BAC Sequence – LE_HBa0128L09

>C04HBa0128L09.1
AAGCTTAGGGCCCGTTTGGCCATAAGATTTTTCAAATAATATTTGGAAAAAAATTGGCAAATAATGTTTGTCCATACAATTTGTCATTATTTGGCAAATA
TTTTTGGTAAATATCCCAAATTCTCAAATACAAGTTTTTTCTAATATTTGGGCCAAATCTCATTATTTTAGATCTTTTGAAAACTAATTTTTTACCTTAA
ACTTTTATATTTTACAAAAACACCCTCTATAGTAGTTGCTTGCGTTGTATTACATAATCTTTCACGTGAAACACCAAAATATTGATGAAAATGATGAAAA
ATTGGCTCAAGGTAACAAAGTCACGTGCTTTGTATATTTCACGATGTATGAAATGATGTTTGTTGCACTCATTCCAAATTACAACATTGCTCTAGTGTCA
TGAACACTGTTTGTTATTGTTGTAACGAACATCCAAATGACTTGTAATACAAACCTATAGTTAGTTTTGATAGTTTTTAAAACTTATGGGTATAAATCAT
ATTTTTTCTAAAAAGGTGAAATATAATTTCCAAATCCTATGGCTAAACACATGGTAAAATTTCACCAATTTTTCACTCAAATAATATTTGCCAAAAATAT
TTGAAAATCTATGACCAAACGCTAGCTTAGACTAATGACTCATCCCTCAATCTACTTGAACTAATTAATCCCTTGGGTTAAAGTAACGTCTATTTTTTAT
TTATATATTACGTATGTTATGCATTTATCGATTTAATTTTATGATTTGAAATATCGACATGACGTCAATCCTTAGACCAACAATATTTTTTGAAACTCAA
AGATAATGGACTAGTCCCCTGGTTTTCTTCATTAAAAAATCAGACTTTTGCATCTTTGAGACTTGTAACTCGTTTCGAACTAAGCTCTGAAACGTCAAAT
TTTTATATTTTTTTTATTTTGTCTATATATTATCATATATCATGCATTTATTAATTTAAAACAGATTTCAAATATGAAATAATTTTATTTTTCGAATAAA
CTTATGAATCATAATGAAGAATAACCATCAATTTGGATCAAGACTTTTGTGTAATTGTGTTGGTGGGGTGGACATAATCTTGAATTATTTCCAGCAAGAT
TACAGCATTAATAGAGTATTGACCAAATAACACATGGTTTGACCAATTTTTAAGGTTGGGACATATTAGGTAGGTACATAAAAGAAAAAACAAATAAATA
AACAGTATATATATATATATATATATACATAAAGAAACAGCCCTTACAGCTGGAAACAGTACTAAAACAAAGAGGTAAAATTATGGGGATTTAGATTCCC
TAATTCCTTTATATTATGTTATATATGAAGAAGACATTATATTATTTTCTTAAAAACAAATTACTATACATTAAAGAAAAGATGAGACTGACATATGAAA
TAGAAAATAAATAAAAAGCAGAAGAGTAGGGAGTATTATTATTATTATTATTATTATTGGCTTTGTCAACAGCAGCACTATCTTTTCAATTGTACAAATC
TTAAACCTCACACTTTATTATCTCTACCCATCAATCAAAGCAACTTCTCTGCATAGCATCTTTCAAATATAACTCTTGAGGGGCCCCATTCTTTTTATCA
AATTTTTAATTCCTACAAACTCAATATTTGCAATATTTTATTAATAAGACTGAATTGGATGGTGTTGACACTTCCCGGCTCACGCTGACGGTGTTCAGAT
CGTTGCTATGCTATAACAATCGGAATAATTTATATGTATTTCGATAAATATTAAGTTTGTTATAACAAGTATTGTCGAGATACTCAAAGGCACAAGTGAC
TATATGGATCCTTTTGGTTAGATTGAATTTGATGTTTTAATTCATATTTGGTATGTGTTATTGATGTTGTAACTGATTTAGATTTGATTTGACAACAATT
AGCGTTGCTTTGTAGTTATAGATTAAAATAAATAAATAAATATAAATTTAGAGTTTGAGTCCTAAAAATAAAATCAGGTTTAGTGTAACGACCTGTTTAG
TCGTTTTGAGCAGCAGATTTTATTTCTGGAAAACTGGCTGAGACGACGGACCTCACGACGGACCGTCATGGGTACGACGGACCGTCGAGGGTGTCTCGTT
CCAAAACACTTGGGAATTCTGAAATTTGAGTGCTGAAATCGACTCTCTGAACTCAGTGACGGACCTGCAGAGCGAACCGTCACAGCCACGACGAACCGTC
GTGATCCGCCGTTTCAAAACACTTCAACTCTTGAGAATTTGGTACAGGGAACGATTCTCTGAACGTCGTGACGGAAGTGCAGGACGGACCGTCGTAGGTA
CGACGGGCCGTCACAGACTCCTTAAGGAAATCGAGTCTCTGACGAACCTGCATGACGGACCGTCGGAGGCGCGACGGGCCGTCACAGGTTGCGTAATCCC
AGTCGGAGTCGAATTTCTGGTTAAGTTTTAAAGGGGCGTTTTGGACTATTCCTGCTATAATTATATATTTCGTGGGTTTATATTAATAACTCAATTTCTT
GGGGGGAAAAAGAGGTAACCTTGAGTTAAATTGTGGGTTATTATTGTCATCTTTTACACTTAATTACATGTTAATTAGGGTAAAAGAAAGAGAGTTTGAA
TAAGAAAAATAGAAAGAACAAAAAGAAAAGAGAGGGAATCGAACGAGAGAAAAGGGAAACGAAGAGGATAGCAAAGATCTTGAGGAATTGCTTGCTTGAT
CACAAAATCTTCGGTAGAGGTAGGTTATGGTTTCTCTTATGATATTCGTAGTAAACTCTTAGTAGCGAATGATATGTATTGATAATATTGTAAACCCTGC
TATGTGCTTAATTGTATGCTTGCATGAATGTAATTATATAATTGTGATTATATAAGCATGATGAAGTTATTGAATCCCAAATCTTGAAAAACCCTAATCT
CTTTGTTAATAATGAGGCCTTGGTGTAAAAGAAGGCGTGATGAACTAAAATAATAAGATTGATGATGCCTTGATAAGAAAGAAGGCTTGATGAATTGATA
GAAGGAGATTACGGGATCGGGTGCCACGTTCTGGTACCAGGATAGAATTAGTGGATCGGGTGTCACGTTCTGGTACCAGGATAGAATTAGTGGATCAGGT
GTCACGAACCGACACGTAGAATTAGTGGGACAGGTGTCACGAATCGACAAATAGAATTAGTGGATCGGGTGTCACGAACCGACACGTAAAATTAGTGGGA
CGGGTGTCACGAACCGACACATAGAATTAGTGGATCGGGTGTCACGAATCGACACGTAGAATTAGTGGGACGGGTGTCACGAACCGACACATAGAATTAG
TGGATCGGATGTCACGAACCGACACATAGAATTAGTGGATCGGGTGTCATGAACCGACACGTAGAATTAGTGGGACGGGTGTCACGAACCGACACATAGA
ATTAGTGGATCGGGTGTCACGAACCGACACGTAGAATTAGTGGGACGGATGTCACGAACCGACACATAGAATTAGTGGATCGGGTGTCACGAACCGACAC
GTAGATGTAGGGGATCGGAGTGTCACGTATCGACACAAGAGGACTAATGAATATGAGGGAGCGGAGTGTCACGTACCGACACAAGAGAAATAAAGATAAT
GAATCTTGAAAGATGTTAATATACTCAATCTAATGAACATAATTCCCAAATGAGTATGGTATTGAGGCTTGAGTCCTCATGTGTGAACTTGGCGGTAATT
GATTATGACATCGTACTTGTTGTTGCTACATGTTGAGTATCATAGTTGATTTTATGATATTACTTGGTATATATTGATTTCTATTTTGAGTTGGCCGATG
ATATCTACTCAGTACCCGTGTTTTGTACTGACCCCTACTTTTATGTTTTTTTCTTGTTTAATTGTGGAGTGCAGCAAACGTGCCGTCATCTTCGACTCAA
CAGTAACTCTAGCCAGTCTTCATTACTCCTGATATCAGGGTGAGCTAATGCTTCTAGCTTGGACTGGATCTTCCTCTTCATGTCTTGATGCCTTGAAGTT
CCGGCATGGACTAGCTTTTATGTATTTTTAGATTCTTAGAAACTCTTAGATTTAGTAATTTGAAGTAGATGTTCTTGTGATGATGACTTTCAGGTTTTGG
GAAATAATAGTTATTGAATTGGTTTTTATTAATGAGTTTAAGTCTTTCTCATTACTTTATGTTGATAGTACATTGAAATGTTAAAGTTTAGATTTGGTTG
GTTCGCTCACACAAGAGGGTAAGTGTGGGTGCCAGTCGCGGCCCGATTTGGGTCGTGACAAACTTGGTATCAGAGCATTAGGTTCGTTGGTCTCATCACA
CAAGAACGAGTCTAGTAGAGTCTTAAGGAACGGTAGGGGGACGCCTTTACTTTTCTTTGAGAGGCTATAAGACTTTAGGAAAATTCCATTCTTTCTTTCT
TTCGTGCTATTACTTGGATCCAATTGGTATCTAGGTGATACAAATTGGTATCTGACCATCTTCACTCTATTTCGCGGATGGTTAGAACTAGAGCAACGAC
TGCGTCAACACCAACATCGGCAAGACAAGAAGCGTCTGAGCCAGCCACTGAGGCTGTAGCTCGAGGAAGAGTAGCGGCAAGAGGCCGTGGGAGGACGTCC
TCTAGAGGAAGAGGACAAACACCTAGCCCATCTGATGCTAGGGCGGTGACTCCTCCACCGACTGAAGAAGTAGTAAGAGAGGGTGAGGAAGGGGAAATTG
AGCAAGTGCAGAATGAGGAACTACCACCCCAACCTACCCCAGAGATGATCAATCAGGTTATCGCTTATCTTAGTGGGTTGTCTGATCAGGGTCAGGCACC
TCCAGTGTTTCCTGCACCAACACCTCCGGTTTCAGAGGTACAACATGCAGCCACTATGGCTCCCCGCATGAATGTTCCATTGGAAATAGGCACGTTTCCT
CGTTTGACTACTGGGCCTATAATGACAAATGATCAGCATGAAGTTTTCAGTAAGTTCTTGAAATTGAAACCTCCAGTCTTCAAGGGTGCTGAATCTGAGG
ATGCTTACGATTTTCTGGTTGACTGTCATGAGCTACTACACAAGATGGGTATAGTAGAACGGTTTGGTGTTGAGTTTGTGACTTATCAGTTCCAAGGAAA
CGCCAAAATGTGGTGGCGGTCACATGTTGAGTGTCAACCAACAGAGGCACCACCTATGACTTGGGCATTATTCTCTAGCTTGTTTATGGAGAAGTATATC
CCCCGAACTTTGAGGGATAGGAAAAGAGATGAATTTTTGAGCCTAGAGCAAGGTAGGATGTCGGTTACTGCATATGAGGCTAAGTTTCGTGCATTATCCC
GGTATGCCACCCTACTATGTTTCAGTCCACAAGAGCGGATTCGCCGTTTTGTGAAGGGGTTGAGATCAGAGTTGTGGATTTCAGCCTTACAGGTAGCGGC
TACAGCGAAATCTTTTCAAGAAGTGGTAGACTTCGTGATAGAGGTAGTGGGAGTGAAGCCAGATGACTTCACCATGGCAACTACATCAAAAAGGTTTCGA
AAGGGAGGTGAGTTTAATGGTTCTTACTCTAGAGGACAGGGTTCAGAAGGTTACTCAGTCCGACCAATCCAGTCTTCACTACAGACTGTAGTTGGAGGAC
CACCTCAGACCGGTCAACACTTCTCTGAAAGACCTATGCTTGAATCCAGAGAGTGTTATGGATGTGGGGAGACTGGACACATTAAGAGGTATTGTCCAAA
ACAGAGTTACAGACCTCCAAATGTTAGAGGTAGAGTTGGTTATGGAAGAGGTCGTCATTCTGGAGGACGCAGTGGTCGAGGTAATGGTGGTCACCAAAAC
GGTCGGGGTGATAGGCAAACTGGAGCCACTATATCACAACATGGTAGGGGCAACGGATAGACAGGTGAGAGGGCCCATTGTTACGCTTTCCCTGGGCGGT
CAGAAGCGGAGACATCAGATGCTGTCATCACAGGTAATCTTTCGGTTTGTGATTGCATGGCTTTTGTATTGTTTGACCCTGGCTCTACAATTTCATATGT
ATCTTCCGCATTTGCTAATGGTCTTGATTTACATTGTGAATTGCTTGACATGCCTATTCGTGTTTCTACTCCGGTGGGTGAGTCTGTGGTAGTTGAAAAG
GTATATAGGTCTTGTTTGGTGAACTTTATGGGGAGCAACACTTATGTAGATTTGGTTATGTTAGAAATGGTTGATTTTGATGTAATTCTGGGTATGACTT
GGCTTTCTCCGCAATTTGCGATCTTGGATTGTAATGCTAAAACGGTGACATTAGCCAAGCCTGGGACAGATCCGTTAGTGTGGGAGGGTGACTACACTTC
CAATCCGGTGCGTATCATCTCCTTTCTTCGTGCTAAGAAAATGGTTAGTAAAGGGTGTTTAGCTTTCTTGGCACATCTCAAGGATGACACTACCCAAGTA
CCTTCAATTGAGTCGGTTTCGGTGGTTTGTGAGTTTCTAGATGTGTTCCCTACAGATATTCCTGGTATGCCACCAGATAGGGATATTGACTTCTGTATTG
ATCTTGAACCGGGTACTCGCCCCATTTCTATACCCCCTTATAGAATGGCTCCCGCGGAGTTAAGAGAGTTAAAAGCCCAACTTCAAGAGTTGTTGAGCAA
AGGCTTCATTAGACCAAGTGCATCTCCTTGGGGTGCTCCGGTTTTGTTTGTGAAGAAGAAGGATGAGAGTTTTCGGATGTGCATAGACTACCGGCAGTTG
AACAAGGTAACCATAAAGAACAAGTATCCTCTTCCTCGCATTGATAACTTGTTCGATTAGTTACAAGGTGCTTGTGTCTTCTCTAAGATTGACTTGAGAT
CCGGTTATCATCAATTGAAAATACGGGCAACGGATGTGCCAAAGACTGCTTTTAGAACCAGGTATGGGCATTACGAATTTGTAGTGATGTCTTTTGGTTT
TACGAATGCCCCTGCTGCGTTCATGAGTTTGATGAACGGGACTTTTGAGCCATATTTGGATCTCTTTGTGATCGTATTTATTGATGACATACTGATATAC
TCTAAAAGTAAGAAGGAACATGAGGAGCATTTGAGAATGGTATTGGAAATATTGAGGGAGAAAAAGCTTTATGCCAAGTTCTCTAAGTGTGAGTGGCTAG
ATGCAGTGTCCTTCTTGGGGCACGTGGTTTCTAAGGATGGAGTGATGGTGGATCCTTCTAAGATTGAGACAGTGAAAAATTGGGTAAGACCTACTAATGT
GTCAGAAATAAGGAGCTTTGTTGGTTTAGCTAGCTGTTATCGCCGATTTGTCAAGGGATTCTCTTCCATTGCTTCCCAACTGACGAACTTGACTAAGCAA
AATGTCCCATTTGTATGGTCGGATGAGTGTGAGGAAAGCTTTCAGAAGCTCAAGACTCTGTTGACTACTGCACCAATTCTCACCTTGCCAGTGGAAGGTA
AGAATTTCATTGTCTATTGTGATGCATCCTATTCGGGTTTGGGTGCAGTGCTAATGCAAGAGAAGAATGTGATTGCTTATGCTTCAAGACAATTAAAAGT
GCATGAACGTAACTATCCAACTCATGATTTGGAATTGGCCGCGGTAGTGTTTGCATTAAAGCAATGGAGACACTATCTATATAGAGTTAAGTGTGAAGTA
TACACGGATCATCGTAGCCTACAGTATGTCTTTACTCAGAAAGATTTGAACTTGAGACAAAGGAGATGGATGGAACTACTGAAGGACTACGACATCACTA
TTTTGTATCATCCGGGGAAGGTGAATGTTGTAGCGGATGCTTTAAGTAGAAAGGCGGGAAGCATGGGAAGTCTAGCTAACTTGCAAGCTTCTAGACGTCC
ATTGGCTAGAGAGGTTCAGACTCTGGCTAACGACCTTATGAGGTTAGAAGTAAATGAGAAGGGAGGATTGTTGGTTTGTGTGGAGGCAAGATCTTCTTTT
CTTGACAAGATTAAGGGAAAGCAGTTTAATGATGAGAAATTGATTCGGATTCGAGATAAAGTATTGCGAGGAGAGGCTAAGGAAGCACAAATCTATGAGA
AAGGTGTTCTGAGAATTAAGGGAAGGGTATGTGTACCCCGCGTCGATGATTTGATCAACACTATTCTGACAGAGGCTCATAGTTTAAGGTATTCGATACA
TCCGGGTGTAACCAAGATGTACCGTGACCTAAAGCAACACTTTTGGTGGAGTAGAATGAAGCGTGATATTGTGGATTTTATTGCCAAATGTCCAAACTGT
CAACAAGTAAAGTATGAACACCAAAGGCCCAGAGGAACACTTCATAAAATGCCCATTCCGAAATGGAAGTGGGAAAGGATTGCAATGGATTTTGTGGTTG
GTCTTCCACAGACAATGGATAAGTATGACTCTATTTGGGTGATTGTTGATAGGTTAACTAAGTCTGCTCATTTTATTCCGGTTAAGGTGACTTACAATGC
CGAGAAGTTAGCAAGATCTATATCTCAGAAATCGTTCGATTGCATGGGGTTCCACTATCCATCATATCAGATAGAGGTACGCAATTTACTTCTAAGTTTT
GGAAAACATTGCATGCGGAATTGGGTACTAGGTTGGACCTTAGCACCGCGTTCCATCCTCAGACCGATGGTCAGTCTGAGCGAACGATTCAAGTGTTGGA
GGATATGCTTCGTGCGTGTGTGATAGAATTTGGTGGCCATTGGGATAACTTCTTACCCTTAGCGGAGTTTTCATACAATAATAGCTATCACTCAAGCATT
GATATGGCTCCATTTGAAGCATTGTATGGTAGGAGATGTAGGTCCCCATTGGTTGGTTTGATGCATTCGAGGTTAGACCTTGGGGTACTGACCTTCTGAG
GGAATCGTTAGATAAAGTGAAATCTATTCAAGAAAAGCTTCTAGCGGCGCAAAGTAGGCAAAAAGAATATGCAGATCGAAAGGTTAGAGACTTAGAGTTC
ATGGAGAGTGAGCAAGTCTTGCTGAAGGTTTCACCCATAAAAGGGGTAATGCGGTTTGGTAAAAGAGGTAAACTAAGTCCAAGGTATATTGGTCCCTTTG
AAGTACTTAAGCGAGTAGGGGAGGTGGCTTATGAGTCACCCTTGCCTCCAGGGCTGTCCGGAGTACATCCGGTATTCCATGTGTCGATGTTGAAAAGATA
CCATGGGGATGGAAACTACATCATCCGTTGGGATTCCGTTTTGCTTGATGAGAATTTGTCTTATGAGGAGGAGCCTGCTGCTATTTTAGATAGAGAAATT
CGCAAGTTGAGATCAAGGGAGATTGCATCCATCAAAGTTCAATGGAAGAATCGACCAGTCGAAGAAGCCACTTGGGAGAAAGAGGCTGATATGCGAGAAA
GATACCCACACCTGTTTACAGATTCAGGTACTCCTTTTCACCCTTGTTTATCTTCTTGTGATCGTTCGGGGACGAACGATGGGTAAATTTGTTTCTAAAG
TAACGACCTGTTTAGTCGTTTTGAGAAGTAGATTTTATTTCTGGAAAACTGGCTGAGACGACGGACCTCACGATGGACCGTCATGGGTACGACGGACCGT
CGAGGGTGTCTCGTTCCAAAACACTTGGAAATTCTGAAATTTGAGTGCTGAAATCGACTCTCTGAACTCTGTGACGGACCTGCAGGGCGAACCGTCACAG
GCACGACAAACCGTCGTGATCCGCCATTTCAAAACACTTCAACTCTTGAGAATTTGGTACAGGGAACGATTCTCTGAACGTCGTGACGGAAGTGCAGGAC
GGACCGTCGTACGTACGATGGGCCGTCACAGACTCCTTAAGGAAATCGAGTCTCTGACGAACCTGCATGACGGACCGTCGCAGGCGCGACGGGCCGTCAC
AGGTTGCGTAATCCCAGTCGGAGTCGGATTTCTGGTTAAGTTTTAAAGGGGAGTTTTGGACTATTCCTGCTATAATTATATATTTCGTGGGTTTATATTA
ATAACTTAATTTCTTGGGGGATAAAAGAGGTAACCTTGAGTTAAATTGTGGGTTATTATTGTCATCTTTTACACTTAATTACATGTTAATTAGGGTAAAA
GAAAGAGAGTTTGAATAAGAAAAATAGAAAGAACAAAAAGAAAAAAGAGGGGATCGAACGAGAGAAAAGGGAAATGAAGAGGATAGCAAAGATCTTGAGG
AATTGCTTGCTTGATCACGAAATCTTCGGTGGAGGTAGGTTATGGTTTCTCTTACGATATTCATAGTAAACTCTTAATAGCAAATGATATGTATTGATAA
TATTGTAAACCCTGCTATGTGCTTAATTGTATGCTTGCATGAATGTAATTATATAATTGTGATTATATAAGCATGATGAAGTTATTGAATCCCAAATCTT
GAAAAACCCTAATCTCTTTTTTAATAATGAGGCCTTGGTGTAAAAGAAGGCGTGATGACTAAAATAATGAGATTGATGATGCCTTGGTAAGAAAGAAGGC
TTGATGAATTAATAGAAGGAGATTAGGGGATCGGGTGCCACGTTCCGGTACCAGGATAGAATTAGTGGATCGGGTGTCACGAACCGACACGTAGAATTAG
TGGGAAGGGTGTCACGAACCGACACATAGAATTAGTGGATCGGGTGTCACGAACCGACATATAGAATTAGTGGATCGGGTGTCACGAACCGACACGTAGA
ATTAGTGGGACGGGTGTCACGAATCGACACATAGAATTAGTGGATCGGGTGTCACGAACCGACACGTAGAATTAGTGGGACGGGTGTCACGAACCGACAC
ATAGAATTAGTGGATCGGGTGTCACGAACCGACACATAGAATTAGTGGATCGGGTGTCACGAACCGACACGTAGAATTAGTGGGACGGGTGTCACGAACC
AACACATAGAATTAGTGGATCGGGTGTCACGAACCGACACGTAGAATTAGTGAGACGGATGTCACGAACCGACACATAGAATTAGTGGATCGGGTGTCAC
GAACCGACACGTAGATGTAGGGGATCGGAGTGTCACATACCGACACAAGAGGACTAATGAATATGAGGGAGCGGAGTGTCACGTACCGACACAAGAGAAA
TAAAGATAATGAATCTTGAAAGATGTTAATGTACTCAATCTAATGAACATAATTCCCAAATGAGTATGGTATTGAGACTTGAGTCCTCATGTGTGAACTT
GACGGTAATTGATTATGACATCGTACTTGTTGTTGCTACATGTTGAGTATCATAGTTGATTTTATGATATTACTTGGTATATATTGATTTCTATTTTGAG
TTGGCCGATGATATCTACTCAGTATCCGTGTTTTGTACTGACCCCTACTTTTATGTTTTCTTCTTGTTTAATTGTGGAGTGCAGCAAACGTGCCGTCATC
TTCGACTCAATAGTAACTCCAGCTAGTCTTCATTACTCCGGATATCAGGGTGAGCTAATACTTCTAGCTTGGACTGGATCTTCCTCTTCATGTCTTGATG
CCTTGAAGTTCCGGCATGGACTAGCTTTTATGTATTTTTAGCTTCTTAGAAACTCTTAGATTTAGTAATTTGAAGTAGATGTTCTTGTGATGATGACTTC
CAGGTTTTGGGAAATAATAGTTATTGAATTGGTTTTTATTAATGAGTTTAAGTCTTTCTCATTACTTTATGTTGATAGTACATTGAAATGTTAAGGTTTA
GATTTGGTTGGTTCGCTCACACAGGAGGGTAAGTGTGGGTGCCAGTCGCGGCCCGATTTGGGTCGTGACATTTAGTTAATGTGTTTAACTACTTATAATG
AGACTTTTGATCGATAACAAATGTAATATTCAAAATTCAAAAATAGATATCATGCATAAAATAAGAAACTAAAAAAAAGGGCAACTTTCACATATAGCAA
ACAAAAAAATCATATTTGTATGTTATAGCAAAGTTTGCATAATTGATCTCCATAGCAAACATAAAACTGTATAATTCGCTATACATATACAATTGTATAA
TTCGCTAGCCTAAATTGTATAATTTGCTGGCCTAAATTGTATAATTCGGTGGCCTATTTCGCTGCAATTTTATTATTTGCTTTGCATACAGTTGAATCAA
ATTAAAATGTATGTATATTGCATAATTATAAGTGTATAGCAAGAAGATATATGTTTTTCTCGCTTTATACAAAAACAGAAACACAATATATATACTTTTG
TTGTATAAAGCTAGAGAAAATTATATTTCACTACAATTGTATAATTCGTTGGCCTTTTTCTTTGCAATGTTTGAAGTAAAATGTTTGTAAATTGTATAAT
TAAGTGTATAACACGAAGATATACATTTTTGCATGTGTATATACAATTTTCTCTCGCTTTATACAAAACAGAAACAGAATTATACACTTCTGTGTATAAA
GCAAGAGAAGCGAGCGAGAATGGAGAGTGGCGAGCGAGATTTTTGGGAGAGAGACGCTGGCAAATTTTAGCTAATGTTTGCTATGGAGCACAATTAAATC
AAACCCTAGCTATTCCATTTAATTTAGGTTATTAGTTTGCTATTATATACAATTTTCTAAAAAAAACGCCCCTCTTTCTATTTTTTCTGATATTATTATT
TAAGAGAAATCAAATAATTCCTTAGTAAAATTTTAAAAATTTATTACATGAAAATGCGGTCATATATTGTTTTTAAATATGCAAAAGACTATTTCACAAA
TTTAAGACATCAATATCCAAATTCACGTCGAGATTAGATAATAAACTGTTCACACTTTGAATTTTTATTTTTTTTGAATAAATGGAGCAAGTAAAAGAAA
CTATAATATTTGTTTCACATTCTCGGACATGAAATTTTTTCTGAAGTTAAATGGAGTATGCATCAAATGGTTTTTAGTAAAAGAAAAAAAAATATAATAC
TTAACACTTTTTAAATTTTGATAATCAATTAAACTAATCATCACAAAATTAATTAAATTCAATATTTTTAATAATCATATTATAAATTACAATTTTTTTA
CATATCAAAAATAGTGAAAAAATCAAAATATTTATCAAAATTCATATTATTCAAACTTGAGACACAAAATACTCTACCTACTCAAATATTCGTGACGCTG
TATAACTCTAAACAAAAAAAAAATAATTCTTTTTTAAATTTGCTATTAAAGATATTTATGTAACTATAAATTATCTGTGTTTACGTATCGATTAAAGATA
TTTTATTGCAGGGAATATAACATCACTCTTTACAAATCTGTGTACTTAGAAGCATCAAATAAGAAAAGCAGGCCTAGTACATCATCAATCAAAATTGAGA
AGTGATTTGGTGGGCCATAACATGCATGGTACACAGAACTCATGGAGTTTTGATGGACCATAGAAGCACAAGATTATTTATGAAAGAAGAAGAATTGTTA
GGTTAGTTGGCACTCATACAAAATATAAAATATGAGTGTGTAACAGCAAAGAGAGCTCTGTTACAACAGTTGGCAAAATGTGTCAGTTAAAAATTAGGAA
AAGTTATGTCAAACTTGCCCTTCAAGAGAAGAACAACAACCTCTCCAATATGTTGTATGTGAAATCATTTAATTGGATTGCTCGGTGCACTAAACTCAAA
GGTTTCAAAAAAGCGTTTTATATATAGTTTTATCTTATATTTCTATAAAGATTTAAATTAGTCAAAAGGTTTAATAAAATAATGATTGTTCAAGTCATAT
AAAGAGTCTGAGATCAATAACTTGTTTCACATCTAGGATCGGAGATGTGTTGATAATTTAATATGAGAATTCAACATCTTTAGTATAAATATGACTTTAA
TACGAATTAAAGAAACAAACTTTGAATCTAACTCAACTTTAAAAATTACCTAAATCTTTATCCCACGACTTAATACAAAATTGTTTCTACTGTTTCAATT
TATGATATCTTGATTATACGATAACAACTTTATCGATCGGTTTAAAAAGACAGTATGTGAAGCCATTTATTAACTGGAAATATTAAAAAGCATAAATGTA
TAGGAATGAGTGTGTGTTTACAATATTTTAAAGGAAAGGAAATTACAAGGAGTAAAGTATGGGGAAAAAAGGGGGAAGGATTAGGTTCTGTAATAATTTA
AGCAACCATTTCTGTAAGAGCAGTTGGCAGTAGTTAGTATGTCTTTTATAAAATCATAGATGTCACCATTTTGCTTGGGCAGGTAAAATACCTTTTACTA
TCTTCTTAAGTATTACTTATTGCTTTCTCTTTCCAAAAATATATAATTAGTAGTATAAAGTTTGCTTCTTTACTAGTTCTTGAAAGTACTCTCAGTTGGT
GAATTTAAGTGGTGCAAAAGGGGTACTATCAAAAACCCAATTTAGGGTACTGTATGTTATATAATTGGGGTTAGGAATTAGTGCTTTTTATTGGCATTTT
TAGCTAACATATTTCAGAATATCTGAAAAGTCTTGTTGGAGTCTATTCTTTATCTTGATACTTGTGGGGCTTTGAGTTGTTTTTTGATTCTAAGCTTCAG
CTGAGACAATTGGTATATTTCCTTAACAAGAACCTTTTTTTTCTCTTTAACAAACCCCATTTCTCATCTCCATATTGAATTTGCTGGAAGATAAAAAGAA
CAGGTTAATGTGAAGCTTGTAACTTTCTCTTTGCTGTTTTTAATAGTAGTAAACAAAAGGAATCTGCTTTCTTTTCTATTAGTGTGAGCTGTTATTTCAC
CAATGCTTTCATTTCTCTACTTTATGCTCTGAAAGTTTCATACTTTCTTGTCTCTGAGAATTAAACTACTTTTTATTTTCCATGTTATTAGACTAGGCTT
GATCCTAGGGTTCTTGAAAACAAACAAGGGGGGTTAAAGATTTTATGCCTAGTACTTTGGATTTTTTATTTTTTTACCTTTGTTGTGTGTCTATAGGATG
CTGCATTGAGAGATTTCTTTTGCTTTAAAGCTGCCAAGTTATTTTGTTCTTTGTTGAGTCTTGCAAGATATTACTACTTCTTTTTGGTCAAACCCCACTT
TACCTTTTCTTTTTTATTTTTCTTGCACAGAGTTCCTTTCTGTCAAATAACAATCAAGTTCTTGGCTTTGGTTAAAAACATTGCATTGGTGTTGTTGCCT
TTTTGAAGGTTGCACGAATTGAGTTCAGAACTAAATTTGTGGATCCTGAGCTATCTGCCTTTGTATTTTCTTGATAATGGGTACTAAGGAAAATGGTTCT
TTCAATTGCCCTTCTACTGGGATGAATAGAGCAGATTCAATGCCTAATGTTGACCCTTTTAGTGGTTCTGGTTGGGATCCACTTCTTTCACTGAATCAGA
AGGGGGGATTTAAAGGATCTTCAGTTGTTGGTCACAATGAGTTTGTCAATTTGCCCTATCAATCATCTCAGTTTGTTCACTATCCATCTGATTCAAATCT
AGCTGAAATGGTCCCAAAGATTCCAGCTTTTGGAAATGAAAGTTACTCAGAATTGGTCAATACTTTTCCTTTACAAGAACAGCTTAGAGGGGCAAATTGT
TATGCTAACTATGTTAAGAACAGAGGGATTTCCACTGAAGGAGAGTGCCAAATTTCTGGTGAAGGTGCTGTGGAGGTTTCACCTAATGGGAAGAGGAAAA
TATCAGAAAACCATTCTTTATCCAATGCCAACAAGGTATATTGCCATCTTTTTAAGTAATTTTGGTCAGTAGGTAGCAGATCATTGCCTTGTTGTTTGTT
CATATTATTAGTCCTAGTATTGCTGTGTAGTTCTTTATCCTTCAAACTATCTTATTATTACTAGTACCTCAATTATCATATTGCTTTTAAGCCTTTCCGG
TTAGTAGGTAGCAGTGCATTGGCTTGTTGATTGTTCATATTAGTAGTCCTAGTATTGCTCGTGTAGTTTCTTGCCCTTCGAAATCTGTTACTATCTTTTG
ATTCCTTGTACCTCACATATCATATTATTTTGTTGTTGTTTATGTTTTTTGTGACTATATGCTGTTTTTGTTATTAGCTATTGTTTCTTCTACTTCCTTT
ACTTCTTTTGTTGGACTGCTTTGAACTGTTTTTTTCTTGAGATGGTCTATCAGAAACGGCCTCTTTACCTTTGAGGTAGGGTAAGGTCTACATGCGCTCT
ACCGTCCGCACACTCCACTCTGTGGGATTACACTGGTTAATTATTGTTGTTTTTAAGTCTTTTCGATCATCAGTGTTGCTGCTAGAAGATGTCCATTTAG
TTTTTGTGCTTTCTTCAATGTAGAATGTTGAAGGAGAGCTGCAGAAGGCTCCATCAAGAGATAGTTCAGACTGTTCAAAAGAACAAGATGGTGGAAAAAG
ACACAAAACAGACCAAAACGTTAGCTCTAACTTAAGGAACAAGCAAGCAGGGAAACAAGTTAAGGATGACTCTGATGGTGGAGAACCTCCTAAGGATAAT
TATGTTCACGTTAGGGCTAAAAGAGGGCAAGCCACAAACAGCCACAGCCTTGCAGAAAGGGTAACTCATAGTCTACTATTGGCCTTTAAGGATAATGTTG
TAATCAATTTAAGTGGTTTATCTTTTCTTGACATATTGAATGAATCTTAAAAGTCATTTTGGCTGGCAGGTGAGGAGAGAAAGGATCAGTGAGAGGATGA
GATTGCTTCAAGAATTAGTTCCGGGCTGCAATAAGGTAGTTACTAGTTTTATTGTTGCTTAAACTTTTTGGTTATTTGTGTTCTATGGTTAACATTGATA
ATTTTTTATTTTCAACAGATAACTGGAAAAGCTGTGATGCTTGATGAGATTATCAACTACGTGCAATCGCTGCAACAGCAAGTTGAGGTAAACATGATAG
CCTCTGGCTCATATTTTTGTGTTTTCTGTGCCTGATGAGATCAAATTTTAATTTACTATTGAAACACAATTTTAGATAGACATAACTATATCATGTAGGA
TTAATCCAATGGTGCTCGTTAAACATATTTTGTTAGCATGAGGTTTTTTCTTCTGATGAAGAATCTTGCGAGATCATGGTTCGTTTTGAGAAAAGTAAGC
TTGGCCTAACAAATTAACATAAGAGGGATCCAAGTCAGAAAATGTCTGTGATAAATGAGAATTAATTTTGACTCAAGGATATGTTCATTGTACCGGTCTA
ATGCAGGGAAAAGTATTCCTTTCCTGTGTTAGAACTAGCATTTTTATCATCCTGTGTTAGAATTTTTTATCATCTTGTGTTAGAATAAGTGTTCCATGCT
TTCAAGAACTGATTAAACTGATTCCAAATTTGATCTGATTCGATGTTGCAGTTCCTGTCAATGAAACTTGCTACTGTAAATCCGGAACTGAACTTCGATA
TTGATCGTATTTTATCAAAAGAGGTAAGTTCACTATGTGATCATCTATATTCAATATTCAACTATGAGGTTTAAAATTCACCTGCATACCCTTAAATGCA
GATGCTCCATCAGCAAACTAGCAATGCAGCTCTTCTTGGTCTTGGTCCAGGGCTAAGTTCCTCTCTTCCTTTTCCTGGAATTTCTCATGGAAGTTTTGCT
GGTATCCCCGCAACGACACCACCCTTCCATCCCTTGCCTCAGGTATAACCAAAGTTCTCTCATAGGAAAAAAACTTATGTGCGCTCGATGTTCACGCCAA
GTAAATAAATGCAAGACCTGACTCAACATATACACTGTTAACACTAAACCATAGTTAGGTAATATGCAAATTTTTGTTTGATATGTGACTCATAAGTAAA
TGTGCTGCTTGACTTGTTTCGGTTGACATCTATGTGCTCCCACAGTTGGTGTGCACATGTAGACACTTAAACTTGTATAAAGTTGAACAAGTAGATACAC
GCGTCCTACAATGCAATTCAGTTGAGATACACTTGAACTTAGATGTATTAAGCAATGTATGATGCATGTGTACTTGTTCAACCTCGTACAAGTTTAAGTA
TCTACGCGTGCACACTAAAGTTGGAGGGCATAGATATTAACTAATGACAAGTTAAAGAGAACGTATATGTATTATTGGTTTAGTGTAAATACGAGAGCAA
GAGTATTTTCCGTCTCTCATCCTTGCAGTGGCAAAGACGGGAACTTTGTTCGGGTGTTCAAGATTAGTATGAAAAATAAACTTTGACCTATACATTTACT
ATAATAGTTTATATAACGGAACATCCTTCACTGTACGTTGCTACGGCATTGCATCCTTGTTTCACATTCTACTCATCTTCCAAAAATGGTAAAAAAGTGA
AGTCCTATTTTTTTCGATGCAGAATGTATGGGACAATGAGCTTCAAAGCCTTCTTCAAATGGGATTTGATTCAACTTCATCTATGAACAATATGGGACCA
AATGGTACTGCTCCTTAGCTACTGCACATACACTCTTTATTGTAAAGAACATGTTCAATCTCTTAAATTTTTTCCCAAGTAAAGAACTGATTTCATGTAA
ACAGGACGGTCAAAGTTGGATCTGTAGATTCTTTTTCGGGACAGATGTTTGCGTTGTTTTACTATGATCAGACGATTCTATTTACCCCAATTGACTGCAA
AATGTGTTTTGCATACTTGGACAGAAGATATAGTGAAAATTTACTTTTACTTTTTTCTGGAGTTGTATAGGATATTAGCTCCTAACTCATTTTGTGTTCT
TCGAGTTTTAGCAGAAGAGATTATTTTAGATTGGTAAGAAATGAACTGTACATTGAAAACAAGAAACATCATTTGGGGTAAAAGATGTCTTGTTTCAATT
ATGTTTGTGCAACCTGTAAGAATTTGTTTGAGGATTTCTGAGAGAAACAAACAGTGGTGATTTTCTTGTAAAGTCTTGTCATATCTGAAATGATCATCAA
TGTAATTGTGTTTTCTTTTTCTTAGTCTATTACCCCTAGTCAATTTCTTCTTTATGATGTTTTTGTACCTTGAGAGGCCACGGGCGGATCTAAGGTTTGA
CAAAATTCAGTAACTTTGGTCTAAATCTTCGATGGAAAAAGTAGTGATTTTTTTTGTGAAATCTTTATGGAACTCTTTGTAGAGAGTTGAAAAGGCAACA
AGTACAATTTCACCATTTTTATAGTGATTATTGTGGCATTCAGGGGCAATTAATAGGAACTATTCTCAATATTTCGTATGTGTTAGCACATGAATAGTTT
GGTGTTATGGCTTCCAGAAGATTTATTTGCAAAATTTTTACGAAACTCTTTAATAGGGAGTTGGGGAGCCCTACGTACAGTCTCACCATTCTTAGAATGA
TTTTTTGGTTTCTAGCGGTCAATTTACGAAAATTAGGCCATTTTCAGTTTGTTGTAAATATTAACCCATGAATATTTTTGTGATGACTTGGGATGATTTT
TCTGCAATATCTTTACGGAACCTTCCATTGCGAATCGGGGAAACAATACATACAAGTCTCACCATATTTAGACTGTTTTTTGGATATTTATGGGCCTTTT
TACATAAATATAGTGGTTTTCTCAAATTTTTTTATATTTTAGCTCATAAATATTTTTGTAATATGTCTTCTAGATGTTTTTTTTGCGAAACATTTTCGAC
TTGTTTAAATATTTAAAATAAATTTTGTTTCTTTATTTGTTTTGTTATAATCAAGAGAATTTATTTATTATGTGCAATTATAAATAATTTTTTTGATTAA
AATTTGATAAGAAATTGGGAAGGCTACCCCTATAATCCTTTACTTAGCCCATTTTTTACCAAATTCATCTCAGCCCAACAAATTATTGGACAAAGTTGGG
CTAAGAACCTTGAATTGGCGATCATGTTAAACATCTTGGGCCATGAAAACATTGGTTCACAATATTGTGTAAATGAGAGTCTTATCACTTCCTCGATTCA
CTTTTACTTATTACACTTTACTTTGTAAGAGATAATTTGACTAATTTTTAAAATAAAACTAAATTATCTTACTTTAACTTTTAAGATTTTAAATATAAAT
ATTTAAAAAATTATACAAAAAATACTACAAGTTGCAATTCTTCTGAGCTAACAATTTAAGCTGTTTGCTGCCATGAGTCTTAGAGCATGTTTGGTTCAGC
TTAAAAGCTAGTCAAACTGACTTAAAAGCTGGTTTTTGACTTATTTAGCTGTTTGGCAATACTCAAAACAACTTATTTTAAGTAAAAAAATTTATTTTAA
GCCAAAAGTTAAAAGCTGGGGTAGGGGTCCTTTTTTTTTCCAGCTTATAAGCTGTTTTAAGTTGACCACATTTTTACCTTTTTGCCCTTAATATTTTTAT
ACAATTTTCAAATTACCTACATAACCCTAACATCTCTTTCTTCTATTTTTCCCTTTTCACGTGTGGATGATAGACAATTACTATTACTAATGAATGAAAA
TAAAATAAATCTTAAATCTTTCCAGTGATCTATTCAAATTATATATTATTAAAATGTAAAATAAGTTGCACATATAACTTAAATAAAAATTTATATTCCT
CTTATAAATAATTTGTGATAATAAAGAAATATGTGAATGATAGACAATTATTATTACCTATGGATGAAACTAAAATAAAATCTTAAATCGTTCTTTAATC
TATTCAAATTATATATCTTTAAAATCTATAATAAGTTTATATTCCTCTTATAAATAATTTGTAATAAGAAAGAAATATGTGAATGATAGCAAAATATAAT
TATTTATGGCTGTAAAATATAAATTAATTAACTTTTATTATGTCAACAGCTTTTAAGGGTATTTCAGACATTTTGATTTAAAAAGCTGTTTATCAGCACT
TATTTGCCAAACACATCAACAACTTTTTTTTTAACTTCAGCACTTTTATCCAAACGCATAACTGCTTATTTTAAAAATAAGTTTCAGCACTTTCAAAAGT
ACTTTTTTAAAGCTGCTTTTATTAAACCCATCCAAACGGACCCTTAACATACTGAAACTAATTTGAGTAACTTTCAAACATTAAGTACCATATAGCCCAG
TAGATTTTTTAAAAATTATTGTGAGGCAGGTTGCAGATTTATGTGGATTTAAATTTAAATTTTAACTTTTTACATGTCTTAAGATTACTAAGATAATACA
TGAAAACGGTTCAATCAAAACTAATATGATTGCGCATTCTAGAAAATAAAATTTTAAGTCGTCATCAATTAAAGTATATCTAATTATGTAGTTTTTCCTA
AAAATGTTATGTAGGGTGAGGTGAGGCGAGTAAAAAATGAAAAAAAAAATTATTATGCAGAACGAAGCAGGGAGGGTTAAAAGCTTTACGGGTTAAGCTC
ACCCCGCCCGCACCACTCCATTGCGTAGATACATGAGACATACACTTTACAATGTAGTGTTATCTTAAACACGATTTTAAATTGTTTAAATCTAACTTTA
ACTATTATTTTTTTCCACAAATTGAAGAAATTTCATAAATAACAAAGAAACTACATTTAATAAGCCTTTTTCCACAGTTTGCCTAATTACGTTGTACATT
GTAGTTTCATTTGCTTTGTGTAATTCGCTTGCCAATATACAAACATACTAAGTATATACAAATTTTTCATTTAGAAAAAAATTCATAACTTATATAAATC
AAATGTATAAATAGAATAATTATATACAAGCTAGTTACACATATATAAATTCATAGTCTATGCAATTACAATAATTCTGACTCTATATAATTATAAACTA
AATTATGTAAATTCTGAATTTATATAACTAAAACATGCGGTTAATTTTCCTCAACTTAAAAGCAACGTTTTTATTTGGCTATTGAGTGGAATTTTTGTAG
TAAAATAGTGAGATGATATCATTGTTGTAAATTTGTTCATTCTTATCCATTTCCCTTTCGAAAGCTTTTTGCCAAAAGTAAAAATGTTCCTTTTAGTAAT
TTCTTTTAAAAATTTGAAGTCACTCATATGCCAATAGACATTGTATTTTCGAATAATAATACACGCTCTGGTTGTTTTGAGATAATAATTTTGAAATAAA
ATTTGAAAATAATTTTGTTACATATTTAATAGGAGGTATTAATTTATTTTGAAATATTTATTTCTCTAAAAAAAATAGAATTACTATCTCAAAATTAAAA
AAAAACAATTTTAAATATTTTTATTTATTTCATTTCGCTTACCAGATCTTGACTACTATATATATGTTGTTATAAGAAGCCGGCAGATCACCTCAATTGC
AATGTAAGCATTAGGCAAATTTATGGTTATATAGCCATCAAATTTCTTTATTCGTAGGACATGTCACATGAAACCAAACAAACCATAATCTTATTTTTCA
CGTTGAATTGTCGCAGATATTCGAGACAATGAAAGAGTTATTTGAATGGTAAATATTCTACATTTTTAATTTATAATTTATAATTTATAAGTTCAAATTA
TTAAAATAGCAAAAGCAGAAGCTCTTGAGGGGAATGATAGAAAAATGTTCGATACGAACTTTCAAAAGAATCATTAGTTTTAAAAAATATGAAATTAGGA
AAATTAATTATTATATGTGCATTGATAATTGACTACATGAACTTATACAGTTAATGATAAGATTTTTTTTTTTCATTACAAATTAAATACTTTAGAACAT
GATTGTCTAGACACACGTGTTATGTTTAATTTTTTTTTTCAATCTTCCCTTACGACCTCGTCAAGACATTAGTCAAATTCTATAATTTCTCAAGAGATAA
GTTCCACGTAAGATAAAAGACAAGTAAATAATTGATCAAAGCTACATGCATGTTTAATAATTAATGTTATGATAATCTATTTTATTTCTAATAATGATAA
AATATTTAGTATTATTTCTCATAAAATTATCATAGACTCGTTTGAAATATAAATTTTTTTTATTAAAAAGCGTTAAAAAGAGAAATACGATTAAATTAAA
ATATTCCAAATAAAACAAAAGCAGAGGTGGATTCACCTTTATACGTGAGTGCACGTGAACTCATTAACTTTGAAAAAGATCATGTGTATAATCTATTTTG
ATAAACTAACAAAAATTAAGATGTAATTAACAATATACATATGAACAGCGTAAAAAATCATTGTGACACTAGTACAAGTTAATAAATCACCTATGAGACC
TGAGTTCAATTCCAATCTAATGTAAGTGTGTCATATTGTCATATTATTTTACCTCTAATATTATTTTGATACTATATGTTATTTTTGTCAGAGAATAAAC
ATGAAGGTCACAAGTTAAACAGAACAATGATCGATGGTGACATTAGTTCGAGTTATAACGATTTGGAGTCATGTTCATTCGAATTTATATATATATTATA
AAATAAATATAATATATAGTATAATATGATATCTGTAACAAGTAACATGGAAGCTATAATGAATTGGCAATTTATATATGCAAAGTCTCTATATTATAAT
AAAGGCACGTCACTATTTACGTGTCAAATTCACGGATATCAGGGAAGTTTGTTAACTAATAAAACAAGCAAAAAAAATCACCTAGATCAACCGTTATTAA
TAAAGAAGAAAAAAAAACTAAAATTTCTTTTACAAAAATAAAATAAAGTACTCAAGAAATATTTAAAAAAAAATAATATATATATATATATATAGGGTAG
TTAATAAGTCACATAAAAGCCAGTAGGTTGTGACACCAAACATTACATAAATAATATTAGATGTGTCCCTCTTTCTAATATTTATATTAAATGCAGTCAT
GTTGATATTCATGTTCATTTGATGAGAGTGTTACATCCATGTAATTACACTCCAGCTACAAATTCATTAATTACATGATTAATTCGATCCCGTTTATTTT
TATTTGTACATTTTGAATTATTAAACTAATAAATAAATAAAAGTAAACGAAAAAAATATAATTTTATTTTTGCACAACATTTTTTTGCCAATGATTAGAT
TCGTAAGTTATTTGTAGTTAAAGCATTATAATTGTTGTTGGTATTGTTGATTTTTTTAACAAATAACTTTTTGATCTTTTAGATTAAATATACTTTATTT
GCTATTATTGATCATTTGACTCGATGAATAACATTGAAAACTTATCTTGATGTTTTATGATTTTATAACTCAAATTTGTTATTATTTTATTTATCTATTT
ATATTAATTATTTTTCAATATATTTTTGCGGAAATGTGTTAAATCAAATATTGAATAAATAAAAATGAGCAAAGTAAAAATAATTAAGGCTTAGAGTGTA
GTGAAATATATGAGAATCTCTCACACAATAATAAGTAGTTATTTTCAATGTCCTCCCAATGTAATAGAAATTGAAAAGGATAGACAAAGATAAAAACTTG
TATTTATTGTTGATATGGAGTTTATTACTCAGTTAGCACATACTTTTTATCTTAGTTAATCATAAGTGTAATAAATGGTAATAATAATTAAGATGAAATA
TAAAAATTAATTAAATTGTTTTTTGATTAATATTTTTCTATAACGAGGTATAAAAAAGATACGATAAAGTAAAATAAATAGATTAGTAAATATAAAAAAA
ACTCATTGTTTATGTATAAAAATAAAGTGAGAAAATGACTAAAATGGTCCTTACGGGTAAGATATGCAATTTTTGTCATTTAATATATTTCACTCCATTG
AAATGATCCTCAATATATGTTCATTTTAATCTTATACCGTAAATCTAATAAATTTCTTTTAAGAAAAGTATTAAATTTTACTATAGCCTACGCTATTAAA
AATATTTATTATTGTTATCTTTTTTATTAGTTTTAAAGAAATCGATAAAATTTAACACCATTTTCTTTAACAAAATTTAGTATTTTCTCTTTTTTAAAAT
ATTATTCTATTGCCATAATTTCCATCTTTGTTTTAAGCAAGGAAAAATAATAAAATTTATCTGAGAAAGTAAAAAAAAATAGTGTTAGATTTCACGAAAA
ATTTTCTTTTTAGAGCTACATAGGAGACATCAACGGTGATTTTGTTAGCCATATGGGATTCATAATTAAATTTCACTTTTTTTAAAAAAAATAATTTGTT
AAATTTAGGATAAAAAACTAAAATAAACCTTTTTATCATAATTAAAAATCATTCCAATCAAGTAAAATATATTAAAAACCAAAATAAATACGTTTATCGT
ACTTTAAAAATTATTTCGATCAAATAAAATACGTTAAAAAACAAAATAAAACATTACCCACCCACTAAGGACCATTTTAATAATTTTTTCTCAAAATAAA
TTCATAATAATTTATGTTTAGTACCACTGCATTAGGTAATGGCAGAAAAATTAGGTTAAGGACGGCCATCTATTAATTAGTGGCCTATCTGCAAAATTTA
TACTCCTACCTTTCTCTCTCATTGAAGTACTGAAACTTAAAATTTTATATTTAACTTATGAAATCAATTTAAAAACATAAACTCTTAATAAATATATGAA
GTTAAGTTATTTTATTTTAATTAATCAAATTAACTAATAAACATAAATTAATTTTTTAATTTTTTTATATTTGTCAAATTCATAATCTCAATGCTAATAA
CTCTCAAGATTAAAATAAAAAGATAGAATATTATTTGTGTATCTGATTATAAATGAAATGACAAGTATTAAAAAAATATTCATATTTAATAAAAACGATA
TTTAAATACTTCCTCCAATCATTTTTAATTATCATATTACGTTTTTCAATATTAAATAGATTACGTTAATTCAATCTTTGAAATGAAAAATAACACAAAA
AATACTATAAGTATTTACTTATTGATATAAAAAATAAAATTCTTATTGTTTAATTGTACAAAAGAATTAATGACATTTAAAATAAATAGAGAGAGTAAAT
AAAAAAAAAAGAAATACTCGAGCAACGTGCTGCATTTAACGTAGTACTACACATAAAACTCGCCTGCAAATTCAATTATTTTAAAAAGACTTCCCTTGCA
CAATGATTATGGCGGAGTTTGGCATATAAAATTATTAAGGATTAAATAAAAAGATATTAATTACTATATCTTAAATTTTTAAAAAATAATATTTTCTTTG
TTTTATAAAAAAATAGTCTGATTTGACTTGACATGGAATTTAAGAAAATAAAAAAAAAAATTTAATCATGTGATTTTAAATTAAAGTTATGTTAAATATA
CAAAATTTTCTTTTAATTTTATAGCTTTAAATATGTCACGTGAAAAGTTATTACAAAAAATTATTCTTTTTTAAAATAGACTAAAAAAAATCATTCTTTT
TAAAACTGAGAAAGTCTCAGTAGATAATTTGACATCATTGATATACATATTATGGCGGAGTTGGCATATAAAATTATTAAGGATGAAAAAAAAAGATATA
AACTATATCTTAAATTTCTTAAAATGATAAATCGTCTGAAATAATTAATATACGTTAAATAATTTGAGAGATAAGAAGTAATTGATGAATACCTTCCCCA
TTATTCCGCTGAAATTGCATTTACGTCAACGATAACCACCATGATTAATTATTTCCTAAAGGTCCAAGATCATTAATTATTTTATTTTTTTAAAAAAATA
ATTATCGTATGGAATTTCACTAAAAGACAGAAACAAAAATAAAAAGTTAATGAGAATGCAGAGTTGACTGTTAAATTTACTCTTTGTCGGTGTTTTTCTA
ACTCCGACGATAGATATATTGGTAACAAAAGAGACAAATGGATTCTAGACCCTCTCATTCCTTCTTAAATTTATCTCTATTAAGGGTATTATTGGAAATT
AAATCAAACTATTTACTCCTTCGTCTAATTTTAATTGTCATAATTAAATTTTAAGTGACTTTATATGATATATTTTTTTATTATATTAATATACAAAATA
TTAAAATTATAATACTTTTCGTATAGTTGTTTAAAATCTAATTTTTTTGTTTAAAATATTAAATTAATATAATTTAAACTCTAAAATTTAGTCAAATTAA
CATATATGATAAATAAAAATGAACAGATGGAATATTTGTTTAAATTTGTGATCACAAGGATACGTAAATTTATCTTTTATTTCTACAAAAGATTACATTT
CATAACTTTTGAATCTATAACCTCTTGAATCACAAGAATCTATTCTACGTAGATTTACCTCTTATTTATACAAAAGATTACATTTCACAACTTTTGAATC
TATAACCTCTTGATCACGGAGCGATAACGCAAAAACCCCCTTTCAAACAACAGTTCAAAATAAAGATCTTACCAGTGCAACAACTTTAAAAGCTTACTTT
CAAACAACACAATTATTTCACTAATAGTTGCTATTTAATAGCACATGTCCACTTGCCCAAAGAACATATCATACATTTGCAGGAACAAAGAAGTTCAGAT
TGTGTAATGTCAAAAAACTTGGACAACATGTACTTTGGAGGAACAATATGCACCTCAAAAGACATTATAATACTCCTAGTTATGAAAAAATGTACAATAT
TTTGGTTACATAATACTCCTCCTGAGAGATTCTCCAAACAAGAAATGAACCAGAGGGAGATTTATGTGTGAAGAAAAGCTGCGTGCTTGCTATACTCTAT
TCAACTTCCACTAAATTCCTTGTTTAATGTTTCAAAGACAAATTCTTCTTACAAAAGAATATAGCCAAAAGAAAGAAGAAGAAAAAAAAAAGAATTCAGA
AGATAAAGAAATTACATTGACACAGTGGGAGGGGGGTTTTGCTTAAAATGAACACTATTCACCATTTCTTAATGGTTTTCTCTATTCATAGATGCTGCAT
TTGCTCAACCATCTGCTCTAATGTAACTTTGCTTCATCATCTTTTACGGGTTTCCAACGGTTTGCGGAGAGGCGATAAGTCTCCACAATTTCCCCCCATT
GCTTACTCTTCTCATTTACAGGAATGTACCAAAGGTCAGGTTCAGCATCTAATTCTTTCCAACTAATATTTATCCCTAAGCTATGAAAGATTTAATCGAC
CTGTTCACCGATCAAGTCTAGGCCAACGAGCAGGAATGATATACCTTGAAACAGCAAGAAGTAAAAGTGGATTCCTTGAGCTGATAGTAGGCTCCTTAGT
GAAGCTGTCAACAGCAAGAAAGCTAAAGCCAATTCTTTTGTGTATATTCTGTTGTGCTTCTTCTTTCTTGAAGCTTTTTTCTCCTTCTCTTTAATTTCCT
CTCTTAATTCCTCTAAATCAGGCACGGAAACACCTCGTTGGTGTTTTGGTTTCCCATCGACCAACAAAGTAAGATCGCCCTCAGAGGAACGTCCTGATTT
CTTGGTCGCTGTCCATTCTTCTGAAGCAACTCGCTGGTGTTTTGGTTTTTCCTCAGCTAACGAAGCAAGATCGCCCTCAGAGGAACGTCCTGATTTCTTG
GTGACTACCCATTCGTATGCACTTCCTAGTTGGAAGAGGCCAGAGACCATGGCATTAAACTTGGTAACGGACATGGTGTTCTCGAATAGAAGGTATGGCA
CGATGAATGGGAAAGATTTAGGCGCCGGAAGTATATTAAGAAATGACATGGTGGCAGGGACGTAAGAGACGACCCATGATGGGAGCGTCGCCTCAGGAAT
GAACATTGTCATTGGGAGGATTATGCAAAACAGAGTGAATGAATAAAATGGCAATACCAACTTCCTCAAAAGGAAGAAAAGAAATATCAAATTGCCCTTC
TTCCATATGCTTATCTGCATCCAACCATATTGCAAGCATTATTGTTAGGCACAACATCCAAATATGCTAAAACTTAACAAATAGAATCGGATATCACTTG
AATGGATGCATTCCACAATACCTTTGATTTAATAATGGCAGGTAAACAGAGACGAAACAACTGCATTGGCCCCGAATGCCATCTATGTTGTTGCTTCCTA
TACGCTTCATATGATTCCGGTAACTCACACTGACACTAAAGTACCAATAAATTCTTCTTTAGGCTCAACACAAAGCAACTACTTTCAATAAAGCTATACT
CGAAAACGAAGCTTTTGCAATGAATTTTACCTCTACATCATTGAGAAAGATAAATTTCCACCCATGTAGATGAGCCCTGACTGCAATGTCCATATCTTCA
ACGGTCGTCCGCTCCAACCAACCACCAGATTCTTCTAATGCCTTAATCCTCCATACTCCAGCAGTCCCATTAAAGCCAAAGAAATTCAGAAAAATACCAT
TAACCTGCTGCTCCACTTCAAAATGAAAAGCCAAATTAATGTGCTGCAATCTTGTAAGTAGATTTTCATCCTTGTTCACAAAAGACCATCTTGCTTGAAC
CAATCCTATGTCATCATTATCCTACAAACAAACCACTCACATCATAAGCACCACATTCTACACTAAAGTGATAGCATACAACACAAATTACATCACATAT
GAAGGTAATCGAATATACCTTGAAATAAGGGACAGTTCTTTTAAGAAAATCAGGCATAGGCTGGAAATCAGCATCGAAAATGGTAACAAATTCGTAGTCT
TTGACATAGCTGCAATTCATAGCTGACTTAAGATTACCAGCTTTATAACCCTCTCTGATCACTCTATGCCTGTATATGATATTGGCACCTTCCTTCTGCC
ACTTACGAACCTCTTCATTGATCAATGTCTGAGTAACTGGATCATCTGAATCATCAAGAACTTGAATCAACAATCTTGATTTAGGCCACTCCAAACAACA
CACAGCACCAATGGATTGCTGATAAACCTGATAAAAATAACAACAATTCCCACCGACAATATAAAAATGAGTTCTTGATAAACAATTAAACACAAAATCT
TGGAAAGACAAAAAAAAAATTTACTATAGTTTTACCTCTTTTTCATTACACATAGGGATCTGAACTAGTACCATAGGGTAATAACCACTACCATCACCAG
ACTCCAGATCCATTGCACCTTGTTTTGCTATTGGCTTAATCTTCTTCATTTTAACCCAAAAACACCCTAAACATAGTACTAATCTATCCACACTTTGGAT
AAGAAAAAGCACAATGCAAGCATTAGCTAAAAATTGAAGAGGAGGAGCAAGATACTCCACCCTAATCAACACCCATTTTGAGTAAAACCAATCAAAAACA
CTTTGCACAGCTAATGGATTAGCAAATTTGTGAAAATCCAATGAGTACAAATACTGTAATTGAAGATCTGGTGCACTAAAGTACCAGCCTTTGAAATAAG
CTGTTATTTCAAACCCTAACAAGATTACCGACAACCAAAGAAAGATCTTTATGCAAGTATAGAACCGGTTCTTGACAGCCGGATTCTCAGTGGAACTGTT
GTCTGTAGAATCAGTCCGACCGGCAGCGACACGGCGGCGCACGACGGAGGCTAAGCTGAACAATGCTGATGCTATAGAAGTTAAACAACCAGCAGCTTTA
TGAGCCTTAAGAAGAAGAACCCATGTAAGCTGTTTAGCATTCTTGTTTCGAACTTTTTCACGTTTATAAGGAGACATTGAAGAAACATCATCGTTTGGTA
ACAAGAAATCATCTTCTGATGGTCCTTCAAGCTCAACCATTGACCAATTGTTTGGATTCTCCATTTTTACCACTACTGGTGTACCCCTATGAGTTTCTTT
ACCCCACCAGGTAAATGAAGGTGCCATTCTTGAAACAGACCCAGATGGCAAAATCACTTTAAAGATGTAAAGATTGAATCTTTATCTGTTTTTCAGCTCA
AATCAACACAATGCTAGCAAACCCAGATGAAAAGAAACTAAAGGGTGTTGGATTTTTGAATTCTTGAACTCATTTCAGAGTCCAGAAAGAGAAGAGATAA
GAAGAGACAGACACAGAAAGCACACACTCACTCACACACACACAGAGGTTTATAAAGGGAATATGAAAATTTGCAAAACAGTATATTGAATGTAGAGAGA
GAGAGAGAGAGAGAGGACCATATAATAAGAGTGTAAAAAAAAGAGCTATAATATAATGATATGATTTTAGTTGAAGAAAGCAGTACAAACAGCCCCTTGG
ATTACAGCTTGCAAAAAAAAAAAAAAAAAACTTTTCACAATTTTTGTTATGGTAACAGCTCAACACGTCTTTGATTTTTGTAAAATCAAATAATCTCAAA
AGGAAAATTTGACAGCACGTTGTTCTTTTTTCTATCAATACCACCACTCTTTTTTATGTATATATAAAATAAATAAATTACCAGAGTGGTTTAATTGCTC
CTTTTTTTTCACCCTTTCACATGACCAAGAACATTAAAAAAAAAAAATACCCAAAAATCAAATAGGACATGAAATTTCGTGGACTTGTGTTTTTCACCTA
CTACTCCTTAATGGTGTTTTACAATAATGAAATTAAGAAAGAAGAATGAAATAGTAGATATTATATTCATAATGACAATAATAACAACAATATAATATGT
GTATATATTTATAGATAAACAGAGATAGAGATTCAAATGATAAAAAATTTAATGAACCTTCAAATTTTGGCTCCTCCTCTAATGAAATTTTTCACGAAAT
AATAAATCAAGATTTAAGATTTGTCTTTCATTAATACGCATGAAATAGATACATAACGAGAATAATATAGGATAGGAGGAGGATATGACTTTAACTAATC
ATCTAATCTTCAGATCATAAGATCTGGGAAATAATGAGCATTTAATTTTTGTTTTTAGCTGTAATAAATTCCTAATTTTTTTTTTTTGTATAAGGATAAA
AGAAGTAAAAAAAAGAAAAATTAGTACATTTGTTTTCTTGTTTTTGGTCATGTTCAAAATTCCTTGACCGAGAAAACAGCGGGTCGTGGCCGTCATCAAA
GGATTAATGTCCAAATCACCCCTTTGAAATGGTACTCGCCTATAATATATGAAATATTTTTTTTTAATTAAAATTTAATAATCGTAGTGTACGGATTAAT
TTTTGTGGTATCAAATTATTTTATTAATTATTAGATCAGATTTTTTAGTGCATAAAATTATATAATACCACTTAGATTAGAGTTTTTTTGTGCACGAAAT
ATATAATATACTAGTAAGTCGTTTGAATTAAAAATAACTTATGTTATAATTAATTATGATGTGGCTGGTTATTTTGATTATTTTTCTTATTAATTGTCCG
AATTTTTAATATTTAACTAGTTGTTCTTTACAAAAAAATATTGTATCTAATGAGTAGAAAAATAGATAGAGAAAGTTTAAGGATATTTTGGTCCTTTTAA
TTATTTTATCATGAGATAAGTAGGTGATTAGTAACTAGTAATAATTTCACCATAGGAAAAACTTATCTCAAAACTAATTACAATATAACGTATATAGAAT
CAATAACCAAACTGAGGATACTACTAAATTTTTAATTTTGAAATTATCTGTAATTGTCAGACATCCCCAACATTATATATATTTTTCAAACGTACCAAAT
GACCTGATAATTTTAAGAAAATTTAATTATAATTACTTTATATAAACGTAAAATAATTAATAACTCTCAAAATTAATTCATATATAATAACTTGTAAATT
AAAACTCAATATACTTCATTCTCTATATTGTCATGATAGATAATTTCGAGCTCGCAATTTTTTTAGGAGGACTTGATAGTAATTACACTCAATTTAGTCA
ATTTTTTCTTTTCGTCTTGGCCGATTTTTGTCTTAGTGGTAATAATTATACTAATCTAAATAATTAGCGTCATTCACGCTACGCCAAAGACACAAATGCA
CAAACCAAAATTTGACACTTCAACTAAACAAAATTTTGAAAAGACAAAAATACTATACGAATTATTGTACGTATTAAAGAAATTATTAAGTGGTGGACCT
CTTTCTTTTTTTATAAAAAATAAAATAAAATTGTCTTTTTACAATACTTCCGAGAATAACGAAAGTTGCGTTGAACAAGTGGAGCTATACAAAAAGGCTG
CATAAAATATTTCCTTTTCTAAAGGTAAAAATATTCAAAAATATGAAGTAACATATTGTTACTTTTTAGATGTATAGTAGTACTTGTTAAATCATGAAAT
GAATTACGTAGAGTTATAGCACTAATAATGGTAATATGATATCACTTCTTTTAACCTAAATGAAACTACAAAAATCACAATAATTGTTGGATAAGAAAAA
GAAAAAAAAAAACTAAAACCAAAAGCCCATGATAATTATTAAGAGTGTAACATGTAAAGCCAAATTTTTAATTTAAAAAAGGTAGAATTGTTTCTTAATT
AGCTACACTATGGAAAAGTTGAGCCTATAAAAGGTTATCCGTGATGAAGGAATATAATTATAACCTAATTAAGGATTTAATAGTTTATCACTCTCTAGCT
TCTACGGTTAGAATGTGAAAATCAGCTTGTAAAATTATAGTTAATTTAATTTGTTTATATGGGGAGGGTAAATAGTATATTCAAGTCATTAGTAATATAA
GTTTATTTTGACTCGTTCAGCTCTGATCATTTAAAACTTGATTAATTCATAAAATTCATAATATAAAGGATAAAGTTCTATTAGGTACTCAAACAAATTA
TTTTTTTAAAAAAAAATTAACTTTAAATTCAAAACTCAATAAGAATGGGACGAATTGGATCATAACTCAACTTTTAGCTCAATTCCGTCTAATTTACTTC
AGTTCAAATATCTTTGAATAACTTAATGACACGTCCATTTATTAGTTTCATCTATTTTAAACTTATCACAACCTATTCAAACTCTTAAAGAAATATATTA
CTCCCTCCGTTCAAAAAGAATGTCTTTATTTCCTTTTTAGTTTTGTTTTAAAAAGAATGACCTCTTTTCTTTTTTAGCATCACTTTAACTTTCCACGTGA
CATGTTTAAGACCACAAGATTAAATGACATTTTGATACATTTGACATAACTTTAATTTAGAACCACAAAATTAAAATATCTTCTTCCTTTTTCTAAACTT
CATAAAAAATCAACTAGATCATTCTTTTTTAAACGAAGGGAATAATATGTCTCAAATAATATGCCACGTGATAAGCACGCGTTGGATGATGTATGAACAT
TAATAAACAAAAATATATACACATAAAAAGACACATAAAAACAAATTAATTTGATTAAATTATAAAGTGAAGGTCTAACAATCTTCTTAACTCTCAACCA
AACACCGACACTTTGCGGTCAAATAAAAATGTCTAGTATTCTGAGAAGTTTTTTTTTTTAAAAAAAATAAAAATAGAGAGTTTAACTAACACTAAATTAA
AGAAATATAAAAAAGATTATGGAACGTTCAACATAGGTTAAATATTATATTAATATTAATCATTTGTCATATTAAAAAGTGTCATTTTTTTAAAAAAAGA
AAAAAAGTAAGTCATATAAATTAAAAAAAATATATAATATATCCATATAATTTCTAATATGATATATATAAATATAAAAACTTAAATTTTTTAAGACAAC
GATTTCGAAGATTGAGTGGTCATGTAACTAAGTACACAAATGTCAATTACCTGTTATTTTCTTAGAGGTTCACTTTACTACCAAAATCCTCAAAGTCTCC
AAGTATTCATTCTATATATTATTATCACATTTATGATTAACAAAAACAGGTAGATATGGATTTAGAAACGAAAACTACTTAAGTTTAATATCTTCTAAAA
GAACACTTCTATTTAAACAAAAAATAATATTCTTTTTATATTACTTTGCGGAGGACAATGCCAAATGGAATTGTTTTCTAAATGAAAATAAATTAATTTT
TGTCAAGTCTCCCATTTACTCGTGGTAGTTCCTTAAAATGAAATTTTCTGAGGCACGTGCGACGACTCGGTTAATGCACGTGTGAGACTACCGCTGGTAT
AAAATTGATCGGTCGGACAAAGCCGGCTATCAACCACCCCGGTCAAACCGGCTGTTGGTTAACTTTTGTGAGTATATGACATTATTTCTTAATTAATATG
TTTAAATAATTTTTTTCTTTTGACTTTAATGCTTACTCCTTTTTCCTGTGAATTAGAGATATCGTTTTTAAATAGATCTTCGGCTTGGGAGGTTCGAACA
ACACAAGAATAAAAGAAACTCCAATGAATATATTAAAAAGAGAAAAATATTGCAGCAAAAATAATAATATAACTAACAGAAAACAAATAAAAATTTTTTT
TGTACTAATGAACATGTGTACCCAACTGTTGCAAGTTCGAGTCTTGCAAGAATAATTATTTTTGCCTTTTAAGGGTGTGACTTAGTGATCAATTAAGCGA
ATGAAAAATTATGAGGTCTCAACTCTCAAGTTAAGTCGTGGTAAAGATAAAACACTGCGTAATTTCTTTTCGTTTGTCCTAATTTTGGTGAATAGAGTTA
CCAGATATGATCTATTATTGATGAAATCTGATATTTCACGGAATCATATTAGATAAAATTGAAATGGAGGAGTGTTTAATTACATATTAGTATGTAACCA
ATTTAATCTTGCAATGTATAGAGTCATACAAGAAAAAGTGAAAGCAAAAAGAGTAGAAAATCAAAATGCTTCACTAGGGGATCCAAAGCGTGTAGGGTCA
ACTAACTGATTGAAAACCATAGAGTATTAATCCAACATATTAATCCTCAAGATTATATTCATCATTACTATTAGCTTTGTACAAGTGGATACCTCAATAA
TATACATCTAGGGGTCCTAATCTATTGTTTAAAAAAATTAACAATAGATAACTTTACTTGCTTATCCAATTAAACAATGATTAGTGACATTTAAAGTTGT
CTTTTTCTATTTTGCCCGTTTGGGTTTCACGGCCAATGACCACATCACACTTTTAGTGCCTTCGATTAATTTTTAAATAATGAGCAAAAAATAAAATAAA
TCGTGTTAAGTATGATTTTATAAAGAATATTTCTGGTGTATAAAATATTTTGTTTGAAGGTCGGATGAAAAGTCAAATTTAAAAGGTATGATATAAATAA
TCTATTCAATGCAAACATTAGTAACTATTTAACGAATCAGTTCATGACCTATAAAATAACATGAAGATAATTTATCATTGCTCTAAAGCTTCTTTCAACG
ACCTTATTAGTGGAGTATAATAGTTTATAAAAGGGAAAAGGGTCTGATATACCCCTAAACTTTGTTATTTAGAGCTGATATACCCCTTGTTATTAAAGTG
ACTCATATATATCCCTACTTGTAAACAAATGACTCACATATACCCTTTCCCTTTAATGGAAATGAAAAAAAAAATTGTAATCTAAATTTTTATTTTTTTC
TAAAAAGTATAATCTCATATGAGTAAATTTAATCCTCGTCAAACATATTTTTTTGACTTTTTTTTGTTTCAATGATTAATTTATAATTATTATTTTGATA
ATCAAATTTATTTATGTTTTACTAATATTCTTGTAAAACTTATTGTAGATGACCAAATTTTTTCTTCGAATACGAAATTAAATTACAATAATACACACAA
AAAAATAGTTTAATCTTTTATTCTTTAAACTAAGGAATGAAAGAAAAAAACAAAATAAGAATAAGAAATTCAAATAATTATAATAAAAGAAGTCAAAAAA
TAATTCATGTATGAAAAAAATTAAAATATACCTTGAATTTTGATAGAAGAATCATATATACCCCTAAATAATTCCTTTTTTAAAAATTAGAAGTAATAAA
CATAAATTTAAAACTACTTTTTTAACTTCCGTTAAAGGAAGGGTATATGTGAGCCATTTTGTAACAGCAGAGGTATATGTGAGCCGTTTGTATAACGATA
AGCGCATATATGAGCCACTTTTATAACGAGGGGTATATCATCTCCAAATGACAAAGTTGAGGGGTATATCAAACCCTTTTCCCTTTATAAAATTGTATAA
ATTAGTGGGAAATTTTATTGGTGCAAAAAATTAGTGTGTGATCATGTCTACTTATGCATGACATATGAAAAATTATTGAGACTTAAACAACACAATTTTG
GAATCGTTAAATAAAATTTTCCAATGATTGTCAAAATCAACAACATGTGTAAGTTAATTTTAATATGGGGTTGATTACGACCTATCAAAATTAGAATAAT
AGAGTTTGATTAATATTTATTTTTTCTTTGTCGGTGTGACCAACTTTTTTAAAATTATTTAATGTTAAATAGGAGTAACTAATATACAAAAATTCAATAT
CTTGACGTTTGTATGGTTTATGTTGGTTTTCTTTTTATTAATTATTGGGGTTGTTGGTTGGTACTATTATTTTTGGTTTATTTATATTTAAAAATCATGC
CTAGTCCTTTTGTTTTCCCTTTTATTTCTCTCTATTTTTTCTAATATAAGAATTATATATGGTCAACAATTTTTTAATATTTTGGATGACAATCTTGTTA
TATTCAAGTTTCAACTTGTACGGTATCATATACCTTGCAAAAATTACCACAACAAATCACTAGTTTAATACAATATTCTCTCTCGTTTTTATTTACTTGT
CTATATTTTTTTTTTATATTTGTCCCTATTTACTTGTCCATTTTAATAAATCAAGAAAGGATAATATTTTTTTCATAATATGCGCTTATTTAATTCTAGA
AAATTTCTAGTACTACTAAGTTATAATGCATGTTTTTTGGAACCAGAAAATACATTTATTATACTTAGGGAGTTACATAGTCTTTTAAGTTAAGGATAAA
ATTGTAAGTAACCTATAATAATCATTGATGTCTGTGTCACTCCTAAAATGGACAACTAAATAGGAACAGAGAAAATATTTTTTACTACAGTAAAAAGTAG
ATTGAGACATAAAATTTAAATAACTATTGTGATTATAATAAATCGAATCAATGTTGTTGATGCAATAACTAAAAGAAAATTCACTTACGCTTTTCTTTTT
TCAAATATTCGTAAAAATTCTTGATCTTATTGACTATCCTAACATATTATTTTTTTCTATTGGTTGAAAAAAGGAATAATAAACGAGAGGACATTTTTAT
TTTGACTTGTGTTAGGGCAATATTCAAAAGGTTTTATGCCAAATTAGTGGACATCACGTAAGAAACTATTGTTATTCGAATATTGCAACTAAAATTTAAT
TATCAGATGCAATGGATTGACTTCAACAAACATAATAGTATGAATTTGTTATTTTGTTTAAATATCTCATTATTTTAATTTAAACAAAAAAAATAGTCCA
ACTTAACTAAAATCAACTACACAAATGTTGCCACGTTAGCAAAATAATGCAAAAAATAATAAGATACAATCATCGTGGACTCAATTAATATGAACTTCTT
CAAATGTTGAGTACGTGTTTGAAATGAGAGTGATATTTTTCTTAGTTAATAAAAATATTTTCTAGAAGTTGAATTTCAAAAAGTAATCTCTTAAAAGAAA
TAATTTTTTTAATATGTCTTACATTTTTCATAGGTACAAGTCAAATTTTTATATTTTATATAAACAAATATTTTAATACTTGAAGCATTTCGTTTGTTTC
AATCAACATTTTTATTTTAAAATATTATTGACTAACTTTAATTACTCAAAATTAGCACATAAAAGCACCCGTCCATGACATTATAACATGAATTAGCGAT
TAGCAATAGACAACTTGTGTCATTATAAAATAAAAATCGATCACTAATCCGATTTGATAATAGCTTATTGATAATATGATAATTGTATTAGCTATGCAGG
CTAAAAAAATTCAAATAGATCCGCTATATCCGATCAAGAAGTTTTAAATTTCTAGACTCAAAGCGGAGAGTTGAATAAGATTTTTTGATCAATTGAATTT
TCTTTTCTTCAAAAGAAAGATCAATTTATTTATTTTTGATAATAATACGATTTGCAATAAAAAATTAATCACGTGACCAGAAATCGATATGAAGGCCAAA
ATAGTAGTTGTTGTCTATTGGAGATATGAATGTTACACTTCTTTTTTTTTTTAATAGATGTATTTTCCCCCACTTCAAATCTCTAGTTAGACAAATTTAG
TAAGTTTTGTGTACTTTGGAGGATTAGATTAAGCTATAGATCTACTAACTAATTAATTAAAGTTATCACCATCATGAGATGTTGGGAAAAGACATCTCAA
TATAAATTGAAGGACAACTTATTACTGCTACAGCTGGGCTTTCGCTAAAAAAAATATTATTTGAAATATATTTGTATGTATTGTTACGGATATTTTGATT
AAATCTGTGAGAAAGAATATCGATGAGAAAGATTGTCGATATTTTAGTGAGGATCAAAATCTCACTGTTTTCTTTCATAGAGCTGATTTTAAGGGAATTA
TGTGGAAAAATCATGTTTAATTATACAAATTTTCAATTGATTTGCAGTAGAAAAATCTTAATAACGAGGGTTCAGTTTTTAGTAATGATAAAATTAATTG
TTATGTGATGTGTAGGTTACGAGTACAGGCTATATACTCATTATTAAACTTGTGATAGAATAAACAACTTAAATTACACAATTTCTTATAAACACACAAT
ACTTCATGCGAATATTCAATTATAGATTATTATTTTTTTTTGCAAAAAAAAAAATACAATACTAAATATTTGTGCATTGAGTTTAACAAGTATAACATGT
CATGCTACCAAGACTTTTTCTTTAGTTATTTAGTATCTAAAATTCATTATCTCGATTAATTCAAAAATGACAATCAAAGTTCCCTCTTTATAATTATTAT
CGAAGAAGAATACACATTTGAAGCCATAAATTATGTACGTACGGTATACAAGAATTTTTATTTAATTAAAAATTTAGTAATGCTATCCGAAGATTAAATA
CATATTCATTGCTATTAAAAAGATAATTGAGACACAAATTAGATATTTATACGTAGCTTCTGATCTTTGACATGAAAAAAAGAAAGAAAATTATTGTAAT
AATGAAACAGACATGTGAGATTAAATTTAGCAACATATATATCAGTTGGATATGAAAATCTATTTGGATTGAAGTTAACGAAAGAAATTAGATAGTTAAG
ATGTCACCTTCATTATAGATACTTAACACAACTCTTAGCTAAAAGTTTGAAATTGTCTAAAATATTGTTGTAACAATAATATATCCATGTAATTCAACAA
TATTATCTTATGTGTGATATATTAGTTATTTTCAATAGATTTCTAACTTTAAAAAGTAGAAGCATTATCATGTTTTATTAATTTTTTTCTATTTAGATGA
TTGTGAAAATATAAAAGGAGCTAGGTAAATAAATATAAAATAATAGTAACACTAATGCTTTTCTTTTTACGATGAGAATTGCATTTGAACTTATTTTGTA
CGCATCTTAAATATTTCATCATTAATTACTTTCTTCAACATTGATAACTAAATAGTTTTGCTTATTAAATTTTTTTTTTTATTATAATTTGAATTCGGAT
TTATCATGATTTTTAGTATAATGAGTGGGAGTGACATGCTTTTCCTGGCATGCTGGAATAAGATGACAAGGCTAGAATAATGCATTCCCAATAGACACAT
GGTAGAATAATGTCATGAGTCACAAGTTAATAATAATAATAATAAGGTTTTGGGTAAATTCCAAATGATGAAATTGGATAACTATGGAGAAAAAAAAAAA
GTCTAAAAACACTTTTTAAGCGGTTGAAAAATATATTTTGGCACATTTGTGACAAACTTGTGAATGTTCATAATATGTTAAATGCAAAAAAAAACATTTG
GCACTCATGTCAATGACTTTCTTAACACTTAGTTTTTTCTCTTCTTTAATTTGTTCTTTTTGGTATTCTCTTACACTTCATACTCTTTAGATTACAATGT
TGGACAATGCATGACAAAATAGCTAATAATAATGCAAGCAAGATCTGCCTCTTAACACGTTTGAATTTAAACAGAAAGGGATGGGCAGCACGTGGATTTC
GTTTAACTTCATATTCTTTCTTCGAATTCTTCAAACTTTTAGAATCCATCTTCAAATCTTCAACTTATCATTAACTCCGTTGTAAAATCTCATAAATAAT
ATATATCATGGCATCTTACTTTGAATTTATCGTGTAAATATATCCATCACCAAGACAAATAAAAAGGGGCTCAAGGCTGATGTACGTTTTCTCTAGATCG
ATGAATATCATATGTATGTTCTTTCCTTTCATATACTATTTCATCAATTTTCTCCTATAATTGAACGTCATGAATCAAAATTTATTAGCTTTTGTGAATG
GGTTGTTAAGATCTATATAAGTACCACTTCTTTTTTGCTGTTGTACGATCTATATTCAGGGTCGTTCAGTTCAAAACAAAGTGATCTTAGGATTACGCTT
GTAAAACTATAACCAAGGTAGATGATATCATATTCTGTATGGAATATGGCATCCTTTTGGTATATTTTTATCTTGATTTTAGCTAATACCCTCCTTAGAT
TATTATGCTGATCTCCACAAACATTTTGCAGTTTACATTTTTAAAAATCTTTTTAGCACAAAAAAATTGAACTTAACTGAGTAAATAAGTTAGCTGCTGA
GATTTTCCATATCTTTAAATGAAAATTACAACTATGTGAAAGTTGTATCAAGAAAAGTTGGCAAGACGTTGATACAAACGCTCTAATGTTCAAGCCATTT
TGTAGATTACAATTTTTCTGTGCTGTACAGAACATAGACCGATTCCTGCATTATGTTCCCATGTATTTTCCAGTGATATTCTCTTTGGAATTAACTTGGC
ACCATCAATCAGAAACCAAAGAATCAGTTAACTTACCCGAAACCAAACTCTATGGCGCTCTTCTAATCTTCAACTCCAATATTGAAAATGCTGTAAATGT
CACTGCAGATTGCCACACTACTTGAGGAAACAGCTAACAATATCATGACTGATGACACTAGCCTGTCCCTCTTGGTTGCAATTCCATGTGTATCCCTGAT
GAATGGCACAGACGTGGAGAATGAACTCTGAGTATGTGAGGATGATTACAAATAAGTAGTTGAAAAGGGAAGATGGTACTCACCTAAGGACAATAGCAGC
TGGAAAAATGAAACCAACAGAGACAGTAGCCGTGGCGCCAGTAAACTGGAAGGCATCCCAGATGCTAGGTACACAATTTGCTCCCAAAAATATGAGACAG
ATGAGAGCTGCTGTGACTGAAAAGAATCTGCGATTATCATAGGCAATAGGAATTGCATATGGGAAAAAGAGGCCATCCATATTGAGGCGAAGGGAAAAGA
AGACAATTGGGAAAACGAGCATCAAGTGGATCACATAGCTCACTCGCACCACATCATTAAGTAATGAGCCATAAGGAATTCCGAGTTCACCATCAAAGTT
GGCAAGTACATCATCCAAGGTATGATCACCAAAGAGAAGGAATCCGAAAAAGCTGGTTGCTATATATACAGTTAAGCATAACACAATTGAAGTACGGACT
ATTGACTTCATCTGGCTGCCATCTCTTAGCTCATTCTCTATTGGATGTACTGCAATACTCATCAAACAAGTATTAGAGTTTTTGTACTTTTTACAAGTAA
TTTCTGGTCACTCATTGAGCATTTATCAAGACTGACAAGTAGGATAAAACCATGTCTAGGAGGTGAGATTTAGGGCAAGTGTGTATTTGGTGGTAAATCA
AATTATGACAAGATGAAGTACAAGTACATCTGGTGATCCATCCCAACTTATAACTGCGTAAAATATAATAATTTTGTGAAATACTATGTCTAGGTTCATG
AGTAAAGATTTGATCTTTCAGAATCATGAACTTGGGAAGCAGAATGTTGCCAGCATGAGAACGACGGACTTTTGGAAGCTCTCAGCGTATTTAAAAGATT
TGGATACACTCTTCTTTAAAAAACAAACAAGAAAATTTTGTTGACAAGAGAAGCACATAGAGGAACACCTACATGTCCTCAACAAACCCGGATAGACATG
CATGACTTGAAGCTCTCGAAAGAGCTGCTCACTAAAATGTAGATTAGACACTTGGGGAAAATATGTGACAAAGAAAATTTAGACACTACTCAGATCTCTT
GGTTTCCCTTGGATACAAGGAGACTTGTTGCCTAAAGCATGTATACCAAAAAGCCTTTGAGGAAACGTCCTCAGCTTGATTTGGGTATTAAGATCACATT
AAAAAGGAAAATTGCATTATCTATCTGCTTAATCACAGAGGGGGTTGTTACTAACGATATTCTTTGACACAATACTGTGTAAGTAATGAACAGCTAGAAC
TTACTATTGTGATGGCAAATATAGGCAGTAACAAGTACTGGAACAGTTGTGAAAAGCTTCCAGAAAGACGCTTGATCAATAAGTTTAGGCAGTAAGCGGG
GCATCCCAATGCTTCCATTAATGACCTTAACAATGACTATTCCAGCAGTGATCACCACAAATACAACAGCCAAAGCGACTGACAAAGCTGATGTGTATCT
CAATGAATCTGCCCAATACAATAAAAAAAGTAATCCATATTAGTGACTGACTGCAGATAGTGCCTTCACAGGCAAGTATACCATCTGAAAAGTAGGAAAA
CAAATATAATGAAGGTGTAATAATATCGTATTGCTGGCTGATTTCGATAAGAAACTGTACACTACATGCAATACAATCCGAGTTTCATCCCATAGACAAG
GAGAACCACCTCCTTCATTTAAGGTGATGTCACATCATAAGAATTTAGACTGCGTGATTATGCAATAATAAGTTAATAACCTTATGAACCTGGGCATAGT
GGAAGAGATTGTACATTGAAAATTTCACAAAATTATTGTACTTTAAATGGTTCTAACTTGGCTAAAGTGTAACCAAACACAAGATGCCCTTCTACTTCAT
ATTGTCATAATTCGGTTAACCACCACATCACATCAACAGCCCTTAACCTCATATACATAATTGGCATGTTCCACTATGAGGTAATATCTCACCCTAAATA
TCCCTTAAAATCATTTTTACCACAACATATTTGTTGATTCTCATGAAGTCACATTTAGGTAATACACACATCCATAATCAACTTAAAGATGAATTTCACA
ACCAATACACTCACAGATTGGAACTAAATCCTTCAACTCATATTAGAGTTTATCCGTTAACACATCTTTTCATGAATGAAAAAAAGAGGAGAAATGCCTT
TATCAAAAAGGAGAACCTATTTGTAATTAATTTGTCAAAATTCATGATATAGAAACTTACTCCCTACTTCCATTCCATGTGACCCACTACTTTTTGTTAA
CTTATAACCATAATTCTATCAGGAGAAAATAAAACTCCTCTATTCTGTCAGAATTTACAACAAAATTTGGATCTAAATAAAAAGTCAGTCCGTTATCATA
TCTTCGTAACTTCAAAGTATTGCTACTTCATATTGCAGATCCTTTGACATGACATTTTCCTGGATACCATCGGTCGGAATGGGATCGGGTGTTTTCGCGT
CTTATTTTGAATTTATCTGACTCTAGTACTATAAATTGTACTTCTTTCCTTAATTTCAGGAAGTAGTCATAGACTGATAGAAGAGCCGCTAATGAAAAGC
AGCAAGTATCTCAGTTCAAATTCTTATACAGTAAGGATCAGCTCATTTATGTTAAATGATTATTAAAACCTAAGCAGAACTCTCTTTGTCTTAAAATGCT
TGTCCTGTTTTTACAGTTTGGGTTGTTTCTTTTTTCTTATACTTTTTGATGAGGTAAGATTAGGGTTATTTCTAATTGTTGTCTACTAACCTTACGCCGA
AGGCATTTGTAATTTTAAATACTATGAAAGTTTTAAGAGCCTCAATTTACGCTTCACAAGTTCATCCTCTTCTACTCTCTTACCATTCAAAAATAAATAA
ATTGATCCAACAAATGCTAAGCAAATATTTCATTTTATAATCTAGTCATATTGTAGATGGACAAACAACTTTTTAAATGGAGAGTGTGGTATCATTAGAA
TGTGTTGGACACGCATAAAATAACACCTGATACTCTATAACCAATTTCATTTTGATTGCTAAAGGTGTCTCATTGGTATTCAGTATCAAATGTGTGCTAT
AAATATTTTCAAGAGGAAACACCATTACGAGTAATACCCAATAAATACCAATCCAGATACACAAATCCGTTTTACTTGACATATGTATAAATGGAACGTA
AACATACATGGAAACTTTGGGATGCGGAACAAGTTTGTTTGGGAAAGAAAGTGGGGAGAAACAGGGATAGTACTAGCATGAAGAGTAAATTAGTAGTGTC
ATGTTGATTCACAGTGGGATTAGCTATGTTATATCAGCATTATAGAGAACTCCAGAAATTCCAAGGGTAACAGTTTAACTTGGTATTAGCTATAAAATGT
AAACATTTCGAAGATAACAATCATCAAATGCAGAGAAAGATTCCATATTTGTGACTACAGATACAGTTCATTTCCATCTTTGCAAGTTCAGCACATCAAA
CTACTTTCCTTTTTTTTTTCAAGTATCCGTGTCACAGTTCATAGTAAGGATATAAAACGAGAATAACACTATGAAACATTGGGAAGAAGAGATGAGTTAG
TACGAATGCTCACCAACACGCTTGAATGAAATAAGAGGAGCAAAAACAAGGAGCGTTGTAAGAAGCAGTAAGTTGGAGCGCGAATTCCACCAATGTTGGC
CAAACCATTCTTCCGTGACACCCGAATAATGCACCCCATCTGATGAAGTCCCAGACAAAACATCTCCTGCAATCAAACAGACCACTTTCATTAGCCTACA
CAGATAACTCCAGAGCTACTACATTTAGCAACTGGTCACAAAATGGAGATAACACTCTGGGAACCAAAATGTCATTTAATCTCGTGATCTTAAACATGTC
ACGCAAAGTTGAAATTGAAGAGATTAAAGAGTCGACTAAAAGATAAAATGTATTTTTTAAAAAAACACATTAAAAAGTGATCAAAAAGAAACCAGAGAGA
GTACCGATGATGATCATGTAGACAACAAGGGTCCCGAGATTGTTGATCACGACACAAGCTTGCAGCAATGTACGACCAAAGCCACCGAACGCATCGCCAG
CGAGGCCAGAGTAGGAGGAGCATTTGGAAGCTCTGGTGAACCTCAGTAACATCTCAATCGACTTTTCTGTCAGTATAGCAGCAAGTATGATAACGATAAG
ACCTGGAATTGCACCAAGTTGCTTGAGCGTAGCCGGAAGAGCCATGATTCCGGCGCCGACAATTGTAGTTGACAGGTTGAAGACGGCTCCGGAAAAGGAA
GCTCCATCGAATCCGGCCTCGGAGTGACTGAAAGCATCATCCTTTTGAGGCAGAAGAGGGGCGGTTTTATAGCTCCGACGGTGTTTCCGGTCGGAGTAAG
TCATTCTGGTAAATTTGGGGGAAATACAGGGGGTTACATGAAATTTACGCGGGACAGCGCTTTATTTATGGATTACACCAATGAGATACTGACACGTAAT
CTAGCGGGCCCTGAATAATTTCTTGGGCCTCGTCTTGTTCGCCTTCTTGGTACCAGCTCAGTATTATTAATAAGAAGTGTTGAAACTTTCGAAAATAAAT
AAAAGTCAGCTCGATTAATAAAGTATTCTGCGTAGTTCGAAAAAGAATTGGCACAGTGTTCAAAATCATATGATAAGTGATAAATCTAAATTTATAATGT
GTCGTTGGATAGTAATCAGTAAGTGTATGATCATGAATTTTGAGATAAACGTTGAAATTTTAATTTTTAAATTTCAACTTCAAAACAGATGATTAGTTGA
AAAACAAATTATCTAAATTTTAAATATTATATTAAAATAAAGCAATAAATCTTTTAACTTTGTAATTTCTACGAATTTAGACTGTTTCCTCTCTTGGACT
TTTCGCAGGTACTGTGATGAATTGGAAACATTGAACATTACTATGGAGTGCATTCATTTAATTGTTTTGAAATAAAAGTTCCGTATTCCATGCTATTTAT
ATTTTTTGCTTTTCTGTTGAAAAAAAAAATCTCTTTTATGTCATTTAATTAATGTTTATATGTATTTATTGTATGAATTGTTTCGTATTTGCACTAGATA
TGACTATTCATACTCATGATCTATCCGTCACAATAATCACAACTTTTATCATTCCTTCAAACAATTACATTAATCAAACATAAACAAATGATATTTTCCT
TTATTTATTGAGTATATAGGCTTTTAGGAAAACATGAGTCCTCAGTTGTCACATGAGTAACTCACTTTCCCCATTACTTTTTCAAGAATGCCAGCTAAAC
CAAGCAATAAAGACGTTGCATATCTGCTTTCCAATTTCACACAAATCTCAATTATACTCACTTTTTCGATAGAATTACAATCCTGACACTGCACTACTTA
TATTCAATAAAATCATACCGCTAGGGTAGAATGTTTCTACACTAGTAGCTTATAGATTACAAAGAGAAATCAGTTGTCCGCGTTACTTGATTTTCAATTT
CAACAGAGTTATAATCAGTCGATAAGATGGATAGCTCATAGTAGTGCTATTGACATTGATTGTATGCCTAAACACACATGAAACACAACTAGTAAGTGCT
TGTTTTAAGGGTTTACATTAGCAATATATACAAGCAGTTTAAAATCCTTACAAACAAAAACAGATTTGAACTTACTGACCGAAATCATCATAGTCACTAT
GCACGCTTCCTCTTGGACTTCCGCTTTGAGTTGACTTCCTTAGGCTCTTGTGACAATCCACCTGATTTGGCACCCACAACAGAACTCCACAGTGCCCGTT
CAACGTCTGATGGAGTAAAAGAGTCTTCTTTTGCTGATAATTCCTATTAAGCAATTGCCAAAGGAACATGAAATGAGATAGGTCCTCCACTTCAGAGGCA
ATAATAAACAAAGTACCATGGGTTCAGCATAAAAGTTCAAACGACTTACAAACACTACAAAGCTTTTGATTTGGTTCACGGAAAAGCTACATATTATTGT
ATAAAAGAGCCTATGTTTTAGTCTTGAGACATTTTCTCTCAAAATATACAAACTCTAAATCTAACCTAAAATTTATGGCTTAGGTAGTCAGGTCTTAGTT
ATACATATTTTTACTTCAAAGTATTATTGATATCGAAACTTGTGGAATCAATCAGCATACGAAAATCAGTTCAACTCCACAACACCATAAAATTACTTCA
GGTCATCAGAATATTGTCTCCTTCATTCTTCACCATGTCATCAGGTCTGACGCAAAGCTTACCTGGCAACTTGCCAGAGAATCATTTTTTTATCTGTATT
GAAGCCAAACCTATGATCACAAATTCATAATGACTTCTTCCCCCCACCAGCGTAGACAGACCTCCTTTTATGGTTTTCTTCATCCAAAGGGAAGGATGTC
TGAGGCATGACCATGAGCCATGAAACATAGGAGAGGGGAGGTTTTTTTAGCATTCTTTGATATCCTGGTGACTGAACAGAAGAGTAACAAGTGGCTTCAT
CTGAACATCGCATGCATTTAAACAAAGTCTACAAAGAGCAGATTATTAATTTCTATCCTCCGGGATTTGGTCTTGAGTGAACACCAAAAAGAGGTGGTCT
TGAGTGAAATTTAAGGGATAAATCACAAACTGAATGATGAGATACATATACATTGTGAAAGCAGAAAACTCCATACTAAATGACGTACAACTATGAAAAC
AGTACAATGATGAGCTGATATCCATGCATAAGCATTACCGTCATAGCTAATCAAATGAACTTCTAAAACTAGGAAGAAAAAGCATCTTTGATCAACCAAA
TTTTCAGATGGAAGCTAGAGTCAGAAAGACTACAAAAAGGTTTCCTGCAACACAGAAATTTGAGGAATACTGTGTGGTTCACAATCAGGCAGTCATTTAG
ATGACAAAAAGAGATGTGCTTATTTGTAATGGAGGAACTTGCTGTACACTGTGCTCTACATTACACCAAAATTTAGTCCCTCTGTCACGCATTCCAAATG
AATCGAAGGAAAGTAGTTCCAGTTAGAGCAATTTGATGATCTCATTCTCAAAAAAAAAAAAAGGCAAGCAAAACCCAGATGAGAGCATCATTCTACCTAA
AACATAGAGAAAAAGTCTAGCTAACCTTGGATTTTGCCTGCAATTTGTCCACTAAAACTAGATACTGTTTCAAAGTATAGTCTTTTGAGTTACCAATTGC
TGCAACCATTGCCTATCAAAACAGCATTTTCACATAAATCAAACATTTTAGTACACTTCAATTAACAAAATATTACAGAGAATCAAATAGAGTTTTCTAA
AGCAAAAAGGCATGACAAATTTACTTCATCCGACATAAAAGGTGCAGTATCCGGTGCATAAGCAGCCAGAACAGCAGAGGCAGTAGCTGGACCAACGCCT
TTCAAGACAGTGAGTGCCGAAATAGCTTTTGAGATATCAGGTAGAGACTGAAATGCCTTCTCCGAAGCAGATCTCACAACAGCATCGTCCAGTGATGATA
CAAAATCCAACAACCTAGGCCTGAATGACAATTATCATATGATACTTGGAATTTTCTCATAGCCTTTTTTTTTTTTGAAAACGGTAATGTGGAATTTTCT
CATTGCCTTAAGTACCACATCTAAATATACTCACTCCATCTCAACTTACTTGTCTTACTTTCCATCTTTTTCCTTTATTAGAACTCTTTAATTCTAACTC
TCTACGTGACATGTTTAAGATCATAGAATTATAAGGTATTTAAATACATTGAACGTATTTTTAAATATAAGACCACAGATTCAAAAAGTATACTTTGAAA
ACCAGACAAACAAATTTAAAGGAGTGACATATTATGTAGTCAAACCTTCAAAATACAGCAAATTAACTACAAAAAAAAAGTTGCATAAAACTAGAAATAC
TTACACATAACAATATTACTATTCAATCAATATACCATAGCAATTATCAAAAGTAAATACATATATTTTGGCAAATGCTAGATGAAGAGAGAAGTAGCAA
CCTCCATTTGCCTCTTGTAAGCTTCCATTGCATGAGCTTGGAGAGTTCGGGAGTTGTGATGTAACTAGGGTTTCGTTGCCGGAGAACGCCGGGAAGCTCA
TTCCGGTAGAAATCATCGAGAGAGACGAGATTAGGCTTGTTAAGTGACTCTATACTGGCTTCGTAAGAAGATAAGGCCTCCTTCCACTGTTCTAAATCGG
AGCATTTGAAGTCCATCGCCGGCGAATAAAGAGGAACTATCGCGCCATTTTCTAAAAATAAATGTGAAAATTTATGTGGTGAAACTTTAGTTACTCGAAA
ATACAAAAGAGTCCACTAGGTTTTGAAAAATTGATTTTTTTAAATCTCAGGTTTGAACACTGGTATGGCTCTCTCGAGCTTGACACATGAGTAACTCTAA
TATCATTTTAACAGTTCAACTCACTAGATATATCGTTCTCTTTGAATTTAGACGCGTACAGTTTTAAAACTTGTCAATAGTGTGTAAGACATACTCACTT
ATATATTTAAAATTATTTTTACATTATGTCTGTGTAAAATCTTTTTTATCTTAAGTAAATTGTCATGATAGAGTTTCAATACGCATCATTTGAAAATTAA
ACAACTTTGATGGCCTTTGAATAGAAAGAAAGGGGTTAAATAAGCTTTTAAACCACGTTTATTTGAGATAGAGGACTAGCTCATTTATTGAGATTCATCA
TGTTTGAATTGACCGGTTTAAACTCTATCATATATTAGCAATAATAAATAAAAATTATTCTATGATAACAGTTGCTCGAGTCTTTATTTGCTATTTCAAT
TTTATTTATCATTTTGATAATATTTTTCTCGATAAAAATAGAGATAGAGTGTGTAATCGATTATATATATATAATAGAAATGATCGTAAACTCAAATATA
ATTATATATTAATATCAAATGCTAATAGAATTCATAAACCTGAATTGCTATGTACCTCAATCTAGATAATTTAACTAGAATATTTTCTCATCCTATATTC
AAGAAAATTGTTAAAAATGACAAACACTGTTGAAGCCCACATAACTGAAAATAGATCGTTCTTCACTATGCTTCGTTTGGGCCAAAGCCCATTCTTTGTT
ATTATTAGGAAAAAAAAGTTCATAATAGCAAGATATGCATAATTACAAAACGTACATAACATTATATCACTATGAATAGAGACAACAAATTATGTGATTA
TCAAATAACTTTTTGTCTCTCTATGTTTCTTTACTATATTGTTCACTATTTAAAATTAGTAAATTGTTAATATTTTTTTTATTAGCTTGTCACTTGACTT
AATTTAATAATCGAATGATCTACTTATCAATATAATAAAGTTATTTATTTTGTTTATTAGTGGGTGTAAGCTTTTATTTTATTGAACAAAACTATTAAAT
TTATGGACAATTTCATTTAATCCACCATGCCACGTATAGTTTTGTTGCTATTAGTAGGGGCAGAGTTGGGGACCGATGAAGAAATAAACTTGATTTATCA
TAAATAAAATAAATTTACATTGTCGTTGTCTTTTAATTATTATAAAGAACCAAAATATGATTTTTTGATAAATAATAAAGTGTAAATTCTCGATGGTACG
TAGAGGCTTACATGATGATGAATCAGATTGAAACTAATTTTTTTTTTGTTGGATTGTAAATAAGATAGAGAAATAAAACAAAAACAAAAAAAGACCCACT
AGACAAATTCATAAAATTAATTTTTGGATTTTTTTTATGTAACAAAGACAAAGAGCTCAGGGCCAAATGTTTAACGCATTCATGTTTAAAGGTTCTAGTG
TGTTTTTCTCCACAAGTATTAGAAATTCGCATTGAATTTTCAAAGTAAATTTGAATCACATAAAAATTTAGGGCGACACACCAATAGAATTCTAAGTTAC
TCTCTTCGTTTTAATTTATTTATTTATTTTTAATTTAACATAAAATTTTATAAGTAAAAATATTTATGAATCTTATCATCTTAAATTTAAAATATTTAGA
TAGTAGTAGTATGGTGCAAAAATGTCTATAATTTTGCTATTTTAAACATATTATTCGGGAAAAGACTAAATTTAAAGAATTGTCAAAAAATGCAAAAGAC
ACTCTGCATAAGTTCTTCAAAGGCACGAAATATAACTTGTCAAATATTACGATATAAAAGTATAAATATATAATCAATTATTTTCTGAAGCAAAAACTAA
AAATCAATACTCCCTCCGTTCTATTTTATGTGACACTTTTTGTATTTCATGATTCAAATAAATATATCTTTGACCGTAAGTTTTTCATTGATCCTTTTAA
CATTTTGAATTATCAATTATTATGACTTATAATACTCTTTACATAGTTTACAAAAATATAAATTTCATTTCAAAAAAATTGAAAATTATATGCGTAAATG
TCCGATTAAAGTTAAATTATTTGACTCTTAAAAAATGAAAAGTATCACGTAAAATAAAATTATATTGATTTAAAATTTATAAATTCTCATAATTCATGTT
TACTATAAATATATGATCTTAATAAAAATTATTGATTCCGTCCCAAAAGGCAGGCTAATAATAATCTAGCACCTCGGACTCTTGCACATATCATATGTAT
CTCGTGATTTAAATATGTGGCTGTCTTGAATATATATAGAGTACTATTATATTTTATTATTGTTACGATTAAGTACAAACGTGACAACTACTTTCATATA
TACATCTTCGATAAGGACTTTTATATATATATATATATATATATGTGCAAAAATAGGCATTTTTCTTCACATTAGTTTGTTATGTTTATTCTTTAATTCA
TTTCATATTAAAGACGATGTACTCTACTATAGGTATATACAATGGGTTGATTTACATTTTACGCAATTGGCCCTATTTTTAGGCCATTGTTTTGATTTAG
TTGTCTCTATTTTGTTGTGCAAATATTGATTTTTTTTTTCTTTTTGTGTTCTTTTTTTTCTCATAAAATAAAAAAAGATATGTACCCTTTGAATATATAG
CCTTGAGGTTATTTTTTAAAATATTTGGAGCAAATTAATTAATGCTTTTGAAAAATAACAAACATAATCTCAAAAATAAATTCAATATAATATAATGTAA
GATCGGGGGTAGATTACATAGGCATATTTAAAATTTCTACAATATGGTAGACCATTAATAAAATAGTAATGTAATATGTGGGAAATGATCCTGAGTTCTT
TGAATTAATAACTTAACATTTAATCAAGTGCGTTATTTGACCTTGTTGTAAGAAGAACGTCAACAGATAATATTATATTAATTTTTAAAAAAATATGTAC
ATAAACTATCTAAGTTTACAAAAATGAATTCATGTGACCTATTTTTAGTTACCTATAAATTTGTCCCTGGTTGTATATGTAATAAAAAAATAGTTTCACA
CATAGCTTATGAACATCTGGTTCATATTATAGTTGAACATCACACTTTTGTTGTAATCACAAGTATGCATTAAATCATTAGTAGTTTTTTCTTCTTTATT
TAAAGTATATGATGATAATCACCAATTTTTTTAAGCTCTTAGAAAATTAAAGTATATTTGATATTTTGAGAATTAGAGCTTTAAATATTTAACGATTTTT
TTTAATTACGTGAAGCATGTTTGATGGCGCATTCCGTGCAAATTAAGTTAATCAATCCTTGGTTTACCAACTTTTCCCTTTTGACTTAAGATGCTCAATT
TTCACCCATGTGAGTACTTCTCTTGTGATTAAAATTAATTACTCCATCTAGTTAATTAATGATTTTTTATCTTTTTATTTTGATCTAAAATAAATATTAT
TTAACATAATCATGAACATATTGATTATTGTCCTTCAAATTTACCTACGACAAATTAGATTATTGATGATAAATGATTTTGTCATTTATAAATTACATTT
CGTCAAAAAAGAAAAAATGATTATGCATAAATTATATAAAAATTTATTTATTTTATAGTTGATAGTAAGTTTTTGTCACTACAAGATGATTCTTACCATC
AAAATTACATTCTCACTATTTAATTTAATTAGCTTTTTATCGTTAAAGTTATATGCATTTTATAGTAGAGTAAAAATATCATTTCATCATTGAAGACTAT
TTTTTATAACATGTTAAAATCACTATAACAAAAATGATTATTAACGGTATTTAATTCTTAATTATCGTTAAATATGTGTTTTTAGCGACAATTGTCACTC
TTTCTATATGTCCCTAAAGCCTTTAGCGAAATTGAATCTAATGGCACTTAATTAATGCCAGTAAAGACTTTTGCAATTTTTATTAGTGTTAATATTTAAT
GCCGTTAAATTTTTTTTTAATTATAGTGAAAATATGTTAACGGAACCTAAAAGTTAATATTATTATAAAAAAATACTACACGTATTTGCATTTTAAAAGC
TGCCTCCCAAAAAAACTTCCCTTAAAAAAAAATCTTAGATATTTGATATGACTTTTAATATGCAAGATCTGATTTGCTTTAAATAATTTGTGCAGAAGTT
AGGTATATTTGGTTTTCAGCTATTTATATTTCTCAGTAAACATACTGCCCAGTGCCCACAGAGGAGGGGGGGGGGGGGTTGAATAAATACTCCCTTTGTT
TTAAGATCATTGATATTTATTTTAAAATAAAATAGTATTTCACATAATCACATGATATTCTTTCGGTCTAATCCTTTTTCTAGATAAAGAAATTTTTGCA
TAACAAAAATACTAATAAATAACTAAATCTTTCAAAATATTTATTTAAAATAAGGTGGTAGAAGTACATTTATATATGAGGAGGAGTAATTTTCTTAAGT
GGTGTATTTAAGCGAAAATATCGTAATTTAAAATGGAGAAAGTATTAAATTGAGGTTTTTTTCTATGGTGGTATGTTTCACTCGGTCTGATTGTTCATTA
TATTAAATATATATATTTTTTGTACTTGTTTAATTTGTTAAAATTAAAAGATTATTTACCATTTCATATCTTATTATCAATTAATATTCATTTCCCAAAC
ATTTTTAAGAAATCTATCAAATTAAACATAAATAGAAGATCCCTAATACCATGATTTTTGTGATTCTCAAGGTCAAATTAAAAAAAAATAAGGTTAAAGA
TGGAGGATCCAATTATTTCAGCCCACTATTATCATAAATGGTTTTGGGAACAATTGTGTAAGTGCCAAATTCGTGACCATGAATTTTGGTTTGGTCAAAA
GTAAATGAAAATAATTTGATAGGATATTTCATAAATTGTACATTTCATGCTATTAATTTGTTTTATTTCTTTTATATGAAATGATAATTTTACCATGTTA
GTATAAATAGTGAAATAAAATAATTTTAAAATTAGCTAATAGCTTAAATCAAATTTCAATCAATAAAATGAATTTTTGAATCCAGAAAATTCATTTTAAA
AAAAATAAAATCAACTATAAGGTAATTAATTTTATATTTTATCCCATAGTATCCTTACCACATGTACCAAATGACCTATTACACTTTTTTTAATTGGATG
ATCTAATTACGTTGACTGAAGACTTTTTATTATAGTTGGATTTAGCCTAAAGTTTTATTGTAGTTGGATTTAACCTAAGGAAAATTAGTAGAACAAAAAA
AAAGAAGTGAATTATGCTATCAACATGGGTTGTGGTGCACTGGTGGGAGTGCTTCACCTTTAATTAGAGATTTTAGATTCAAGCACTGTGCAATGTGCGA
TTCGTATTTAATCGAATTTCTAATATGAGCTCCGAACACTGGATGAACCCCCCCCCCCCCCCCCGTCCAAAAAAAATGAATTATACGTACAAGAAAAATG
TATCATACCTACCGAAATTTTGGCTGATTAAATTATGGTTGTCCGACCTCCAAAATTTCATCTACTATATATATATATATATATATATATATATATATAT
ATATATATATATATATATATATATATATATATATATATATATATGAATTAGCTTTGGATCACGACAGAGCTAGACAACAAAAAAGAAAGATTTATGTAGG
GTTAATTTTTTTTTTTAATTATATAGCTACCATTTATCTCATATTCAATCGTCTTTGATGATAAATTTATAATTTGACGAATTATTTCTTTCGATCATTT
TTATGTGTCATTTTTAATAAAAATATTTGTTATGTTAATAAATGAACATGAGATTAATTAATTTTTCAACTACTTATGTACCATTATTATTATTCCAAAA
AGACATCGATCACATGACCATTATAAACAATATTAGAACCAAATCCAATTACACCTTAATTACTAAATTGATTCAAGCCTAACTCCAATTAGGCAAACGC
CACCTCTTTAGTCAACCACCACATTTCATAAACAATTTTTATTTGATGATCTATTACCAATAACATATTTAGTGAAATCTCAAAATGTATAACTAAGCGA
GAGATCAATTGATGTTATAAAGTAGCCAAATAACTTGAAATAATATTATATTTTCAGATTTAAATTATTATTTTCACTTTTTATGTCATATATTTATACA
TATATTTTCGTGAACAAACAAAAAAAAGTCAAAATAAATGATATAATTCAATTACATCGTTTATTTTGATCCGCTCAAATTTGTGTCATGCCAAGACTTA
CAAGATGATGAATTATTGGAATCATTTTAATTGGCATCAAGCATAACAACAAGACAAAGTAATTTAGGCCACACGTGCCTAAATAAATTTTTCCAACTTC
CAACTAATTCTTTTATTATTCTAAACATATCTCCAGTATTTATTTATTAAAGAAAAAAAAAGATACGAAGACGGTATTTAGAACTTTATGGAGTGCATAA
CATAGTAGTATTAATTCCTCTTATTAATTAGATAACACGTAAGTCATAAATAGATCTCTAATCTCAATGAAATGATAGTTTCATATTTTAATAATTCAGA
AGACTTTTTTCTTTTTTAAATTTTAATTTAAATTAAATTTTATATTATATAAATCAAGATAGTGAAAGTAATAATAAAAAGAATACTCACTTTAATTCGT
ATGAGTAATAATTGTTTATTGTGATGTTATCAATAAGAATTGTAATATAGAAATAAATATTTTTTATTTTTAATTAAAATTATCAAATTAAATTTCCTCC
TATATAAAATTACATTTACTAAAGAGTTTTTTTTATCTCAAATTAATGAAATTCTAATATAAATTATAGTGATTTTTTTTATGTGGTCAATTCTTCCTTT
GGAATGGGTAGAGGAAGAAAACCCACGTCACAAATTTAGAGACCTCTTTGAAAAATGACTTATTAGAAAAAATAATTTTTTGGTTATTGACCTATCATTT
ATAGTTACTGTCTGTTTAAATTGACTTAATTTAAATATTTTTAAAATTAAAATAGTTTTTAAATAATTTTAATGTTTGAATAAGTTAAGAAATATTTATA
AACACTTATATTAAAATTAAAATAATAAAAATAAATTAAAAATTAATCCAAACAGACTCTTACTTATAAATTTGAATAAATTTCTACACAGGTAAAAAAC
ATCTATAATTGATGATATTTCTGCCCCTCAATTAATATTTTTTTTGGTCATAAACATAGATATTATTTTATGCATCTATTATTTAAGCTATAAAACAATT
ATTTTATTTTTAAAATTTTGAACAACCAAATTTAAATAGAAAAAATAATAAATATTGCTATATTACTTGTTTATTTTTTTTATCTTTCAAGAAATATAAA
CAAAAATAGTATCTTCATTAATTTACCATTTAATTTCTTTTTATACGCTTTCAATTTATGTATCGTATCAAGTAATTTAGTAATGTAAATAAGTAATATT
GAACTGTGTGAGTACTCATTTTAGAAAGTTAATGTATTTTTACTAACCTATTTGAAAAAGTTTAAGTGATAAGTTTTCTATTAGGTAAAACTTTCTTTAT
TTAAATTAATTCCTTTTAGAAAAATTATCATTATAATTTATATAGAATACCTCTTAAAACAAGATTTAAAAAATAAAAACACCATTTATTTTCAACGAGA
GGAGTAGCATTTAATTATTTCCTATGCATCTATTTCTATAACTCTATTCCCACCAACATTTTTAAAATTAATTGCTAAAGTACCAATCTTTTGTCGTGAT
TTTTTTCTATGGTCAAAAAAGAAGTGCAAATCTTAATAAACAATTACAAAGTTATGATGATTCTATACATTTTATTGTAATGCCAGTTCAACTAATCAAG
AAGCAAAATATAAAGACATAAATATTTGCCTAATAAAACCAAATAATTATTTTGTGATTTTTCCGAACACCTGGTAATTTGAAATAATTCAATTATAAAA
AAGAATAAATATTTAGAACAAAAATGTTGATATTAATATTAATGAAGGACTATATTATAGTTGAATACTCATTTGTTTCAATTTACTTGTCTGCTTTTAA
CTTGATAAGAGTTTAAAGAATTAAAAAATTGATAAAATTTATAGTTCTTCAATCTTATGATTTTAAACATGTAATGTGATAATTTTTAGATTTAAAATAT
TTTAAAAATTAATTTAAAAGTAAAATAAAACTAAAAAAACAGAACCAAAAATAATAATACTAATAATAAAATAAATACGTGCCAGAGTCCTTTTAATTAA
TATTTCTTAGATTACCTGTCTCGTGTAAAGTTTCCGCTTGATTACTCTGACAAGTCCAACCTAATATTTTACTCTAATAACATGACTAATTATACTTAGG
TCCAAATCCAAATAACACCTTAATTGCTTGGTTAAAATAATATTGTTCTCTTTCATTTTATTTGATTCAAATATTAAAAATAGCTTGGTTCTATTACAAT
TTTTTTTTATATTATCCTTGATATTAAATTAGTATTTCTTTATTTTATTTGATTCATATATTAAAAATAGCTTGGTTCTATTACAATTTTTTTATATTAT
CCTTGATATGAAATTACTAATACTAATTAAATTTAAAGTTTCAAAATATTATTGCTAAAGTTAGTTTAGTAAATATAACTTTCATTAAAGACCTATTTGG
TCGTAGATATTACGAGCACTTCGTTGATTTTTTTGGCAGAATCTATTTGGTCGTAAAATTTATTTAATTATTGAAAAAAAAATTCAAATTCCAAAATTAA
AAAAATAATTATTTTGGATTTAAAATTTTGAGTTGAAAGCATTTTAAAAATGTTCCTAAGCTTTTCATTTGTATTAGTTTTGATGGACAGAGTTATTCCA
TACTTATTACTAACAAAGATAACAAAAATTAACGCATAAAAATCAATTCAAATATCATAGATATAAAAAAATACTATCTAATTAAAACTTCAACGAATTC
TATCTTTCATTCTCCCATCAAAAAACGCACTTTCAAAATTGATATGATTACTCAATTGAAAAAAGCTCAAGTTCGATTATTTAATTATTCAAGACTAACC
CAATTAGGCAAACACCATCCTAGATGTACACTTCAATGGGTTTAGGCGGGTACGCAGTAATGATAGGAGACCCGAAACGTGAAGTTAGAATTTAAATTTT
ATAAATTTTAAATTTTTATTATTTTTCATATTTAATAATTTTTTATTAATCTAAATATTCTGAATAAAATCTATTGGCCTATTAAAACCATAAACTATTT
TTAACTAAGCTTAATAAAATATTAGTTCTGATAAAAGTTTTCTCACTTTATTATTTAAATTTGAGATCTTTAATTAAAAAAGCTGAATAATTTGACGTTG
AGACTATAAAATTTAGTATATGTGGCTTGTTCTGTTTAATTCGTAAAAAAGTGTGCTTTGTGTCTAGAAATCTCTCTGTATTGACAGCAAAGCATTCATC
AGATACAGCCTAATAATACTACTCTTTCTATTTTCATTTTTAGATATATAGAGATTCACGGGCATTGTTAGAGAAGCAACGTCGTCGTTTCTCTTGCTCC
GTTCCCGTCTCCCGTCCTTTTTCTGCATTGTCGCCGGCGACAATGGTGGATTTAGGTCTCTTCGGATCTCTTCTTGTAGTGGTGTTGGGGTTCGTTGCAG
TTTTCTGTTTTTTCATTGGTCGTAACAAAAGTAAAAATGATGGCTCGGCAACTAGCACCACTACAACTACGCTGTATAATGGAGAGTCCAGATCAAAGGA
TGGAAACGAAGACGTTGATATCATCATCGTCGGTGCCGGTGTTGCCGGTGCTGCTCTTGCTCACACTCTTGGCAAGGTGTTGTTTCTATCTTTGTAATCC
TTTTTTAAAAGTTATTGTTCAACTTTGGTCCTTTAACTATTTTTTTTATGTACATATGTGAGGAAACTGTATTTGTTTAGTGAGAAGTAATTAGGTTGAT
AAGTTGATGTGGTTATTGTTCATTGAAGACTTGAACTTGATTGTTAATTTGATGAAATCATAGAAATGAAAGATGCATTGATGATGAAAGCGTTTGGTGT
CGCTGCAAATAATTTTATTGGAGTTCTTTGTTGATAATTCTCTATAAAAAAAGTTCTTTGTTGTGAGATTTATGATTATACATTTGGGACTACAGGAGGG
GCGTCGTGTAAAAGTAATTGAAAGAGATTTGACGGAGCCTGATCGAATTGTTGGAGAACTCCTACAACCGGGTGGTTATCTCAAATTGCAGGAGTTGGGA
TTGGAAGGTAAAGTTCCTAAATGATGTGATTTGTGTCAATTCTGGTTAATTTACTCTCTTGAAGAGAAAAAAAAGGATGTTAGTCTGTCTGTTTTTCGCA
TTTCTCATGTTTGTATTTGTGTCTGCTGCAGATTGTGTTGAGAAAATTGATGCTCAACGCGTTTTTGGGTATGCCCTTTTCAAGGATGGAAAGAGTACAC
GTCTTTCTTATCCCCTGGAGAAATTTCACTCTGATGTTTCTGGAAGGAGCTTCCACAATGGGCGTTTCATTCAAAGAATGCGAGAGAAAGCTGCAGCTCT
TCCCAAGTATTCCTTCTTACTATTTTTTCTTTTTCCCTTGGCAGATCTATTTCTCTCTTTCTCTTATATGTTATGAAGTATTTGATCTTCAAATAATTTC
CTGTTTGATCTTATAGTGAGGATTCATATTGTCGAGTCTTACTAGTTTGGATGGAAGCTTAGTTGATTGATTGAAATAGTTTCCTGTTGAATTATCTCTG
CTTTGATTGACTAAATGCATATCGGCTTTGATTTTTTAACAGTGTCAAACTCGAGCAAGGCACTGTTACGTCTCTGCTTGAAGAAAAGGGGATCATTAGA
GGTGTTCAGTACAAGACTAAATCCGGTGAAGAGTTGAAAGCATATGCACCATTAACTGTAGTATGTGATGGTTGTTTCTCGAATCTGCGACGTACCCTCT
GTGATCCAAAGGTAAGGGCGCTTATCTATATTTCTCTTGATTTTTGTTAAGATAAGAAGGATGATACTGGGTGATTAATTTTTTTCTGAGAAGGATCTTT
TGTTTAAAAAGCTCGTCTGTGAAATCGTTTGCTTTTACTTACTGTATATCATCTTTTGCTTTTTTACTTACTGTGTGAGACAATAAGAATTAGTGTACCG
AAGTTGTTTGAATGAACAAATATCTTTAAATGAACATCAACTTTGTTGTCCCCTCCTTATGTTTCTCTCAACACTCAGAATGACATGTAACATTGCACAG
GTAGAAGTCCCTTCTTGTTTTGTTGGTCTGGTCCTGGAGAACTGTCAGCTTCCACATGAAAATCACGGACATGTCATTTTGGCTGATCCGTCACCTATCT
TGTTCTATCCCATAAGCAGTACTGAAGTCCGCTGTCTGGTTGATGTACCTGGTCAAAAAGTGCCTTCTATTTCGAATGGTGAAATGGCCAAATATTTGAA
AAGTGTAGTTGCTCCCCAGGTAAAGAATTGTTGAAAAAGTTATCCTGAATGACATACCATGTCATTATAGTAGTATACATACTTATTATGTTCAATGAGA
TGTTTGTGTGGTTGTTCCAGGTCCCTCCTGAGATAAAAGATGCATTCATTGCTGCAATTGATAAAGGAAACATCAGGACAATGCCCAACCGAAGCATGCC
AGCTGCTCCTCATCCTACTCCTGGTGCTCTTCTCATGGGTGATGCATTCAACATGCGCCACCCCTTGACTGGTGGAGGAATGACTGTAGCATTATCTGAT
ATCGTTGTATTGCGTGATCTTCTCAAACCTCTTCGTGATTTGAATGATGCATCTACTCTTTGCAGATATCTGGAGTCATTTTACACCTTGCGTAAGGTAA
AAATCTTTTGAAATCCTTCCTTGCATAAGCAACATATTTGGTTGCTGTAAGCACCACATTTTCTACTTTGAGAATCCTTAGTGAAGTAAAAACTCTATGT
TGACTAGTGAGTAATTAAGGATCTGGAACCACAAAACTGACATTCCTTTGATGATTTCACCAGCTATCAATCTACCAATAACAATGTAATGTAAAAAGGC
TTGGTTCATTACGATGTTTTAGGACTTTTTGAACTCACTCAATTCTCCTATAATTTGCCTTCTACATAAAAAAAAAAAGGGAGAGCAAAAGAGGATGACT
CAATTCTCCTGCAGCACTTTCAGACTTAACTAGAATATTATTACCTTTATAGATATTGACTTGTTCTGCTCGCATATTTATCTGCAGCCTGTGGCCTCCA
CCATCAATACATTGGCTGGTGCCTTGTATAAGGTATTTTGTGCTTCACCTGATCAAGCTAGGAAGGAGATGCGTGAAGCATGCTTTGATTATTTGAGCCT
CGGTGGAGTATTCTCAGAAGGACCAGTATCTTTGCTTTCTGGCTTAAACCCTCGTCCATTAAGTCTCGTTTGTCATTTCTTTGCTGTGGCTATCTTTGGT
GTTGGCCGCTTGCTGCTTCCTTTCCCATCACCGAAACGTATATGGATTGGAGCCCGGCTAATATCGGTAGGTGTCAATCTTGCTTTTGCTCAAGTATTTA
CAATCTTACTCGTGTTCTTGTATTTTGACAATTTCATGTTGATTCAAATGCAGAGTGCATCTGCAATCATTTTCCCTATCATCAAGGCAGAAGGGGTCAG
ACAGATGTTCTTCCCTGCTACTGTTCCCGCATATTACAGGAAGCCCTCCTGAAGTGAGGTTGTAACTGCTATAAACAGAATAAGGCTATGCCATTGTACC
ACCTCCATCAGTATTCTGGTTGTGAGTTTCAAGAGTTTAGTCCAACTGTTGCACAATTTTTGGTTTCTAGTCTTCCCTTGTAATCTTTTTCCTTTGTTCC
CATGATTGATTACACTATTAACTGCAAAGTAAATATAAGTTGTAAAAGTATACCTTATCTCTTCTCTGTACATTCATTTTTTTCTCCTTTTTACCTTTTC
TTCTTGTGTTCTCCCACATTTGGCAATAATTACTGATACCGAAGATTTGAGTTTGACGACAATGGAGTAGAAATTGAGGAAGCATAACAACTGATCCTTT
AAAGGCTCGAAGCTTGAGATTGAAATTAATGTAATGTAAAAGTGAGTGCTATGGCATATATCTTGACAAAATAATAGCATATAATTTGTTTTTTTCTCTG
AATTTCGACCTTTTGTGATGCAACAATGAACAATCTCAAGAAGTTTCTTACATATCTTTTCTACCAAGCAAGAATATAACATAATCAACCACTTGCATGG
GCCATTCAAATTTAATACAAGGCAAAATTCATAGGCTGATTACAGCCTTTTCTCTCTTTATTTGACATCTTGAGCTAACTTACAGTGTACTAAAGCCTGT
GTGATATACAATGTAAATCCGTATGTCAGCTTATCCCACGACACAAATTGCGCTCTTCCAGGAAGTTGGAAGTCCATGGAGGGATTATAGAAGCAACAAT
CCTAGCTGTAGAAGTACTCTTAAAACTCGTCAATTGAAGAAAAAGAAACAAGAACCTATTGCAAAGCGTATCCTGAAAACCTTGATAAGCAGCCAAGAAT
GTCAAGAGACTACGTGTACCAGTCAACTAGCACAAGGCTGGAAGCAAATGGCTCGATAGTCTCCCAGGAATCCATCATGAAGGACCACTTGGATTAGCTA
GACTAATATACAACATCAAGTGGACATGATCTTTTAGAAGTTACAGAAAATTTCAGGCATTTATCATATGGCTCTTTATCTGCTCGTGCCATTCTTCCTT
TCCGACTTTATAGCCTCATATGACTTCATGACTTCCTTAAACTTCGCTTCAGCAGTATCTGCAACCATGTTACAATATCAGATATTTATCACATGATGCA
GGTAGTAGCATTTCTTTCCTTTTGTTTTTCTTGAATTTGAAATAGGTAATACAAGGATAAAATATCAAATAGACCAGACTAACACAATCCACCTTTGTTT
TGCTGATTCTGATCAGGGTGAAACTGCTTTGCCTTTTCCCTAAATGCTGACTGCAAGTTCAAAAAAAGAAACTTCTCAATACAAGTTAATGTTTTCACAT
GTGCCCATGAAAGACAGGGAAAGAAGCAGAACAGATAGTCGAAACTGAAGGACCATTGCGATGTCAACTACAGACGCCCGAGCAAATAGCTCAAGTTGGA
GGATTTATCATATTAAGATAATTTTAGCAGAGATCAGTGTGTACAAGTATGATCAATAAATAAGCAGCTTCATAAAATCTCCTTGTAATAGGCAATGCCA
GAACCACCCAATAATATTAGGCATCAACTTCTTAAATTTGACGAGGCAGTTAAGAAATAGTATTAGAGCCTGCTTGAATGGGCTTATAGCTTTTAGCTTA
TAAGCCAAAACCCGTAAGTTAAAAATTCTAACACATGGCTTTTGACTTATTTTTATCCCTCCCCCTTAAGGACAAGTGCTTAAAAGCACTTATTAATTAT
ATCCAAACACTACAAAAAAATTTAAAAGCTAAATTGACTTAAAAGCACTTAAAATAAGTCAATCCAAACAGGCTCTTAGTCAGTTGTTCATTTCAATTTC
CTACCAACTATGCTCACTATTTCCTAGTGGTTTTTTCATAGAGTTGAAAATGTATAAATATTGCTAAGAGACAAGTCGGGATGTGCGGACTTTTAGGTTC
TTGATCAATTGAATAAGGAGTAAAGTTTCCTGAAAAGATTAAACATGTCCAATATCACTTTTTGTGAAGTAAAAATATGTTTTAACGGGTAGCCTAAATT
AGTGAGGATCACTCCAACAAATATTGGAAAGGAAAGATGCACATTCGATTAGAAATAAAGGAGAAGCAACTTAACATATGAAAGTCCTTGTGGATATCCA
TTTCCCAATCCCAAAAGACACTCCTTTTTGGATTCTATCAAACACGACTTTGCCGAGCAGACAATTCATGCTAGTTCTGTAATGTTTTTAACTGAAATTT
GTAGGGAACTGCTCAAGTGTCTTTGTTGTAGCACGGCAGTAAACTCAGACCTGAAGCTACTCAAAAGTGTTCTATTCTAGAAAAGGCTAGTACATAATCT
TGCAAAACAAAGCAATACGCCTGGATCTTAGTCCATTGGAAATATGTTTATATTCCACGAAGTTTTTTTGTGTATAAGAGACATGGTGGCAGGTAACAGA
ATTGAAGCAGCTCGGCTTGCAGTCTCTAAGTAAACAAGGAACAAAGAAAAGTAAAGTTGTTGAGTAATTAACAGAGCTTCTAGCTACGAAAATGTTGGTG
ATACAAAAAATTTATCCGGGGAGTATCATTTCATTTTATTTTTACCTTTATCAAGACAGTAGTTTTCTTTAAGAGGTCACAGATGATTTTGATCACTCTT
TTCCTGCCTAATGCCAAATATAAACCCACATACGTTTCATTCAGAAAAATAGGAGCAGCACAAAGGAGATAAGTTAACTCTGTCATTCAGAGTAGGGTGG
TATCACCCAAAGGGAAAATATTTCTTTATTCAGAAAATTCAGAACGGAAATAAATGTTTCAAGGCTTCAAGTCATGCAGGGTGGCAGGGGTAGTATCACT
CAGAAAAAGCTTTTCTTCGCTATTTAGTTCTCTAAATCATTCTCCTCCACAAGGAAGAGGTGGGATCAGGGAATCTTAGAACAATGGAAGGTATAAAGAT
AAAAAGAAAAAAAAAGGGAGGTAAACTGCACAACAACACTATTTTCATTTAATACTGGAAGAATTTTTGGACATGCCAGAGAGGATAAGTACCTTTATCT
CGTCATCCGTGTAAGGCTTCGTCCTAGACCTGTCATAATGGAAGGATCAAACATGTCAAGTTTCATGTCAATGTCAGTATCATTGCCAAAGTACTAAACA
GATCCACATTAAACACCTGACATTCTAAATATGGACCTCTTGGCCACATGAAAACTAGTACACGTAAGAGAAAACTAAAACTAGAGAAGAACAATAAGTA
TCTGTAACTAACAGAAGAAGTAATACCCTTTTACAGCAGCAAAGCCTAGACCACCTCATCATAGGCAAAACCATGTTTTAGAAAATAATTTTCAATGTCA
TGATTTACCCAGGTGAAAGTAAAATTCAATATGAGATTAATCACATAAATGGAAGCTATCCAAAGTCTGTAAAACAAATCTTCACCTTCATGTAAGTATG
ATACATGCCACACTTGATAGGTTGCACCATTCACATCATAAGGTACCTGTTAGGATTCTTAGAGAAGGATCGAGTCACAAGACAATGAACAGGGAAATCA
AATTCAACTGCCTTCGATTTTTCCTTGCTTTTGTTCGAATTCCTAGATCGACCTATTTTTGTGTATGAATTCAGCTCATCAAAGGGAAGCCGAAACCTTA
GAGTTCATTAAAAGAGAGAACTCCTATCTCTTGTTTTCTGATAAAAATCTGCGATACTTCTTATTCCTCAAATCCTCCTTTAAATAGGAGTCTTCTTACA
GTAATAGGAAGTCTTATGAAACTAAGAAACATAAATCCTATTCTAAACTAATAAGAGAACTACTACTAATATAATTAAAGTCTTCCTATTCTAGAATAAT
AAGAGAACTACAAGCGTTATAATTAAATCAAGTTATTTGGCTCTCTGTCGCACATATGTCTTGCCCACAAATGCATCCACAACAGTACCATTATCTCCTT
ATTAGATTGCAGTGAGTGAATAGGTCGAAAACAAAACTAGAAGTGTTCCAATCTATGTCCTTGTTAGAAGTCCATGGTGACTTCAAATAGAAGAGCCCAC
GGCATTGGTAAGCTGCATCCTATGAGGCATATTCTTATAGGGCTGAGGTGTATGCTCTGGTCCTTGAGTTGCCAAAAAAAGAATGCAAATTAGTTATTTT
TCTTCTTTGTAAACCCTTCTTTCTGCTTGGATGCAGAATTCCCTAGCAAAAGAATTGGCCAAAATGCATGCCTCAGGCACATACATATGCCTCAAACCAT
AATAAATGAACAGTAACGTGTCCTAAACAACTTTGATTTTTGGACTATCATCTTTGTAATGGACGTAACAAAACGTTTGACACCATTCTATTTTACTGCA
ACTTTCACGACTAGCAAGAATTTTAATCATTAAATATACACACTTCAACTTTGATGTGATATTTGCTCTCTATTCACCCACTACTTCATTATTCTCTTTT
ATCATCACTAATATGTTATATAAGTCAAACTAAAATCTCAACTCCAAACCCAGTTAAACATTGTAATATAAAATGAAACTGAGGTAGCACATACTTTTAC
ATGAATTCGTCTTATATGTTTAGTATCTAGTCGTGGAACTGCGTCATATACAACAACATACCAAGTGAAATGTTTCCAAAGAATGCAGTAGTATAAGCAC
CAAAATGAGTTAAAAGTGGGCCCCCAAAATTCCTTAAAACTTTGACTTGGATTCTCCCTCCAACTTCCACTTAAATTTCATTGGTAAATGTGGTTGTAAT
TTGCCTCCTCATATCTGTATATTTACCACATCTGCTAGCTGCATGGCGGAGTTCTGCCAGTTGATCGGTAGCCTTCCAACCTTCATTTTCCAATGCACTA
CTCTATGTTCTAGCAGTTTTTGCAAAGCCGTTGGAAGGAATTAGTAGACCCCAGGATAAGGTGATGCATCAGGTAATACGCAAGACTCCTCTATAACCAT
ATAGCTATATATAAAGGAATACGCTAGGTGCAAATTTTGTCAGCCTTTGCAGAAGGAGTTCACTTTTGGCCTGTGTTAAATTAGAGGACATGCAAAGAGG
GCCTATTATGTTTTAACTGTCAGCTGGAGAGTAAAGAAATAGGGTTTGCTTTTGCGCTCTTGTGGGTAATGTTTACACCATTACTGTTAACTGCCATATT
ATCGGTCAGACACCAACAGCTATCTTCTTCATGAATACAACCACTCAGTAAGGTCTTCTAGGAGGTTCTGACCAAGCAACCAAAATTGGTACGTCTTTCC
CAACTCATTAGAGAGGAATGATTTGCTAATTACTGAGCCTAAGCCAGTATTAGCTTATGTAGATGCATGACCAGACACATGCAAAGTGCTGACTTGACAG
GTCCATCCAAATGAACTGACATCATCAGTCTCAGTAAACATGGACTAATTCTAAGTGATAAGATGTTCACCGAATTATTGATTGAAATGAGACTTCTGAT
GAAATCGGGGATAACATCAAAGAAGGAATCGAGAATAACATCAAAGAAGGAAATAGAAAGGAGTGAATACCACTGAAAAAGTCCCTAGACACAAATAACC
AAGTTGGTGTTTTGATAAAAATATGCATAAGGCTTCTAGAAAATCCAGTCAGCTATCTATACACTAAAAAGTTAAAAGGAAAACAAACAAACTATGATTT
AGCTTTTGATAGTATTCCATACTGACAATAAATAAGAAAGAGGCAGCTTCTCACAGTTTTATTATTCTAACAATAAGCAAGAACATACTACAGAGAACAG
CAAAAAAATTTGGTTCAAGACCTTGAGCTACATGAAACAAAACTAGCTTCCTAATTCATCAAAGTCCAAATAATTATAGCATAATCATTCTTAATGATTC
ATTTGACATTTAACACTTACCCCTCACCTAGCTAATGCAATGAAGAAACCAGTCTGGACTGCCAAAAGAATAACACTCGGCACTAAGAGATAAAAGAACC
TAAATCATTGAAAGAAGCAACTTCACTACTACACTGATATCCTTAAGGATGCTAAAGCTAAGACAATTGGAAGACTGAAACAGCATATCTGATTAGCGAT
AACATGCGTAACCAGTATAAATATAGATCAATTCAACATCTGAAAAAAGTTAGTACCTATCAAGACCCAAAACTGAGTAATGATGCGACAGAGGGTTGCT
TGCATTGGCCCTAGGAGCTTCCCTGAAATTAGTTCCCCGGTCTCTGAACGATGTATCAGCCTTCCAGTACCAGTCATTTCTTTGGAAGTGCTGATGATAT
GCACTTTGCCCATTTTCTTGCCAGCTCTCATAGCTCCTCTTATATTTGTTTCTCTCCCTGTTGAAAACACTTTGCATACGGCGAATGCGCTCCTACGAAA
AGCACAGGATATTAGGTCAAGAGTAAACTCACAAATGGAAGTTTATCTGTGATCTCATTATGTTTTTCCTTAGCTCAGATATGTAAGTCTTTAGATCTGC
TATCTGTAGTTGTCTTTGTGAAGGTCACAAATTATGGGATAGAAAATAAAGCACAACAGTTCAATCAGGCAAAGAAAACATAGGGTAAGAGTGACATTTC
ACTTGAAAGAAATACAAATAAGACGAGTGTTCAACTTTGTTAAATATCCAATGGTTCTGTACAACTTCAGTGTATTATTGCAGATGAAGAAATATGGGTA
AATTTTATGTCCGTCCTCCAACCTTCTAGCTATAAGATTTTCCATAAAAAATTTCCCACAGCTTGTCCAAGAAAGCAAGTTATGCTTATGTCCAGAAGAA
CAAATTGTAGTTAAATTCTCCTTCTCAAAATAAATGGTAGTTAATTTCTCGACGCGGCCAAATTATATTCAGAGACGGCACACATTATAAATGATTACAC
ATAGGGGCCTGGATTTCATAAAGCAAATATCACCAATGTCTTCACTTCCTTCTAGTTGAAATAAACTTTGACGATATTCTCTTTCAATTAGATATAAGGA
AATAAAGAGTAAAATTGTTGAAGATGAAAAATGTAGCTCACCACTCTCTCCATTTCTTCTTCATACTCCTCTCGCATCCTGCGATTGTATCTTTTCCATG
CTTCCTCCTGAAAACTTGTCCTAAAAGAACTGCCAGCTCGACTTCTCTGTGCTGACTGCCTCAACTTTTTCAATTCAAATAAGTAGTTATTAGCTCAAGA
AAAACATTTCTTTCCTCCCCCATGCGAAGTATTTATCAGAACAACTAGAGCAGAATCCTTCTTTAAGCACAAATGTCAATAATTATAAGCAACTTCATTT
GATGTATTTCATCTTATGCATGCAACAGTTAATTAGTATTGAACTTGCACCCAGGACAATTGCATGAAAACAGCAAAATCAATTATTTGCACAATATTAG
TTTTGTGGCAACATCTCATTTCATAGAGTAAGCATATACTCCCTGTATCAGAAGGAAATAACACGATTATTAAGAGTTTCTTTTACAATTATTTTCTGAT
ATTTTTTAACTCTAAAGCTGAGTTATAAAACTTTCTCTGTAGTAAATAAATATGCAAAAGTTTATTTCCCAAAATTTAAAAATCAATGTCAAATTCGAAT
CTGATGATCTTCCCTGAACCCCTCATTCTTATTAAAAAAAAGCGATTTATCAGTTTAATTTTTTTCTTTATGACTAAGAAATATCCGAGGGCGAGATGGC
CCACAGTTTGAAACTCGTTGTATCATGAGACTGTCTCCGTACCCTTCTCTCATTAAATACCATTCTTCAGATTGCCACGACTTTCAAACTAATTACGTGT
GGCTAATCCACATATTGCTTAACTCTCATCACTAAACCAAAGACTTTGGAGAACTAATTTTTAGTCATTTTTCAATCATCTTCTGAGTGGTGAATTATGT
TTAGACGTGAGCTAAAACTGACTCACATACTTCGAAGATCTAGAACATCAGCAAGAGCAAATATGTAGAAGAGAGATCGATGCATCAATATCACATCTTC
CTGCCTTTGACATTAATCTCTTTCTTCTAATTTAAGATTAAACATCATCTCGATTTATGGGTGTCATTTTTTGTGCATGCGCCATGCCAATCTTCTTAAT
TTTTTTGTTTGAGCAAGTCAATCTTCTTAATTTTTAGAAGGCAAAAAAGAATTCTGAGTTAGATATAATACTATTTTTTCATTAAAAGGTCATATCTGTT
GGTTAGCAATAGTCTTATCTTTCAGTTTTAGTTAGAGAAATAGGTTTTGTTGTCTCCAGTTTTCACTTGCTCAGTATTCCCTATTTATAAATTGGACCCT
AGTGCATTTTGGTCGAGAGACTAATAATATTGTATTAATTGATTGCATATAAAAATTCTTCTCTTTATCCTCTTATTCCTGCTCCCTTCTCCTATCCACC
CCCTCTCCTTCCTCTCTCTCTCTCTCTCTCATTTTTGCCTTTTCTCATATCTTCCCTTATTTTTGCTGTCCTATTTGGTGCTACATAAAAATTACAAGAA
AAAGACAAGAAAACCAGATAAGAGGTAGTCAAAAGAAGAAGCAAAGGTAGCTCACTATGATTATGCAAAAGCAACAAGCAAATAGGTCATAACATAGACC
ACATGCAGGGAGGGTAACTCAGGAGTAAACTGAAATTCTACATTTACCCAATGAGATTGAACAAAAAAGCTCATTACCTGAGAGTAGACAAAATCCACTG
TACTTCGCAATTGTGTAACCTGCCAAATTTCTCAGGCTGTGAATTAATAATCAGAAGCAACCCAGAGGCGGAAAAAAGGAAGAAGCAAGGAAAGCTACAA
AATTCCTCTAAAACTTTTTCATTGTTCTAACAGAACACAGAAGAGCATGAAAGTTTAAAGTGGTCAGAAGCAACAACGAACCACACCCGGGAAAAAAAAT
ATCAGACCTAATCAACTTCAATTTGTAGAATCCACTGAACAAGTTTCTAAGAGAAGGAGACTATACAAATGTCACTGAATAGTACGCCATCCTTAATAAC
AAAGAGTTGAAATACACTAAGGACATATGATTTTCTATTCGTATCTTCTTCCACCTGTAAAGGTGGCCGAGTTGGTTGAGCAGGAAATCTCCCAATGATG
GGTCTTAGGCTTGAAACCCCTTGCATGCTTTCTTGGTTGAGCGTGTAGTAAGGGATTTCCTAGTGCGGTTTATCTCTCCTGTGAGGTTAGCGGGCTATTA
CAGTGGAGCGAGGTTTACCCTGTGTGCACCCAAAAAATATCGGTTGCGGGATCCCTTGTCATAAAAAATATCCATATATTTTTCCACCTTTGCCCCCCCC
CCCCTCCCCCCCCTTCCTTCTTCTTAGAGGATGCCTTTCGTCAATACATGCAAATACCCAAAGCCCTCCATTCCAATCTATCTAACTTATCTCCCATACT
CCTTTGCATGAACTCCACTTCTCATTCCCAATACAAAATTACTCTTTTGAAACTAATTTCTGAGATATTACTACATGTTTCTTGTGAGATGTGACAAACT
CGGATATATTACCCAATCTATGTAGAATGGCTAACACCCGAAGTATATGCATACTTCAGCGTCTCCACACAAGCTATCCAACCAAAAACGTAGATGGTTG
TCACTCCGAGTCCCGACAGTTCCACATTAAGGGTCATTGTCATGACAATGAACTTTGTAAAATCATCTTTTCCCTTCACAATCTCCTTTGTTCTAATGAC
CAAAAGATAACAAAGGTTATATCATTCCGTTGCCGGGAGACAAACTTTTCACAAACTTATCAATAAATAGAAAACTCGTAAGGTCATCTTATCTTCCACT
ACCTGACAATTTGTATCTGGCAACATTCAACGACTTCCTGATAATGTCTCTATGTAAAAAAGACATTTTTCCATTAGTGCCATATTAAATCATTTCGATC
TCTTCATCACTAATCCTCCAAAAAGGAATAATTACAGATTTCCAATCAAATCTATAATCTGGTCTATATCATCTATACAAAGTTGTTTACACCAAAAAAG
TAGAGATACTATACAACTCCATTTTACTTTGTGGATGGAATTGGATCTATCTTCAAAACATTTTCCATTTCTTTCTTTCCAGACTGACCACCATACACAT
GATGATATTAGCTTCCACCATCTCTTTTGACTCTTACTGCCTCCCCTCCTAATCCAACAGCTCAACAAATCTGATGTATGTTCTGGCGTTGTCCAGTTCA
TGCTTGTGATGTTGAGAAACAAGTTCCAAATTTGAGCAGTAAACTTACAGTGCAGGAAGAGATGATTATTTGTTTCCCCAATCCTCCAACCCTCCCCCAA
ACCATAGAGAGATATTTTCTTCTCCACCAAAAGATATCGTATTGCCATCCTTCTTTTATAATCGAGAAACCTCCAAGGGTCACTAGCGCACGGTCAGAAA
CTAGGCAAATAATGGGCCTGCACCTTTACCCGTCTCTACTTAAATAACAAAATTTACCTGCGACGACATGGTTCGAACCATGACGTACACCTAACTTGCA
AACAGCAAACCAGCTTTGGTGACTGAATCTTTCTGTTGAACCCATCAAAGGAACATGACCTCAGGTATCATCTCTGGCTTTTTGTTTCATCAGCTGAAAC
TGAAAACAGAAGCTCATTCTCATTCTGGATAGATATAACCAGCACCTACCATCTATGGTGGTCCCACACCCTGCCACTTCTTAGAAAGATTCCCCTCTAC
AAAAAACACCACTTTACACTACAAGTTCACTGGTGACTTTGAATATCTAAATCACATCTTAGCTGCAGAGTTACACGGAATTTGATGGTGTAGGACATAA
TGCTCAAACACCTTGGCTCCTAATCCAGGAAACGAATATATTATTTATGGTAATGAGACGAGCAAATTTTTTTCAAATACAGTAAGGGGGTTTCAATAAA
AACATTGACAAATGATGGTCATCCCCAAAGTTACAACATATTAACCTGTAAGCAAATTAGCATCATTGTGGTTTTCGAATATAATTAACTCAAATGGCAG
AATAACTACTACTTATGGTAATTAATCAGGGCAAATTTTGTTCACAACTGAGCATAAAAAAAATTAGAAACCTAAATATCCCCAAGTTTCTTTCTTTCCC
AGTTTGATCAAGCATACACTTTGGTTTCTTCACAACCCATTTTCCCTAAATGCCCAATTATCACATCATATCTGATATTACAGATCATAGATTTCAACAT
TACTCAATAAAGCTTCTAACTTTACAGAACCCACTGAATTGCATAACCAAATTCAAATAAATGAAAAAAAGTAGAGAAACAAAAAAAAAAAAGAAAAAAG
ATGGGGTAAGAACCTACCGCAAAAGTTGTGGCAGTAGCTCCGATTAATGCAAAAACAAAAATACCCCAAAGTTTCATCTCATCTTTTTCTTGATAAGGTT
TTCCCCTATTGTCTTCATCGCCTTGTTCGTTACCCATAATTTATTTAGCTTTGAATTGTAATCACTGTAATAAACTGGAAAAAGAGCCGATGAAACATAC
TATGCTGTGTGCTTTATATAATCGTTCCTCCTTCTTCTCTACGCCGTCGCCGACTTTAGATGAAATTGTACTTTGTATTTTCTCTATTTTCTTCTTCTTT
CAACTTCGCGTTTTTGTTTCTCTGCTGGTTTTAATTGGTTGTGATAATTCCCAGTCACCCGCTACCGCTCGTCGGACCTTTTCGGGTCAACTGTATGTTA
AACTAGCAATTTTTGACTTATTTTTTTTTTCCTGTGTTTTATCATTCTCGTTAAATACATAATTTATACTATACATATATTTATTTTTTAAGAAAAAATG
CAAAAGTACCTCCTCAACTTATGATCGAAATTTCAGAAACACACTTATACTATACTAAGGTATTATTATCCCTGAACTTATTTTATAAGTAATTTTCTAC
CCTTTTTAGCCTACGTGACACTAGTTTGAAAAAAAAAAGTCAACCATCTTTGGACCAACAAGATAGTGCCATGTAGGCTAAAAAGGGGTAAAAAATTATT
AATAAAATAAGTTCAGAAGGGTAATAGGATCTTAGTATAGTATAAGTGTGTCTCTAAGATTTCGGGCATAGATTAAGGGGTACTTGGACATTATCCCCTT
TTTAAAGGACGTGTCAAGTTAATAGTAGACAGTTATTATCGGACTATTGGAGTATTCTGCTTAATTTGCACAATGGAGTCAAGAGGTAAGTATACCCAAT
TTTTATCATATTATTTTCAGTAGATTCTCAATAATAATATCACAAATAAATTACACAAAATGATAAATAATAACAGAAATCAAAAACACAAAAAGCAATA
AAAATAGTCATACGACTAATAGTTGTTATACTATCGAATTTATTACCATATTTAGAGGGTTTTTTCAATCTACCTATAAATCAAACAAAATATATATTTT
ACACAGTTCTTCATTCTTATTAAGATAGTTTCGAATTTGAATCTTTTAAAATATGAAATTACCTTTTTAAGAATGTTTTATCTTAAATGTGAAACTTTTT
GATACAAAATCAAATTTAATCGAAATTTAATATAAATATTTAAAAATCATATAAGAATTAGTAGATACTAAAAATAATATTATCTAGAAGTTCTTTCTGT
TTTAGTTTAAAGGGAAGCACACTCATATTTAAGTTTAACATTATACAGTTTCAAATTCAGTGTCGAAAATTCATTTTTTTAAAAAAAAATTAAATGCAAT
TATTTAACCAAAATGGATAATTTGCTCGAAATGAAATGTGATTTAAATGAGATTCGGAGCTCCGGAGTGTGAGCAGAACCATTGAATTGCAACCGTTCCA
ATCCCCACGCGCCAAATTCAAGCTCTCCGTATACGCGCCTTACTTTCCAAATCTGCAAATCTCCAGCAAACACTTTCACCTTTTTCTCCAAACAATTTTC
AATTTTCTTTTTTTTGTATTCATCAAATACACATATCCATTGTGTACCAGAATTACCAATCATTTGTAAACTACGGATCTTTAACGTTGTTGACTACTGA
TTCAGGTACAAATGATGTTTTGCCATTGCCTATTTATTTGAAGCAAAGACCTCAAAGCTTCCCTTTTTCCCCCTTGTATCAAAATGGGTACAATTTTGTT
TTCTTGCTCTTTGTGTTTGCTAATTGTAGTAAAAGATTGAATTTTTTTTTGTCTCTCCTATTAGTTTCCATTCATGGGTTAGGTTAACAAATACTAGACT
GTTAAATGCTTCACCACAATCATTTTTTTTCCTCATATCAAAATGGGTTTAAATGTTGTTTTACTTGCTCCCTAATTATAGTTAAAGATTGAATTTTTGG
TCTCTTTCTTGAAACCCTTTTAATTTCTATTCATGGGCGTGGTTAACAAATACTAGTATATGATTAAATGCTTCACCACAATCCTTTGTGGTTTTTAGTT
TCCTCATATCAAAATGGGTTTAAATGTTGTTTTCTTACTCTTTTTGCTCCATAATTATAGTTAAAGATTGAATTTTTTTCTCTCTTTCTGGACATCCTTT
TAGTTTCCATTCATGGGTGTGGTTAACAAATTCTATAACCAGAATCCTTTGTGTTTTTCCTCATATCAAAATGGGTTGAAGTGTTGTTTTCTTGCTCTTT
TTGCTCCCTAATTGTAATGAAAGATTGGATTTTTTGGCTCTTTCTGGACACCCTTTTAGTGTCTGTCATGGGGTGTGGTTAACAAATATCCTTACATGTA
AATCCATAGTTACTAATCATTGTTTGCTTAAAAGACTGGTCTTTTCCTAATATTGTGATAATGCCATATTTAGCAACTTCTGTGAAAAAGTCGAAGCTGG
CAGATTTAAGAAATTTACCAGCTTTTGGTATCTAGTTTTGATTTTTGACGTAATAAGTTCTTGATTAATTTTTAATAATTAGAATTTGTCTTAATATTAC
CCAGGAAATTAGATTTTTTGGTTACAAGAACCTAAAATGATGTCAAGGAGGCCTATCAATCCATCTCGACGTGTAACAGACAATGGAGCTTCTTCCTTAG
AAGGCTCAATTCGGTCAAAGACACGGTCTCCCCCATATTTAACAATTGGACTTATTATTGTGGTACTTATTCCCGGATTCTGATGCTATTTGTTATTTAA
CTGTTATCATTCTGGATGACAGTGGATAAACTTTGGAATATTACTAGCCTCTAGTCATTTAACAGTAATTGTAACTCAATTTTTCCTTTTGGATATTCCA
GGTATCATTTCTTCTCATAGGGTATTTTTACCGTGACACAGGTTTGTATCTGAATCCTTGGTATTTTATGAATTATTTTTATCTTCGGAAATATAGTGAG
ATGCCCCCCAAAAATGATGCAAAAAGAAAACAAAATATTTTGGCTGATTGCTCAACACTGGAGTCTGGAGCTGTCTGGTAGCCTATAATTTCTAGTTTAA
AATATATACTAACAGCTACGCTCTTTAGTTGACTTGGAGGACTCCTATAGATTCTTTATTTAGAGTAAATTGTATATTGAAAAGAACGATAATACTTGTG
CATGAAAGTCTTCCCTTCTCGAGGAAAGAAGATATCGGCATCCACATATGCACAAGTAAAAGATGGCTCATGTGTATTGTTTTCGATATATTTTTTATTT
TTTTATCTGCAAACAAATAATGGTCTGTCTTCCCTTTAAACATTTTAGCAAAGGAAAACTGGCCCTACCTCATGTTTTGATGAATGTTTTCTAAATAAAA
ATCTCAAATGAATCTCTGCTCTCAGTAATGGTCATGCAGATGCAGGTGATTTAATTACACGTCGTGTTTCCTTCTTTCAACTTGAACATTTTGTTCTGCC
TAAGTATTGTTCTTTACTTCATTCTTTGTGCTTCTGAGTCTTGTTCCTTACTTTAGTCTGACACTGATAGAGGGATTATCATCGGTTGTAGGTACTTTTG
CCAGTATTAAAGGAGCTATCAGTAGAGTGGAAGGTAATTACTCGTGCATTATTCTAGAGGATTTGAGTTTTGACGTATTTATATATCAAATGCCACATGA
ATTATGTGATTTAATTGAAGTACTGAGACTTTTCTTTTAATTGCTTAGTGCTAATGGTTCTAACTATGGACTCATGATCACCTCATATTTGTATCAAGAA
CTTCAGTTTGGTCCTTAATGATAATCACTGTCACTTCTCTGCCTGGGGCTTTACTCTAACAATCATTATAATAATCTATTATAAGAAGGCTCGTGTAGTA
GGAACCATCTAAAATTACTTAAAACAAATGTCTGTTGAGACATAATAAAACCATCTAACGTATCTCTCTAACAGCTCAAGCCTTTGGCAAGTTGGTCAAC
ATGATATCTGAGCAGACTAGAGGTCCTGGGTTCAAATCTCGCAGCCATCCAAAAAGAAAAAAACGTGTTTGGTCCATGAAAACGAATAGGGCCAACAAGT
GAGGGTGTGTATTGAGACATTATGAAATCAAGTCACTTAGTTGCTACAACTTAAGCTTTTAGTTTTAGATGAGATGGTCTCACACTTCAGCAATGTCTTT
GGAGATGACATGCTGTATTCTTGTGTTCCACAAGGAAACCTATGTGCATTGTTATCATGCAGTCAGTCTGTATACCAACTTCAATAAACTAATATCAACC
CAGAAACTTCACGTCTTTGATATCTGTTCTCTTATTGATTTGCTGAATAATTCTTTATTCTGGTGAGCATCTGGAACATCTGTAAACTTTCCCCCCATAC
TTTATACATCATTTACTCATAAAGGCATAGAGGAGGTAACAAGATTAGTAATTTTCATTTGTCACTCTAGGTGGGTGGAGTGACTGCATTATACCTATCA
AGAATCTTGATATAGTCTATACACAGAGCTACTGACTTCCATTCTTTATATTAGAAGATACCTGAATTCTATTGCTTTTGTTTAGTTTGGGTAATACGGT
ATGTCAGTTTATTTGCCTTGACATTTTTGAAGATTAAGTTACTGCTATTTTTACATTAGAGTTGACTTAGGATCTACCACCTGTTTTACCTCTGCAGGGG
ATTTTTTATGTACTGTAGAGGTTCAAAAGGCCATTTCTGTTTTGAACAAAGCATATGGTGATAGCATGCATAAGGTGCTGCATGTTGGTCCTGATACTTG
CTCGGTAGTTGCTAAATTGTTAGAAGAGGAAGATACCGAAGCTTGGGGTATAGAACCATATGATATAGAGGATGCAGGTCATTTCTGCAAGAAACTCGTG
CATAAGGGCATTGTTCGTGTGGCTGACATAAAATTTCCTCTCCCATATCGTGCAAAATCGTTCTCTCTTGTGATCATCTCAGATGCGTTGGATTACTTGT
CTCCAAAGTATCTTAATAGGACTCTTCCCGAACTGGCGAGGGTGTCATCTGATGGACTCGTTATTTTCACAGGTAAGAAGAGTTTGTATTGGTTGTTGTG
TTTGTATGATTGCCAGTCCAAAATGGAAGTTTATTTTGCATTCATTGTACTGTCCGAGCTAAGCTGCTTCCTATCCTCACTTCCTGTCAATCTGTATTTT
GGTGTTTGCCCCTTTGGGTTACAGACATGAGTAGGGAGTATTTATCTCAATCCTAGATAGATGCCTTTTTACCATGTGAAACATATTTTTTTTTATCTTC
AGTACTTGGTCATACTAGCACATTTTTCTCGTTGATCAACAAATCTATTTAGAAACTTGATCATTTGTTGCCTTAATTTCAATTTCCTTCCACCTGACGT
ATCTTATACAGTATGCTTTCAATAGGTTTCAAACCCCCCCTCTTTACTAGGTCCAAAATTGCCCTATTCAGTTTTCTCCTTTGAAGTTGGATTTAAGTTG
ACTGGGAGAAGTTCTTGTTATCACCATCCTTTCTGCGGCGGAGGATAAAGTACATCACCACTTCTCGTTAGTTACCTAAATATATCAAGAAAAGCTGAAT
ATCTGTAAGATTTTATAGCAGGGACATTAAGGACAAATGTTGGATTTCACACACTAACACACACACGGAAAAGAAGAGGACATCCGTGGTTTTTTTTTTT
TTTTAATAAATGGCATTAAACTGCTATCTCATATATGAACATAACAGATGCAGAAGTGAGGAGATTTTGCAATTGGGGGAAATTAGATGACCAGGGTCTA
TTTATAACTGAAAGAGAGAACCTGTATTTGTAGAACTTAGAAGAATTTAGCAGCAACAGCATGGCTTTTCCCTTTCCTTTTACTGGAAAGGAACAACTTC
ATTTCTGAATTAATGCAACAGTTGTTTGTTACTGTGAAATAGGATACTTGAGAATTCGTCTCCTTTCCTGTTTATCAGTGATAATATTTTTAAAGAATGA
TATGGTGATAGTTGGATCTAGTTTTGATGATACCTCACACATACATATCCATCTCCAGTACATGAATGGTTCACAATTGATTCCAAATAGATGCAATGTA
GCGTACTTTCAATTCAGCTAGTGTGCTTTTATTCTTGTATAACTTTTGGTCAGTTGACCTCTATAGAGTAACATTTTGTATTTTGGTTGCGTTTGGCGAG
TCTGATCACCTTGCTTTCATAGAGCTGTTAACTCCGTCAGTTTTCTCCTTTAAGATTTGACCATGTCACTAAATTACTCCATGCATGGGCTTTCTAAGGA
GTTAGAAATGCCTTTAGGGTATTTTGCTACCTTCATCCTTTATACTCCATGATTGCTCAATATAAGACATTGGCTGCATTCTGCATATAAAGACAAGTTA
ATATGGGAAACCTTGTAATCCAGAGAATTCTTCTGGTGTTAATCTGATGTTAATATCTGATAATTGCAGGTTATCCACGCCACCATAAAGTTAAGTTTGC
AGAGAAGTCCAGATTTGGGGGGCTGGTAAGTGACCAGTCCTGCATCGTATAAATTCTTATATATTTTTGTTTCACTGTATGGACATTTGATCTCTCATAA
ATTTTAGGGATGAGGAGCCAAGACTTTAATCCTAGTTTGGAGCCTTCGACCCTTATATGACGTCTTATGGTTATCTATTCTTGCTCTTTTAGTTTAGTTG
ATCTGAATTCTTAATGGTGTCTTGAAGAAATTGAGTTTATGTCAGCAGTTCATTTGAAACCTCATTATAACATCACCATTCATGCAGTAGCATATCGCTG
CTAGTCAAAAGTCAGATTTTCTAGTTTCCGGTGAATAGGAAAGTGTTTATATACATTTCTTGAAGAATGACTTCATGCTGCAATGGTGCTAGCCCAATAA
ATTGGCAGCCAAAGTTGTATGGTGAAATGTTTTAGTGAATGCCCTGCTCATGATATCTTTCTCTCCGTCTATTTTCCACAGTAACATTGACTTAAATGAA
CCTTCAATTTTGAAACCTGATGCCATCTAATTCCACCTTTCCTTTATGTTCTCTCCAAAGGCTAAATTGAGGAGCTCAACGTGGTGGGTGCGATATTTTG
TTCAAACAAGTTTAGAGGAAAATGAAATTGCCATCAAGAAATTCGAGCAAGCTGCTTCGAAGAAGTCTTATGTTCCTAGCTGCCAAATTTTTCACTTGAA
ATCTTACCGTTGATATAAATACTCAAAATTTATACACAGTAGGACTCACGCAGAGCTCGTGGATGATGGTCAAGATATGTTGTGACAACTTTCAAGTTTC
AGCTGTGTTGATAAGTTGTTTAGAATAGCAGTTGTCTCCTTGAAAAATTATTGAGTATGCCATCATCTTCATTAGTGTAGTCTTGTTAGATATATGGAGT
TATGGCAGTTTGTTGATTTATTGCAAAAATGGGAATTAAATTGCTGTTTCATGGGAGACTCTTTGTGATTTTGGTTTTAATGGCCAATTAAGCCAAATGA
TATACATCATCTAAATTTCTTCTTTTGATTCTGTTTCATTTGTTTCACTTGAGCCGAGTATCTTTCGAAAACAACCTCTATACTCCTACCCTTTCCAGAT
CCCACTTTCCAGATCCCATTTAATGGGATTTTATTTGTTTATTTACTTATTTCATGTTTATTGTTTGACAAATTACTCAATAAATCTTTGTCTTACTACT
TTTCATTTGGTCGTCCAAATGTTGGGGAATCACAATCTACTACTTTATTAGTGTTGCCTTTATTTGTGATTAATTCGAAATATTTTTACCTACTCATGTA
GAAAGTCACAAGGCAAAAAAAATAAATGTTGAATGTCATTAGAATTCTAAAGAAGTAGAAGTATAAAATTGATTAGAATGTCAATACATAATCAAAGTAA
TGCACCATTATTTCTCACCAGTAATAGAGTTAGAATTTTTTAATTGGGAGAATTAACTTATAAAGAAATAAATATGTACGAAGATATAAAGAGAATTGTA
TCGATCTACTCTGTCGATTGAATATCTTGCACCAATATTGCTGAAATTTTATGGAATGTATGTGAGCCATTATTTTCAAACTTTAGTACTAAACTCAATA
AATTGGTGGAAGCAGAGACAAGAGGTGACTTTAAGTTGAGTAGAAAGGGCCTTTTTATGGATAAACAGAACAATGTTCTCATAAAGGGGCAACAGTTGAT
AAATAAAAGTGGAACAACATGGACAATTATTGCTATCAATGTCCTAATAAAGCATTACTATCTAATCACCACTTTGATTTTTTTGGCGTAAGTTGTTTTC
ATATATTTGAAAATGTTTGTCCCATTTTAATTATGACTAATCTCTTCCAATAATAATCATGCACAAGTGTTGCAATTAGTGTTCCATGCAACACACACAA
ATTGATCCTAGCTAAAAAGCTAGTGACATAATTTTTTTTTACCGACATTTAAAGAAGTGAATAAATAAAATAAGTTGCTTTAACAACATCATATTTTAGA
AAAATATGTCGATTTTTGTTGGCTAGTTAAGAATGTACACATTTAGAAAATGAAGACAATAGAGATGAGGATGCTCAAATCACATGTATATGTAGGCATA
TCAGAAGAGACAAAATCTTAGGAATGAGATTATATGGGACAAGGTTGGAGCAACCTTTGTATATATCGATGAAGGAAGCGAAACTGAAATGATTCAAGCT
TGTAAAGAGGACATATGCACGATAGTAATTAGTAAGCAGGTGTGAGAGTTTGACTATAGTAATATAATATGTTATAGGGAAGGTAGAGGTAGTAAAACGA
ATAAAAACTGAAAAGAGTTAATTATGCATAGTGTGACACATCTAAAATACTTATTGAGGGCATGGTCTTAGATAAAAAATTTTGAAAATAGAGAAAAAGA
ATATAAGGATAATAGGTAGTTGAGCATTGTAGTATTAGTTACTAGTTAATTAGTATAAGGCCTCATTTGATTCCATTAAGATTAAGAGGTTTGAATCTGA
ATACAAATCTGAATATTAAGATTTGCATTAAGATTTGAATGTTTTGATCTAAACACACATCTGAATATTAAGATGTGATCTCTAATTCTGAACATTAAAT
AATTAATGTTATTTGTTTTCAATATCTGATGTGCAAGTGAAATTGAACATTATATTAATAAAATATTATACAATTTTCATTTCAACAAAATATATCACTT
TTGATTAAAAACAAGTTTTAAAAGTTTTAATAATCATGATTTGGAGTACTATTTTTTCATTCAAAAACCTTGATAAACAACAATACACCAAAAAAATTAT
TGCAAACCAGTGTTCTTGCCAATATAAGAAAATTATTGATATAAAAAAAATACTTGAAAGGATTTACGAAAACTTACCGTTGGGAAAAAATGGTGTTTGA
TTGAGAATAGAGAAAAAAGAAAGTTCTTAGTATGAGATACAAAGGCACGTCCAAAGCAGAGAAGCGATGATTTATTATTTGGTAACTTATCAAATGAGTC
TGAATGTTGTTAAGAATCTCTACAGATCTGATTCGTTCAGTCTTCTTCAGACACATTAAGAGGTTTTTTAAAACATAAAACAAATTAACTTAATGGGTTG
AATCTGAATGATTGAGATTCAGACATAAAAATCAAACGTATTTAATGGGCTGAATTTGAATAATTAATATTCAGACTCCCATTAAGTGCTTACGCTAAGT
GTAGTATATATCTTATCCTCCTAATTTTCTCTATTATCGCTTGTTTCATTTGTTCGATTTATTATGCTATTTTGCTATCATTTTATTATCATCATCATCA
TCATCATGTTTTGAGATAGGTCTATCGAAAACAACTTCTCTACCTCACAAAGATAGGCGTAAGTTAAAGTACATTATAATACCTCCACATTCTATTTGTG
ACTTGTGAGATACGCTAGATATATTATTATTGTTGGATAAATAAAAATTTCGACGAAGCGGAGCCGCATGACAGACTCAACGTGTCTTTGTCCCTGAACG
AAGCTATTAAATGTAAAATTGAATCACAAGTACTACTGTTAAATAAAACTGTGAAATGAAAAGGAATCAAGAGATATAGATGGCATAGTATAATATCTAG
ATTGGAAAGAAAATATCAAAGGACAAATTAAAGCCTATAGCACAACTAATTCGAGGAAACAATATCTTAAATTCGATCTACCTTTAAGTGGATCAATATT
TATTTTTCAAGTAAGATGATAAAAAGTACGTCAATCAATATTGAGTATTGTCAATTAGACACAGACAACTAAACATATATAGAAATATTGTACTGAAAAA
AATAAAATAGACATATTCGATAGATGTTTATATAATCTGTTTGATTAAGTTATAGAATTAAATTTATTGAACACAAATTATACCTATAATATAATTCTCA
CCATATATATATATATATATAATTGATAGAGTTTTAATTTCTTATAATAAAATAAAATGACTTTACATAATTTTCCATTGGTTGCCATTTATGTCTCATA
ACTTTAGAGTACGTACAATAAATTCTACCTTAAATGGAAATAGATAAAATTATAGAGAACCATATACATAGAGAGTACTATCATATCTTATGTTTTTCAT
CTTTCTTTTTATAATCAAACATGATAATTTGTGTAGCGATGTACTTACTTTATGTTACCTCGACAAGAAGTTACACTACGATATATTTGGATAATAACGT
GGCTATGTATATCAACATACACGTACACATGATTTAATCTAAAATTTCGCCTTATCCATAGATCAATAGTATTTTTTTGTGTGGAGTGATTCAAAAAGAT
AATATTCAATATATCTTTTCGTTATAAATTAATCGGTAAAAGACCTTAACCAACTGATTAACCCTCACATCACGTTGATCCATAGACAGTCAAGTACGTA
AGCTAATATAATTACTATAATTTATGTTTTAGTCAAAGCAATTCAAATAATTGATTGCAATATTTGAATATGAAGATATACACATTGCCACTTTTTGTAC
CCCAAAACATTAGCTATAAAGAGAAATTGGATAACATGCAATTCTTTGAATGTATAATTAACTTCATGTGCATGTGTAATATTTACTCTTTATATATTTC
CATTTTAGTGTTCCAAGGTATGGACTTCATTCTTGGAGGACAAGAAAATTAATACTTTAATAGAGGGAATAAAAGGTGAGTATTTTTTTTATAATTTATT
TAATATAACATACTTTTTATATTTGTATGAGCTAGATAGATAACTTCTCTAGCTAAACGGTAAAAAATTGTTGTTGTTTTATTTAATAGAGTAAATTTTT
TTCAACAAATCATTAAAAAAAATTTATTGAAAAATAAGCTTTACCGATATTTAATGACAATATTAATAAAATTATATTCTTTTAAAAAATCGAGCTTGAC
TGTTAAATTCATAAAAATTCATAATCAAGACTTAAAATTATAATCTCTACCTGTTTCGATATTCATATTGAGAAGTGCAACACTTTATTAAAATTTAAAC
TGTTAAAGCTAACCATCACATTTTATTTTAATCAAGATTTGAAATCATAAACTCTACCTGTTTAGATATTTATATTGAGAAGTGTAACATTTCATTTAAA
TTTAAATTGTTAGATCTAGCAATCACACTTTATTTTAATTTGAATATTCAAAAGTTATTCAAACATATGAATATAACGAAAATATACTATTTTTATTTAT
ATAATCTACTCATATATAATATAATAATAAATAAAAATTTGGTGGAAAGTTGAAAGAGTACTACTCCTGAAGGAGAAAACTTTAAACAATGTAGGTACTT
TTTGAAACATATTTGCAGAAAATTCTTTTGACTTTTGTTTCACTGCCATATTCTGAAAATCTCACGAGGAAATTTTGCTACTCGTCAAATGGTAGCTCAA
TATTATTCATATTATTATTATTATTATTATTATCGACAATTCTTGTTCATAAATACTTTACTTTATATACAATAAAGTAGGTAAATATGATAAAAATTCT
TTCTCAAGTGTTTGTCATGTGTGTATAAAGTTGGACTATTCTACAATGGAATTGTTTTATGGTAAAATGAAAATAGGATTAAAATATCTTTAAAGTATTG
AAAATGGTATAAAATTATCATCCATAAGTATATTGGCTCCAAAATGTCCTTCTCATTCATCTATTGGTTCCAAAATATCCTTGTCATCCACTTTTTTTTA
AAAAAATTGACCACTTATTTAATTGTTTTTAAATTAAACTCTTTAAATATTTTTTAAAATATTTGGCGTTCAACTATTGATTATAATTTAATTTATTAAT
ATAATTTATAAACCAACTCATTACCCACTCATTGCTAATTAAACTCCACTCAATTAATAATTCAATTATAATATTAAAATCGCCATAAACACTAAAACAC
GATGAAATTGTAGATTCCTGAAAATGACATTCAAAATTATTCGAGTTCGAATTTAAGCCCCGACTAAATTTAGGTTGAGCCATTTATTTAGGAGGAGACT
TTCAATAGGATTCTCTTTCAAGATTGAATTAGAAATTTATAATTAAAGGTAAAGAAGTAATACATCCCGAAATAATTCATGCATTTTTTTAAAATATAAT
TTTATAAATATTTATGATTTGTTTTAAAACCTTTAATATATTATTTTGAAAAAAAAGTTACCTATGAAGTAATATTACATAATTGAGACGTGAGAATAAT
TAAGATGAACATAGTCAGACTTTAAGTTTATCGATAATTTTTATTTAGACACTTGAATGTATGATAATTTACTACTATAGATATTCACCTCAAATTTTCA
AAAACACTCAATTGGTAGTATTTTTTTCTGTTGTTGCATTATTAATTTGGAGGGGTTTAATTAGTAATGGGTGGGTAGTTGATTGATTTATAAATTATAC
TAATAAGTTAAATTATAACAAATAGTTGAGCGCCACATATTTAAAAAATATTTAAATAGTTTAAATATAAAACCGTTAAATAAGTGATCAATTTTGAACC
AAAAGGTGGATAACAGGGGTATTTTGGACGCAATAGATGGGTGGAAAGAGTATTTTGAAGCCAATAGGTGGATTAACGATAATTTTGTACCATTTCCAAT
GCTTTGAAGGTATTTTAGGCCTTTTAAGATGTTAAAAATACAAGTGAGTTTTTATTTATTATTATATTATTTCAGAACTATTTATATATAATCAAGTAAA
ATACAATGAGATTGGGGTGGGATGAAGGTTAGAGGTTGGTGGTGTTAAGTCGGTGGGGAGGAGACAATGAATTTAAAATATCACTTATTTATAGAACTTG
CTTTTTTTTTACGTCCATTAAGTAAATCATTTCTCTCATTTTCTCAAGCAGCTTATTTCCAAAAGAAAATATTTTAAAAAAAGGTTTTTTCTTCGTAAAA
AAAAGGTTAATTCACTAAATGGTTGAGTTTTTCTTTTCAAAAAAATAATAATTAATTTTTCATGATGTGATATATCATATATTCTCTCTCTATATATATA
ATAAGATTTTTGAACAATTCTATTATTTCAATTTTGTTTCATTGGGTGGGGGGTTGTTTTATTTTAGTAAAGGGAACAAAATGTTGGTGTGGTTTTAATT
TTTTGTGGTTAGAACAATGAGTTATGGTATAACGTGGGGATGCACGTTATATGTTACCAAATGAAGTGGCCTTAAGGACCCCAAAAAATATCCTACAATT
ATGGTTTTAAGGGTGCATTGAAGAACCCTAGAATGGTGCTCTCACATGACCTTTTCACACTCTTTGCATCCACAATCCACATGATGATCTCCTACAACAT
TTAATCTAGTGTGGTACAATAATCGGAATCAATGAGATTACATCACTTTTAATTTAATCAGTAAAAAAATTTTGATTATATATAAAAATACACTATTATA
AGTATCAGAATAAGAAATACGATCAATTCCCACATTAGTATATATATATATATGATGTCTAGGGTTTTACAATAGATTTTTTTTTTTTTGTGGTTATTAC
AGATCCTCTCCTGCTAAACTAATATTTACTATTCAAATACAACAAATTTGTATATGGATCGACCAATCATATTGAAAGCTT