCTTCCCCATTTTTTGTCACTATTTTGTCCAAGTTAAATTTCAATACATTGTGAATGAAGGTTTCAACAAAAATGACG
GAAAATGCTTCTAAAATTTAAGAATAAACCCATTCATAAAATTCTTTCTTAGAAAAATTTAATATTTGCATGGAAGTGAATTTAAGAAGATCGATAAAAG
CTTATTTCGATAATTTGTGGGCTTGCAAAAAAAAAATAGAGGTATTTGGAGAAGGCAATTTTTTTTTTTGTAGAAAGGTATCTGGATGAGAAAGTCATTT
GAGGGGGGGGGGTTGGAGAGGACTATCAAAGGGGTTCGTTTGGTTGGGGTGCGGGGTTTAGAGAAGGTGATTGTCCGGGGGCCAAGTCAAGCTTTAAAAA
AGAATCTTTCTGGATGTTTTGATAATCTTAATCATATCCAAAAGTAAGTAAGCCAAGCAAGGGAAATCGCCAATTGATTTCCTGATCAAATTAAGAACAA
AACAACACGCCCACAGGCTCGGCCTTAATCGAGTCGCCCAGGCCGCAAGCGATAAACAGGTAGATTCTCACACTAAAGAAGCAGTGGCTACTAGCTGCCA
TTGCTGAAGTCCAACATTAGGAACAACCTCAACCTGGTGGCCCAACCCAAGAAGCTGCTGCTGAGCGTGTAGAGGCTGGAGCCAAGCCTAGAAGGATTAA
TCAAGGAACTCAATGGGGTTTGGAAAGGACATCGGGGTAGGGTGAGGACGTGGGCTTTAGAGAAGACGATCGGGGTGGGGTGGGGATTTGGAGCAGGTGG
CATTGACTTTTTTTAGTTCGTTCAAATTTTGTTTTATTTTGTAATTGTTTGGGGGAAACTATCATGTGTCACTTTTATTTTTACTCAACATTTATTTTTG
AAAAATTACTTTTAACACAAATGAAAAATGTCATTGTTTAATTTGTCACTTTACACGTTATTTGCGAGTGTAACACACGTGATATGTTTTTGCTCATATG
AAAAAGGGTCAAAATGACAGAATGGGACCTTACATAAAGTGTCGAAAATGAGCATCTCTCAGTTATAGTTATGGTGTCTAAGTAAAGCATCGTGCCAACT
TTAGGGGGTCACTGATGGTTAAGCCTATAATTAACGTTGAAAACGTTATCTAATTATCACACAAACATTGGAACACTAGCTATAAAAGTTTCAAGGTCAC
TACCTAGTTGACAATGAAGCGGGTTGAGAACCATGAGGTCGCAGGTTCAAACCTCAGTTGAGCTGAAAATACTAGGTGATTTTTTTCATTTGTCTAAACC
ATGACGGATAGAGTTACCCTGTATACCCGTGTTGGTGGGAGGTAGCAAGTAACCCAGGGTTAGTCGAGGTGCATCCAAGCTTGCATGTATATTACAGATA
TAAAATATTTTCAAGATTAAATTTTTAAGTAGTGAAATTGTTCGTGCTTCACGTGTGCTACGTGGAAATATAATAAATTATATATATATTTATGAATATG
AATCTCTATGAATTGTTAATTTCTTATTTAATAACGTAATTATGTAAAATTTATATTCAAGTTAGTATCAGATAAGACAACATTGATATTTCTCTTCATT
TGCTTCATGATATGTTTTTCATCCTGTTTCAATAAACAAAATTGAAATTATGTGCATTCTTTTAAGTACAAACTATTCATATGTATATAGTAGAATAAAA
CATCTATAGTGGTGAAGTTAATCGAATAATATGTTGTATTACGTGTAAATGTTACTATGTATTTTAATTTCCTCTCATCTTTTATAGTAGCTCTGGAGTC
TCTATACAAATTCTGATTTCTTAAAAGACTTTTAAACTGCTTTATTTTTTCTTTATTATTACTTTGTTTATTTTAATATTAAATATAGTTAATAACTATT
GTAATGGAAACACAAAAGTTAGGAATAGTGTTTAAGAACAGAAGGTATAAGTAACAATATGAGATTTGAGTTATGAATAATTTGAATATATAATTTTATT
AGACATTAAACAAATAATAACTATGCATTGATTTTAAAATAAATAAATAAATGAATGGTGAAAATAAGAAAGGGGGAGTCAAAAGATGAATAAAATAAAT
AAATGATTGGTGGCTACATTGAGCCGTGTCATAATACTATTTTGAAAACCACAAGTGTTTTTTACGAAGTAAGTAGATTCATTTAAAGGCATCAAGAAGA
TGCAAGCTTTATAAGGATTTCTTAGTTGTTGTTAGGACATATCTAAAAATACTATACACTATCATATTCACAACGTAATTTAAATGAAAAGGAAAATTAT
AATACTTCTCAAACAAAAAAAATAACGATAAAAACAGATTGTTACATATCACATCATACAATTAAGGGAAAATGCTCAAATATGCCATCAAACTTCGAGA
AAAGGCTTATCTATGCCAATTCCTATTTGAGAAAAGGCTCATCCATGCCATTATTTGTTAACAGGAAACATTTTTGATTTTGCAATAAAATATTTGTTAT
TTGCAATAAAGTAAGTAATTCACTTTTTCAATAAAATAATTATGATTTAAACAAAAAAACCCACCCCCACCCCACCCAAAAAATTAAAAAAATATAGCAT
TTGTGATACAACAAGTTTAAAATACCATAAAAATATTCCAATATATTTATTTCAGTAGTTACTTGTAAGTAGTTCTTAATTTTTTTTTTATGGAGAACTG
ACATTCTTTTTTAATTCTTTTTTTTCTGATTTTCACTAATGCTGCTTTGCTAGTTTGCCATTTCCTTTGATAAGGAATTTACCATTTATACCTATGTTGT
GAGTATTTGTTTAGTCCCATCCGTCCCAATTTATATGGCTAATTGTTGTGGTGTCATACTATAGTAATTTGACCTTTTCTGGAATATCTTGTTGATATGC
GATTCCTATGTATTTTTTAGTTATGTTCTAATTCTTGCAAGATGGCTCACAATGAGGATTACACTTCACATGACGTTTATTTGGATAATCTCCCAATTGA
CGACTATGAATTTCACATCCTATTCCATTCCTAATGAATAACCCCCAATACATATATATTTTTTTACACTAACCCCCAACACTTCTTTAAGCTAAGTTTG
TGTGATATTGGGGGTATATCAAGCATTTGTATCCTTTTTTTAAAAAAATAGATATCTGTCTGTTTTCACCTTAAAGAGGTACATATGTGTGTCTTTAGCT
CTCTTCCTTCTTGACAAATTTGAGATCCTTTTTATGTGGAAAATATGGTAAAACATGCCTAATATAACTGATTTTTATGGTTTCACCAGCAAGTTCATAT
GCATCGTTATACTTCATCATCTATACGCTCCAGAGGAAGTGAACATCCTCTGCTAGAGGTACCTTCAGATAAGTCAAAGGCAATTGATGCTATACACATT
CTAAAGCATCCATACCGAGCTACCCGGCCTGATCATCTTGTTGTTATTCTTCGGGGACTTCCAGGTGCTTCTTTCTTTCCAAGAGCTATCTCATTTAGTT
ATGTAGTTGTCCGTTTGCTTTTAGTTGATATCCACTTTGAATGAAAATTATTTACCTTTATATTACTTGGTATGGAGACTTAACACCTTCCCCACTTTCA
ATAGACTCCATTAGCCCCCCCCCCCCCCTCCCCCCCTCTTCCTCCCCAGGGAAAAAAAGGAAAGAAAAAGTGAGCCCTTCTTGTTATTAAGAAAAGAAAG
GCGATTTTTTTATTGTGTTAAGTCTGCTGGAGACATATTTAAGGTAATAGTTTTCTGATTAGGTATTTAAAATTAACGTTGAAAGGTATGTCATAACAAT
TGGAGAGTTCTATTAATTAGTAGCATTCATATCAGTTCTTCATTTTTGAGATGGTGACATTTATGACTTAGAGATTCAGTGGTCCATGTAAAAAGATGAG
ATGGATGGTTTACCGCATATCATTTAGAAAACAAATTGGGGCACTTTGATCGTTAACTTCTTGCTTGCACACCTCCACATATATTGTTATTCGTTAGATA
TTGTAGATCGGTTGGTTTGATTTGGTATGATGTGGGTATGTTTAGTTGGCATTTGGAGAACGTCTGGATGAAATTGAAAAAAATAGAGGAGAATTTGAAG
TATTTGGAATAAAATTTCATTTGGAAAAGAAGGTTTGAAGTTTTGGGCGTGAATCCATTATTTCACTTGAAACTAGTTTTCTTCCTACTAAAATAATACT
GCATTGCGAAACAGATATTGATTTAGACAATAAAATAGAATTTATGGCCAAAAGGGGAGACATGTCACTGGATCATGACCATTAGAATCCTACTGTTAGG
TATTTTAGGCTTTCCAGGCCACTTAATGGCAGGCAGTCATGTTATTTGTCCTTTTGTGACTTCATTTCCTGCATTCTTATATGAAAATTTTCTTAAAAAG
GAAAGTTCACTGTGCCCAAAGAATTTGGATCTCTGCAAGTATTCTTCTTTTATTATCAGCTTTTTGTTATCTTTTTCAGGGAGTGGAAAGAGCTATTTGG
CAAAGATGTTACGTGACCTTGAGGTTGAAAACGGTGGCACTGCCCCTCGTATTCACTCAATGGATGAGTACTTCATGACTGAAGTTGACAAGGTCTTATC
TTGCTATCTTACTTGAAGTTCTTTTGATCGTCAATATCTCCCGCTTTTCTTCGTTTCACATTTTCAAGCCTCATATTAATTCCAGTTACTAGTTATTTCA
AGTCCTCTCCTAAAAATATAAACAAGGTCTTTCAGACATGCAGGTTGAGGAGAGTGAGGTTTTGCGATCTTCTGGTTCTGTCAGGGGCAAAAAGATGGTG
ACAAAGAAGGTTATCGAATACTGCTATGAACCTGAGATGGAGGAGGTAAAGCCATCTCTTCCTGAAATTACGAGATAACCGAACTTCCACAGAATTTGGA
GCCTTTAGTTTTGAGATATTTATCTGCCTTTCTATTTGGTAGCTTTATTCTATTTGTCTGCAGTGTAGTAAAATCCATGTTTTAGGAAGTTTATATCAGA
GATGAACAAAGATACTGGGGATACAACCCTAAAAGGTTTGGTCAAACCAAAAGTGCTTAGAAATTGTAAAATGATAAGCTAGGGTGACCAACTTATAACT
TTTAACTGATTTTGGCTTATAATTACTTTTTGTGTTTACCAAATGGCCTAGATAAGACAAAAAATTACTACTCTCTCCGTTCAAAAAGAGTGGCCTAATT
TGACTTGGCACGGAGTTTAAGAAAATAATGAAGACTTTTAAATCTTGCGGTCCAAATTAAAGTTGTGTCAAATATACAAAATTGTCCTTTAATATGCCAC
GTGTAAAGCTGAAAGTGAAATGTTACCAAAAAAGAAAAGAGATCATTCTTTTTGAAACAAACTAAAAAGGATAGGAGGTCATTCTTTTTGAAACGGAGGG
AGTACAAGATAGTTTGATCAACTTATATGCTTAGCCAGACACCCTCATAGTGTTAGCTATTTGTACAGAAGTTCAATATCTTACTAAAGGAATGATATTT
TGTTGGTTGCACAAGTTTCTCTTTGCCTAGTATTTGTAAGGCTAAGATGACTTTAGAATTGTAAATTTACAACGTAGAATCATGCAGTATTCAGGGTAAG
CAGTATTGATATTGAGTTCTCTTTGTCCAATTTTTTTTAAAAGTTTATTAAGGTTGCAATTTCTTTGTTTGCTACTGTTAGGTTCACAAGTTCTTACTAA
TGTAATGCTAGGGAGAGTGTAATTAGTCCTAGTTAAGTTTCCTCTTTCCTTTGTTTGGGGGTGGGTGGGGTGCATAAGGATTGGATTAGAGTGTTATGGA
CATAAAGTAAACAAGCAACTATGGTTTCTCTTTTTCTCCTCTTTTTTTTCACTGTGAAAAAGGTGGAGGGGGGGGGGGGGCGTTGTGTAGTAGAAAAAGT
TTTTCCTCCTCTAACCATGAGGTTGAGTGTTCGAGTCACCAACAATTTGAGAAAAAGTTTTGTTACTGGGATGGGGTTTTGAGGGGGCCGAGTTCACCAT
ATCAACAAAAAAAACATTTTCATATTTGCATGTTAAGGAAGCTATATCTTGAAACTACGAGGTAACTCGCTATGTACAGTGGTTCAATTCTTTTTTAGAA
GGATATTTCCAGTGATTTATTATATCTTTTGGTAACAGAAACATAGCATTAGAAACAGTTTGCGCGCCCATATGTGCATTTCTTCTGTGAGTTTAATGTT
GATGTAATTAGTATATTGTAGTTGCATTTTTCAAGAAGCTTGTCTCTTCTATACTGTATGCAATTTCTGGAATCAAATATGGTATAGAGGTCATCTTATG
GCATTTCCAGTTGATTTTTATAGGTTTGATTTTACTAGTTTGCTTTTTCCAATTTTCTGCAATTTAGTGCCTTGTATATATTATTTCTATTGATATTTTC
TCTCTTCTTCAGGCTTATCGTTCAAGCATGTTGAAGGCTTTCAAAAAGACCCTGGATGAGGGGGCTTTCTCCTTCGTAATTGGTATGGTATTTTTGGGGC
AAGATAGCTCTTACTCTGTAATTCCACATATCTTCTTTTTGTCCATAATCTCAGACTGACATGTGAAATGGTTTGCATCACTGTTTCCTCTTTCAGCTGG
ATGTCTATTCTTTTGTTTATTGTGTCTGTGAGATTCTCCAAAATTTGCTAGTGAAATGATTACATGCTGCTGTCAGTTGTTTTCTTGTGTCATCTGTTGC
TCTCTATTGGAGCATATTTCTATAGAAAACCTCCATTTTGTTGGATTTAGGAAACTTGAAGGTAGGTAGCATCCCATAGGTTTCTTGATAATAGCTAGCA
CATTGGTTCTTCAAGTCATGATAGATTGTCTAGTTAAAATGTCACCCATAGTTTAATTATAGATTAAGTGGTGATGCAGTGCCTTGCACTGCCTTCAGTT
TACTAACTACAGATGCAGTTTTGTTCGGCAATTGACCCATTTGTTGCTGGTATTTGTGCCTCATCTTAGTGGATGACCGCAATCTGCGGGTAGCTGATTT
TGCTCAGTTTTGGGCATTTGCGAAGGTATACTCTCAGTTCTCTCTATTATGCAACCAGTTCAAGTGCTATACTCTAGTTCAATTATTTTCTAGGATACTT
TGAATGTCTAAAAGTCTTAAACCTTTCGTGTGTATATATTTTGTTACTGCTTTATAGTTTGTCAGTTCTTTCAAGTTTTAAGTATTATAACCTTTGTTGA
TCTAGAGAACTTGTGGCCGCAACAGCTTTTCTGTTGTTGTCCAATGTGACTGGGTGGATACTGCGAGTTTGAAAACTCACTCCATCAAGTCCTAATATAT
TGTTATATTCGTATTGTAGTATCAGTTTTTGTTAGTTGCAATCTGTTTAATTCATTGTGTATTTTACCTCAGTTTCTATTTTTTGTTGGTCCACTTAAAA
GGACCATTTCTTGATGACTTGTAGATGAATTGTTTGTGAGTTTTAGCTCTTTCTTGACTGCTGGTGATGATTTGATATAGTTTCATGCATTGTTGTAGAG
TAGATTTACTAAATAAGAAAAAGCAATCGACCTGTCTTTCATTTTTGGTTATGTTTGGCTGAACATTGTCATCAATATTTTGGTGGTGATTTTGTTTGCA
ATTCTCCATAGACATTATTGCCGTGTCTTGTTTTGCTCACACTAAGCTTGAAGTTTAGTATAACACAACAATGTGATAGGTATTGCCAAGGATATCTTTA
TCACATCTCCATTTGATTGAATAGGCTCCTGGATTTTGGAAAATATGAGTATACTAGTTCAAAGTTCGTTCAAGATTAGTTATGATGTTACCAAGAACAG
TATATGGAGTAGTTCGGTTTGTGGTAGGATATTGAAATCTTCAGCAGATCATGTTTTTAATCTTGAGATAATTGCTAATCGATGAGCATAAAGCTTAATG
CATCGACTTGGACAACTTCTAAAACTTAGCTTTTTATTACTAATTGCTAGGATAAAACTGGCATATATTTCAAAGTGCAGGATCATCAAGCTTGAAGCTT
CAGACTAATTTAACCAAAGAACAATGCAGAATTATAAATTTTCAGTAAGCAAGCTCAATATTCATTTAGGATAGGGCTGAAATCCCCAGCTAAAGCAACA
GAAAACTTGGATAAATGTTGGATTTAGCATCTCTTCCAAGTTCCAATCTACAACTTCTTAATAGAAACTATGGATCTGTAGATGACAAATGGCTTAAGTA
TTTGAAGACTTTTCTAGAGCTACCTGCTTCAGCACTTGCCTTCCAGTCGATGTATTATGTTGGTTATCTAAATACAGCTAAACAACTGTGTATTCAGAGT
GCACAAATTTGTGTGTGACAACTGCATGTATGCATGCATGCATGCATGTATGTATGTATGTATCTCATAAAGAACTTTTAAGATCATGAAGGTTTGTTGA
AGGATCTCTTATTGACAGATCATATAAGCTTAAATTTGTCTATTTTACTGTACCAAATTTTCCTTCTTTTGGGTTTAGGTTTGGTTGTTTGGAATGAGGT
GTTAAAAGAACTGATTTGATGGAAGTGGTTGAATATGTGAAGATTCCAAGCAACTAATTCAACCATACAATTGAGGTGGGTTTATGTTTTAGATTTTGTA
GCCAAGGAGACTCGAGTCACTAGGTTTGTCCTGTAGTTATTTGTATTTATAGTATAGTCAGTTTCTGTTCTGGCTGGTTATTACATAAATTAGTTTAATA
ATTCTTAGCCAAGGTGGCTCGAAGTTATGAAATCGGTCAAGGTAGATACCTGGGTTTGTGGGAGGTAGCAGTACTCGGTGGAAATTGTCGAGGTGCATGC
AAGTTGGACTGGACACCACTGTTATCAAAAGGAAAAATAAATAATTACTCTATGTCAGAGTTCTTGCTTTTTGGATAGGAGTGGTGCTCCTTGCTTTCTA
AATTTAATTGCTTGTTGCATTTTGTTCAGTGATGCATGCTGCTTCTGTTACTTTTGCAGTGTTATGGCTTCTCGAACTGCTGATTGTTTTTTTGATGACC
GATTATCTTCTTCGATTGTTACCATCACATCTATTTAAGAAAAGCTGATTGCTGCCTCTATGATTGCCATGGTTGTTTTCTTTGCTTATTTCCGTTGCTT
ATTATTTCAGAGATCTGGCTATGAAGTGTACTTGCTAGAAGCAGCTTATAAGGACCCAGCGGTAAGTTAGCTCATGTATTTCTTTGTTAGCCACAATCTA
ACATTAAGCATTGTATATGTCTGTGCATTATCTGATACGCTGAAGATACTTTTTCAACTCATGTCCTTGTGGTTTCAGGGTTGTGCAGCAAGGAACGTGC
ATGGTTTCATGCAGGATGATGTACAAAAGATGGCTGGCCAATGGGAGGAAGCTCCATCCATGTACTTGAAACTTGATGTTAAGGTACTTTCTCCTTAAAA
CTATCTTGTTGCATAGTCAGTCAGGTTCTACTCGCCTGGACTCTCAAGTATAGCTGAGCAATTTAACTTATTCCAGCTAAGTAGTTGTTAGTGTAGCCTG
TTAGACCTTGTGTGAAAAAGTTAGTTTTATCAGCTTGTATGAGTTGGATGCTAATGTCATCTGTCCTTATGGTTTACTTTTATTTCAACAATGTGACAGT
CATTACTTCATGGAGATGCTCTGGAGGAAGGTGGAATCCAAGAGGTATATTTTCTTAAAACCTTACCCTAGGTTCAGCATACTCATGACCATGTGAGCAC
ATAGACACTTGCATATGTTCAGAGTGTAAGGAATTGCTTTTTATCGGGAATGAGATAGACAATGTTATCCCATAAATCAGTTATGCCGCCACATATATGG
GATAACTTGTCCTGTCATTGTAATGCAAATGGTGGGATAAACAATCCCGGGACTTGTACCCCTACCCCTACGCATGATAAATTGATCGTGCTTTAATCTC
GAGATAATTATTCCTTATCCTCATACCAAAAGTCCCCTAAATTTGTCCGGAGAGTTCTCTGGAGGCCCACCTGAAGTTGCGGATAGCAGGTATGGAATGA
AGAGAGAACTCTGTGCAAGACGTCCACTCAATTAGAAGAGGTAGAGAATGGGATGGATAATGTTATCAAAAGCAAACAGCGCAAAAAAGCTCTGTGGTCT
GTTGGGGCTTTATGTGAAAATAAAGCGTGAGCTTTAATGGAAAAGGTGCAAAAGGAGAAAAAAGTACAAATATATATGTTTAGTCTAAGTCTCCTAATTG
TAAGCATGAATGTCAAATGTATAAACAACAATATTGAATTTTTTAAATGATAAAGTGAAATATCAATTGCTTAGTACCACATCTTTAGAAGAGGCTCATT
GGCATGGAGAAGTATGCCTTAGCGCCTTGATGATGACACTAAAGCGCACATTAAGTGAGGCGAAGCGCTCGACCATTTTGACCCCCTTTCCCGGGCATAA
GCGCGCCTTTGACAACAATACGCATGGGATGCCCCCACTGCCTACCTTTTAGATATGTTCTGGAGTATCTGGAAGGAGATAAAAGTTTGGGCTTTTAGAT
ATAAAAAGATAAAAGGAACATACTAGCCTATGCTAGTATTTGTCCATATTTCCAAATTTTTTTTGCAAATATTATTGGGGTGAAATTACACCATGTCTTT
GGCCATAATATTTGGGTACATATTTCACCTTTTTTAGAAAAAAATATGATTTATACCCACAAGTTATAAAACTATCAACACTAATCATATGTTTGTATTA
CAAGTCAATTGGATCTTCGTTGCAACATATTACAAGTAGTGTCTTTGAAAATATGGAAGGAGAGGAACCTTAGTGTCTTTGAGAATATGGAGAATACTGT
AGTTCATTTTGACTTTATGTTTTTGGTGTAACCACATATACTCTAATGATATTGTCTCTATCATTGATGGTCTTAGACTCATTATAAAGATAGAACAGTA
GATTTTGGTTTCTTTTGAAATATGGTTTCACTACAACCCAAATACTGTGTTACAGAAATAGAAACATTTACCTATGTCAAAAAAAGTTAAAAAAAACAAG
TAGTGTCCATGACACTGGAGTAACGTGGTTGTTTGGATTGAGTGCAACAAGCATCATTCCAGGCATTGTGAAGCTTTGTTACCTTGAGCCGATTGTTCAT
TATTTTCATCAACAACCATATCATCTCAATACAAGCGCAATCAACTACTATAGAGGGTGTTATTGTAAAAGATAAAAGTTTGGTGTAGAATTTGAATTTT
TAAAAGATCCCAAATAATGAAATTTAGTCCAAATACTAGTTTTTTCTACTATTTGGGAATTTGGGCTATTTGCCAAATAATGACAAATTATATGGACAAA
TAGTATTTTCGAAGTTTTCCCCCAAATTTTACTTGGGAAATCTATGGCCAAACGGGTCCTATGATTCTGTTGGAAATGCTACTTGGGAAGTCCTAGTTTT
ATTTTATAAATTTTGGCTTAAAAAAATTCTCATAGCTTGTTAAGTTATACAAAAAATAAAATGAAATTAGTCCTGTAAATTTGTATCATATAGCTTTTGA
AAATATTTTCCTCTGTTGTCTTATAGCTTATTCGTTTTGTAAAGTGGCTTTCATTTACAGAACTAAAAATTAATATATGAATGGACCAAGTGGCTTGGAT
GGTTTTTGTTCCTACTTGAAGTGCACAATGAACGGTCAGCATGTTCTAATTGCAGCGAAGGAAAGAAAAGAGATGTTGGCTGATAATGTTCCAAACAGCG
TATTTCTGAAAATTAACAAATGAACAATAAATAAGTTACAAAAGTAATAATATACTAGGAATATCATGTGATGTCCACCAACTTGTAATGTCTTCATTCA
CATCTTTTTCAGGATAGTACCGAACATGTGCAGCTTGTGTTACTCAGAGGTAGAAACTTCTAAATCATGAGTCTTATTTTGGATCTGCAGGTAGACATGG
ATATGGAAGATGATGACTCATTTGGAGTGCCTTCCACTTTAGAGGAAGAGAATATTGAGAAGTTTACAGTACCTCCCCAAGAGGATATTCCAGCATGTGG
TATGTCATGGATCTGTCCAAAGGGTCATTTGTATTTCTCATGCTGCTCCTGTATTGTCTCTCTTGTTGTATGTCCTAAGTTCTAGTTAGTAAACATTTGT
TGTGATTAGCAAAGCGGGAATTCAGTTATGGTGGTTCTCCCTAATCAATTTGTGATGATTCTGGTGTAGATGGCATAGTTTCCTACCTTTGCAATAGATA
TCGCCAAATCAGTCCCTTCCTTTAAAATTTACATTTGTTGTAGTCACAGTAGGTCATGTGTTTGTTTTGAGGCTTAAAACAAGGCTGAGCTGATTTTAGC
GTTTAATAACACAAAGGACCCGGCTTTTGTGGTGGTTGAACTTGGCTGATTTCGAAGTTCAACCGCTAACCCTTAGCTTTGACCATTGGGTGGAACCTAT
TTTCTTTTTCAATGCTGGTTATTTCTCAACATCGATTGGATTCTGTCTAACATTATTATTGGATCTCTTCAACTTTATGCATACCATTCTGAAGTAGATA
CAAACAAATTTGTCCTTTCTTCATTGTCTTGGCTACAAAAAGCATCTGATCATACTTATTATGTAATTTGATATCAGGCGATGTAAAGGATGATCAGGTT
TTAGACCATGAGGAGGACCACCGAATAACTGAAGTAAAAGAATTGGCAAAGAGTAAATGGTCATCTGATTTGGATGAAGATAATACTCGAAGAAATAAAG
ATGCCACTAGAAACATAAATGCTCTCTCTGGGTTGATACAATCTTACAGCAAGGAAGGAAAGTTCGTACGTTGGGGTGACCAGGTAACTTTTACGACGGA
CGATAGCTATTCGTAGTTCTATATTGATGTGTTTTCTTACTGAGGGATGATTGGTGAAACTTATGTCCGCTCTCTGTTCTCTGCCTGCTTTCCCCTTTCT
GCTTTTACTGATGTGCTCACCAGCAAAGGCTGACCTTTTTTCATTCGTCATATCTTTACTTTTTTCTCGTCCTGTCATCTCCTGACACTTTACATTAGCA
AAGGTCTGGTAGATGAATTGTTGGGAAGACTCTACCCTTCCATCCTCAATGTTTTTCTTTGAAAAAGTGAATTTTTTAAAGAATGTAAACCAGGAGTCCT
ACATCTTTTAGAATGGAAATAGGAGTCCGGATTTATTTTTAAATAAAGAATGAGTTTCTCAACACTATAGGTTGTTTCGGTGTCTATATTCTCATATATC
AGAAATGTAAATTGATTAAAAAAACTTGGAAGTGTACGGATTTTTATTCATTGGATTGGACATGTGGTATTTCAACAGTTCTTCCCTTGACAATATTATT
GTGAATCGGGATGCAGTATAGTTCCTAGATAGCTGATATTGGTAACTTTGGGATGGCATAAAAACCTTGTTGTAAAGGCTTGTTTATTTTTCCAAGGGGA
GGGAAGACTTGTAAGAATTCGATTAAGTGGCTCCATCTCGTTGCAAGGCTAAGTTGTTTTATGGGGGCAGATTTACTTATTATCAAATTACATTGGCACT
AGGGGAGGGAAAAATCATTGGAGTGAAATAAGTGTTCCATCTCATTAAAAGCTGAAGTTGTTTGAAGGGGAAGTTCTCATTAGGCGTTGGCCGTGAATCA
TATTTGCATGCCTATTTATCCGTTATTAAGGTTGGTTATTCAATGATTTTTTCAGATGTTGGCATGTAACTTGTTTCAGTGTACTAACCTTATCTATATC
CGGCTACCAAAAACTATGTTGTATACGTCTTGGAGAGGAAGTTGAAATTACATGCAGCTACTAATCTGATAATTGTTTGTTCGCCATCTGTTCTACTGTT
CTTCTAAAAAGAGGCACTAGCTCAATTTCTTTGCCCCAAGTGTATGTTTGCTAGGGAAGGAAATTTCCCATTTTCGGTTAGTCAAAAAATTTGGGGAACT
TTTTCTCTGGGAAAACAAGTTCCTTTAGAATGAGGAAAATGATTTCCCTTGTTTTCCACAAAGTGCCTTTCCACATTAATTGTGTCTTCTCCTCACCCTC
CAACACACCTCATCTTCACTCCACAACCTTGTAGCTCCCATCCCACGCCCCAACCCTTACCTCCACCCTCACTTTTTGTATTTGTCTAGATTATATATAA
ATGCTTTTAGAATAATACTTTTTTGTTTTCCAAGAATATAAGTGGGTTTATTACTTATTCTCTTGTGTTCAGTACATACACACCTAAACTTATGTTACTT
ATCCCAGGTAACCAAAAGAGGCTTTTCTATAGGGGCAGCAAAAGCAACCAATGTATCTTTAATAATTGGTCCTGGTGCAGGATACAACTTGGTGAGATTC
CTCATGCAACTATTGTTTAACTTGTTCGGCTCATCATTGTCTACATCTTGATGCTTATTGGCAATATTATGCTTGTAATTATGCTGCTTACCTTTCTAGA
GTTTTTGTTATTGTAATACAACATTTAGTTTTGTAAACTACTTAAAATGGGATTTTGCATATACTTGGAACCCATATTATAGCTGGCCTATTGTCATTTT
CAGAAGTCAAACCCTTTACCTGACGAAGAGAAGTTGACATCAACTCGACATAGTGGTGAACCAAAGAGGCAGAACATATTTCAAGAGAGATTACGAGCAG
AGCACGAGTCGTTTAGGGCTGTTTTCGAGTCCTTCAGAACTGGTTCTGACAAGAGGCGGCCGCGGATATCTGGGCTTAATGCTGAAGATGAATAGTGCAT
CTGTAGATAGGGGTTTAAAATTGCATATTTGCTATTTTATGTTTTGCTAATCCTTTGCCATAGAGGATGACTGCCCAGTGTCTTACGCTGGGGGAGGGTT
TAGCCATTTCTATTGTAATATAGTGTAATTCGTGTAGCAAAATAGGTAGTTGATGGCCTTGACTGGAGGGCTATATGCTATGGGTCCATTGCCTCTGTAC
TACTGGAAATTTTGGTAATGAAGGTTTTCAATGATAGAAGTGGTTCATTAAGCAATAAATGGATGTATGGAAGACAAATATCTTGTAATCATTGGCTTGG
CTCATGAAAACAATTTTGATTCGGGATGTTTAAGAGCCCGTTTGGACTAGCTTAAAAGTTGGTCAAAGTTACTTTTAATTTTGTTTTTATTTCTGGAAGT
GTTCGGTAAATATGAAACATAATTTAAAGAAGTGTTTGACAAAGTAAAAAATGACTTAAAATAATTCAGAAATCAAAGTAGGTCTCCTGTTACTTCTTTT
TTGATCTAAAAGTTATTTCAGTTTAACTTTTTTATTTTTTATCTTAAAAGCAATTTTTTTAAAGTCAATTCAAACGGGCGCTTTTTTTATTTGTCTATGT
TTGACTTTATACATGTCTTGAGAAAGTAACTAATTAAAATTTTAAGTTTACTATAACACTGTTGGAATATATTAAATTCTATACGTGTCTTGAGAAAGTA
ACTAATTAAAATTTTAAGTTTTCACTCATGTCATTAAATATGGATGGAGAACGTATTAAGTAGAGGAAGAGATGAGATGGCACACAAGGACAATAGAGTT
TTCACTCCTCCCATCTATTTGTGGTCTTGGAATTCAACTTTATAGCGGCTAAGATGTGTAATGGTGGCCCATTTCTTACATCATCTATGGCAAATAATAA
ACTTCTGCGTATATAAAGTAAAGACCATACTTGTTTATTGGGTTTAATTTTGGGTGTACAAATTGGTTACATTCAAATTAAAAACAATATCGATTCCCAA
ACTTCCATCTTAATGGCTGTAGGTGTAAGGCACTGCACCATAAGGTTCATGGAACTTGAATCATCATCACTAATGAAATGTTTGCTCTTGTCTTCACCTC
TATATAGAAAGCAATCAGTTCACTTCTCCAACTCTTCTACTCAAGTAAGATATAACGAATCGATTCTACAATTTGTGTGCTCTGTTTTTTTTTTTGGGGG
GTCTTTTATCTTTTAACTTGTAACAGAGATATAATCAATGTTGTTCATTGTCGATGAATGGATGCCAAGGCGATTCAAGAGCTCCTATTGGAATCGTTGA
AACTCGAACTTTGCCTGCAGTTTCTAGCCCTGCATTGGCCATGGAACGTCTCAATTCTGCCATCTCCGATATGATTAAGTCCGATCCTCCGCCTTACGAT
TCCGGCATTATTCGCCTTGAGGTAAATCCCCCAAATTTATCTGTGTATTTTATCGCTCACGTTTATGTGCATCCATCAGAGGGAAACGGAACAGAATACT
AATCATACTCTTTTTTTTTTTTTAATTTTCTATCTATATTCGATATTCAAAGTCGGACTAAATCTAAATTCACGTTAAAACTTTTTTAAAAACTTCCTAC
TATAGAATATAAATTCACGTCGACTAGGAATACCCTTCGGTAGGAATCCTATTATCTAGTGTATATATGACACGTGGTTGGCTCAGATTGGCCTATAGAA
TTCCTGATCTTAGTCTTATCTACCTCCAAAAAAAACTGCTTCCAAAGTCCAAATGATTAATTTTCTACACACTACGAATAATAGCTCGTTAGGCTATATT
TTATTAATAAAGTCTTATCTACTTCCTTCCTTTATTTTTTAAAAATAAGAGGTGCCTTAATTTTATGAAGATGATTTTAAAAATAAAAATAGAGTGTTTG
GAATTTGAATTAGGTGATGAACTTGAACCTCTTGGACTGTGCAGTAAATTTTTATTTTATGTTTAGGAGATTCAAAATTATATGTTAAAATTTTAAAGGA
AATTTTTTTTTATCTTACTTTGTGTGATATTTTTTATTTCGAGAGTTAAATAATTAAATTTTAACTGTGAATTCGTGCATAGAATTTTTAAAAAAATTAA
TTTTTTTTATATATTTGAAAACTACGTAAAAGTACTGCAAATTACAATAATTGATAATTTTAAATATTTGAAATAAATATAAAAAATTTACGATAAAAAA
AAATTGTTTGAATTCGAAGGTCGAAAGATGTCATAGGGGTGGAAGGAATACCTTATATGTATAGTGTATTTTATTGCTGAGAGGTTCGGATTAACACCAT
CACCTAGATTTGCTTTCGATCAAGAAGACATTAGTACAGTTCTAAAATTATATTTTTTTATTTTTTTGGAATGAATAATTTCTTTAAGGGGTGTATTTAT
TTGAGCTAAAACTCCATCTATTTTTGAATGTTTCTTTTTAAGGAAAGGCTTTTTTTAATTATTTTTTTGGTATTTGACCAAGCTTTTAATAAAACAAATA
AATATTTCAAAGAAATCATAGAACTTGTTTTTTTATAAATTTTAAAAGGGAGCTTTTCTCCATAATATTCTATAAATCAAAGGGGTATTTCAAATAGTCA
GATGGGAAGTATTCTTCAACTTCAATAGTAATTCTTTGATTTCAAGTTATCAAAAGAAGTATAGAGGTGAGAACTCCTACATAGGAAAAACAAATTAAAA
AAATATGACTTTCAAAATTATGATCGAATATAAATGACTAATCTAATATAGGTGAATATAATTTTTATTGATTAGGCTAATCTTTAAAAAATGTTTTTTT
CAAAAAAAAAAAATATATATCTAACAAATATACTTTTTCAAATAACCTTATTTTGCTAGTATAAATATTTATAATTTATTTTATATGAAGTTCAAAACCA
ATCCTCATTGTTGCTTTCATAAGATAAAAATGAATAGACATTTTTATCTTAATCCAGATGATTCATATAATCATCAAAAAAAAATTTATTTTATTTAGCT
TTTACTAGGTTATTTTGTTTTTAATAAAAGTTATGGTAGTAGCAATAATCATATAAATAGGGACTAGTGATATTTTGTTTTAAAATCATTCTAACTTATC
TAAAATTATAATGTGCTGATGCTTTCCATTTTTGATAGTGTTTAAGAAATTAAAAAAAGAACTTAAAGTTTAAAAGTTTAAGAACTTTACGAATAAATGT
GAACACTTAAAAGTAAATTAATTTCGAAAATAATGTAATATGAGACGGGAGGAAGTAGTTGTTATGCCATAAGTACAATTTTGTTTGAAATACTGATTTT
GATATCTGAAAATATGATAACAAATTTGTGAAAATTCAGGTGCCAATTGAAGAGCAGATTGAATCACTTGAGTGGCTTCATGCCCAGAACCATCTCCTCC
TCCCTCGCTGCTTCTTCTCCGGTCGAAGAGTTGCTTCTGAAATGTGCATCAATGGAGCTTCTTCTCATTCTAAATTGGTCAGTGTAGCTGGTGTCGGTTC
AGCTGTCTTCTTTACTCATTTACGTCCCTTCTCATTAGACGATTGGCGTGCTATAAGAAGGTAACTTCATGCCTGACTCCACTTACTAAAATATGCACAA
TTCCCTTTTTTTTTTGTTTGCATTGTGCTCCCCAATGCATGCAGAAATTTTGTTTTGTTTGTGCCCTAGCTTTGGGTTGGTGGTTTGCTTAGACTTGGCC
AATACAATACTCCCCTCATGGCTAGCTTTTAAAGTCATGTGTATCAGAGCCAGGAACATCCTTGTTTGGGGTTCCGCTTCATGCTTCAGTTGGGTCTGGG
TGTGATGGGATATCATTTTGATTTTTACTTTGTGTTGCCATATGATGTGAGTTGATGATTTCGCTAGGGCTAAGTTTATATTTGCTTAGCTTGTTTTATT
TTTATAAGCATTACTGTGCATGGTTAATGATGTTTCATGCTATGTTAGTTTTACTAATTACAATTGAAAATTTGGAGCTGCTAAACTTCACGAATAACTA
TAAACTGGACTCGCTATGTAGTTTAATTTAGTATCATAATCAGATTGTTGGAGCTGCTAAACTTGACGAATAATTATAAACTCGACTTGCAATGTAGTTT
AATTTAGTATCATAATCAGATTGTTGGAGCTGCTAAACTTCACAAATAATTATAACTGGACTTGAAATGTGGTTTAATTTAGTGTCCTGATCAGATTGTG
GGAGCTAAACCTCGGAAAAAAAGAGAACCAAGCATGCTTAAGGATTGTTTTTCAGCTTAGCAGAAGACTTTAGTTGAACTCATTGTTAATTTTCTGAACT
ATAGCATCGTTTTATCTCTGCCAAAGGTTCCTCTCCAAGAAATGTCCACTAATTCGTGCTTATGGGGCAATCCGATTTGATGCAACAGCCAATATAGCTT
CTGAATGGAGTGCTTTTGGCTCATTTTATTTCATGGTTCCTCAGGTAAATGAATCGACTTTCATCTCTTCATTGCTTGGGAGTCTTTTTTTTAGACATAT
CGCCTCTTGAATATAATCCATCCACTGCTAGATGCTAAATGATAGGTTGAGTTTGATGAGCTTGAAGGAAGTTCAATTATTGCTGCAACTATTGCATGGG
ACAATGCTGCCTCATGGACATACCAGAGGGCAATAGATGCACTTCAGGCCACAATATGGCAGGTCTCCCCTTCTCACTTCATTTAATCATTTTGGTTTGG
TTATGCTATTTTATTCTAATTTTTCTCCATTCCTCATTAACTTTTCCTTTTAACTCCATGTTTATGAAAATGCAGCTTTCCTCCGTTCTTATAACAGTGC
AGAAGAAAAATCCCCATTCGCATATACTTGCCAATACACATGTGCCGGGTAAAGCGTCTTGGGACCATGCGGTTAACCGTGCTTTGCAAATAATAAGCAG
AAATGACCCTGTACTGATCAAGGTTGTCAACCGCTTGTGTTTTCTAATCACTTATGCTCTTCACCTTTGACCTTATATTATACCAAAATATTGTTGTTTT
ACTGTAAAATAAAGTATTCCTGCTTGTTATGGAGGACTACAGAAGTAGCCAAAGTAAAATGAGATAATCTGATGCACACTTTAAGATATAGGTTCATAAA
AAGTAAGTTTAGGTGGTTTTGACACGCATACCTTTTCTTAAAACAGGTGGTACTTGCTCGTAGCACCAGAGTTGTGACAGCTGCAGATATTGATCCACTA
ACATGGCTGGCTTGCTTAAAGGTGTTCATTACCCACCTTATTTTTTTGAATACTTCACTAGCATATTTTCTCTTACTTTTGATAAAATATAGAGGGTTAA
GTTTGCAGGTTGAAGGAGAAAATGCATATCAGTTCTGTTTGCAACCTCCCCATTCGCCGGCATTCATTGGAAACACTGTAAGTCAGAAGACTTTCTCAAT
AACTAAATGGTGTCATGAAGCAATGTAAAAGGTGAAGTCCGTGTAGTCTGTTTTATGTTCTTCAATTGATAGATCACATTAATTCTTTGGTGTGCATCCT
ATCAAAGTAGTTGCTAGTTGCTCCAGGTGAAATGAAATTATTATCACATGAAGCAAAATACTTTTGAATTGTTATATATCGCAGCTTCTGTTATATCATC
AAATATATAAAGTGTTATTTTGACCAAAAATATAATTTCTGTGATGGTGTATCTGGTAAAAGTCAAAAAAGAAATATGTTAATTATGCTTAAACTTTAAA
AATGTTCCAGTATGAAATCCTGAAGGTATGGTCTTTAATGTTGGAAGAATTCCAAGTCAAATTTCCTGACCAGTGGCCACTATCATTTTAAAGCCTGATC
ACAACCATTCCTAATGCGCTCAAGAATTTCAGAATAGACTCTTACTAAATATCTGACGACTGAGCTTTCTTAAAATTTGCTTTGACTACAGCTGTTGTAA
ATACACATGGCAAGTCTGGCTGATAATTTATACTGGTGACAGCTGGATACTTGTGACGAATCATCTATAATAAGTTGAAGTAATCAGAACCCATACCCAC
CCCCTTCTATTGATCCGAAGCATCAAGCTCACTTTTGAAACTCTCTAGTGCCAATTATTAGCTGTGGTAGCAAAAACATCTGAATCTTTTGTACACTTAT
TAGAAACGGTGAGGACATAGAACAATTTTATTTATTACTTATGCTCTTTTTGAATAGCCAGAGCAGCTATTTCATCGGGACCGCCTCAGCATTTGTAGTG
AGGCTTTAGCTGGAACACGGGCTAGGGGTGGATCAGAGCTTCTGGATCTTAATATAGAACAGGATTTACTATCCAGGTTCATCTTTCTGCTTTATGTTCT
ATAAAAAGCACTAGGTCACTATTATACTTATTTTTTTATTGGTGTATTGTTTACTATATTCTTATATTTTCTTACAGCGCTAAGGACCATAATGAGTTTG
CTATAGTACGGGAGTGCATAAGAAGAAGATTGGAGGTAAGCTTGGTTAAGAGGTTTCTGAACAGAATCTTAAGAAATTTCATAAGGGAAAAAGAAATTTT
GAGATCTCTAATTGGGGGATTGCACTTGTTCATTTTAGTTTGGTGACATGTACATTTAATTTGACTTTTTAATAATTTTGATGTCAAACTTGAACTATTC
CGGCCCTGGAATTTCTATAGTTCCTAATCCACTTTTAGGACATCTCAGGAACCCTTCATGTTGTATAAAACTAGTTGGCCTCTCTTAACATTATTTCGTT
TCATAGGCTGTGTGTTCAAGCGTTATAATTGAACCAAAGAAAGCAATAAGAAAATTTACAAGAGTTCAACATCTTTACGCTCGATTGAGGGGGAGACTCC
AGGCTGAAGATGATGAGGTAAGTCTTGACGTCTTCTATCCCATTCATTACTTACCGAGTTTTAGTTGATGCAGGGCCTTATGAGACTCTTTAATGTAGAC
AGGGAAAGTTTGCATGATAGCCTTGTTTATGGTTTCTTCAAACTTTTGTTGTTCCCCCTGATTGGGACTGGTGGAGTTGGTTTTCATTGTTCTTGAGGGT
TATCGTATGTTTTATGAGAACCAAAACTGAATGAAGCATCTATTAGCATTTCAACCGACATTCTTCTTGAATTAGTTCATAATTACTCCCTTTAGTTGGC
AAAAACTATAATTCTGAATCTCTATTATCCATAAAGATGTGGTGATGATATGTATAGATCATTTTATTGCTTTTTCTGTTCCTTCTATAAAGCACCACAC
TAAGCATCTACAGTTTTCCAGTTTAAGATATTGTCATCCGTGCACCCTACTCCAGCAGTTTGTGGGTATCCTACAGAAGATGCACGGGCTTTTATTTCAG
AAACTGGTACGTGCTAGTTGGTATACCCTTGCATGTTTGACTTTATTCTTGAACTAGCTAGCTCTTTGTGCGCACCAATAATGATAGATAGCTACTTATC
TTGGTTGAGAGATTAAAAAAAATGAAGAATGGACGTAGGCTTTTGTAGCTAAAGGATCACTTTGCCCACTCATTATTGCAAACCCCCTTATGGAAAGCCA
GATTCCTCTTGCTACAAAATGCTTATAGGTATCGGCCCTAGGCTTCCATATGAGGCCTGGACTCTGGTACTTGGAAATGCTGTGATTAGTCATACAATAA
GACTTTAATTGATGCGTAAGAGAGTATTATCATTTTATGCAATGTCTTCATACAGACAGAATAATCAACTCAATGGCTTCTTGAACCTTGTGTTCTGGTA
TATGAGTTCTAACCAGCTGATGTTTCCCAGAAATGTTTGACCGAGGAATGTATGCTGGTCCTGTTGGTTGGTTTGGAGGGGAAGAGAGTGAATTTGCGGT
TGGAATAAGGTCGGCTTTGGTTGAAAAGGTGAGGTTAATACTTCATAGCACTTCACCTTTCATTATAGAGTACATCTCTTGCAACTTTGCAAAACTAGTT
TGCATGCATTGCTCCACAGTATAGTAAGAATTTGCTGTTGGAATTTTAAAAATATAAGTATTAAAAGGCATATGATGAATATTTTTATGAGAGGCTAATT
ATTTAAGACTTAAGGTCTAACTGATCAAGGAAAGAGGCTCATCCACATAAAAACTTGTATGATAGTTTAGTTCTCTGTCCAAATTTATTTTATTATTAAG
TATCGATAAACTAGATATATTTCATATTTTTAGTTACCTTTACCTCAAAAAGATAAAGATTAGTTCCATGTTTACTATTTTATATGTTAGGGAAAAAACT
AATATTATGTTCTAAACCAAATTTTATTGCACGCATATTTAATATAATCAAAATCTTACAAGATTAACATCAAATAATTTTTTTGTAACATTTATGGAAT
CAATTTATATGCTTCTGACTTCATTTTTAGAATTCCTTTAGGAATCCAGCCTTACATGACTTTGGCACTTACAACAGATCTGAGATTGGATATAGGCACA
AAATGCATCATTTTGTTTACTTTCTGCATAAGCCTTTCCAGTGATACGTATTTTATATATTGCTGATGATGAAATGTAATAATTAGGGTCTTGGCGCACT
AATTTATGCGGGAACTGGGATAGTGGAAGGAAGTGATTCATCTCTAGAATGGGAAGAGCTAGAGCTAAAGACTTCACAGGTATCCTTAACAATTCTTTTC
TATGCTATTAGACATGTCTTTTATTATCTAGAGTGTGAAGAACTCCTCTACCCTCTGACAGCAATGACAACATAATATTTTTTCTGCTGCATCTTTCTAT
TGTCTCCTGCAGTTCACCAAATTGATGAAACTTGAGGCACCTCTTTTGACTAGAGGACAAAGTAGGATTATCAATCAGAATCAGAAAGGTTTGTCATGCC
TGCCGCATCGTATTTAGTAGACATTTGTGAAAAGGAGAGGGGGGGAGAGAGAGAGAGAAAATTATACTGCCATCTTTTCATATTCTTTGTATGCAAATAT
CATCAACCTGTCATATGCAATTTTGGGGATGCAAAACTAATCCAAATATTTAAGATTTTACTCATTGTTTTGGATAATTCATTTGCTTGAGCACTTTGAT
TTTGCAACTTACAAGCTACTCTAATTATTTTTGTGTGAGCAACTCTTTACAGATCTTACACTGATTGATTAACATTTTTGGCAATTTAGTGAGATGACAT
TTTCTTGGAGGAGAGATGACGTACGTCAATCATATGATATAATACCGTTATCTTCAGCTTTTGATAGCAAATCAGATAATATGATTTAGCTTCCATCTTT
CGTTACCAAAATGCAAGAGAAATCAACACCCAAATTTTCATTCTTATTGTTTGTTCAATATTTATGTAATCAGTAATTGCCTTAGCAAGCAATTATGCCC
TTCGATTGACATAACACAAGAAGTAGAAAATTTGTATAAATGATTACCTTGTACAGATGTATATACTTTTTTTTGTTAGTGGAATATCTGATTCCAAAAC
TAGGGATATTGGTGACAAATTACAGAAACCTTCATGTTTGTGTTGTAGAAGAGTAATATCTATCTTTTACAAGAACACCTTCTTGTTCCTAATGTGTGAT
CATGAAAAATAGCTATATCACTTCACATTGCAGTTTTATTTGATTTGTCACTTTTTTACATTGATTGAAGGAAAAAGGACATTGTGTCAGGAATTTACAG
AAGCACAGAGCATCAAAAACCTAAAAGTTTTTCCATCTTAGCTCACACTCATTCTCCCCTTCTACTTACCAGCATTGCATGTGAGAGGAGAAAGGGAGCA
AACTGACTTTCTATAGTTTCAAGTCCTATTTCTATTCGTAACTTGGTGCAGACAAGCTCTAACAAGGCTTCCCCTCAATGCAGTTCAAAGAGCCTGAAAA
TCTTGTTAGCCTGCCTGCGTCTGATCCTGCCCTGGGGTGGATCATATCAGGACCCGTCGTGAATTTATGATTGGGATCTCCAGATTCCACGAAGAAGGCT
CCGTTCATCATCAGATCTCCCTGTGATCTCCACACCCAATTCTTCCACACACTCTCAGGTGAATATTCCCTTTTGGTCACCTACAATAAAAGGTAAATGA
GAATGAGCATGTATCTTCAACAAGAGTTAGTCACGTGTAGTATTCTTGATTTGTTCATTCTTTTCATAAACACAAGATTGTGATGCGACCTTGTTGGTTA
TAGATATCGTTTATCGTGTTTACCTCTTTAGCATTAGGGTTAGGCGGGGCGATGAAACGATTGCCCTGGCTGAGGATGGTAGGTTGTTGACTACCACCAA
CGGCATACATTAGCCAGTGAGTATAGTCATTGTTGACAGCATGAACAAATCCCCATCTCACTCTTGGCATCCTCTGGATCAGCCCTTGGCCAAAGTGATT
AAAAGCAAGTGTTATTTGTAGGATTTCGTCCTGTTTGAAGCTGTCACTTGCCCCAAACAACATAACCTAAACAAAAACATATTGCAGATATTAAAACATT
CTGGTTGTTTGCAGTCTCTGGTAGAAAATGTTATCAGTATATAGAATTTAAGCATTAATCCAGTTTTGGAGCTAATTTACGTCATTATGATGGGTGAAAT
GGCAGTTGGAAATGGTAATAGCAGTTGAAGCCTGCACGGCATCAATGAGTCCATCGTCACAATTAGACATGGAAACATGATCAATCCAAATGTTTGTTGA
TCCATAGATTGAAATACCATCACCATCACTTTTTGTTCGAAAACCGTAATGATTGATCGAGTCTCTAATTAGTCCACCATTACCAGCCTTTATATCATGG
ATATGAAGACCATGAATAATCACATTGTTTATGTACTGTAACATCAAACTAGCACCACCAGTAATATGCACTTGTTGTCCTCTGGCATCAATTGTCTTGT
CGCCTGTCATAATAAGTTCTTGGTTTAGCTTAATGACCATGTGATGTGCAAATATGATCCATAGTGGCCCTGGCTGAATGACTGCATGGCGCAGTGTCCC
TTGCTTAGGATTCACCATATCGGTGTCCCCAGGGTCAGTTACTTCGTAGATTTTGCCACCTTTGCCACCAGTCGTATGATGGCCAAATCCTAGAACACAA
TCTGCTAGCTTCTGGCGATTTTTAGCCCAATGTGGGTCACATCTCCAGCAACGATCAATAGGGTTTGTAGCCACGCATGGACCATTGTACTTGTGCAAGT
CCCTTCTTGTGCTATTGCTACCTTCTTCCGACCTACAAATCAAAATAAGATGAAAATGTGATGGTTGACTGTACCATGAAAAAACTTGCCTAGGTGAATC
CTTTTACTAGTGTGTGTGTGTATATATATATTATATATATATATATTGATTATTGAATCTCATGGACGTGTAACTAGCAGCAAAAAGGTGTTCAAAAATA
CCTGTGAACATGTTTGTTGAAATTAGCTGCAACTTTTTCAGGATTAGGATTATAGGATTCTTTAGCATTTTTATTTGCTTGGGTGGCTCGAGTCCTCCAC
ACCTCATCAAACTCTCCAATATTAGCCTCAATGCTAAAAAATAGTGTGCACAAAATTACAAAGAAACTCGACCTATTTATGAGAGTTACCATTTTTCAAT
TATGGGTTGCTATATTTGTAAGCACATTCTTCTCTCTCTTTACTTGAAATTTTTGTTTAAATAAAAGTAAAAAGGGAGAGGAAATGAGAATGAGAAACAA
CGAGGGAAAAGTGGGGAACCGTTTTCCCTCTTAACGGTCAACTGTTGGTCTACTGTTTTATCCAGAGATATTGGCCGGTGTTTACGTAGTTTTCATGGAT
TCTTTTATGTTGGTAATTTTCATATATCATATGAATAAGTGAAAGACAAAAATATATTTAAAATTCTTGTTTTAGTGCATCTGTTTCACCGCAATCTGCG
TTATTATATCCGAAAGAGAATATTTACAAGATTTTTTTGGAAAGAATTCGTTAAGGATAACAAAAATTTAGGTTAAAATATTACATGAAAGTGAAAGAAA
ATCTCAAAAACTATTTTGGGTTCATTACTAAACAAAGTTTGTTTTTTATGCAAGAGTTAAGTACATTTACCCCCCAAAAAAAATCAAGGTGCTTGGATTT
ACACATGTATTAAGAAAAGAATTAGCAATGACCAAGTTAATTAAAATCTACTGCAAAAACTAGTTTACAAATTGTCACCATGTCAGTTGTCAACTGCAAA
CATGCATTCCAAAACGACAAAAAGGAAGTACGCTTTTTTTCGTTCTATTGAGTTTTTTCAATGCTATTTTTTAAAAACTAATCAAAACAATATCCAAAGA
GTCATAATCTAATCGAATGATATACTCTTAACTAGGCTTAGAGTACAGAAAACATGGGCAATAAATATATTATCGCGTATTACTTTAAATAAATGAAAAG
GCATGTCTGCATTCTTTCTGTGGATCGTGTTGCAAAGCCAAGAGAATGGAAGCTCTGAATCAGTTTACTCATAACAAATGCAATCGACACCATAGGTCTC
ATTCACCCATTAGTCCAATAGAAAGAGACGCGGTTGATCTTGTCAGACTCTCCAACTGCATATTAAGCATAAACTGAAAACCAGGAGATATCAACCTCAT
GCTGCATCGCCAGCCACACTGCAACATACATGAGTATCAAATAACTGCATTACTAACGAGCCAAAAGAATTGACCAATAGAGTTATGCTTCATAATTTAA
ACAATGTGAATATCATTCGACCCCTTGGTAGGATGACTGGGTAAAAATAAGATAATGAACGAAGAAGATTATCCTATTCATGTATTGACGAGAGTCACAC
AGGAATAAATTTTTAGCATGACCAGAAAGACGAGATACCTATTTGCATAAATAGGGATCTTCATAATGTCAAAACATTACTTGTATAACTAATAGAATAG
TCAATAGGGTTCGGCTTCACTGAAACTTCAAAACTGAATTTAATTTGAAATAATGCATAAACTTGTCAACAGGAGAAAGAAAGGAAATCTACCCAAACAC
ATAACTCACAAAATAGCCATGAAAAAATTAACAGTCAATATCCTATTACCTATAAATTTACGATACAATAATAACGTGAATAGTGACAGCTTTCATTCCC
ACAGAGGGGAAAGAGACTAAACCAACAATAGCCAAATTACCAAACCCAACTGCAAAAGCACAAGTCTGTTTCATCTTCCATTTCACCACCTTCCATCAAT
ATTATTCGTTTAGACCAAGTGTTAATACACATGGAGACGCACAGAAGGACACTTTACCCGGTGCTGGCCTAAAATAAACATTGGTGGTACTTCCAAGCAG
CACAGGCGAAAAGGAGTTAACACAGAGGGAGGAAAGGGAGATGGTGGTATTTGATAAGAGGAATGTCAACAGACATAACGATGGCTGTAATACAACAGCT
AAGCAGGCATATTTAAGTTGCCAGCAATAGTGGTTCCAGATTATATTTGATTGTCTTGATAGTACGATTACATAAAGTGATTGGCTGTTGACTAACATTG
CAGAATGGGGCTCTCCGGCATAGGCATTTCCCCTCCATTAATTTTTTTTTTTTTTGAAAATGGTAAACTTTAATTCCCCTCCATTAATTAAAAAAGGAAG
AAAATTGGAATTTCAAGGTACTCCAGTATGTTATATACTTTAGAAGGATGGATAATTTCTCGACAACCTATAATTCATCAAATAAATAACCAAGAAATCC
ACGAGCACTATCGGCCCACCCCTCTATCTTTTTCCACTTGAATACCATACTTTATGCTGGCAAAAAAGGTCTCACACATGTGACTTGCACCTATTCCACG
AAATACACATATAACTTATTGCGCTGCTCTTACCAATAGACCAAAACCCTGGGGCTTCATCAAATGACTTAATAAAGATATCAAACATGAATAATCCTAA
GGCGCAAGTACATTAAATACCATTGTGGTTCTATTTACTTTGGGTTGCATTTGAATTGCACGCATGCCCTATCTCTATCATACTCACTGATCTGTGTGAT
TCAATATGGCTATAGACCGTTCCAGATTTAAGTTCACATCATCCAAAGATTAGCAATTCCACCACTAAGCTATTCAATATCTATGAATGGTCAAGTTCTC
AAAGATTAGCAATTTTACCATATTTCCGAGCTATTTTATGTCTATGAATGGTCAAGTTCACATCATCCAAATATTAGCAATTTTACCACCTTTCCAAGCA
ATTCAATACCTATGAATGGACCAGAAACCACATCCAATATACCATGTTCTCTTTTTTGATTACTAAGTGAAACAGATGCTTATAAGGATATTAGCAGCAA
CAACTAATATTAACGCTATGTGATGTGAGTTTGCTACACAAATTTAAGAACGTAAAAACAGGTATACAGACCATTGAACATCCTCCTGGAAAAATGAACT
TAGAGATATGTTTAATACTTAAAGCTACTTTAGGACATTCCTAAAAATAAACTTTGGGATAACACAGATCAAATTTAAGAATTAATTCCACGAAGAACAT
AGAACAAGAAAAATAAGTGATAATACAACAAGTTTCAAGTTCAATCACAAACCTTTGTGTTTTGCTTTTCAATGCCTCGGTCACATTTGACAAGATGCCA
CATATTTTTGCTTCTGCAGTTAAAGAATTGACAACTTCTTCTAAAGATTTCAATTCCTCGTGAAACTCTTTATGTAAAACCAAAGAGGAGAAATGCTCAT
CAACAACCAAACCAATGCACTTGGCTACGTCCTCGAGTGAAGGAACCCATTCACAAGCCTTCAACCCCAATTCAACTGGTGCCTTAGGACAAGGACACAC
CTGAGGAAACCTCTCATATTTATTCAACCACTTTTGCAAGTACCGAATCATAACCATTATCTCTGAACCAGTTAATTTACTAATACAAGCACCCATAATA
ACTTCATCCACATTCCTCGACGCAAGTAAATAATGCAAACACATTTCAGAAACTGAGAACCCATCATGTGCTAGCATAAGCAATAATGAAGCATCCCTAG
CTATATCCATCCTAACCGGACCGAGGCTCACATCCTTTGCCTTCTCAATTGCAGACATTGCTTGACTCTCCCATTCCCTCCTCACATTAATCAAAGTAAC
ATCCCCATTTTTCGAAAGGGAGAGAAAATACTTCAGCACACACATCATATCATAAGTTTGAATATCTAATACATGTTTTACACACAAAACAACCAGCCAA
GATTGCTTCTTTTCAATTAGGTTATTTATCAAACTTGATATGCCTGAATGATCAACAATCCCATTAACAATCATACACTCCAAGATCTCCCAAGTCTCTA
AAACAACACAAGCCTCTAAGACCAAACCCTTGACATCTCTACCCATAAAACTACCGAGCTTTTCAATCATTTTTACAATATTACCCTCATCCACCCTATC
AGGACTAACTGAAATCCCAAATATATCCCAGATTCCCTTCATATAGGAAACCAACACCTCAAAGAATTCGTCTTTATTGAACGTGTTGGGGTTCTTCATC
ATCTTCTTCAATTTTTTGAAGAATTTTTGTCCTGACTCCATCACTTCAGCATCAGTCGATAAAAGGCTCCACCCAGTCCCTCGCTTGAGTAGAGAAATAT
CATCGTTATCCTCCTTTTCGGGTTTCAGTTGAAGCAGAACTGGTTCGGAGTTGAGAAGAATAGAGAAATCACCATCGGAGGTGGTTGAGGAATTTCCAAT
GGAAGCTTTAGTGATAACTTCCAGTAAAGACATTGAGAAAAATGGATACTTTCTTCGACTGTAGAGAGGAAATTGCTGAGCAGAGAAGGATAACAGGAGG
TTGTTCAGAAAGGGCGGAGGAGAACGGAGAGAGGCAACGGCGGCTTTAGGGTAAGGCAGCGAAGCACTTCACAACATAACAAAGTATAGTTAAGTAGAAT
TGTATTTTGGGAAAGACAAAATATATACTCGAAGGTATAGTTAAAGAAATTAAATTTAAAAAAGTATAGTTTATTAAATTTAATTTTAATTAATTAATAT
GTAGTTTGCTTTATTAAATTATATAATTATAAAAATTAAATTAGTGTGATATAAATATCGCGTACGAGTAAAAAAATTTTATATACTTAAGTTTTTATAC
AATGTTTAAAAAATTGCGAGTCTATTGTTTTATTATTTTTTATATACTTAAGTTTTTATACAATGTTTAAAAAATTGTGAGTCTATATTGTTTTATTATT
TATTTTTTAAAAATGGCGATCCGGATGGGGGAGGGAGGATATACCTGCACTATTTTTTTTTAAAACTATGATATATTCATTTTAAATTGCCAAGTTAAAA
AGAGTATATTTTTCTCTTTTTCCATGTAATATTATAATATATATAATTATTATTAATACAGAGTTGGACAATATATTTAGACTGAATTGAACCTTCAAAG
TTTCAGCATCATTACCACATAAACCTGATTATTGTACGATTGAAAACAATATCATATTCGTTAGTGAATGTATGATTGCCAATTTTTGTTTTTGTTACTT
TCATAATTATATGTAAAAAATCAATTTGGCTAAAAAGTTATTTTCGATCGATCATTGTAAAAGGAAGTAGTCAAAACGGGATACTAGTATCATGCTCATC
TACAGACTACAAGCAAAGATCCATCCATTGGCGATTTTGAATTTTAAGAACTTGAACTAGAGAGGGGCAACGAGATTCGAGTGAGAGCAAATTATCCGAA
ATAACTAGCTTATTTATTAGATATGTAGTATAAGCTGGCTGCTCATATGTCTGCACAAACATATGCACTCAAATAGCATTCCACTTGATTTTGTGTTAAC
CAAACTAATTCTTCCATTATCCACAACTGGATTCTCTCCAAGGAATTCTAACGTTAGGCTCTTTGAACGCGATCCTCGAGTGCTTTGAGTGGTAGCAGTT
GGTTCCTCAAGTAGATGCAGGAACTTTCCATCCTAGTGGCATGGGACCAACATCATAGATGATTTCTCTGTGGCAAGACCATACAAGTTTAATAGCTTCT
GGAGTACCTATTCCGGCTCCTCTGGGGTCCCCGGCAGGACCAAACCTACATTATGGGCATTGTTTAGGAGAGTTAATAAGCTAAATAGGTGTATTTACAA
TAACAGATAGAAGATGATAAGAAGTTGCTGACCAGTGATTCTGGGGAGCCCCTGTTGTTCTTGCTCTCAATCCAGCATAAGTGGTTCCATTAACTGAATT
TCCAATCACTTTCTGAAAAGGGAATTTCACAATTGAAATAACTACATAATCATGTACATATAGGGGTATAGCTAATAAAGCTTTTCAAATCTCAAGTCTT
TTCATTTCTCTCGTTTTTTTCTTTTCGTGATAGAAATGCCAGCCATCTTAACAACAAAGCATAGCAACTTTATCATTATCACTCAATGCTAAATTCTAAG
TTCTAAATGATGCAAACAATTCAATAAGTCAAAATGTATTATAAAGGTTTAAGTTCCCAAGTCTGAATCTAAACTTCTTTTGTTCAACGTGCCTTAATGT
TATATACAGAAACTAATCTAAACAGCAGATTAGACAATTGATGGAGGTGATTCAGCCCTGAACCCCTGGCTAGTATAACGTATAGCAATATAGTTTGATT
TTCTTTGGTACTGTGTCCTGATTCTATTTAGGACTATCCAAACTTTTGTATCTTCCTGAGGTTTTATAGATATGAGACTAGCAAAATTTCGTCTCTTTCC
CTTCTCTGTGGCTCTTCAATTCTACAGTAAGGTAAAATAGCAAACAGCATTACTACAAATGCTTCATGTAAGTTAACAGTGAACACTACACCTCTCTTCT
CACCTTCCTTCCCTCCTCCTACACTGACTTTTGGGACATAATAGAAAATTCAACAGTTTTGATCTACAAATTTTCTTCGGTAGGGAACGACAACTGATTT
GGCATTGGCATCTTTCGTGCTGTTATTGCCTTTTCTATTCTAGATTCATCCGATGAAGTACAAAAAATAAGTTTATGTACAAATTCTGGATGCTTTCTAG
AGAAAGAATTCGAGATATTTTCTGCTAGTTGCACGTGAAACATTTTAAGTTGTATATAGAGCAACAGATATTTCAATAGAAACGGGAACATTTTCTTACT
TGCAGGAACAATATATCATTGGAAACCACAGCAGCTGTTAAATGTGCATGCATCTTTTCAAGGGCATCGAGGACCAGTGGAAGCTGATTATCTTTGTACT
CAGTCACAACCTAGGGGAAAAAAACAGCAAGATTTGATGAATCAGCGAGAAAATTACCCAACTTGACATTTAATTCAGAATATTCAATTACCTGGAATGG
CCCAAAAATCTCTTTGGTCACGAGAGGATAATGTTCATCTTTGAGTATTTCTTCAAGAGGTACAAAAATAGCAGTGGGCTTAATGGCTCCATAAATTTTT
GGGATCGAATGGTTCTGTAAGGCTTCACCACCAAAGAGCAATCTCGATCCAGGTATCTGAAGTAATTTCTTCGCATGGTCCAGCATTGTTTCAGTTGTAA
CCTGCAGGAGCAAGACATAACAATTATCGCCAGGTATTTCTGACAAGATTGTTGGCATTACTTGACAATGTACTACAAAGAATGCGTAATTCAAGAAAGA
AAATAACGGATAAATCATGTTAACAAAAGGTGAGCTCCTCCTTTATTATAAATATTCTGTTTATATCACACAAAGTCCCAGATTTCTGCACTTGTTTGAG
TGAATAATATTCTGAACATCAAAAAGACTATCCAAAATAGATTCAAATTCAACGTATCGATACTTTCAAACTTCTAGTAAATTGTATCAAATGATGGACA
CAGAATCTCCAAATTAACATTAGCATTAGGTATTCTTACCGTAAGGACAGGACCAATAGTTAAATCATCTAACTTTCTTCTTGCAGCAAGCTCGGTCATT
TTGTCTAAGAGAGAACTTTTACTCCAATTCTGCACCAAAATAAAAATGGTTAGAAAAGAGAGTTCTTTGAACGAAATTCAATGAAACCATATTACATTAC
TTTTTCCAAAACTTATATAAACCACATAGATTTTGTATCTCAAAACATTTAACTTCCATGAAGAAAATAGAAGGACTAAGCACACCTCATGCATGAACAA
TATTGATTCAGCTGAACACTTCTGACCACTACATGCATATGCATCTTGGTCACAAACCCATGCAACGTAATCCACCTGTCAAAAGCCAACAATCACAATA
AGTAAATAAAAAATCTTTAAAAAAGCCTTTCCAAAATGCAACAAACTCTGTCGATAACAGATTATGTAAACCTCATTGACATCGGGCCCAAGGATCTTCC
AGTCGAATCCAGCATCTTCTAGTTTGACTCGACCGCTTAGGTCATCAGCTAACTTCTCTGCCACCCTTGAGCTACCTGTGAAGAGAGTCATGCGTGGTTT
TGCCTAACGACACAATACGAAAGAGAACTATGTCAGGAAATAGGAATATTATCTTTAGTAGTTGGAAAAGTTGGTTAGAAAGAATCCGACAATTATTATA
GACTCTAGAAAGTTAATTACTCCATATTAGTGCGAAAAGCCAACAATTCAACAAAGAAAATAGATTAAATTATTCTTGGGATTCCTGAATTAGTTTAACA
TGGTTGAAGTGAAGGTTATTTGCACATAACATGAGGACAACAAAATTTTAATAGGATGGGAAGTTTTTGGACTAAAATTTGTAATTTTCAGTTGCCAATT
CTTGTTCATAAGTGGCCAAAGGAGTCTAGTTTTAGAAATTAACCTCCACGAGTAGCTTGTTCATTGTCTTTCCATCTGAGTTTATGAAATCCACATCATC
CACAGGTAACCCACACTCATGAAGTAGTCGAAGCATTTGTTCCATAACAATGCATACCTAACCAACAATGCAGGTCGAATTATAAAAACCACACTGGAAA
AATATTTAGAGTTATTAACAGGAAAAAATAAACTAAACTAGGAACAAAATCTTCCAATTATCTGCACATTTTGTTAATTTGACAAAAAAAGTAAGGAGTT
TGTAAAAATCAATAGCAAATTTTTCTTCTTTGATATATGATAGACAAGTTTGTTTCTAAGCTGGACCTTGTCCGATAAGTAATTTTGCACGTGAAAGAGT
CTACAAAAATTTGCACAACCTTACCTTGCTATCAACTTTAAGTACTGGCTTATTTCCCATATACAACGCTCCCATCAGCTGAAGCAAAGGAATCTCCAAA
GGAAAATTAAAGGGAGCAATAACCGCTACCTATGAAATATAAAGTTAAAAATTGGGTAGTGTGAGAAATTTTAATAATTGAAATAAAAAATATCATTCAA
TCGCATAAGGAAGTCACAACAGGAAAACGTAAGAAACAAATTATGTTCTGTTAATTTACCACTTTGAGCACTATGGCCAAAAGCAATGTATAACACAACT
TAACACCATTCTGAAATTGTGAAGAATTTGTTTCCCCCGAAGCTAAGTGATTTTAGTTACATAACTAAACCTTCAGATCTCAGTTTCAACGTGAAAGATT
GTATCATAGGACTTTTTTGTTAACATGTTCCATTAAATATAGTCAACAACGGAAAGAACGGTGCCTTACAGGTCCATAAGGCCATCGGAAACCATGGCTC
TGCTGCCCCAGATGATTTCCTGGTACTGCAAAAGATCTAGCTAGAAAGCGAACCTGCCAAATAAAATCAAGAGTTCAGCATTGGATCGGACAGTCATGTA
TCATGTTAAAGAAAATGGAGAAATGATTCCCGTGTGAAATAAGTCCTTGTTCCTGAAACTGAAACCTATTAAGCTTTCAAATATTTCAGTGTCAAAAAAG
CTACTAACAGTTAACAGAACAGCAAAAGGAAAAAAGAAACAACCAATCAGTAGACACAAAATTGTTGAAATAAAATAAAGCAGCAAAAAAATCACATGGA
TGTGAAAGCTATGCTGCTGAATTGTTGCGCCACGATTTAAAACACATCTTTTTCTTAGCTAGTCCCTGTATAACGTTGAACATACAAGGTAATAGTTTTA
GAATCTACCTGATCACCACAGAAATTTTCCAGAAATTTCTGCGTCACGAGAACTTCAACAAGAGCTTGTTGGTAACTCTTAGGAGACACCCTTTGTATTA
GCTTCGCAAAGAAATCAGAAACCTGTAAGACCCAAAAAGAAAAAGAGAAGAAAAACATTAAGATGATAAGAATTAATTATGCATATCATAAACTGTTAGT
CAAAAAGGTTTCGAGAACATCAGCATCCTTGCTTGAATATATATTACCTCAGGCAAGCCAAGCGCATGAGCTGCTTTTGTAGATACGTCTCCTAACATTA
AGTACCTGCGAGAAGCGGTGTCATTCGGATTAAATTTTCTTAAGTCCTCATATCTTCCTTTGGAGAAAAATTCATAAGACAGTAAATGCTCATCTAGACA
ACTTCATAAAAAAACAAGAAAAAGACCAAAAACATTAAAAGCATACCTTTCTGGTGCTTTGAATGGATTATGTAGACCATGTTTCGGGCACTTGGACAAG
CTCTCCACAAACGGCTGCACACCCAGCAATAGGACTTATAGAACCATGACAATCTTTGGTGTTAAAGAATTCATACTAGAAGGGAAAAGTCTTTATGCGA
CTGAACTAGAGTTGGTCATAAAGTAACAAGTTAACTGTACAGAATAAACAGACTCTACTGTCGAAAGACTCATCTTGAAAGATACAGTGCAAAGAATTAT
GATGCATCCAAATTATATATACCTGCAGTTCTGATTCATTTACTTCTGCAACTTTAATGAACGGCTGCCCATTCAAGGGATCCAATATTGTATTCCAACT
AGAAGATTTTGTCCACTTGCCCTGCACTGAATGGATGAAATTCACTAGTCAACTAGATGTAGCAGTAAACTAGAGCAATGACCAGAGCTAGCTTCTCCCT
TTTTTATAGGAGAAACACACTTGAATCTGATCGAAAGAAAAGTGGTGTACGGAAGTGATGTATTACTTCAATATCAATTGCTAACATGCATATGGTATAC
AGGGAGTTTAACATCATTCAAACTTACAAAATTATCTAAAGTCTATACAGTATATCTCACATCTATTCTTAGGCAAACGTTGGAAAACTGCATATTAATG
ACCAATTTCAGCAGCTAGTCGTTATGTAAATGTACATACCCAAGTTGTGAACTTCAGCAGGTTGAGAGCCTGATACTTCTTCAGCTTTTACAGTAGCAAA
AGACAAAGTGTGGTTTGATCTGCATTATGAAAGATTAAATCACAATGTCTGAATGACTCTAAAACAACACCGTCCGCTTGGTCCATACACGTCAATTGAT
TATCTCAAAACAGAAGGTTGAGACTACCCAGAACCGTAATTCAGTAGAAAAAGAAATACTAGTTAAGCAGCATTTACACTGATAACAAGAAGTCCATATC
ATGATAATGTAGACGCCCAATAAGGAAGAATCAAATACAAGAAATCATCCATCCATAACATAAAAAAGACGACATTTTTCGTTTTGAATCCTTAGGGAAT
AAAATCTTAATAGCGAAAAAATAGTAGCACTAACTAAAAAAGATGGAAGGGACTTCAGGTTCTGTTAAAACAATTGGTTTAGAAAAGAAAAAAAGATAGT
CACACAACACATTGGTAGTCTCAAGCCCAGATAAAGGACGATATAATGAACCTTCGTAAAAACTACCAACGGATGGACTGGAATGAACAGAATTTAAACT
AATAATTTCCAAAATGGTAGTTTTTAAAAAACTAAAGCTTAGATTTTATCGAAAACAACATCTCTGTCACCACAAAGATAAGGTAAAGTTCTTTATACAT
CCTACCCTATGCACAAAATTTATCAAAGATTACAATAATCAAATTGTAAACGCTTCTAAAGAACAATTTTAACCTATTAAAAGTGATTCCTTCAAAACAC
CATTACATTATTGTAACAAAACAACTGAAATTAGGTGGCGATCGCTTTGTAAAGTAGAATTATTAAACCTAGATTATTTACAGAGCTTTTATTACTGAAA
ATGATGAGAATAAAAGAGTATACCTTCTAGAATCGAATAAAGTGATCCAATTGAGATGACTAGAAGAAGCTCTCTTCTGCAATTGCCTGTATGCGGAAAG
TCGATACATCATTCTCTTCCAAACTTTTCGATAGCACTTTACCTAGGTTAAAAGATTTTTTTTAATTTATAGATACTCTGATTCTCTACTTAAGATTTAT
AGGTAAAATAATATATTTGATTTGATGTTTTCTATTATATCTTCAATAAAATATA