BAC Sequence – LE_HBa0130B18

>C07HBa0130B18.1
AAGCTTTCACACAACTGATCTAGTTCAAAGCAGACTGATCGATTAGATATGTCAAAATTGAAACAATTCCATAATTTAGATCATTAACAAGAAGATATCA
AACTAAAACGGTTAGTGAAATAATTTCAGAATTCAGATCAAAATCACCCTTCGTAACATACTATACATGTAAAGTTTTGTACTAAAATGAATCTGAAAAT
TAGTATCGTAACCTATTTTCATCTCGGGATTACCTTCGTTCCCCATATTATCATAGACAAGTTGAAAATTTCTCGATCAATAGGTCGATCCATTCGGGGA
TCATCTCCTAGCTGTTCCCTAACATCATTGAAATTTTTACAGAGTGCTATGATTTTTTCTTCTAAAGCCTCTCTGGACATTTTCAAATCAGGGAATGAAT
CCTTGACGTAAACGAGTCGATTATTAAATGAGGAAAGTTGAGGAGAATTTCTAATAATGCACTCGTAATCACACATGGCTTTTAAAATCGCCAAATCCAG
ATGATGATCCTCGTCTTCGTCGTGTAATTCAGTAATTGATATTCCTCCTCCATCACTCATTGGTTGTTTTCCTTTTTCAGCAGCTCTTCTTCTTTCTTCT
TCTTCGTCTTCGTCGTCTTCTACTACTACTAACCAAGATGTATGATTTTCATCATATGATTCTTGATTTCCACTTCCATTTTCTTCAGAATTTTGATGAT
TCACATTGTTTCCCGATCCTAAATTCTCCATATCTTCTTCTTCTTCATAATCGTCATTGCGATCTTCATCTGTTTCTCCTAATTGATTCCCTCCAGCTTC
CTCTGTTTCTCTCTGTTCTGAATTTCGATTTCCATTTTGCCCTTCTTCTTCTTCATCAGTACGTCCAATTGCAGGTAACATTTTTTTAAAAATTTTTTGC
AGAGAGAAAAAAATGAGTAGAGATTTTACACTTTCTTTTTTCGAATATGAAGTGATTGAAGAAGATTAAGCTCCGCTATATATATAATAAAATTAATTAT
TGAAAAGATTATCTATTAAATAACGGTTTTTAACTTCCACTTAAAATTAGTGTTTTACTTTTTAAGTTTTCTCAATAACTTAATAGTGTAAATTCATTTT
AGTATGTAATGTGTAAAGCTTGTTAAATAAGAAAACCTTGAAATTTGAGTTGAATCGTATACATCGTTGAACAAATTATATAAGTTGTTGAAGAAATGAA
ATATCAAACATAAGTGGAAAGAAAATCAATTAAACAAAAATAGCATATTCATTTGTTCGTCCAAAGAAAGCTACTTCTTAGAACCTATGGTAAAAACTGG
TACGATTTATTATATCAGTTTGAATGAGGGCCACGTGTCAAAAATGGTTTTGCAAAATCACTGTTAACAAATAATGACATGAATGAGCCTTTTTTTAACG
ATAACGGCATAAATGAGCCAATATTTTAACGGATGACATAAATAAGCCTAGTCTGAAAATTCGAGAGTCTTTTCCCAAATAAATTGTAAAGCTTGTATTC
TTCTTCTATCAATTTCTTCTGCAAAATCATCAAAGTTTTCATCTGATTCTCTTCTTAAATGGAGCAATATGGTGAATGAAGATCCATATAGCTTAGCTTG
GCGTCGTAGTTCTTGTAAAGTCCAAAAATAATTCACATATGAAATTGTATTACATTATCTCTTATATATATAATTAACGAATGAATAGTTGACATAAACA
ATATTATTACGTGAAATTAATGAAGTAAAATGACTATAAATGACATGCATGTATTGACTTTTGTAAAATGACGATCAATGGAGACTAATATTTTTTTTCC
ATAATGGTTTAAATCCCAAACAAAACAAAGAATGTAGTCTTTTGTTTGATGCTTGCGGGCGTATGAGCTTGTTGGTTTAGATTGTCAAGAGCCCTATCGA
CCAAATCAGATAGCAATGCAGTTTGGATATGATCGAGACTTAACCTAAATGGATTCTCATTCGCCTTCAAGCCCAGAACTTAGTCGATCTATTGATTCTG
ATTTGAGGTACTACTATCCGTCTAGGCTGTTTGAACCGGATGTAACTACATCGTGTTTGAAATGTTGGAGAAAACACATAATTAATTTTAGATGATGCAT
TGAAAGGGAAGTGAAGTGAGAATAAGGAGACGACTTTTCCTAGATTTCATACACTAAATTGAGTGATACTTTTCGATTATATTTGTAGGATATATCTTTT
CTAGATTTACCCATAGCAACTAATTCCCTCATTTGAACAAAAAAAAATAACTCATTCCCTTTATTTCACTAACTTCCCTATTTACTCATAAAATCATAGT
TAGTAGTTTTATTTTTTCCTAGCGGAATGACCCTTGTATTTGGCTCCGTTTGTCAGTTAAACCCTTCTATTCATCACTTTACCAACTAAATCCTTAAACC
CATCAGATCACAATATTCTTGTGTTTATATGATGATGATGAGGCTATTCAATCAGAGTGTAAAATGATGCTACCAGAATCTCAAATTCCAATCGAGATGA
CTCTTCTACAAGGAGGTTTCTATTTTATCATTAATAATAGAGATAAAAACCTGATATGTTGTGTTATGTGAATTTTTTTTGCCATCTCTGAAGAATGTTA
AGGGAAGCATATAGATGAATGTATGAACCAGATTTTATACATCCAAAATAAAATAAAGGAACGTGTGTTCCAACTACTGGATAATTAAAAAGGGTCATGG
CAAATATGATTCGAGCGAGAAACTGTTACGCTAGAATATCTAGATATTTCTTAAAGTTAACCACACTAGACTATTGTAGAAACTATACTAGAATAATCTA
TAATATTCCAAAAATCAACTTTATAAAGTATAAGAAAAAATATGAACCTTTTGTCTTTGCAACCAAACATTACATTTATATTTCAACAAATCCAAATACA
TTAAACCCATAAAAGTTTTTTGAACTTTGTTGGTAACAAACAAGAAATGACACAATTAATGGATCAAAATATCTACATTATCTTAAACTGCATCACACTT
TTCGCTATTAGCCATCATAAAATTTCTTCTGATCACCCCATAATTGCATAGACAAGTTAAAATTTACTATATCAAACGGCCTGTCCAGCCTAGGATTGTT
GAGTTCCCAAGCAAATCGACAATGTGAAGCCCAGTTGCAAGTTTTTCAAATCCACAATCTCAAAGATCAAGTATTCTTTTTTGACTAATTTTTAGATGAG
AGTCTTTGATATTTTATTTTAGCTTAATTTTTTGTTCATATATTTGTTTCTAATTATTAATTAGTATATAATTAATTTAACAAACAATTCTGTGTGATGT
TGTAACAAACCATCTACGTTTTCTTTCTTGATAACAACACTGCATAGGACTACTTCCATTCGAACAAAGAATTATCAGCAAAATGGACAAGAAATAATTA
CAAGAACAAAAAGAATGATCCTAGCAACTACTTTTTAAGTACAAGTGATGCACAACCATGCATGTAGCAGATCATCTCTGAAACCGTAGCGTTTGTCAGG
TCTCTGCTCCCCTCAAGTTAGCAACGAGTCAATCTCTTCCGGGTTCTACCATGCCTGGCTTCTAAAATGAAAGAATATTCTATCCCATTTTCTTCGACCA
TAAATGGAACCAATACATGCATGGACAGTGAGGATCCATATACCCGACCCCAACTTGCTTGCTTGTGTTGTTCTACTCAGAAGTCACATCCCTAAGCAAA
ACATAACATGAAAACAAACAAGTTACTCAACATTTTTACTATAGCAGGTGAAATCAAAGGTAAACAAACAAATAAGTAAGAGCTAGGTACCTTGTACTTG
GTGAGAAAAATGTTTTTAAGGACTGTCATCGTCTGAACTAAAATCATCAATTCGCCTGTCTGCAATAGCCGGGAAAAGCTTCTGACGCTGATCAGGTCGT
GCTGAAGGGATGGCTTGATGGGGTAGTGCTGAAGGGATGGCTTGATCAGGTCGTGCTGAAGGGACGGATTGATCAGGTCGCGGTGAAGGGACGGATTGAT
CAGGTCGTGGTGAAGGGATGGATTGATCAGGTCGTGGTGATGGGACGGATTGATCAGGTCGCTGTGAAAGGGTGGATTCTGAAGTTGTAAGAGTTACATT
CTCTCTCCTTGGTGTGCTATTTATCTTTCTTGGAGCATTTTTTACCTCTCTGCATACCTTATCCAAAATAACTAGAAAATCTCTAACGATCACAAATAAT
CGCAAACCTTCATCCCTCTTAGCATTTCCATGGAAATAATCACCTGTGCTCTTAACCAGAGCCATTATTCGCTTTTCTTCCTCAAGTAATGACATGACAT
CACCCTCAGCATTCTGCACAAAGTTCTTCATGGTCTGGTGAAACCCATCTTCCTCATCTACATGCTTCATCTCCGAATTCAGGAACTCACGTGCTTTTAT
AAGTGAATGGCCAAGTTTGGACACTATGCCTGTTAAGTTATCTGCGTCCAGAATTGCAGCTTTCTTCACATTTCCAAGATCGCTACTCAAACCGGAGACA
ACTTGTAAACCGGTATTTCGATACTGATCTTCTTGATCTTGAGGCAAATCCTCGAGTAGATCATCAGACTTGATGCTAGACAAGCTCCGTTGATCCCTAG
CAGCACGAGCAGCTCGTATACCTTCTGAGCGGATTATCTCCTGAACAACAAAATGTAACAATGTAGTTTTCCCGTCTATTCCTTTTACATCTGATAATTT
CAGAAGCGTGTCAAGCTTAAATGCTTGTGCACCACCACGAAAAGTTCCATCGTTCATCCGATTGCCAGTTTTTAAAACAGCCTCAAGGAGCTTGAGAAAC
AGCCTGCTATTCCGTAGTTCTATGCTAGCAGCCTGGACAACAAAAAAGCATGCATGAAACACCAATGTCAAAGGAATTTGGATGCCACAAAAATAGAAGC
TTCTGCCTAGTGCTCATGCATGAAGTCCATTTAGATTAATATCGGAAGCACAAATTCCGGAGTATTTTTTCCAATATGAAAACCACAAACAAGTTAGAAG
ATTTTCACTCTTTACGATCTCACCTCCAAGGTGGCGAATGATTCTTTGATCATTGACGCCTCATCCTGAAGAGTGCACATGAAAAGCAATGTCTCTAGCC
TTTTGAATGCAAATGGAACCTCAACCAAAGCTTTCAGGAACCTCTCTGCCTGCCCAAGCCGAGAAAGTTCCCCATTGTAGACCCTCAGCTTCAGTTCTTC
CTCAGCAGTTGGTGCCATCTTTATCAAAGTTTGAATGAGTTCAGCAGGAAGCTCATTTCCTGAGTAAATTAAACCATTAGTCACGCTTTGGTAGCTGCAA
AGTCTAAGAACACACGACAGCCCATTTTCCAAGAAATATCACTCTAATTAACATACAAGTACATTAACGCTTTACCAATTGAAATAGCAACCATATGTTG
ACAGTATTAGCATTGTGATCAGGTTACCCTAAGCGAAACTGCTACTTCTTATTTATTCTGACATCAAATTTAGAAATGTAACCATTGCAAGGTAAGGCTC
TCAGCAAAAGTCTCGAGAAAAATGTGACATTGCAGATAAATACTGCATACTACAGTAGTGAAGCTGCTCCTAAAGAACATGTACGTGCAGAAAAAGGTTA
AAGGGTGTCTCAAGGACAAATAAAATGCACAAATACATCAGTCTAGATATAGTTTCACATGAATGCATTTCATAACTTTACTTCCGAAGAGAGTCATCAG
AAGTCGAGCATTTCATAGACTTCAGGTGAAAAGGCAATCATACTTCTAGCCAAGTTAATAAAGCAAAGAGCACTTATGTGGGGAAAACAAGAGAGAAGCC
AAACTCAACCAATACTAGCACTCCTTCCTTCAGAAGTAACTTACCTACGTTCGAGTAAGTTCCCTCCTTGATGATATAATTGTTAAATTTGACAAGATCC
AAAAATGGATTAATGAGAAGATATGGTAGTTAGGAGGATAATTCTTCATTGGTAGAGATAGCACCTTGTGTAGGTGAAATTTAGGTGAACCATAAATTGA
TTTCACAAGGTAAATCTTGACATTTTGACATATTGTGATGTCATGGATGACATCGATAGGAAGAATTCACTCTTATAAATAGGTAGCTCCTAATTCATTT
GTAATACACCTCTCACTTGCCTTCTCATCTCCTAAGGCATTTGTTCTTCTTTCTCTCTTGTAGTACTTCACTTGTACTCTTTTGGAGTGAAATAAATATT
GGTTGGTTGTGTCCGAGTACTAGGCAAAAGAAAACAAAAGTTAGCCGAACCTTGTTAATTCCTGGCGTTCTTTTTATTGTTGTCTCATTTACTAGTTATT
AGCTACATTTAGATATAGCAGTTGTGATTCCATCACTCTCTATATATTTGGCTTCCGCAACAATAATCTAATAAACTAAGACAAGTTACATTCTAAACTA
CTAATGAGAAAATGTTTCAACTATTTCAGTTTCACATTTGATACACTTTCATATCAATTATTAATGTGATGATTTCATTTAGAATATTTTTTCCAGTTAT
CTCTGCAGTAGTGAATTAAGACATTCTAGTTTAAGAGGCAGTATAACAGAGCATAAACTAATGTAATAAGGAAGCATGATCCACTTTAATCAGGCATCTG
GAACAACTTCCAAGACCAATTTCAGAACGGACAAATAGAATACAAAAACAAGTAAATCTTTAAAGATCAACATGAAGCAGCGGTCGATACAAGATTTACC
CTCAATAGGTTCAGAGTGGGTGCGGTCTATATACCTGGTTGTTTCTGCACCTACTGCCGAGAGCTAAGATTGGCTCGTGGAATGAAGGTGTAAATAGTTC
ACCACAGAAGCATAGAGTACAGCTACAACTAAATCTTTTAGGACATTCAAAAAATTTCAACGATTGGCAGGAAGGAGATGGAAAATTGACAACCAGTAAA
GCACAATTATTTCCTTGAATAACAAGATAACCAGCAAGAACAACAACAGAAATATTGCCCAAAAACTTAAAACACTTGAAAGGTGAATGTGCAGATGATC
ACCTTCTTTCAGTGCATCACAAACTTCTTCAGTTGTAACGTTCAACGCTTTAAGAAGAATAGACAAATTTTGGGCCTTCTTCTGGTCAATGATTTGAATA
TATAGATTGGAAGGATCTTGGGAGGAGTCTTTCTTTGACCCATTCTTCTTTTTTTCAGCAGAGGCAAATCCAAATAGAGTCTCTATCTGCTCTTCATCGA
ACCTGTCAAAGGATATTCAGTGTCTATTGAACTCCTTCCTAAATTAAAATGATTTAAAGCTGCATAAAGCAAGAAATGATGGACTTACTGGAAAGATCCT
GCCTTGACCTGATGCCAAACCATTGATTGGTCAGTGTTGGCTTGAACCTTATCCCAGAAGAAAGGCTTAAGCTTAGTTTTGGGATCAGTATCATCTCCCT
CAGCTGAAGCACTTGCGGATGCATTTGGTCCAAGAGGTGATGTTCGAGGTGGCTTCAAGCCCATGGAAGGTGGCCGAGGTGGTGCTCGAGGACCAGACTT
CATAGGTGGTGGTGGAGGAGGGCCAGCTTTAGGAGGACTTGGGCCAACAGATGAAGGCTTTCCTGGTGGTGGAGGTGGTGCAGCAGGTGCAGGAGTTGTT
GGCTTTGCAGGAGGCGGAGGTGCAGGTGGGGAAGGGGCTTCAGAATGAACCGCCCTACCAGGGGGAGGTTTCAGTGGAGGCATTCCAGCTGGTCCCGTCC
TTCGAATCTCAATTTTAGAATCATCATTGGGATTGTTATTGAATGAATGATTTCCAGCATTAGTGAATGAATGATTTCCAGCATTATTGAATGAAGATCC
TAAAGCAGATGACTTATGTGATGAATAGTCACTCGAGCTTAAGCTAAGAAGAGGTCTCTCATCATTCAAACCCTTTTTGGATCTCCTACAGCACTTACAA
CAACAGCATATGCATAGAAGTGCTATGAGAAGGGATATTGCGGCAGCAGCGGCTATAATTGGAACTCCAACCGTGTTTGCTTTCTTACTGTCTTTAGCTG
AGGATTTCTTTTTTGAGTCTTGTGATTTAGCTGGCTTTGACTTAGGAGAGGCAGGAGGAGGATTAGGTGCTGCTTTCAATATGCGTCGTTTAGGAGCTCT
GTGCAAGGAGGAGAGAAACTCTACACACCTGGCATACCAATTTGGCGAGCCCTTCTCCTCTCCACATATAAGAAACAAGAGATTTTTTTCCCTCAAACAA
CCTAGAAGAGCTTGCTTAACCAGCGGATGCAAGTCACCGTTAGGCTCATGTTTTTCTGAGCTACTTTTTAGGAGGACTTTGTCTCTCACACTTAAAACTT
CCTCCGCGACATAATACTCGAGATCTTCAACTGGTTTATTAGCTCGTGTTAACTCTATCCTACAGTTCAACCACAATAGCTCAGCCTGCAAGAGAAGATT
TTATCAAACTTTCTCATAAATGCTCATTCTCAAACAAGTTCATATCAAATTAGTATTAACATCTCACAATAAATAATTTTACGAGAGTCACAGTGGAGTT
CAGACTAGATGCAAGCCGTGAAAAAACGTAATTGAAAAGGCTAGAGTGATATGGAACTGTTCAGACTTCAGGCTCATCTAAAAGATTAAGTTGTTAGAGA
GACCGCACTTTTACTATTTGATTATATTTTCAACATGCCTCTCATGTGCGGGCCTGATTTTTTTTTCATGGGCCAAGCACGTGGAAATTCTTTTTGATTT
CAATCTCAGTACCTTCAATACCTTTGCCTACTCTAATATCATGTTGAAGTGTGTGACCATCTTATCCAACAGTTTAAGCGCACACTTTTATTATTTGATT
ATATTTTCAACATTTACTTGGGGTTCTCTTTCTCAATTATAAATCATAGGGTGGACATGAATTATTTATCGTTATGGCACTTTGCGCTAAATGTTTCTGC
TTTGGTATTGAAGTTATCAATTAGTGCGTAAATATTCAGGCCCAAAAGAACAGCACAAACGACACTTGGTCTATCCAGAAACAAGATCAAGCAATAGGTT
GTTCAAGCACCAACAAAGAGTTGTTTCTCTGATTAATCGACACTAACTCCACAACAGCATAAAATCATTCCACAACAAAAGAAACTGATCATATGGCGAT
TAGGAAACATATACTTCCCTTTATCACAAACCCCTACAACTACATATTCGCAAGTAATGTTCAATTAAGTAACTCAAAATTCTTCAAACAAACATTTGAA
AAAGAATATCGAAAAGTGTGGTACCATGTCCCTATTAATCTGAGGAGAGTTGATGAGATCTGAGTCCTTCTTGCTTCCAAGTACTGCTACCAAAAGCATA
AAGAAGAACACAAAGAAATGAACTACTACTCCTCTCACACCCATTTGCCCTTGAATCAGCATCAAAGAAGTAGAAAATCTTTTTCATTACATAAACCCCA
CAAACCCCCTTTATGCCTCAAATCCACAAAGGGCACAAAAAAACATCAAAAAAAAATTCTGCATTTAACCTTCCAACTCTTCAAAAAAAACCAAAATTTC
CACTTCCAAATGCCTTACTTACAACAAATCTTTCAAACCCACCTCCAAATTCATGCAAAAAAACTTAGTTACAGTAACATCAAACACCATAAATCGAAAA
AAAGAAAAAAGAAACTCTTTTTTCCGCAATAATCGAATAAAAAACTAGATAAATCAAACCCACCTCCCAAAATATTGTAAAATCAATGAATCACAATCTA
CAATGTCATTCAAAAATCAAAACCTAGGCCCCGCACCCAGAAAAAATCAAAAATCAGTTGAGGTTTTTGTATGCAACGAGATCGAGCAAAAAAAAAATGC
TCAAATACAAATAATCATACAAGGATTGGGTGCGGGTCAAGGAGGGGCATGAAATTGACCCGAAATAATTTCTTTTGAGCAGAAAAGTGAATTTGTGTGT
ATATGGATAACTAGCAAAATCTACCAATCGTTTCTGGCATTTTTGTTGCTCTCTGTAATTCTACATAATTTTTGTTTAATCCATTTCTTTGAATTTTCCA
TACAATAGAAACCGAAAATGGCGCTCAAGAGATGCATGCATGGCATCTCAACGCTGGTTCATTTTTATTTCATCTCATCATTATGTTATACGATATTTTA
TTGGCGTCTTATATGCATTATGTCACCTAAAATATATATATTTACTTATTCAAATTTTAAATTTAAGGATCGTTTGAATTAAGTGTATTAAAAATATAAT
GCATATATTATAATACTTTGTTTGATATTCTTTTCCTATGTATAACTATTGATATGTTGTATTGTGTATTACTAATTATACAGATTTTTAGGTAAGTAAT
GTAGTGGTTCGAATTAAGGGTGCAAAATCAATTCAATCGGTTCAACCTGTCCAACTCATTTAAGTTTGGACAAATTATTGACTTCTCTAGTTATTAGCTC
ACCTCAATCGATTAAAAATTAAGTTGATATGTAATTTTAATTGGGCCATGAGAAATCTCGTTAACTTTTTTTAAAAAAAAAAAAACTTGATATGATATAT
AGATATAATAGCGTAAAATAAGAATTTTATTAGGTGCTAATTACTAAATATTATAAAGAACAAATACAATAATTAAGTTTTGTAGCAATTAGTTTGGTTT
GGGTTAGGTCGGGTCCCATTAAATAACTCATTTCCTAACTCATTTTGACCCAATATGTTTTGACTCGAGCAAATTTGGGTTGGGTTGGATCTTGACTCAA
TCGTTGTCTAAATCCATTATGACCCACCATAATTTGAGTTATCTCGCCCAATTGACACCCCTAATTTTGATGCGGGCATTAGCATAGTTAAAACTCAATT
GCCCCTCAACTTTTTTTTACATCTTTTGCCCTTTAATGGGGAGGGTGTTGTTGTAATTATTTTATTTTTTTGTGCAGCGAATGCTATTTTTAATGCACCA
AATCAAATAAATGCATAAAAATAATCTATATATAATTTTACATGCATTACTAATACACTCTATTTACTATTATTCTTATATACACTACCAAACGATTCAA
GTGTTTATTTGTGCATATTAAAAATTTGACGGTAAAAATATTACTTCATCCATTTCAAATTGATTCAATTGTTGAGACATTTTATTTTTCAAATTAACTT
AATTATTCAATTTTCAAGACTAATTTTAGAATGTTTGTCCAATTTAACCCTTCATTAGTTAATATCGAAATTAGTTACTTAATTAATGTTTAGTTATTTT
AATCATAAATTTTGACACTAATTAATAAGGGTAAAAATAGAAAGTTATGCACATTTATGTCATAATCTTATTTTCTTAAAGGATGTGAAATACTTCAACA
ATTCAATCAATTCAAAACGAAAGAAATAATAACGAGAATCGCTAAGTTAAAGAAGCATATTTATATTTATGTATCTCACTAAAATAACATATACCTAAGG
TTTTTATTACTCAATTGTGACACATTGGCCAAATCCACATCCACACAAACATGATAGATGTGTTTTGGTATACAAAAAAAACAAGTCGTAAATTTCTTCA
ACTCTACTACGATGAGTGGATCAATATATTGATTTTTCTTTTACTTTAAACAATATTAAATATTATTAAAAAATTAAATTTTTTAATAATACTATTATGC
AAGTTAAAATTATTTAATGTATTTTAAGAATATTACACATATATAAGTAAAATGTTTGAAGTAACAAAACACATGAAAGATATCATAAATATAAGAAAAG
AAGTCGTATCGGCTTTGGCCAAAACGAATAATATTATCACTAAGATTTAAGATAATTGTGTTGTTACATTAGGTTAATTTATTTGAAAATTAAGAGTAGT
TTATAAAAGTGTTTTTATTTTTATTTTTTTTGACTTTAGTGGATATGCAGAAATAATGCCATTTGGTAAAAGCAATTGGATTCCACAAATGAAAGAAATA
TCAAAAAAAAAAAAAAAAAAAAAGAAAGAAACAATTGGTGACACTAATCATCATTAATAGCAGATAATGCACTTTTAAGTATTCCTTTCACACACCTCTT
CATTACTAGAATTACATTTTATCAAAATAATATATGAAATTATCTATTATCATATAGAATGCGTGGTTATAATTCTAAAGATAAACTTATTTTGAATTAA
ACTAATGTCTTATATGACTATTGGTTATCGTAAGTATTTGTATCAGAATTTTCACTAAAAATTTAAAATACGAAAGATAGTTGGTTGCGGTAAAATGAGG
AAGAACCCCAAAGAATTCAACGGTATAATTTTCCACTCTAAACCCCTCCGATCCTACCTGACTCCGGCCTAACTCTCAATTCAACGACAACCGTCGATTT
GTTTTTGGTGTTCCACAAGTAATTTCTCATACTTTTTTCTAGGGAAAAAATCTAGAAAAGAAATATATTCTCTTATCTTTACAGCACATTTTTTCAAATA
TTCCATAAGAATTTGTTCTCTTTCTTTGATTATTTGTACCACTAGAATTAGTATAAGAGAAATTCATGTCACAAATTCTCATCCACCATTTTTTTCATCT
TTGAAATTTAATTCAATGAGCAAACAACTTGAAGTTCAATTTGAAGAATCAAACCCAAAAAAATGGTGTGTTCCATTAAAAGAAGATGTTTTTGTGAAAT
TCATGAACAAAGGGAATTTTATAACACATAAAGCTTTGTGTGAAGGTTCATTTTTTAGTCCACTTTTGTTTGGCAAATTTTTTGATCCTTCTGATGCATT
TCCACTATGGGAATTTGATTCAGATGTGTTATTATCCAATGCAAAAAGTTCCAATAATAATCATTACAAAGTTGATTGGATTCAAACTGAGACAGATTAT
GTGTTGAAAACAGAAATTCCAGGTGAGTAAAGAGATTTACTTATTTACTTGAGTTTGTGTTCGTTTTTTTAGGTCAAACTCATAAACAGATTTCTTGTTA
GGTTTTTTTTCTTTAGATATTTTACCTACGCCATTTTTCTATTGAATCATAAACTACTCATATTTTATTCCTTTAAAACACTGCTAACTGATTTTGATTA
TTTTTCCTATTGTAAATGTATTCAACTGTGTTTGTATTGTAATAATTTTGATTGAAGAAATGAAGACAAATTGTTTGTTAGTCTCATTTGTTTTCTAATG
TGTTCAAATGATTTCGAGTAAATACAATTATTCTCGAACAATTTCACTATCAATTGGTCTAATGAGTTCTAGAACAACATATGCATATCTACCAATACCC
CTAACAAAATCTGATCCACATCGATCAACGGTGTTTAAAAGGAACAAAATTATGGGTGATTCAATAATTTAATAGGAAAATAGCCTAGTTAAAGTATTTG
AGAAAAAACCCAACAAGTTTATAAATTTGTTTATATACTTGGCCTTTTTTTTAATGTACGAACGAATTTAAAATTTAAATTTTATAAATTCTGAATTTTA
TGAGCCCCGACTTTACTTGAATGTCATTTAGTGGAACAATAGCGTTAAAATTTTAAAAAATCCTATATCTGACAATATTTTTAAAAAGATCAATATTAAT
ACAAGTAAAACTTATATAGGGTGCTTCTAGTAGTTAGCACCCTACATACTAGAGATGTAGGCTGTTGAATTGCCCATTTGGTAGTTCTTTTGGCGGGCCA
TAAGCAGCGGTAGAGCTTCGGGTAGGATTGGTTCAGATTTTCATTCATTTGATGAATTTAAATGTATTTAACTGAATTCATTACTCTCAGCTATATAAAA
ATAAAGATAAAAAATATATACTCTTATTATAAATTTACGTTCATTCAATTGAACCCTTTTTTTACACGTAGATCCGCCCCTGATTTTGCAATATTAACTC
GATTAACATTATTGACATTTGTTGCAACAGGTGTTGGTAAAGGTATCATTTGTGTCTCCGTTGAGGATGGAAAAGTTTTAGAGGTAAGTGGGCAATTTAG
GCTGAAAGTCGAGACGGGGACGAAGGACTGGAGAGTGGGGAACTGGTGGGAACACGGCTGTGTTCGGAGGATCGAGCTGCCTGAAAATGCAGACTGGAAG
AAAACAGAGGCACTAATGAGCAATGGTGATCACAAATTCTTAGAAGTTAAAATTCCAAAGATACCACCAAATATTTGTGATGTACCTTGAGGAAATCAAT
TATGAAAGGGGCAAATAAAGATGTATAAAATGTAATTTATATTTTTGATGAATGATTAATGTTAGGAGTATTAAGATATGGAGAAATATATATGATCAAC
AAAAGAAACTAAACAATGAAATAATGAAATGTATCAATTGGGAAGATTATAGGAACATGCTTGACATATTAATGTGCAGGATTAATTAGTATTTCTCAAA
TTTTTGCTCTCAAAAACATTACTGTTACGGATATTTAATATGGAAAAATTACTTGAAATGAATGTCTTTAATAAATAATTATTATTTTTAGCGATATTTT
TTATTTATTACTATTTATAGTAATATTACGTTAAATCTGTAATATGTGTAAATTAAGTATGCAATATATATATATATATTATGCTTGTTTGGTAAAAAAT
TGACACATTGTGTTATAACTTATAAGTGTATTAAAATATGTGAATAATAAATTATTTTTTGAATTAATAAATTGTGTTATAACTTATTATCTATTAATAA
AACTTGTATTTTATGTGAATAATAAACTATTTTTTGTAATATGAATTAAAAGTGAAAAAGTGAAAAAAAGTTATTATAATAAATGGTAAATATTTTTTAT
TTATAATATACTTATGTAAGTTTGCCGTAACTGACCCAACATAATATTTTAAGGAAAAATTACGCAGATAAGTAAACTTATACTATTTAATTACTCATCA
TAGCTATAGTTTGTAATTACCACTCGCGACTAATATTATACATTAATTACGTGAGTTGACTTCGAGTTTGTATAATAAGTCATGTTTGTATATGTATAAT
TCGCCAATATATACAAATAAATATGTATAATATACAATTTTTAGCATATATACATATACAATTCATCTCTCTCCCACTCTATGCGCTCTCTTGCTCGCCT
CTCTCCTCCCTCTCTGAATCTCGCTCGCCTCTCTTCTCCCTCTCCAATCTCGCTTGCCATTTATACAAATGTATATGTATAATATACAGTTTTATACAAT
TATATACATATACAATTCACCTCTCTTCCACTCTCTACCCTCTTTCGCTCGCCTCTCTCCTCTCTATCTCGCTCGCCCTCTCCTCTCTATCCATTGTCGC
TCGCCTCTCTCCTCCCTCTCCCAATCTCTCTTGCCATATATACAATTACATATGTATAATATACGATTATCTAACCAATATACATATACAATTTACCTTT
CTCCCACTTTTTCCCCCTCTCTCTCGCCTCTCTCATCTCTCTCAGTCTCGCTCGTCTCTCCTCCATATAACATGTAGCTACAAACTGTAATTATCAAACT
ATAGCTATAAAGAATAATTAAGTATTTTTAAGTGGTTATATATGAAAGTTTCCATATTTTTAATGCTTAATTATGATAACAACTTGTTATTTGTTTCTCT
GAGTGAATTTAATTTTAATTTCTCCCTAACACCAACTAAAGTTTGTTGATAGAGCTATATTCACAACTTTTGTTAATAAAAAATAATTGAGTTATTGACA
ACAGAAATGGTAAAAGAGATAGCTTATGGGACTAGTAAAATTAGGTAATCGATCAAGTAATTTACGTGCATAATAAAAGAGTATCAATACATATTTATTC
ACTCTGAAGAATGTCAAGACAGGAATCCATAACCTAATTTGCTTTGATTCTCCGACTGTGGACAAGCATCGATATATAAAGGTACTTGCAGATACTGTTC
ATACATGGGGATGTAGCTCAGATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTACGGGGATCGATACCCCGCATCTCCACTTTTTTTCGTATATTTATAA
TATAATTGTGATACTTAAATTTTTTTAACTTTAATTTAAAAAAAAAAACTAGATAAACTTTTTATTTTTTATATATGCTTAGCTATACTAATATATTTCT
TATAATGTCGAATAATCAAGAAAAGATTTAATAAAAATGATAAAAACATGCTCATGTTCATTCATAACAATAAAAAACTTATTTTACATTTGATATTTAT
ACCAAATCAGTAAATATAAGACATGAATTTGTAGTTTCAATATAGAATTTTAGTACTTAACCATGGTTCATTAATATGCATCCTTTCACGTCATGTCATC
AAATCGTATAACTATAATAACTTTATATGATTTCGTATAAATATCAGACGCAAGACAGTTTTTGATTGTTATGATCAATACAAACATTGCACACCCAAAT
TGGTAAATTTCCTAATCTACCTTCCCAACTTTTTATTCATTATTAGAAGTTACTTTTCTAACGCAAATATTTAATCAAAGGGTTAAACTAGAAGAGAAGA
AAGATATAATTAAGCAATGATTTCATTCTTTAATTAATCAATCCACACGAAATTTTCTTTATTTATGCCTTAATTTTCTGGAAACATAGTTTATAAATCT
TAACTTCAAAATTTTCCTTTCAATATTTTAAATAGTTGGTCAAAAACAACCTCATAAAATTGGTAGTTTCTTGTCAAGTCTCACAATTACAAAGCATAAA
GATTTGTAAAACTGAGAATTTAAATGCAACGACCAAACGTACCAAAGTCATAAAAAATTCAAGGCTACCTAGTGAATTTTCAACTACTCCTATCGAAATA
CTCGCGTACGAATGATAAAATTAGCTTATGAAAATATGACTTATCCAAATTTACGTGATATATTTATAGTTTATTTTTTAATTTTAAATTGTAAAACTCT
CCAACTTCATAACTTTAAATTAGAGCGGTATATACAAAGTTAGTGATCGAAAAATTTCGATTTACGATCTAAATAAATCAAACTTTTGATCGAACTATGT
CCTTTGATGTGCTCTTGTTTAACTACTTTACTATGCCTATTTATGATCAAATTAAAATTCGTGTCGAAAATAGATAACTTATAATTTAATAATTTTTTTA
ATGATATTGTTTGATAATTATAATTTTATATATACCTCATTTAATTTCACGTAACTCTGTTCATCGATGCTAAAAGAAAGTAGTGATTTCTTGCAGGCCA
CCAACTTTAATTTGGACGTTGCTTCTATGTCTTATTCAGTTTCTTTTCTCGTCAATTAATTAGTTGAGAAGATATTATTTTCAAGTCAATGGTCTCATTC
TCCAACAAATAATTCATCTACAACTTAATAAATTTTAATATTTGCCATTTGGCCTTCACAAAAAATAATACAAAGAGTCGATGCATCGAAAAAATTTCTT
CTCTACTTCCCTTTAATAATTATAAATTAAAAATAGCCATAAAGATTTGAGAAAATAGAAGTAATTATAATTTTTAAACGATATCACAAGAAATCAAGGA
TAAGAATAGTCTGACTCAAACTTATGTATACTTCGATTAATTGATTTCATAATACACTTGTCACCTCTTTCGGAAAATAAATATCACATGTACTAGATAA
TATTGTCCAACTATGACTAGAACGGAAGTAAAATTCTTTGCTCTCGTCTATAATTTTCTTTTTCTTTTGCTATAATTTGAACTTGCATATATTAGACCTC
ACGATTCTCAACTCGTCATTTTATTATTTAGTTTCTTGACTTGAAAGAGACCTTTTTAATTGGAAAGCAAGTGTGAAATGACAGTACATGCAAAACCTTG
CCAATATATGTTAGGAACTACAGTATTATATACTGTTACATTAGCTTGAAAGGATTGTCATCTATATTTGCCAAAAAAGCCACAATATATGGAGTAGTTA
TAGTATCATAACAACTATTTGTCCTATCGTGACGAGTGATAAATATTCCTTCAACTTTAATCAATATGATCTCAAATTTAAGTCATGGTCATAAGCGTGA
AGTTGATAATTAAAGAGTTGATGTTTATCAGCTTTCAATAAAATTTTCTGACATAAATCTAAATTAATCGAGATTCGATCTGTATATATACTTTATATAT
ATTTTTGCCAAAGCCATAATATATGGAGAAGTAATTATAGTATCACAACAACTATATATTACGCTTTCAAGTTCCATATATGATATTTATCCTAATGAGG
CAACTACATAAATTTAATATTGCCTGCTCAAGAAGCAATGAAAAATTTATTAATATAAGCCTACTATATATATCTATACATAAAACAAAATTTATTTCCC
ACTTCATATATTATTTATTTGTTAACTACCTAGTCTACACTCAAAAGCCTATATATACAAACAAAACAAATCATGAACATTCTATTTCTTTAATTAATAA
GATATATGGCTACATATATATATACACAACACATTAAAGAAATACTTAATAGTATAAGATTTCGTGCGAGTCAATCTAAGCTAAATATTTTACCCAAATA
GCCCCAACGATTCGATGAATTAAATTGTTTGGTTTAAATTAAAATAGGTTGATTTGATAAATAAACAGATTAATAACTCAAATAAATTTGATCAATCATA
TTTTCTTGGATTAATTTTATCACTCCTCTATCAATAACATCATTTCCGGGTAGAATTAATTAGTACTATATTTTGACGAACTAATTTAAGAGTAGTAGTG
AAATTGTAAGTACTTATTCATCCTAAATCAGATGTCTTGAGTTTGAGTCCCGATCTAGATACAATATCGTCTTTTTTAAAAAGCATTTTACCCAATATTG
AAAATTTTACGGTGTGTAAATTCAGATTTAGTCAGACTCCGATATAAATTTTGAAAACTAAGAAAACCAACTTTTTTTTTTTTTAAAAAAAAAAAACTAT
TTCGACTCCCCTACCCCAAGAAAAAAAAGGATAAATTATAAGGTGGATGAAATGGTGACACCTAAAAAAGGCAAGAAGTTAACATCACACCTTTGAAAAA
AGGTCCCTCGTGGTTGTGCTCTTTTAATCTTAGGTGACAACTAGAAATAATATGTGATAAAAACTTTAAATTATTAAAAAGCCTATGTACATGACAGTCT
TTTACACATTTTTTGTCATGTTAACTAAACACGTTAGGCATAAATCAAAGTGTTTTAGAGATATTTTTTTAATAGTAAAAGACTATCTAATTGTGAAAAT
AACACATGAATATGTTAGGCTAATGAAGAAGATTAAGGAAAAGGTGTGTTGAAAAGGACTATAAGGATTAGTACAAAACACCAATAAGTGAAAAGATATA
TTACCAATGCTACTCTTCATAGCTATTATTGGCATATTGAGAGCACTATAAAAACATTATATTATAATTTTTATCTAATGAGGGAAAAAGTTAAAAAGGT
TAGAATAGTATTCTTGGCACACATAAGACGCAAGATAAGGCAAAAGATCAATTCCATTTGTTTTGCAACTCAAGTTACCTAAGCATATGTACCTTATATA
TTTTCTTAAAATTATTCAAATGTATGTTAAAGTCAAAATATACGAGCTTATAAATAACAGATTCTTTGATTCTAAATAATTCAAATCGATATATCTGATA
ATTTCATTAAAAAAATTATAGACGAAATGAGCTTGAAAAGATATTATTCACTCTACTTAATTATCATATCTTTGGATAAGTATTAGTTTATATTTACTAA
GGATGCACAATTTTAAAATGATAAAAATAAAGAAAAAAAATTCTATAGTAATTATTGAAATATTTTAGAAAAGTCAATTAAAAGCTATACCAACGATTTC
TAAGCGCCATATGGAGCCTCGTTGGAGGACCCCAATATTTAAATCCTCGACCGGCAAAATGTAAATGGAAGAAAATATAACTCCGAATAACCTACGTGAT
AATATTTGATTAAATATATCGTTATATATATATATATATATATATATTTTATAAATTTGTGATTTTATATGTATTCTTGGAATCTTTACTACTATAATAA
AAGCATTTATATTAAATAGAGACAAATATATCATTTATATTAAATCTTAATACTTTGATGCAAAGGTAAACTTACGTTAAAAAATTAACTAAAATAGCAA
TAATAATAATCACTAACTAAAAACATTTCTTTTGCATTATGAATCAATGAAAAATTTATATTATAGAATATGATTTTCCACATTTACTACCGAACTAGCT
TACTATGTAAATACACGTGGAAACATATTCCACTGAAATAGTGAAAAACAGAATCAATCCAATCAAATAATCGTGGGAATAGACACTAAAGATATTTTAA
TAAAATAATAATGAATTCCAAGTAGCGAATTGTTTAATATTATGAAACAATAAATTTAACAATACAATACATTCAAAGCTTAAGTCGTGAAACCACTTTT
GCCAACAAAGAATATATTAAGAAAATTTACAACTACAAAAATAACATAACAACAAATTAATATAATATACAACGATACAACAATGTCAAATATGTATGCA
TACATTATCTCTCGATTATTCGAATAACCACTAACTCAAGAATAAACGTAAAGTTAAATGATTTAAAAAATCAAAATACATTAATTTTCTATTGTATCAA
AAAATTAAGAAAATAGTGTCAAATGAAATCGAAAATAAAATTTAGGTAAAAAAAAAAAGTACATAATATAAGTGCAAGTAATGATAAAGTATTAAATTGG
ACCGTTAGGGGTACAATCGGTAGTCAATATTTCAACGAATCGAAAAAGGCCCTAGCGCCTGCTTCCATTTCAAAAAAATTCAAAATTCTTCAAAACGACT
TCGTTTTTTACCCAAACTTCCGTCGATTCAGACAAATCAAAACCAAATTACCAATTAGGGTTGCAGAGTGTGTGTGAGAGAGAAGACAGTAGAAGATAAT
TAATCTTTTTTTTTTGTTCTCAAATTCATCAGTGTGGGTTTCTCAGTTTACTGCAATTCAAAGCAACGGTAGTGAAGTATTTGGGGGATATAGCTTCGAT
TACAATCCACGGACCCACTACTTCAAAGTTCAAAAATCCCCAAATCAAATCGTTGATTTTAACTTCTTTGTCTTTTCTCTCTCTTCTTTATCATTTCATA
ATTACGAATCTTTTTTCAGAATGGCTCCTCCCAGGAACCAGAACAGAGCGCCTCTTCCTTCAAGTCCTTCCAATGTAAGCAATCATTTCTTATGTATGTG
AAGTTTTGTGTTTGTTTGGTTTATTTATGGAAGATTGAAGAACCCCATGTTTTGAATTTGGGTTTTATTTTGTGGGTGTTTTTGAATTTTTGTGTTTTCG
GGTTTTTTTATTGATTGAAGAACCCCATGTTTTGTTCTTGGTGTTTAAAGTTGTGGTGTTTTTTGAATTTTTGTTTTTTTGGTCTTATTTTGATTAATTG
AAGAATCCCATGTTTTGTTTTTGGGTTTTGATTTGTGGGTGTTTCTTAAGTTTGATTTTTGGGAGTTTTTGAATTTTTGGGTTTTGCAGAGTAAGTATGC
GACAGATGACATAACAGTAGAGAAGAAGAGGAAAATTGCGAATCCGAGAATGCCGACTGCAGCTACTGGTGGTAGACCAATTAGGCAAGCATTTGCAGTG
GTGAATGCGGCTCCAGATCTGGCTCCAGCCAGTGGACCACCGAGTACTGCTGGTTCAGATGGCCCTGTCTTTGAGTTTACAAAAGAGGATGTTGAAGCTT
TACTCGGGGAGAAATTGAAAACTAAGAACAAGTTTAACACTAAGGTGAGATGTTGAATTGATTCTTCTGGTTAATTTACCATTACTTGCTAGGTTGTAGA
AATGTTAATTTGATTTATATTGTTCCTATCAGGAAAAATGTGATCTCATGTCAGAATACATAAGAAGACTTAAGCTTTGCATTAAGTGGTTCCAGCAGCT
TGAAGAAAACAATGTCACACAACAGGCATCACTTAAAAGCTTGTTAGAGTCAGCAGAAAAGAAGTGCAACGAAATGGGTATGAATGTGTTCCTCTTGTAC
AAATTAGTGCTGTCCAATGAATAACAGACTTATTTTAGCTCTTTTGCATTTTTTTTAGAGGTGCTAATGAAAGCCAAAGAGGAAGAGTTGAACTCAATCA
TAATGGAGTTAAGGAAAACTATTGAAGCTCTGCAAGAAAAGTGTGCAAAAGAGGAGTCAGCCAAATTGGTAGGAGGCTGGGCAAAGATCATGTTTCATAA
ATTTGGGATTTTTGTTGGAGCTTTCGCTGTGGCAAATAATAGCTTTGTCTCTGAATTATTTGACATTTTGATCAGGAAGCGATGGATTCTTTTAGTAGAG
AGAAAGAAGCTAGAGATGCAGCAGAGAAACTGCAAGCTTCAGTTTCTGAAGAGCTCAAGAGATCTCAACAGGACAATTCAAGTGCAAATCAGAAGGTAAG
GAGATGTACAAGGTATTGTTTTGGTTTGATTATAGTAGTGAATTGCTTGGTTGGATTTACGTCTTGCTTATATCTGCAGATTCAATCACTAAATGAAATG
TACAAGCGGTTACAGGAGTACAATACAAGTTTACAGCAGTACAACAGTAAGCTCCAGTCCGAACTTGCTTCAACAAATGAAACATTAAAGCGAGTGGAGA
AGGAGAAAGCTGCTGTTTTTGAAAATCTCAGCACTCTCAGAGGTCACTATACTTCTTTGCAGGAACAGCTCTCTTCTTCTAGAGTAAGTTTCAGATTTTC
ATGTTGGTTCCTTGTCTCCTGTTGTTAGCATCGATGCAGCGTATTTGTTTCCATCTCCACTATTTGAATACTTATATGTAGCATCTGGTCAAGTTAACTT
AAACTCTGCTGCAATGCAAATGTCTGCTTCATTTTAGGAATTAAAGAACTGCTTTTTCTTACTTTTGAAGCTCTCAGTTGCTAATTTGACGGCATTATGG
CACTATTCAGAATTCTAGATAACATTTATGATTCTTGGGGTTTTCTTGGTATGGTGTTTTTCTCCAAAGTAGCATCTGCTTGGTCTGTTGATGTCTCTAA
GTATCTAATTTTATCATGGATTATTCTAAATATCTGGACTGGTAGGTTGTATAAGCTCTGAAGAATGGCTCTTGTGTTTGTCATCTATTGATTCATATTC
TTATTCTTCCTTCTTGCTTAAAAAGGCTGTTCAAGATGAGGCTGTCAAACAAAAAGAAACTTTAGCAAGTGAAGTTGGATGTTTGCGGGGAGATTTACAA
AAGATGAGGGATGATCGTGATCAACAGTTGTGTCAAGTCCAGGCTCTAAGTGCTGAATTACTTAAATATAAGGAATGTAATGGGAAATCTGTTGCTGAGT
TAGAGAACATGACAGTAAGGGCAAACGAGCTGGAGGTCCGTCTTGTTTTATTTGTTTGTCTTAACTTACAAAGCAATATATATTTGTAGTAAACATCCTT
CTTTCCTGGTTTTTTCATCAGGCAAGTTGTCTGTCTCAATCTGAACAAATTAACAGATTGCAAGAAAAACTTACTTTTGCGGAGAAGAGATTAGAGGTGC
GTTACAATATGGCTCGAAAACACACTTTTGCTGTGTATATTGAGATTCATATACCTCATAAGTGTAATATTTCTCTTAAATATTTTACCGCTTTGTCAGA
TGTCCGACATGTCAGCACTCGAAACCAGATCAGAATATGAGGAGCAAAAGAAAGTAATTTTTGATTTGCGTCAGCGTCTTGTTGATGCAGAAACAAAAGT
TGTGGAAGGAGAGAAACTTCGGAAAAAATTGCACAACACTATACTGGTAAAGTTCACATACATGATATGCAATTAATATCTTCAAAGTGCACTGTAAACT
TAAGAATGTTTCTTATACAGGAATTGAAAGGCAACATACGGGTTTTCTGTAGAGTGAGACCTTTATTATCTGAAGATGGTGTTGGTGCAGAAGCAAATGT
CGTCTCTTTTCCATCTTCAATGGAAGCACAAGGGAGAGGCATTGACTTGGCACAAAATGGTGAGTATGTGTTGTTTCTATCACATTTAACCAGATGTTAT
TTGTATTTCTGTAGAGTGCTCTTGATGGTTATCTGTTAACATTGATTTAATATTTCTATTACCAAGGACAAAAGCATTCCTTCACGTTTGACAAAGTTTT
CACGCCCGAGGCTTCACAAGAAGATGTTTTTGTTGAGATATCCCAGCTTGTACAGAGTGCTCTTGATGGTTATAAGGTGATGTATTTTTAAACATTTGTA
CAGAGTGCTCTTGATGGTTATTTGAGTTACTCATTCTCTGCAAGTCTCGTGTTAATAAAGAAAAACAATTGATGTTTGCTGTCGTGTGATAGTTATCAGG
TGATATATTTTTAAACTTTGTCTATGAATGCAAGTCAGTAGTCTCGCGTTAGTAAGGAAAAGCAAATGTTACTCTCAATGAAATGCTCTTAAGACCATAG
AAATGTCATAGTATGTCTAAGGTCTTAAGTTCCAAGGATACTTTTGGTATGTGTCAAAGGCTTTCTTTCTTTCTTAATACTCTATGTCCAGACAAATGCC
GTTGTATTCGTTTTTCTTTTGATATGTCAAATCGTTCAATTTATAAACTAAAAAAGCCTCATCCATAGCTGATTCTCATCTATTTTTTCAGGTTTGCATA
TTTGCTTATGGACAAACTGGTTCTGGCAAGACACATACAATGATGGGCAACCCAGAAAGTGCAGAGAATAAAGGACTAATACCCCGCACTTTAGAACAGG
TATTTGAGACCCGGCAGTCTCTTCAAGCACAAGGGTGGAAATATGAAATGCAGGTGAGAAATTGTAACTCTTCTTGATCAGTAATTAGTCTGTTTCTCTT
CTATTTGTTTGTCTTTTCTGACATTGGTTTTCCACATTATCTTTAGGTGTCAATGCTTGAAATATACAACGAGACTATTCGGGACCTTTTGTCAGGTTTC
GATGCTTCAAGACCCGAAAATGGCGGAAAGCAATATACAATCAAACATGATGCAAATGGCCACACCCATGTCTCAGATCTGACAGTTGTAGATGTTCAAA
GTAGTAGCAAGGTCTCTTCTCTTCTAAGGCGTGCTGCACAAAGCAGGTACAAAATTACAGCTTCTCTTTTTTCCACAGCATTTCTTTTCTTAATTTAGTA
CGAAAATAGGATGATTTTGTGAGGAACTTATTTCATTTAATGCTTCTTGGTTGCTTTATTTGGTGGAACGCAAAAAGATTTTAATTTAGAAATTTTTATC
TTACTGAATTATGCATGCAGGTCTGTCGGCAAGACTCAGATGAATGAAAATTCTTCAAGAAGTCATTTTGTTTTCACTTTAAGAATTTCGGGTGTTAATG
AGGTGAGAATATTGTATGTAGCACGCCATTTGGATCGTCTATTTCAGAACTAGATTTTTGAATGGACTAATAGTTTCATGTCTATGTATGTAGAGCACTG
AACAACAAGTACAAGGCGTACTCAATTTGATTGATCTTGCTGGCAGTGAGCGTCTATCTAAGAGTGGGTCTACTGGAGATCGGTTGAAGGAAACTCAGGT
TATTTGAGTTATTCATTCTCTTAAAAAAGCTTCCTATTTTTAGAAATTTATGCTAAGCCTATTTCTGACTTTCATTTAGGCTATCAACAAGAGTTTATCC
TCTTTAAGTGATGTTATATTTGCGCTTGCAAAGAAAGAGGAGCATGTACCATTTAGAAACTCAAAGCTTACATACCTTCTCCAGGTAAAATTTGCTTTTA
CTCAAATTTAAAAACAAGGATTGGCTCTTTATCTTATTTTGAGTCCTAAGATGTGTTGAATTAGTATGCTTTTGATCTAACTAAACGAAAGATAGAAAAA
AATTGTGACTGTTGTATCTGTTTCCAAAAGCTGAGTTGGTTGTTATGAAGTTATTTTGAGATGTCATGTCCAATGGTAGTAATGCAGATTGTTGGGTACC
TTTGTTTCTGACTGTTGCATGTTTAATCAGCCTTGTCTAGGTGGTGATTCGAAGACGTTGATGTTTGTCAATGTAGCTCCAGATCCTTCTTCTACTGGTG
AGTCCCTATGTTCACTGCGATTTGCAGCAAGGGTTAATGCGTGTGAGATTGGTATTCCAAGACGTCAAACAAGCATGCGTTCATCAGATTCTCGATTGAG
CATTGGCTAATTTTTCATTTTTTGTGTTTATAGAACACTCGTTCTAGTTTTAGGAAACCGCGTGTGGTCTGTATTATTCTATATGATTGGCATATGATTT
TAACAGAAGTAAAACACACCTTCTAACCGAATCCACCTTCGATTTGTATAGTGTGGAGAGAGATGAATACTGCCTTATGTATCTGTAACAGCAAAGGGCC
TTTCCCTTTGAAACATTTATCTTCTGATGTTCTTTCACGAAGTTACCCGAGTGTTGTAACTTTCCATTTTTACAACTTAAATCTCCTTTTGTTGTAACTT
TATATTACATGTTTTTTTTAGTCCAAAGTTCATTTGATGAAACGTTTGTTCTTACGTTGTAGATCATGTAGTTGATCCGACTTGTTTTGAACTGAGACGT
GGTCCTTGTTTTTATGTCTATATATCATAATTGTATGACAAATGGGCTTATTGCTGGACATTATCCATTAATGCATGGGCCTGTGATGGAAATTACAAAT
GGGCTTTTACCTATTATTCTTTTCATCGAATATAATGATGCGAATCGAGTTTTAATTTGTTGTAATAAGCAATGTCAAGTAGTTCCACTTTCTCGTTCCG
AGGAACGCATTGTAGAATCGGATTAAAACGACAAGTAACACTATATTCGAGGAAGAAGATAGATGGATATCGTAAAATTTGGACTCACTTATTAAATTTC
ACTTCTTTATCCATAATTATTCTCAAGGCAAAACAAAATTATAATTTTAAATGTATGTTCTGATTTTCCCTAGTACTAGAATTAATCATTAATACTTGTA
TCGAATATTTTTTTTTACATCTCAAATGTGGTAAAAAAATATTTTATTATTCGGAGCGACAAATTATTGAAAAGTTTGTTCTGCCACAGAAACAGCATAT
TTCATTAATCAAATGTATGCTTTACTGGCATTGCAATTTACCTAATAGCAATCATATATTATAATACTAACCAAATATTATTTTATTCAATCTACTAAGT
TGATCCTGACGTTGTACTCCACATTACATAAGCATTAGTATGGATAACTAAGAATAATGTATCTATTAATTTCATCATAAAAATAACGTATCTATTAATT
TCATCATAAGTGATCTGTCTTATATTCATAATTATTTAGAACTAAATTATCGTCCATATGGAAAAAGTTATCTTAATCATATAACATTACTTCTAACATC
CAATTGGATCCTACCTAACTAATTATTACTATTATTATTTTTATAGTTTATATACCACAAGAGGAATAATATGATATCATCATCATACAAAAGCTTATCA
TATATAGTAGGAAAAAAGTACTCAATTATTCTTGTTTAGTGGCTAATCACAACTTGTATGACTGCAATTTATCCAAGTTTTTATAATGTGTACACTATAA
TATGGTTTAACTTAATGATAAATCACTCAAGCTCAACAATTTTTGGGAGCTCAATGTCATTTATCAGTTATATTACTCCGATTTATTAAAAAAATTAACT
TCACTTGCATTTTTCAATGAAATAAATACTATAATATAAAAAATTATTAAAATAGAACCCCTACTTTTAATTGAAAAATTCCCAAAAGTTAAATTTATTT
ATATACTTCTTCCCAATTTATGTACTAGTAGATTACTATGGTCTACATCATCTCCTAGATTTTGGACATTTTATGATAGAGATACTACATAAGGGCATTT
TGGGCCACTTATTTTCAATCCTTTTCTTCTTATAGAAGATTTTATTAACCAATCACAGAATTACAACTAAGCATAGGTTCTATCTTCATTATAAAACCTT
TACTTCACTCATAAACTAGACAAGTATTTTATTTGGACATCGTTATTTAATATATATTTCGCTTTTTAAAAAGTGTATAATCCATTCATAGTTCTCTAAC
AAACATTAGATATCTGATGTTTATAGTTTCATACGACTTAACTTTTGGTAAAAATAATTTGGTTCAGTTTTATGTGCATGAACTTAAAAGAAAAACATAT
TAGAATCGAAGAAAGAAATTAAAATTGAATCTCACAAAAAAGTATCGAAACTTTAGATATTAGTATTCTAAAATGAATAGACATACAAAAATTAATAAAC
TTATCACATAACTTAAACGTGACACGAAAATCGGGTGTACAAGCACTTTCCTTTTTTTATCAGGAAACTTACATATATATACTATAACAAAAAAATATTT
ACCATTTATAGTAATAACATATTTTTTCCACTTGATCACTTTCGATTCATTTATAATACAAGTTTAATATATATTACAAAGAACAATTTATTATTCACAT
ATAACATAAGTTTTAATAATGAATAATACATTTATCACACATTTTAATACACTTATAATATAATGTGTCGCACTTTTACCAAATAAACATATATATTTTC
AAAAAAATTATAATTCATACATATTGCATACATAATTCACTTTTAATACATATTACAGATTTAACATAATATTGCTATAAATTATAATAAACAAAAAATA
TCGCTAAAATCAATAATTATTTATTAAAATATACTAATTCAATGTAATTTTTCCATTTTAGCCCTTTGTGTAAGTTGTTAATCAGTCATTATCAAAGTTT
TCGTCAAGACAATGACAGGCCCAAAGCATAAAGCCCAATCATGTGCCGACATCGTGGAAGCCCATTAGTTTTTTTTAATTTTAATTTATAAAAAAAATGC
CAATATGAAAGAAAAAATTATGAATTTTACCCAAATACATTTTCCGATTCAAACAGCAATTGGAAACCCTCATTGGAGAATTTACCGGGAGAATTATTTT
TTTCATCTTCTGGCCGGCGACTGATCGGAGATGGTTTCACCGGAGAGTACCAATTGGCTTTATGATTACGGATTCGAAGATAGTTGCGTCCCTGATTCGA
ATTTCTCAGCTTCTGCATCTGGGTTTAACTGGTCTGTGCAGAATTTGAATGGTTCAAGGAATGTTAGGTATGTTAAGTTCTTAATTTTTTGTGACTCGGT
GAAGTTCGGATCTTTTAGCTGATTTATGAATCTGTGATGTATCTGTTATTTAGGGAACAACTTTTTTTTCCCTCTATATGCTGTGAAGTTTACAACTTTA
AGGTCTTTTTATGTACATTTGGAGTTGATTTGAGCCCAAAGAAAGTTTAATTTGGCACGATTTCTGTTATTATTTGTGTGTATTTAGAGTTGTATCCATC
TAGCTCTACTTTCTCTTATTGTGATTTGATGCCACTGTATTACTTGTGTCTAAGTTAAGGATTGGAAACATTTTTTTTTCATTTGCCAGATGAAAAATTA
CAACTTCTAGAAGTGATGGAGTTGGATATCTACCTTCACAGAAAATATAGTTTAAATGTAGAACTATATACGACGGAAAATAGTATCTTGTAGAACTTTA
GTCCTGTATGTTTATTTTAGAGTCTCGATTTCAACTATAGAACGGAGGCAAATGCTTTTAAGTATCAAATTACTGGAAGTTTTCTCTTTATCCAAGTTAT
AGAGATAGAAAGTTAATGGTCTTGAGTGCAACCTAGTATAAGTTGCCTTTAGTGGAGGAGCAGGTTGAAGATATAATGTCGCTGCATATTTTACTGTCTT
CCCTCGCATGCTACCAACTTTTCATTGGAAACTTGCATTTAGCCTACTGATGTGCATCATCAGAACCTGGTAGTAGTGGCAGAGATTGGATAAGAAACAA
TACAAAGGAGGATGTACTGAGGATGGAGGATAGGAAAATACTTAGGTCAGAGCATCCAGTGTGCATAAAGAGGTAAACAGATATTAGCGCAGACATGATA
ACAAGGTTATAAAGGAATGAAGAATATATCGTTAAACATCGTTTTTGGAAGTAGAAAACTGGAAAAGCTTGGTCTAATGTGCAGAATCTTGACAGTTAAT
AGAGAAAGATATTACTTCTTAACTTATTGAGAACAGAAAGGGGGGAAAGCAGGGTGTAGAGTAGAAAGAGGAACTGATATGGAGGAGGAAGATAAGAAAA
AAGATGTGTGTGGATATTGGAAGATAGACTGAAAAAAAGAAGGAAGAATAGAGGAGGAAGCTAAATAGCGAGGAGATGGTAAAGGAGAATACCAATTAGT
GCTGCTGCTTCTAGAATCACCACAAGAACAATTATACCTCAAGTCTCTTACTAGTTGGGTCAGCTAATAATCCTCTATATTAATACTGATCTGTTTTGAC
CCATCTTATTACAATAGTCAATAATAGGTTTTTAAACACAAGCGTCCAAGGTTGTGGCCTAGACTAGTTGGTGTTGCCTGTATGCATTTTCCTAAAATTA
CTAGAATTGTTAATTAAGCATGAAATACAAAAATGTTGTTATCTTTGCTAAACTTAGCATGCTTTGTGTGTGTTTGGGGGGGGGGGGGTCATCGTGTCTT
GTATCCAGTTGAATGACTAAAACTTTTCATCGTAAGCTGGATATGTTGGCTGGAAAAATAGAACAGTAGGGGTAAGTAGGGTTTCCATAAACATAATTTC
CATTCTTTCATGTGCCTAGTTCTTCTATTTCATGTTAGCAATCAAAGGATATCTTCTTTCTATTGTTTTTTGACTTTGGTTTTTCCTTCTTTTTTGTGCT
TGTTTCTAGTTCTGAAATCGATGGGTCAATTGGTGAATCAGATTACCCCAAGGAAAGTGGTTCTAAGAAACGGTAAGAATTTTTGCCTTTTCTGAACATT
TGTGCTGATCTCCATCATTGATGTTGAATAAAGATGTGGTGCTGCCCTCAATTGTTAAATGTAGTTTAATTTGATTAGCTTCTGTTTCATATAATTATTA
TTTAAATCTGTGAGGTGACACATTTCCCACTCTCTTTCTAAGTTTTGAGTTTTTTTAAATCCTTTTTTATTCTGTGATTCATCATCTTGAAAAATCTGTT
GTATTCTGCTTCTAACTGGCAAGATTTGAGAATGTAGAATCCATTAAACCGATTTATATGTTCTTGATTTAAAAGCCTGCATAATTCAAGACATATTCTT
AAGTCTCTATTCGAAAGAATTCACTATGCCCTGGCATTCTTCAAGTTCATAAACGCTTCAACATTGTGTGATTTAACATGTTTCACGAAGTCCCACTGAT
ATATTCCTAATCCTATAATTACAATGCAAGTTGAACGAATTTGTTGGTTGAAGTATTCCTTTTAGCTCCGGGGCCTCAATTTTACTGTTGAAAGGAAAGT
CAGATGTCTTGACCTATATCTGTTTACTATTTTCTCTCACCATTTAGGTAATTGTTACAGGGCAAGGGTTGAATCATGTGCTCCAACAAGTTCCAAAGCT
TGCAGAGAGAAACTGCGAAGAGATAGGCTGAATGACAAGTGATCTCACAACCCATTTCATAAAAACTTCTCCATTTATTTCATCCTTAATTGCTAAAATT
GATCTACTTATCAGGTTCATGGAATTGGGTGCACTCCTTGAGCCTGGAAGACCCCCTAAAACAGACAAATCCGCTATTCTTGTTGATGCTGTTCGCTTGG
TGACCCAGTTACGTGATGAAGCTCAAAAGTTGAAAGACTCAAACTTGAATCTGCAAGAAAAGATCAAGGAGTTAAAGGCTAGTATTAATTCCCTCGCAAT
GCTCCTAATAGAAAGTTGACTTTTTCTTAATCTTGCATCTGTCATTCCATTTGTTTAATGGTACCAAGGCTTTTCCATTTTGTAATGGTGACAAGACAAG
CTAGAACATCACTTCACTCTTCTGCTCCTGAACTTCAAGCATGTGTTAACTTGTGTAGGTTGAGAAAACCGAGCTTCGAGATGAAAAACACAGGCTGAAA
GCTGAAAAGGAGAAGCTAGAGCAACAACTAAAGACTACAAGTGCACAGCCTAGTTACTTGCCTCCTGCTATACCTTCTGCATTTGCTGCTCATGGTCAAT
TTCCAGGAAGCAAGCTGGTGCCAATCATGAGTTACCCTGGTGTCGCGATGTGGCAATTCATGCCTCCTGCTGCTGTTGATACTTCACAGGACCACGTCCT
CCGTCCTCCAGTTGCTTAACTTGTCGCAGCTTAATGCCTACAAAGGTTGCCTTCACTGTACCTTAAATTAATCGTCTAGTCAATGTCCTCCGGTTGTATT
AGTTTTGGCTCAACTCCCCTTACTGCATTTGGCTGATGATAGATAAGTTGTGACTTTGAAACTGGCAACGGTTTAATGTTTGCTTTGTGTAAAATTAAAT
AAATTTAACTATAAACTGTATCTACATTTTCTCGGTTCCATTAGCTAAATACTACCCAACTTATAAGAATTAATAAGAATTGCTTCCTTCGTTTCGTTTC
ATTTTATATGACACTTTTCGAATTTCGAAACTCAAACAAGTCTATTTTTTTACCGTAAGTTTTTCATAGATCTTTTAAACGTTTCTAGTGACTTGTAATA
CATGGATGTGGCAAGAAATTCGATTGTCTTTTCTCTAGCAGTTCGTTGATGCTTTGAACGAGAAACATAGTCAGAGGATTCAAAACGAGTGTAATTTTAG
TAGAAGTTTTAGTTTGTCGTCTTGTATATGTAATAATGTGGAATTTGATGTTGTTAGGACATATTTTCATACTCAGGTTTTCTATGTATTAATTTGCTAA
ACAGTGAATTCAGAAGGAACACTTATTTTTTCTTGTTTATGTAATTATCTATGTTTGTTTGATGTTTTTCAATTTGATACACCATTTATGCTAATTAAAT
CTGAAGCACGAGATGAAAAGAAAAAGGAATAAACGAAACAATATGAAGAGGCATAATAATTAATTGGTAATGTAATTTTTCAGAGATTAAAACACATTAC
ACAAAAAAAAAAAAAGCGACACAAATTAATTAGCAGTATAATTTTCTAAAATTAATACACATTAAAAATCATTTTAAATATAAATTATAAAGATGAAGGA
AAAGTTTATAAGAGAATCTCAAAGTTTTGAATGAAGAACATTACTAGGCAGGGACTAAGAGACACCGAATTAGTTTTTAAGTATAATTTACATAAATCTC
ACAACGGTAAGAAGTAAGTACAATGTTTCAATTACCTAAATATAATTAGAGAAATAAAGAGGGAGCATTAATATATTTCTTTTGAAACTTCAATCCTTAA
TTAACATTGTTAAAGATATTGTATCTAAGTGGATTTGTATTTATCTAGAATACATTGACTCTTTTGTTAGCGTTTCTCTCATCTCGCTCGCCTATTTTCT
TATGTATCTATGTTTCAAAATGTATCTGGTATATATCTAGTGTGATTCACATGTATCTGGGATACACCGACTCTCTCGCTCGCCTCCCTCCTGTCTCTCT
CGCCTCTCACCCTTCACATCTCCCCCTCTCTCACTCGCCACTCTCCCTATTTATTTGTATTTGAGAGTATATCTTATAGCAAAAATATATAAATCTAGGT
GTATCTCTGATTTGAAATTTAATACTCCCTCTATTCATTTATACTTGTCTACTGTACTAAAAATAGTTATCCAAGAATATTTGTCCAGTTTGAAAAGTCA
AGATATAATTTACTCTTTTGAGTCTGTTTTATCATTGCTATTAAATATATTCAATATCTAATATATTTTCCAAAGTATTAAATTTAATATATTCAAAGAG
TAATATAGTATATCATTCTTATTATTTATTTATTTATCAATTTTATGTCAAATCAATATGCACAATTAATATCGAACAAAGAGAGTAAGAAATTGTTAAT
AATTAACGAGACTATTTGTAATTATTTAAAATTATAAGGAGAACTAAAAATATGAAAATTGAAAGAAGTACAAGAAAGTGACACTAGAATTCAACAACTT
GACTTAATGCATTATAACAAAATTAGTGAAACATCAATTGTTTATCGTAACTACTGTTCTCATGACGATTGTGCTCGTGTTAGACGCACAATGTCCAAGA
TGTTGCAGATGGTGCAAATATTATGTTACTACAAGTGGTACGATCATTATGTGCATTGGTTGTGGCAAGAAATTCAATCCAAGATCGAATTTATCGTCCT
CAGGTTATAAACTTGGTGTCAAATCTTACTTGCATCGCAAGAAACAAGATCATCAAAGGGTTCGTTCATGCTTTTGAACGAGAAACAGAGTCAGAGGATT
CAAAACGAGTGTTATTTTAGTTGATAGTTCCATTTTTTCGATGTATATATGAAATTTTGATATAACGATTGTTGATTAAGAACTATGTTTTAATTACCTA
TAAATAATTAGAGGAATGATTTTACTGATTAGAACTAGGGAGCATTAACATATGTACTAAGTAGGTTGTAGTTTATTTGAGTTTTTGATTTCACATATTT
ATCGAATAAATGTTGCATGACATACCTGGAAATCACGCGTAAAACTTGAAAATATAGCGTCTTTTTATGCTATCTGTATAAGTATTTTTGGTTGAAAGAA
TGGATAATACTGTGTAGAATCTAAACTGCAAAACAAAATACATCAGAGAACAAGAAATTCAAGTAATCGCGAAGAGTTCCAGTGTGTTAAGATCAGATCT
ATTGCCATTTCTCATCAGGAATTGGAGGCCTTCCCATTCGCGTTAACTCTCCTCTAACTTCGTCCTCTCATTTCAAGACGCTCTAATATGACAACTTTTG
ATAAGTTTATCAGAGAAGTTAACGTATTTAGTCCATAATGGTCGAAGTTGTGGGAATGCTATATCGAGCCAAGGTTTAGCTCGACCATTGAAGTGAATCA
CGCCCGCACTTTGAGCTTCTGCTAAGGTTGTATTGTCTTGATACCCGAGTCCTAGCATGTGCCAGAAGGGATCAATGGTGTGTACGTGTCCATGAAATGC
GATTAGACCAGGAGGTAATGTACCTAGCTGCCACAAACTTAGGTCTGATTTCAAGTTCTGGATAAAAAGTTGTATCAGATAACGAATTTGGTATATTTTT
GAACTTACAGAGTTTTTTATTTTATGTTAGTTGTAGTTTACCTGTTGGAGCCAGTAGTAGTATGTGTGACTTATATTTGTTTTCCTCCATTCTTCTAGAT
CGAAAATGTTCATGCCATAGGCCCACGCGCATTCACTTGGATCGAAGTGTTCTGCTATCAATGGATGAGAAAAGTTTAAATAGCTTTTGAATCGCTTTGA
CATGACATACTTGTCCTCTCCCGTGCACGTCTCAACTGCCCCGTTCACCTTTCCATTCATGTCGATGTCCCATAGAGGTGAAAGATCCGTTTGAACAACA
ATGTCATCGTCCAGGAATACTATCTTATCTAGGCTGGGAAATAGCTGGAAAGAAATTCTTACATCTCAGTATAATCGAACACTATATGGATGTCACGTGC
ATTTATACAACAACAATTACTACGTCTCAGTCTAAAACAAGTTGGGATCAGATATATGGTTGGGATCGGATATATGGATGTTACATGTTTGTGTATGTTG
TAGAGTTCAGGGCTTACCTCGGGCAAATGTATCCTTATGTGATTCATCAGTGAGTTATATTTGGGACTGAGGGCTTGTAATTTTGCTGCAATGATTTTAG
GTTTCTCAGTTTTGTTTGCTACAATTGCTGATGACCCTCCTCTGAACTGTGACCTGGCTTGTTGGTCTTTCTCCATAGCTTCCATAACCGGGACTCTCCC
CTTCGTGAACCAATCGAAATGATGCAACCCTTTCACCTCAATGACAGCAGGTGTTAAAGGATGCAACGAAAACCAAGCTTGCATAGGTGCGTATGTTTTC
CTGTCTGTGATAATGTGAAGGACTATCTTTTCAGGCCGGATGAAATTTTGCACGAGTGATGATGCAACGACAGAAGCAGCAAGAATATTGTCAGAGGCAA
GGACGAAATGGAAGTATGAGTTATCAACAAGAGCGGGGACAAGCTCAGGCGATGGTAACTGGAGACGGGCATTGGAATTGGTGGAATGCTCATGTGCTAG
CTTGAGAGCAAGGCAGTGCAGCTGTTTCGGGATGCTACTAGATGCCACATGACGATACAAATATTCTTGGATTTTGGCAGTTCTAGTCCTCTCTTCTAGC
TGAGTGACCTGCAAAAAGAATAGACAAAAATCAGGCCTTGAGCTGAACACAGGGAACATTATGAGGAACTGTTTAAACTAAGATTTCTTGTAGGTTTTCA
AAGGCCTGTTTACGGAGGTTTACGTGATCCCAACAGCTTTTACCCAAATTCTCTATATGTATATTTAGTAGATTACCAATAAACCATTAATATTTGACTC
TGACAACAGTTAGTACTGTGTTATTAACAGAGGTCGTTGTAGGAACTCATAAACCTAAAATCCTGGATCCGCGTCTGGCCTGGAGTACCTAAATATGGAT
ATCTTATTGCCTTTTTTTTCACTACTAGTTCTTTGTCAACAGAAGTTTGTTGCCTATGACATAATGTGCCACTTTAAATTATACTACATATATATTCCTA
TATATGATGTAGAAAGCATGATAAGAGTAAATATACCATAGCTTTAAGCTTGACAGCAAAGGTTTTCGCGTCTGGTCTTCCATCCTTCATTTCTGCAACA
AACTCTTCTAATGTTTGAGGAGATTCAGGCCTTGTTTGTGTATCAGTTTGGTCTGAAGGTTCCTCCAATACTCGATATATCACCTCGGGAACCTAACAAA
TGCAGAATAATATATGAAACAAGACTATACAATTCCAATATTCGATACTAAAACAAGCACATCATTAAGGAAATATCGAATATCACAGTAGTATGCACAA
GGGAAAAGATACAAGGCTCAGAAGCGTACAGTTGATTCAAGACGTTTCCCCAAAATCCTTGGTCCAATTTTTTTTCCCAAGCAACCTGAATCCAAATTGC
AGAAAAAATTTCGGCCTTTCTGTTCATTAAAGTTAACAAAGGGAGGAGCAATATTGAGCAGCATTGTTCTGATCATCATTTAACTCTCTAAACTTACTAT
GTGTTTGCTATTTCTTTCCATTGTAACACATACATTCCACGCGATGAACTTAGCATTACTTCTACTATATGTTTGTAAGAGATAGTACTAAGTAGAATAC
GAACTTAACATAACATGTTCCAAATTCTGTATACAGAACTAGAGAGACAGAGAAGTACCTAAGGTCGAACATTTTCGTTCTCCATCAATAGTATCTATAG
CTGTTAACACGAAGACAAACCGGAGCAAGAATGTAAGGAACAGAAGGCAGTAGAACACCATACGATAAGATAATCTTTTGGAGCCAACTTTAACTTTAAT
GAACTCCTTGAAACCTTTAGCAGGCAGAACAGTAACATGCCTTAAACTTGGTGATATGTGAAGCTGCATTGCTTTTAACACTCAATAACAAAGTCAAAAA
ATTGATCAATCTGCCCAAAAATAGGCAGAAAGAAAAGTTCTTGAAATTTGGCTATTAACAAAAATATTGGTACTTTTGGCCTAATGATTAATTAGGCAAA
CAATAACTGAGAGAATAAGAATGCAGAATAACCCTGTTGAGATATGATGTAAAAGGAAGTACTAGGAGGGGTGGGGGTGAGTGTTGTTTTCAATCACCTA
ACCTTGCTTAGCATGAAGGTTACATAACAAGTCTTGCAGCCTTTCTTTTTTTACCAAAGCTTATATTGATTTTTCTTAGTGAAGAAAACTCAAGAATTTT
AGTTGTTTGAAGGAAAGAGACATAACACTGCCTTTTACTAATAGTAAACTTGCGAGCGAGCTACAAGCACCTACTCATATCGATATGAGACCATTAGCAA
GAATCAAACTTGTATCTATAGTATGTAAAGTTCTTTTCAAGAGTTGATTTCGTAGATAGTCACTCAATTTATTGTCGCACCAAAGTTCTCAAATATCACA
AAAATCGCGAAACTATTTTTTGTTATGAACGTTGCCTAAGAATCACAATAAGTCATCCAACTTTGTCTAAGTACCATACAAAATGCATCTTTTATTTCTT
CATAATGACTTGTTATATTACTCATACAAACTTAAGTGACTTTCTAGTTACAAAATTTAATTTCATAACTTTAGTAATATGTAATTTCAGCAGTTGAATG
ACCATTTACGATATTACTAGACTGTATGAATTGTATAAGTTTGATCTTAAAAGAATGAGGAAAAAAAGTTATAATAAATGAGGCTATAGTATTATTTTAT
ATTTTGGAATTAAAAGAAGAGAAGAGTTTGGTGTTGCTTCACTTTGCCTCCACATATAAGTTGTTAAAGAATAGAAGCTTATTTTTCACAATGTGAAAGT
TTAGGCACATTTGATTTGAACAGAGTTTCTAAATTGGAAAATGACACACTGTCTTTCTTCTTTTTGTTTTTCTTATTGTGACTAAATTCTAAATACTGGT
GGGGACAGCCTTAGTAGTAGTTGGTTTGTTGGTGCTAAACTTAATTTGGAAAACATTAGACTATTTTAATAATATTATTTTGTTAGTTAATTAATTTGAT
TATACTTAGAACAACAATAAAGTTATACTCGTATGACCTCTAGATCACGAGTTAAGCATGTCTACGTTATACTCTTTGGATTGTGATTCTTCCTCAGAAT
ATTTGAAAAGTTATATGAACGATGTATTTATTTAAAGACGAAATAAAATTTGGCTTGTACTAAAAGGTAAATCAACTTGAGATTTATTATTAGTTCAATT
CTTTTCAAACTATAACAAAAAACAGTTTCACCACCAAAAGGATTAATAAATTCTATCATCCTTAGTTCTTTGAGACATATTTAACTAATTTTTAATAGTT
TTAAAAGAAAGAACTCTTTTTTTTTCTTAATTAATGTATTTTAACGACTTTGAAAATTGAAATATTATTATAAAACCAAAAGGAATTATCAATCCATTTT
CTTTTTTAGAGGTTTAGTCAATTCATCAATCATTTGGTCTGGACCTTTAATTTAAGATCACTCTTTTTTTGTGAATTGATTTGTAGCAACAAAATTCAAC
GTAATTTCACATGTGAGATTTGGAGAGGATAGTGTACTTAGTCTTACCCTTATGTTGTGAAAGTAACGAGAATGTTATCAATAGACCTCTGACTCAATTA
AAGAATTGTGGAAAAAACAAGTGTGAAGCAATAGTAAATTTTCAATCCTCTAGACTCAATAATAAGTGATTTTATGATCAGAATAATAAATCTTGTTTTA
AAAACATCAAGCACTTGATAGTAGTAGTATTTCAGGCTCTTGAAGTGATGAAACAAACAGTACATATTCGTGAAACTCAATCTCATTTAGAAAGTCTGAT
CTCTTTCTTTAACAAAAAAAGTTTCTAGTTTAGATACTCATTCATTCTAAACCAAAACGACGAACCTACACAGCTCGCGATGAGGTAGAGTTGCAATGCA
GCACACAACCTGTCCAACAGTGTATATAACTTAGATCCATCTCGAGAAAATATATATACATTGTAAACAATGGACTGAAGATACGGTGAAGATATAGTAA
AATAAAAGCAACAAGTTGCAAGATCCAGGCAATTATTTACACATTACAGCTAATTTATTGGATAAGTTTCATATCTAAATATCTACAATACAAAGTTAAA
GCATCCACATTTTGTTCATTGGGTCAATCAAGGAGCCTAAAACCTCTTTCTTCTCTACATTTTCCACCCCCCACAATATCAACACTTACAGAAACCTTCC
GCGTAATAAACGAATAACGAACACCTGAGAAAATAAGAAGACAACGAATTAATCAACTGGCAAGAAGATGTAAAAAGATTAAAAATGACTAATAAAATGA
GACAAACAAGGTGTAATTTGAACTCGGGTTCTGGCGATCTCTTTCTCTCTTAAATACAAGAAAGGGAGGGTGCTAGGACTTGAAAATGCCAGCAGGAAGT
AGTGAAAACAAGTAAAAAGCAAAATCGGTTACCTTTAATCAACACCGTCGACTTCATCTTCGAAATGATCCTCCAATGCTGCGCCATCTAGGTTATTATT
TACAAACTTCATGTTATTTACAAAATCTAGCTCGGCATCCGCTTTAGGGCTCTCACTACTATTTACAAAGCCATTAGCAGTTTGACTTGTCATTGGAAGA
CCATCCAACCCATTAACTTCTCGGCCGCAGTGAACTTTACTCCTGGGACCAGTCATGGAATGATGCAATTCATCAACACCATTAGCCATAAGATTGCAGT
AATTGGAGACCTCCAGCCTAGGAAGTGACTGTTGGCTATTGTCACTGTTAACAGATACCCTATAACAAACATTTAACTTCAGAAACAGAAACCATATTCC
AATTTCCAACAAGTATAGGCAAAACATTACAAAATGCAGCAGTAAACAACTAATGGCTAACCAACGAAACAGTCATTGCCATGCCAGAAGGTTATGCATG
TTCCAAATCCCCTGATCAGTATTTGCTATTATTACTCTCCTGCTATCGTATTCTTCAATTTTAGTATCAACTTACTGTTGTTTTCATTGCTTCAATTTGC
ACTATGTTCCCCTAGCACTTCCTTTTGTTGTTGTTACTGCTAACATTTCCATATTCCTATTTTCAAACTACTTTGAGAGCCGAGGGTCTATTGACCCTCA
AGAACATCCTCTTATCTCCACAAGGTAGGGGTAAGGTTTGCATACATTCTACCTCCCCAGGCCCTGGTTATGTTGTTGCAAACAAACCAAACTGTTGGGC
AACTTTCTATAACAAGGGCAACTCATTCACCAAAAAAAAAAGATTGATTACCTCCCTGGTTGGGTCTTGGAAGCTTGAATGAAATCAAAAACTGGGACTA
AATCTTTTGATCTCGCCTCGACTAAATGAGTTGGAACTTCTTCTATCTCAGTCTCTCCTCCAAAAGCATAAATATCGCCTATCTTAACCTCATCTGCAAC
AAATGATTGAAAATAGATCTGCAGCACAACAAAAGCACAAAGTAGATATCAACCATTACGCGAAGCATGAGATTTACTGAAAAATTGTGATACCACACAA
ATACCTCTGGTTTTGCCCACAGTGAAATCTGACGTTTATGCATTTCAAGCTCCACTTCGGATATATACATATGATGTCTTTCATCAGAACTTCTCTTTTC
TTCTGTGGTTGTATTGCTAATCTTGGAATAGAGACCATTTTCTACCTTCATTCGTTCAGGAAATATTTTACTGTTATCAGAATCTCCAAATTCACCATAT
ATATCCATATTACCACCTCGTTCTTTGCGATTCTGTTTCTGGCAAATATTCCACTTCTGTATTGCATCTACGACTAATCTTGTATCAACTTCAACGCCTG
ACTCATATGTTGTGGCCACCACAGGAGTGGTGGTTGTAAGAGAATCTAGGCCAGAACACATCCGTAAAGAATATTGTATCACGCAGCCAGGGGAAGAAAA
AACCAGCAGGTGATAATTTAATTTTAGAAAGGCTGGATCTGTATATTGGTTATGGTTTTTGTTGTAGTATTGAAAAGCTGAAGCAATGGACCCAGATAGA
GAGCTCACGTTTCCAGTAGCAGCAGCAGCAGCACCACTTAGAGTATTTTTCCAACCATTACCTCCACTCCTTATCCGGCCAACAGCAGAAAGTGTCACAG
GTGAACCAGATCCACCAATGCTTTGCTGAGAAATTACAGCCCTCTGAACTGCAAGCGTTGCTATCACCCCAGAGCTATTAGGGCAAGCACTACGACGTGC
ATCAGATGTGTGAAAATCAACTGATCCACCTGAAGGAGATACCGCAAAAAGATGGCTAGTTCCTCTGGAAGAACTTATCATAATCCACCGGCTATCATTA
CTAAAACTTATGTCTTGTATGACCTGAGATGTTTAAAAAGGAAATTAAAGTTGACTTCAATCCTCAAAAAGCAACAAGCTCGAGAAAAAAGGGAAAGCAA
CATAAGCATACTTACCGCGTTAGTCAGTCCACGCTGCAGCCTATACAGATGGACATAAGAAGATCCAGGATCAGTAGCACAAGTACTTTCAGATAGTCCA
GGCATTATCCGAAATACATTGATGTTATGACCTTGAACTGAAGCAGTCACCAGAAGAGTAGTGCTAGGGTCAAAGCACAAAGCTGCAATAGGACTTTTAT
GTGCCCTAAACTGAGCAATAAGAGTTTTGCTGACAATGTCCCTGACTATGACCTACAGATGCAAAAGATCAGACAAGTTAGATTAGAGTCCAATGCTGGT
CAAAGCCAGTATTATATATCTAATACAATACAAAGGGCAAATTATGGGCATATATAGATGTCCACAGAACAGTAGACACGGCATGAGAGCCTTAAAATGG
CCACGAAAATTTAAACCAACATCTTTGAAAGAAAGTTGACGAGAGTAACTCATACCATTCCAACACTGTCTACGTCTTGAAAATGACCATTAGGAGCTCC
TGATAACTTTACACAAACATTCCCAGGCTGAGAACAATTACCATCTGGCCGCAACTCAGAATAGTACCTCGACAGCTTCTTGTACCCCATGTCCCCTAAA
GTCACAATACCAGCAGCAATTTGCCTGCTTGATTCCTTTGCATAATGAGCGACAAGGCTGCCATTTGGCGCTGGACTTGGGAAACTAGCAGAAGGAGTAA
GGTGCTGTGGATTAACTCGACCAGAATTCGAAACTGAAACTGGACTTCCACTATAGGCTATCCACCTGGGACCTACTGCAAGAGGTCCCACACCAATGTT
TCCAGACACAGGAAACCCCGTGACAACAGGATTAGTGACAATAGTATATTCCCTCTCTAATGTTGCAGCATCAAAACAGTGTATCTGTAAATAAAAGCAA
CTTAACTCTTATGTCCATCCAGTTAAACCCGAGTACAACTTTGTAATATCATGTTACATACCTGAGCTGCTTGTAAGATCGCAATCACTCGGGAGCTGCA
CCTCACCAAGTGAACAACTGTTCTGAATCTCAATTGATGCACGTAAGAGTGAGATCTCATGGAATAAAACCAAACAACAGTTGGCACAAATGTGGTTCTT
GCTTGGTTATTATAATGTCGGAACGTTCCATTACAAGGAGTTTCTGTTCTCTCCCCACTGCTACTACCACCAGAAAAAGATACATCAGCACAAAGTATCA
ACATTGGGCGATTAACAGAAAATTTGTCATCACAATTCTTCGATGCTATTAGTTTTGGTAACACTTGAACGAAAGAAACAGGGCCGTCATGCCGGGAAAC
CAAGTTGTACACATTATCACCATCTTCAACATCCCAAACCTGGAAGCCATAACGACACCCCAGGAGCAAAATTTGTCTAGTTGTGCCTCCCTCACATTCC
AACTTGTCAAACCCAGCCCAGAGAACCTGTGTGTTGTAGAAGAGGAATATGAGATACACTACCTTTCCCCTTGAAAGGGCATCAAAGTGTTGACCTCATT
CACATAGCAATGTAATGAACATCATCTCTAAGCACTAGCAATATAAATATTTTAAATAACCCATAAATCTATGGATCTAAAATTTTAATATCCAACAACC
TATTTCATACGTATTTTAGGTGGGTATTATGCATTAGGCTCCTTAAGACAATTGCTTTAGAACTCTCATGGCATCTTAGCCATATCTTTGAAACCAGACT
CCACAGTTAAAATTGCGGAAAAAAAGAATCACAATTATTGTTAATTCCTCAACTTATCAATGCATAAAGTTAATCTACACTGGATACAACAGCACTAATA
TTCTCCGAGGTAATCACCAGCTAGGATATCCCCAAGGGCCCCCTGATTTTAATTAAATTTCCTTGAGCTAAGGTTACTCTTGCTGCTATCTACCGAAGTT
CCATAAGAAGATTCCACATTGTAAAAGCCACTACTGGTCCTTTCCGGAGCATCAAGGCTGTATGTTATAGACCAAAAAAGGAGAGTCCAGCCCAAAAGAC
TAGTCCGATAGGTGGGAGATCTCATTTAGCCTATAAACTCATTTTGTCCAACCCAGATATCACTGCTGGTACCCCTCTCGGAACCAGATCGCCACTCCGA
GTCGTGGCCACATGCATGGATCGATCGGCTCTGATACCAAAAACAGAAGAGCTCAACCCAAAAGACTAGCTGATTGGTGGGAGAGCCATTTAGCCTCTAA
ATTCATTAACATTTCTATTTTTATCAGATGAGGGACAACTGGCACATAACACTCTACCTTCCCATCGGGAATCGGACCCAAAAACTTTTCCAACAGAACC
ATCAAATACTCAATTTCCAACCCCTGTAACTGGTTTCTAAAGTTTGGCATCAGCGTCAAAGAACCTTTATACAATTTATATTATTGCCCACAAATACCTC
TTCCTATTTTTCTTTTTGTTCTACGCACAAAAGGATCTTGGTTATTTGAATTGAGTGGTGAGAAGGTAAACATTTCTCGGGATGGAAATTCACAAGCTAC
AAGCACCAAAACACAAGTTCCCTAGGTTGTAATGCATTTGATTACATAGTCACATGTTACTTAAAAAGCAAATTACATGATCACAGGCAACTTGCTTTAT
CCTTGTCGGAAACTTCTTTAAGGTCGGTCAAACTTTGACTACCTTTATTTGACCCCTTATGCAACCCCCACACTCAAACCCACCCAAATTACAAGGACAT
GGCAACATGATTTTGTGCCATCCATCTTCAGACTCCCATCCTCATTTATATGATTAGTACTTGTATTTGCAGTAATAAAGCTCAAGTGAAATGTGATATG
CGTTTTAAATTCCTTTTTTTTATCAGGAAAAGGACAGTGAAGAAAATGCATTTTAAATTCCTAACTGCAACACAGGTATGCAACATATGGGATAATTCGA
GGAATCTGGATATATGACAACAATGAAAAAACAATATGATTCGAGGAATCTGGATATACGACAACAACGAAAAAACAATAAGATTCGAGCAATCTAGATA
TACGACAACAACGAAAAAACAATAAGATTCGAACAATCTGGATAAACGACAAAGACAAAAGGAAAGCATGATTTGAGAAATCTAGATAAACGACAACAAC
GAAAAGAAAATATGATTCAATGAATCTGGTATACGACAACGACGAAAAAAAAATATGATTCGAGGAATCTAGCTAGATACGACAACGACTAAAAAAACAA
TATGATTTGAGGAATCTGGATATACGACAACAACGGAAAAAAAAAACAAAAAGGAAGAGGTCCAATTATGCATAAGGATCATTCATTCAGGAACAACAAC
CAGACAAGACACAGGTGGGATCTTAGACAAACACAACAAAACCGAAGTCAGAATTCCATAAATAAAGTAAAAAAAGTTAGCAACCTACACAAGCTGTACG
AAAGAACCAAACACCACATTAAATAAAAAGATTGCTTGAAAGCCGGAAACACTACAAGAATAAAACCTCTGATAGCATTAACATGCTTTTCAAAACGAGA
TAAGAAGAAGGACAAACTTATTTGTGTGTCCCAACGGCCAACTCCTATGGACCTATGATATTAAATTGAAGAAAGGTTATTTTGAAATTACTCATATTCC
CTGATCACAAATGCATCCAGAAAATTGTATTTCTAGTTCAATAAGCATGCATGCTCAAACAGCCCTCCCACAAAGACCCTAATGCTACACATAGACCAGT
TAGGATATGTATGTATATCTTTTCTTTTCTACGAAGGAAAGAGGCCACCAAATATGCATATATACACCATATACAGCATTCAAGTTGATCTCATTTCCCC
TGCTGATCCATACAATGATATAATCATGGTGCAGTGCTAATTATATTTGCACTCAAGGTTGTGGACTAGTGGTCAATGAAGTGGGTTGAGAACCAGGAAG
CCAACATAGGTTTAAGAAAACAAAAAATAACTAGGTGATTTCTTCTCATTACTAGACTTCTAACCTAGGTGGATAGAGTTACCTAGTACTTATTGATGAT
GGGAGGTGACAATTACCCGTGGAATTAATCGAGGAGCAAGCAAGCTGGACACCACCGTTTTCAAGAAAAGAAAAAATTGTATTGGTCATAGGAGAAAGAA
TCAGTCATGAAAAAACAAGAAAGTACATAGCAGATCAGTGAATATGGACTTTCAGATTTCATTCCCCTACTGATCCATATAAGGATATAATCATGATACA
TCTCTAACTATATTCCCTTTGTTGTGGCAAAAAGAAAAAATGCACATGATATGAACCCAAGAAACTTAGCCCACATAAGTTCTAGTTGGAGCTAATACCA
ACATACCTTATGTAATCCCACAAGTGGGATCTAGGGAGGGTAGAGTATACGCAGACTTTACCCCTACTTTTTTAAGATTGTTGTTCAACTTGGAGCTAAA
TTTTGTGAGAAGAAAACTAACCTAAAAAGAGTAGGAAGACACCATACCAGGTATATACTGGATCTAGTTATCCTCAGCAGTTACTTACATAGGTTAAAAG
TAGCATAACATTCAAAGCATTAAGGATTTGAACTCAAAACTGCATATACCAACTGTATTTCGATTTATGACATTCAACTATAAATACACAAGTAGCAAAC
CTATCTTAACAAGTATAAAGCTTCAATCTTTCTCTAGAAAAAAAGTTATAAACCCTGATATCTAACACCAACAAACTACATAAAGGCATAAAGAACATCA
AAACAGCACCTGATCATGGGTTGACTCGTTATCCCTCTCCGCAATAGCCGAAGCAGCTGATTTAACTGTGGAAGCAACAGTCGAAGCACCAGATGACACA
ATCTTAGATAAAGCTCGAAATGAAGACGGAAAAACACCATTTTTGCTCCTTCCTAACGCAACATTCCCGCCTTCAAGAGGTGGTTTCTGCTCATCATTCC
TCATTTTCTGATTCTTAAAACTCCTATTCTCTACTCTTCTGATCATAACCTTAGCTTTATCCAGCCCTATATATATCACCGTTCTTGATAACCCCTAGGT
AGTAGAAAACGTTATATCTCACACCTGTCCATACCTTTTAATTCCAACATCGCAAAAATCCAAAACCCAACGCTGCATAAAACACACCGCTTCTTCTCCT
TCCAAATCACAACAGAATAGCAAAACAGTAATTGAACCCCAAATCTGTCTTCTTCCAAAACTTCAAACTATCAACACAACTACCAAACCCCACAAGTAAA
AATCCAAACTTTAACTTCAAAACACAACAAATTTATCAAAAACCTCTTTTGTTGCAATCCTGTACATCAAATTCATCAATCAAATAAACTTTATTTTTTG
TTTATTTTTTACAAAGCGTATAAAGAATTCACAAAGAATATGTACAAATCTAGATCAAATGATTCTCAAAAAATTGAATCGTAAAGGGTTTTCAATACTT
CAACAGAAAGAGAAATAGATTCCCAAATTAATTTTTTCTAAAAAATTAAAAACAAATTAAGCTAATAACCATAGTAATTTTTTCTGGAGAATGAAGAAAT
GATTTTTGAAGGATCGGATAATGAACAAAGATGATTGAAGAAATTATAAAGCCTTTACGTCTCTCTTTCTCTCTCTAAAATTATATATGTATATATTATA
TATATTTTTTATTTTATATTTACTAATAAATGCTATTTATTTATTTTAATTATCTTTCCTTTTTTATTTGTTGTTCAACAGAAGGAACCTCCCTTCACGT
TTCGTCCGTCGGTCTTTTCACCGCCGGTGGCCGCTGTAAACAGTTAAAAGTTAAACTCCGTTTAGAAAAAAGATAACGGAGACGGTGACTTGGGGAGAAC
GTAAATTTGCAGAAAGTCCTTCCATTTTCCTTTCGTTCGACTATACTTATCTATTCATTTATGAAATATGACGAAAGAACAGATTATAAAATCTATCATA
TTAATTTTATTCGATAGATCGATAAGAGATTTTTTTTCATTTGATTGAATTTGTAATACTTTAATTTCTATATTGAAACTCTTGACTAAACAGAATCGCG
CATTGCAAGACTCATTAAAATAGACATAATATATATATTGGACTCTAAACTTGCTTTCAAATTTTAACTTTGACCTTCAACTGATATGTAAAACATGTGT
GTCCATTTGTTCAACTTTATACAAGTTTAGGTGTCTATTTATGTATACCCAAAATTAAAAAGCATATATATAATTCAAAGCTAAATTAAAAGATATATTT
AAATATTTTGCCATAAAAATATGACGCTCTCGATAAAATTTTCTACTGGCCCGAGTTTTCATTTCATTTAGTTGCCACAAGTTTGAAAGATATGTTTCTC
TACGCAATTATTAATTTCCCTTCTTTCAATTTTTTGTTCTATTTAATTATTTAAAAAATAAAAGAAAAAGAATCTTTTTATAACTTTTTAATTCATTCTA
TTCACGTATATATTTAGATTGTGAGGTTAGAAAATATATTTTACATATTTTTAATTTAAAATTATGAATTTAAATTGTTTAGATTGTGTGGTTATAAAAT
ATACTTTAATATATTTTACGTAATTTTGGTTTAAGATTATAAATTTAAATTCTTTTATTTATTTATCAAAATTACATATTAAATCAAAATATATTAAAAT
AAAGAGATTAATTAACCTTGGAGAGCATATTCCATTGTAATATTCATGATATTAATAGAATTGGAAAATGATTTAGAAAATTGGTAGTTAATATTTAAAA
ATAATCTTTTAACACAGTGGACTGATAAAAATGATTTTATTTTTAAATTAATATATTACAATAACATAGTAATAAAACAAGAAAGGTATAAATTTACTAG
CACCATCAATTAAATATCCTACCATTCTTAAGGAAAGTGATTGTCTTGAAGAAGAAAAAATATCTTACATCCTTGAAGGAAGCATTTTTACCCCAAAGTT
ATCCAAATTAATTACATAATGCTAATGATAATAAGACAAGAGAAAGTAAATATATTGACACTCACATTTAAAGGCTATAATTGTAATTATAAATATCTTT
TCGTTTATCACAAAAATGTTCTTATCCAATATAATGCTATCAAAATTTTAAAAAATATTAAATTCAAAAAAATAGGAAATATATATGAATGATAATAAAA
ATAAGCGAAGTAAATATATTTTACTTTCACACTATAAAGGCGATGTTATTAAAAAAAGTTCATTTATAATTAAAAAATATTTTTACTTAGAATAGCATTA
TCAGATTTGAAAATAGATAATATCAAACATAGAATTACAAAACAAAAAACATAATCCTTCTTAATTAATATTTTTTTTTAAAAATCAAACATAGGATTAA
AAAAATAAAAACATAGTCCTTCTAGATTAATATTTTATAATATACTTTTTTCTAATCATATATTATGATAATAAAAAAAAAGTACTAACTTATATTATTA
TTAATATTATTATTATTATTATATATTTTTAAAGTATTCAAAATTAAAGTTTTAAATTAATTTAATTGGATCTGTAAATCTGTCATTTCCGGACGCATGT
GCCAATGTTGAATACTAATATATATATTCTAATGTAAAAAATCATCTTTTTGTTAAAATAAAAATATATGTTACAAATAATGTGAAAGATCGGGATCAAG
ATATAATACTCGTAAGAAATTAAGAATATGTTGGATTATTCCTAAATAAAACCTTAAGTGGTAATTAGGGATAAACAGTACTCTAATTAGCAAGTTGAAC
TTTTTGATAAAAGAAAAATATCATTTCAAAAGTGTGTTTCTAAAAATTAATTACAAAAATTTAAATTTAATCAAATCTCAATACAGATCTCAAACATAAA
ATATATAGTAAAATTTAAAAAAAAGTTATAATGCTACAATTATTTATTTTTTGCATCGTATAAATTGGTGAAAATCAAAATAAATGATCTCTCAAAGTAT
ATTGTTAATCAATTGAATGAATCTTTCTGAAATTTTAAACAAGAAGGAGATGTAGGACTTTGTTCAAAGCCAAACTTATTTGACTCACACGTGATTGTCA
AATTATACAAGTAATTTATATTAATTTAATGACTACATGTCCACACATCAACTCATTAAAAATGTAATAATTCCATTATATTATATAGTCTAATATATGC
AAATTTCAACTTGAGTTTTCTAGTACCCATGACCCAACTAACATAATTTATTTTTGTACATAGTAATTACCCAAATTAGATATACTATGACTATTCGAAG
GTTGTTTCTAGACAATGTAATGTACCAATGCATTCATTTCACTTCTATTACTTGTTACTTTTGTTTTAAGATATTTATTATGATTTTTTTCGTTTAAATA
CGATAAAAAATACATTTTAAAATGTTGATTTAATTAATTTTCATATAGTTTAACTATTTAAAAATGAAATATGATAAGTACTTAATGACGATCATTGTCA
TAATATATATTAACTATGTATCTAAAATTACTTATTCCAGTTCATATTCGTGTTGTGTATACTTTATTCTCTCTCTCTATATATTTTTCTAAAGCTATTA
AATACACGTGCACATTATGTTTTCAGGTGAATTTAATTTTATCTAGGACATTCATAATGTCAATGATATACAAAGGGATGACATAAAGGCATGAAAATAT
GTTTTTAGCAACATATACATGTCAATGCTCTATAAATTTCTAGTTTGAAATTAAGTACACCTAACATTTTTTCCCCATACGTCTTTGTAAACTTGTCTTA
TCCGTTTAGTTCAATCTTTAATGATGTAATATTAATTATTAGGTAATCATCGGATGATAGAAATTCTCAAAGAGTTGTGATCCACATATTTAATCGATAG
ATTAAAACTAATTACACTCGTTAATTAAGCATATAAAAAATATGTACATTTAGTTGTGTATTAACATTAGGACCTTTTAATTAGCTTATACAAAATCCTC
ATAATACTAATGACTATGCATTAGTAATTACTCAAAACATTACATTGTAAAATTGTTCCTATTAAAATGGTTTCTTATATTTGGTAGTTGGTTCAAAATA
GTTTGTATTATGTGGATATTTTTCATCCTCTAAGTTTATTAAAACTGAACTTTTTTTTTTGTCGTCAAGATATTTATGAAACGCTTATTATGAAATTTAA
TAAAAACGTGAAAATATAAAACATTTAACCGAAACTTACATTTAAAATTACAATTATAGTTTATGTCATATTTAGTTTATTTCAGGAGCTTGATACCATA
TCTTGTCAAACTTAATGGACCAAACTGCTTAACATAATACTTAAGAGGCTAATTAACATTTTTAACAATATACATAAAATTATTCTAAAATCCTAACTAA
ATTCGGAAAAAAAAAATACTCCTATTCCTATACAAACACGGAAACAAAAAATTCCTTTTATACGTATGTGAATAAGAACAAAAATATTATTAGCTATTAT
TCAAAAATATGGCACTTGTTGATTCATTCATAGCTGATTTAGATGAATTAGACGTATTATCCGATGATGTTCATGGAAAAGCTGATATGGATGATTTTGA
TAATATTTCAAAGCTACAAAAATCACGTAGGTACGTTGATATAATGCAGAAAGTTGAAGATGCGAATAAAGGTGATGTTATTATTGAAGAAGATGATCAT
GAATATAAGTTGATAGTAGATTGTAACGCATTATCTGTTGAAATTGAGGATGAGATTTTTATAATTCATAATTTTATTCGGGATATGTATAGATTGAAGT
TTCCTGAGTTAGATTCACTTGTTAATCATCCAGTTGATTATGCTAGGGTTGTTAAAAAAATTGGGAATGAAACGGATCTGACTCTTGTTGATTTGCAGGA
ATTGTTACCTTCAGCTATTATCATGGTTGTTTCTGTTACGGCGTCAACTACTAGTGGCAAGCCGTTGCCGGAGGATGTTTTACAGAGGACATTGGAAGCA
TGTGATAGAACCCTAGCTCTTGATTCATCGAAGAAGAAGGTCGTTGATTTTGTTGAGAGTCGAATGAGTACTATTGCTCCTAATCTGTGTGGTGTTGTTG
GTAGTGCAGTTGCTGCGAAACTAATGTGTTGTGCTGGTGGTTTATCGTTGTTGGCGAATATGCCTGCTGATAATGTGAGGAGTCTGGGTGGTAAAAGGAA
GAATTTAGCAGGGTTTTCCACAGCTAATGCTTTGCGATTTTGTTATATTGAGGAAACAGATGTATATCAGAGTACACCTCCTTCGTTGAGGGTGAAAGTT
TGTAGAATTTTGGCGAATAAAGCTATTCTAGCAGCACGAATGGACTTGAGCAAAGCTGGAATGTTCAATTTTAAGGAAGAGATTTGTAAAAAGATGGAGA
AATTGCAAGAGTTACCTCCTGCAAGGCTGCCAAAGCCTCTTCCAGTTCCTGATTTTAGGTCTAAGAAGCAGAGAGGTGGTGTTCGGCATAGAAAGAGGAA
AGATCTATATCAGGTTACAGAGGCGCAGAAGCTGAGGAATAGGGTGAAGTTTGGGTTACCTGAAGAAAGCTCGTTAGGGGATGGATTAGGGGTGGGCTAT
GGTATGCTTGGTCAGGCTGGAAGTGGCAAGTTGCTTGTATCAGCTCGTCAGAACAAGAAAAAAGCAAAGATTTACAAGGTGAAGAGTTATGGCGGCAGTG
GTGCAGCAGCCAGATCAGGCCTGATGAGTTCGAGTTTTGCCTTCACACCTGCACAAGGGATTGAGCTATCGAATCCTCAGGCATATACGGATGGAACTCA
AAGCGCCTATTTTTCTGAGACAGGAACATTTTCAAAGATTAAGAGACAAAAGTCCGTTTTTGGTGTTTGAGATTGCAAGTTCAATCATGATTCCATTAGG
TAGCAATGACTTACTTTACAGCTTTATGTTTACTGTGAAATATTAACATCCAATACTAGTTTTCCAGTTTTATCATTTCACATTCAAATCCTATCATCAT
GCTATGTGATTCCTGATTTTAGTTGTTTGGCCAATTTCGAGGTGTTCTGTACCTGTCTACCTTCAAAACGAAGCAGATTGATGAGTTTATCCATGGAAGC
AATGTTATGCGAGGATAGTACGAGCTTGAGGAGGTGATCGAAGTCACGTGCATGTGAGTTCCACGACTTCTCCTGTGTTTTGTGCAGAACTGAAAGCTTG
ACGTAAACAACATAAATAATCAAGCAATAATTGAAATTCTAAATCGTTAAATTCCACGTAGTCCAATTTCAAGTGTCTACAAAACAAAGTTGCAAAAATA
TACTGCAGGTGAGTTTTGTACTAAACGCATGGCATGATAAATTCTAAAACCAGAATAAATAAAGTATTACAATTACAGCCAATCAAATTATGTTAACATG
TAAATAAATTCATAAAGAAAGAAAATTATTATCAAAATGAAAAAAGGAGTAAAAGGCAAACAATTACAGATTAGAATGAGGAAGCTTGATTAGTGGAATG
GTAAAGTGGTAACAGCTAAGACGTAGCAAAATCAATTTTATAATTCTATTCATACGCGCTACCCCACCCTTTTGTTATTAAATTATTATTATTATTATTA
TTACTTTTAATATTATTCATTATTTAATGTTTTCATCATTACTTATTTATTCTTCTATTTGTTTCAAACATGCTCTCCCAAAAAGGTTCTTTAATCAAAT
TATTATATCATAAATTGTTTTTGTTTTGAAATACAATAAGCTCTATTTCATTCTTCTCAAAGTTATTAGTGAAATTATGAGAATATATATATAAATATTA
CAAATTGACTTATAGAATAATATCAAATACTTTTGATAGTCTTTTTAAAAAACTTATAAAAAGTTATATACGTAAATTTATTCATATACAACAATTTACA
AATCACACAAGCAATAGATTGCTTTAATTAGGTACGAAACTCAATCGAAGTGATTATAAATGGTTGGAATTATTTTTTTTATAAATATATGATAAATGTA
AAATCTCTTTATTTTGTTTACTTTTTTATATTTCAAATTCTTTAGTGAAAATCATAAATACGCCACTCGTTTTACATTATGAGATATTCTCATTAAACAT
CGTTTGTAGAATATATTAGAAAAAATAAATACATATACTAAGCTTGTATATTATTATCTCTTATTTGATACATTTTTTAAGCATATACATTAATCATACA
TTATATTGTGTATTAATAATACAAAGAATTTCAACATATGCATTAGATTGATTAATGACATAACTAAGCTAAAAAACAAAGGATAAAATCAAGTCGTGTA
CGAAAAAATAATATCAATATAACTAATACGTCTATTATTAAATGCAAGTATAATAAATACTAGTATAACATGAAGATACAAAACATGTTTGATGATCAAT
AATGACATTTCCATTGTCCTTCTTCCTGACAAAAATACCACTCATTTTTTCCCAGATCCAATACATTCATCCATCTTCGTCATTCCCCAGAAAATAAATT
CATCATCAATTCACTATAATTTGTAGTAGTAATTACTTCAACACCATCACCGGAAGTTAATTATACTGCTCCCAGGTCCCACCGAATCTCTATCGCACGT
GATTCCTACGTGCTACCGACTCATCCCTTTTCACCAATCCATATATCCATTTCTCACATTCACATCACCCAGCCGCCGAAGTCGATTTCCGGTGCCGGTG
AACTTCACCGTTGTGTTAGATCTGGTGAGAGATGGAGTCGATACTAGCTAGAGCATTGGAGTATACATTGAAGTACTGGTTAAAGTCATTTTCCCGAGAT
CAGTTCAAATTGCAAGGGCGTACAGCGCAGCTTTCTAATTTAGGTCGGGTCTTTTTCTTTCTTATTAGTTTTCGAATTTCGAGATTCAACGAAAGTTGTA
GTTTCTAAATATGTAAAATTCTCTGGAAATTCGAGCTGGTCACAATAATTTTAGGACAGAGATAGTATGTTATTTGAAGCTTGTTACTTAATTATACAGC
TGAAAAATTGGTGATTGATTTGTTTGGTAGATATAAATGGAGATGCTTTACATGCGAGCACGGGATTACCACCGGCATTGAATGTTACAACGGCGAAAGT
TGGGAAATTGGAGATCATTGTTAGTGGTTTTGTCTCTTTATTTAATGTTTGGATTGCTAAATTCATTATTTTATGAATGAAAATACAAAAAAATGATCTT
TGTTAGCTCAGTTAATTAGTTGGCAATCTGAACTTTCATCTTTTTGGTGAGGGTTTGATTTTCCGCTTTGTAATCCCTCTGTCCCCATTTTTTTAAAAAA
ACATTTAAGTCTAATTGTGTATTGTTATAATTGTCCTTTATTTGTTTAACTTTGGTTTTTCAACTCAAGCTTCCGTCAGTAAGCAATGTGCAAACGGAGC
CAATAGTTGTGCAAATTGATAGACTTGATTTAGTTCTTGAAGAAAGAGATGATCTTGATACACCTAAGAGCTCTAGCAGGTATTATAGAGGCTCAACATG
ATTGATTTACCTTTTTGGATAGTAGCTCACGCGTTGGCCATATATTTTGAAGTTCAAACTTGAAAATTTGATTTTCTGAAGTTGTGTTTGGACGTGCATT
TTATTTGGAAAAAGTAGTTGAAGTTTTTTTGAATGGAAGTTCAAATTTCTGCAAAACAGAGATTTGAAGACAAAATTTTCATAAGTTGATCCAAAATCTA
TGGCCAAATGCTAGCTTGAGCTTGGTTTGATTATTGTTGTCTCACTTGGTATCATACTGCTTTCCATCAGTCCGGTGTCATCTGGTAGCTCCTCGAAGGG
AAGTGGATATGGATTTGCTGACAAGGTTAGCAACATAATAGTATCAGCTTACTTGGTTTGATGTTATGTAAGAGTGTTTGAGTTAATTCCTTGCGGGGCA
ATGGGAATTGTGCGTACATAATTTGTTTAGATTTGATGATTTCATACACAATTTTGAATGTGATAATAAAAGTTGATTACGAAATACGAACTAGCAAGTT
GCAATTATGATATCATCCATCATACGGGTGTTTCAAGAGAAGGATGAAATACATTTTTTGAGATAAAGAGAAGGATGAAATACTTAAAAATGCATATAAT
TTTAAGATTGCTGATGTAAAGCATAATTCAATGGGTTCAGTAGACCCTTAGTATTGTTTAATCAGCATAAACTTTTTATAGGTCTGCAGATGGTCATATC
TTCCATATAAGTGTGTAACTAAAGCATCAAGATATTGATTTAAGCTCTTGGTCTTTCTGTTATAATTATTATTTTGCTTCTTCATAGTATCCATCACCAA
ACTGAAAAGGGAAGGTGGTACATAGGGCTATTCTACTATTGAAATCATATGATATCCAACATCAGCATGCATCAATTTGGTAATTGCAATATGCCTCTTT
TCTTTTAAGAAATCAATGTAACTGTGTTTCTTTGTTTTCCATTTTTTCTTGGGTAGAAAACTCTAAGCAGAACTCAGTTGTAATAGATATTTTATTACAT
GAAAGTAACTCTACTTTGGTCAAGTTCCTCGACTATTCTATGCTAACTGATTTCTCTATGTACTACATTCATCACTACTCTTCTTATTTTCCTTTGTCTT
TGTGTTTAAATTCTCAAGTTCTGGATTGTCAGATTGCAGATGGCATGACATTACAAGTCCATACAGTTAATCTTCTACTTGAAACTCACGGAGGTGCTCG
ACGCCGAGGAGGAGCAAGCTGGTAAGTGTTCAATACCTTCATTACTGATTCTTTATATCCTATTTTTCCTGTTTCTTTTACTTACGAGAACCAATTCTGC
ACTCTCCACCTGTTTCAAAATCGGACTGGATATTCTTATCCCTCAATGCTTTCTGATTCCCTATTCTATTATCAGATCCTCAAGCAAGAAACAAGTACAT
AATTGAATAGAACAAGATGGACCTAGTGATGGTAGGTAGGACTAATGTTGATCAGTTCCGTCTAAACTCTAGTCCATCACATTTCACCTGCGCTTGAGAC
CCAATTTGAAAGCATTCTTCCTTAACTGCAGAATTTAGACTTTAAGAACATAACTAGAAATTTGGTACACTCAGTGAGCTGGGATATTTCTGCAGATTCT
TTTAATGAATGACTGAGAACTATTGAGCTGCTGACATTCAACATAAAATTAAAGATTTCAGGCAGAACAAAAATTTACAGATAGTAATAGGAGCAATAGG
CGAAGAAGCTTAGAAGAGACCACTACTGATGCTAGGAGTGAAAGCATGTTAATAATATGGATTTGGATTTAGGCCTGGACACCACGGTTATAAAATTAAA
AAAATAAACATGGATTTGGATTTAGAGTGGCTTCACAGAAAAGAAAAATATATGGGTTTGAAGTCACTTTGAACTTGGAAAAGAACAAGGTAGTGACTCC
TAGGTTGAGATTTTATAGAATTATAGCTTGATATAACGACAAAAATTGTTCCAGAAGCCGATAGCAGTAAAACTCAAAGCAAAGCATAAATAAATCACTG
GACATGGTTTAGATATTGCCATACTGCTCCATATAAATCAAAGGGTTCTTTTTTCTATTTATGTCCAGATCAAAATCGTGTATTATCCTACTTTGATCCT
TTTGACACTCAATTCTATGTCCAAAAGAAAAGAGAAGAAAGAAAAGCAAGTAGATGCTTAGAAGACTGTCAAATATGTCGGATAAGTAGTTCTTGAACAT
CATAGATTGGTTTGTTGGGTCATCTAAACCTGAGAAATGGCAATATAATAATTCACAATTTACCATTATTATTTGCATATTGCCTTTCTACACCTATATA
TCACTGCACTCTATTTGAGAGCATTCAGACATTGAGTGCAAAATGGTACTTCGAAAGGCTCCAAACTTATAAATCACATTCTATTGTTTATGCTCAGATT
CCCTTGCATCTTTTGGCAGGCTCTTAGCAAAAACTTGTGAGCATTTTTATTTACCTGTTAGGTTTGGTTTCAAACAGTCCCATGATTTAGTTTTCTATGT
TAGATAATGTTCTATCTCTCTTTATTGATTGTTTCACCAGGGCATCACCTATGGCATCAATTACTATACACAATCTTCTTCTGTATACTACAAATGAGAA
CTGGGAGGTAAGGTTGCATTTATTTTAGATGAGATGACTTGTGTAGTTGTTGCTTAAGAATGACTCAAACAGTATGCTATTGCAGGTTGTAAATCTAAAG
GAAGCTAGGGATTTCTCTACTGGCAAGGAGTTCATATATGTGTTCAAAGTAATTACATTTCTTTTTCTACTATTTAGAAATTTTTCCCAATTTATTTACA
TGAATGAGATTTTATTATTCTCGCGGTAATATCTACAAGATTGTTCTGAGTACTTTTTTCTTTTATGCAGTGTCGTAAATCCTTTTTACTCATCTTTGCA
TCATTGTGTCGTGTTGCATCATCTACTTTTCTTTTAATAACAGAAACTTGAGTGGGGACATCTATCTATTGACCTGTTACCTCATCCTGATATGTTCGCG
GATGCAAATTTTGGAAGCTCTCAAGGGGGGAATAACAAGAGAGATGAAGATGGAGCAAAGCGAGTGTTTTTTGGCGGGGAGAGATTCATTGAAGGAATAT
CTGGAGAAGCTAATGTAATTCAAATTGGGCACACAATTTTCTTTCTATGAATTTTGGATATGAACATAGGTTATGATTTGAGGCATACAGACCACTGATA
TTAATGGATTTCTTGCCTTTACATTGTTATCAGATAACGATTCAGAGGACTGGACTAAATAGTCCACTAGGACTTGAAGTTCAATTGCACATTACAGAAA
CTGTTTGTCCAGCTCTAAGTGAACCAGGCATGTAAAAAGAAATCGTGCATTTTGTGGATCTTTTCATGTCTTGTTCTTTACAATTTGCTTATCACTATTT
TGATTTTGCAGGATTACGAGCTCTTCTTCGCTTCATGACAGGATTGTATGTCTGTATAAACAGAGGAGATGTCAAGCCAAATCAGCAAGTATGAGTGACT
CCATTGTCATTGACTTATTAAAATGGAGCCAAAGTGTTGATATAACCTTTCTGACTTTTCCAATGGATTGTTAACTATGACAGCATACAGAAGCAGCTGG
GCGGTCTTTGGTCTCCGTTGTTGTGGACCACATTTTTCTACGTTTGAAGGACACAGGTTAGGTTGGCCACCTCTAATAAATGTATTCTTTTCCCTTTGTA
GGGGACAGGCGGTGAGAAGATTCCTATCTACCAAAAGCTAACTATATATCTATCTGAATTAAACCTATAAAACCAAAAGAATAAAAAGAAGAAGATGAAA
TTTAACACTTTGAGTTTTTTTTCCAAAGGTAACAAACAGTATATTCATCTTTGTTGGTAGCACGTTAACAAAATGATCAATAAAAGTTCAAGCTGTTCTT
CTCTACTTACAAGGACACTAAAAAGTGTAATATTGGTTCTGTTTCAATCTCAGGAAAAATCCTTTTGCCGAAAAATAAGAGACAATATATTCCAGCTTAA
TCTTTTGTAGAGAATTGTGTTTGTCTTCAGAACACCTAGCATACTTGTAGTTTAAGGAGAATAACTCAAACAGTATGATCTAAAAGTGATGATGCAGCAA
AGTAATGCCTTATAGTTAAACTTCAAGGATGAAACACATGATGAACTTAATCAATCAAGTGAAGCTATATTTTGAGATCGGGACTAAAATACATACACCA
AATTGGTTTACAAGTAAATGATGTGGATCACAATTTGGAGGATATTAGATAAATCTAACTTACTCTTGGTGGAGGATGATTTCTAAACAACTTATTATAT
TTAATTCTTTTTATCTTTAATGTTTGCTTTTGTTCAACTTCAAGTAACTTTAGTCTTCATGAAACCTTAAACCAAAAAGTACTCCCCCTCTAATAGCTTA
AGCTTTTAGGTTTGGTAACTCAACTGAGTAGGCAAAAGTCTTGACTTTGAGTGTCATATCACCCCGTGCTTGGCTCAGGAAATGAATCACCTACATGTAA
GGATGCTGCTGCAAATAAATGTGTCCTCACTCTAATAGTTATTTGTATACATTTTACACAAAAGATAAGGAAGCAATTAAAAAGAGATCCTAGTACATTT
TACATCCCTTGCACTCCTTTTGTAAGACATTCCATTTCTTTCATTTGAGTTGGGGAAAAATGTACAATAAGTGTTTTTATATTGCCTTTCTTCTCTCAAA
ATCCAAACTTGCGAGTTCCTTTGTGATAGTCCTAGGCAACACTTGTGCTATGTTGAACATTGAGAATGTAGGTTTGAAAAAAGATGTTGACAAACCTACA
ATGCATGTGAAGATGATTGTTTCCCCCTTTGAACTCCTCACACAAGGAGACAAAATTACCATCATCTACCTCCTAGTTACCCTCCAGATAGTTTCATGTA
AAGGTGATTTTACATCATTGCTTTGTGTATAAATTCTTCAATATCCTCCACTCCTAGTCTTCAGTGGCCCTACAGAAACAATATTCCAAGTGACTCTGAA
ACTATTTGTTCTTAAATAGTTTTCCATCATTGCCTAACTATAATTATGCCGCTCCAAACACTAATGGAAAGTGTGAACCTCTACCATTTGACTGTGCTCA
AAACCCCAGACAAATATCTGGAGTTTTCTATTTTTTGCCTTTGACAGCACTGAACTTCGTTTTATGGAAGATCAAATTGTTGCACCTCATTGATAAGTCC
ACTTTAAGATTTGTCGGGTCACTTAGCTGGTCTACCTTTTTTTTTTTGCTAGAAGACAGCTGAAGCAAATGTAGTTCAATGCATGAACTGTCTGCTACCC
CTTGAGCAATTTATAGTATCCAAAGTGATTTGTGGATATATTATGTTTTTATTAAGGATCTATGAATGGATGTTTTGCTTGCCTTCTTTGCGAAGCCTTT
GATTTAAATAGAGGATACTATAATCCATACTGTAAGGTTTCTTACATCACATCAGGTTCTTTTAGAAGTTTCACAATTAGTGTCGGTTTGCTTTGCAGAA
TTTCAGCTTGAACTTTTGATGCAGTCTTTATTCTTTTCTCGGGTACGATTTCTTATTGATCCAAAAAGGCTTCTACTTTATCTTTTTATGTTGATTCATG
AACTGAGATGCAGCGCATTATATGCTGGTGGAACCAGCAGTTGTTTTGTTTGTTCTTCATTAGGGCCTTTATATTGGATTTTTCCTTCTGCAGGAAAGTA
TTGCAGGTGGAGAAAGTGCCAAATGCTTAACTCGTCTTATGATAGGAGGAGCCTTTTTAAGGCAAGTTTCTGTGATTCTGTTATCATAGCACAGAATCGC
ATACTACATAAGCTGAAAAGAATGCATTGACTGCTACTTGAACTTATTTGAACAAAAATATATTTATTGTTTATCACTAGTTGCAACCAAATAACCATGT
TTGCTTAGAATTATATGCATTCTTTATATCTGGCTCTGGTAACTCCGTTATGTATGCTAACTTCAGTTTGCGAGTCTCAGAGATATCATCACAAAATCTT
TACCTTCACAGTCATGCAAGAGATGAACTAATTCTGTTGTCATTGCAACTATAGCTTGAATTATTCAAGTTTTCAAATATGAATCGTTTTAACCTGTGAA
ACAGTCCCAGAGCTCAGATCACTAAACTATTTCATTATTATGTTTTGTATCTCATAGAGGGTTGACTCAATCTGCAATAGCATCTGCAGCTTACTGCTCA
TATCAGTTGTTCTCTGACAAACTGCTTGTGAATATATGTTCTTGCACTTGGAGCATTTGTGTCATCAAATACTTTTGGATTTGATCCTCATTAAAAGGAG
TAAATGGAGTTTCTCTTTGTTCTACTTCTAAACTATATCTATTTGTTGGAGTTCATGCAGTTAGCTTTAACAATTCTTACTTTGCCCTTCTTGCAAGAGG
AATTCAGAGCCAAAGATCTTAAAAACAACTTATGTTGGCAAAAGTAAACCCTAATTTAGTCTCATAGGGTCGGTTACTTGATAACAATCTGATTTAATTG
ATACAAAGTCCTTTCTGAAAAACTCTTTTGCTGAATTTGAGAGTTGAGTTTCTACAGCACGTTCTAAGTGCACCAGATGATTTAAATGCAGGGATACATT
TTCACGCCCTCCATGCACCTTGGTGCAGCCATCTGAGTTGACGGATTCTGATGATGTTTTGAACATTCCAGACTTTGGTACTAACATCAATTTTGCGGTA
CATTTGTTCTGTCGATAGATTGCTTAATCTAGAATTTATGGTTGAAATTGAATGTATTTCTCCTTTTTCTTAATTCAGGTAAAGATTTTTGTCCTCCCAT
TTATCCTCTAGGGAACCAGCAGGGGAACTTCAGTGCTGGGGTCCCCTTGATCTCTCTTCATTCTCTTCAGCTCAAGCCTTCGCCATCTCCACCAACTTTT
GCTTCTACAACAGTTATCAATTGTCAGCCCCTTATGGTATTCATGTGCTACTAGATAACAACCTCATATTGTCTTTTCTTTTGGCTATCTGATGATGAAC
TATGCTGCTCTTCTTGTTTGTTTGCCAGATTCATCTTCAGGAAGAATCATGTTTGAGGATATGTTCCTTTTTAGCTGATGGGATTGTAGTTAATCCTGGT
GGTGTAGTTCTATCAGATTTCTCGATTAACTCCCTCACATTCAATCTTAAGGGGTTAGATATCATTGTCCCATTAGACATAGGAACAGGAAATCATACTG
TTCCAGGTGGAGATGATGTTTGTCATAGTTTGTTTGGTGGAGCAAGCCTTCATATTGAAAATTTCACCCTTTCTGAGTCACCTACTCTTAAGCTGGGGCT
ACTAAACCTCGAGAAGGATCCGGCATGCTTCAGTCTGTGGGAAGATCAACCAATTGATGGTAGCCAGAAGAAATGGACTGCTGGTGCTTCAGTCATTAGT
CTCTCTCTACAAACATGTAAAGATTCAACTGGACTCCAAAATTCTCTTGCATTACCTTCAAATTCATGGAGATGTGTTGAGCTGAAAGGTGCTTGCCTTG
AAGTAGCAATGGCTACTGCAGATGGAGGCCCTTTAACAAATGTCCCACCTCCGGGAGGAATTGTTAGAGTGGGAGTTGCCTGTCAGCAGTATTTGTCCAA
CACTTCAGTTGAGCAATTATTTTTTGTCCTAGATTTTTACACATATTTTGGGAGAGTAAGCGAAAAGATAGCAGTTGCTGGGAGGTTCAATTCGCAGGCG
GAAGTAAGTCATAAAACTTTAGGTCGATCATTAAGCAAAAAGGTTCCCGGAGATGCTGCTGTATGTTTATCAGTAAATGATCTGCACCTAAGATTTTTGG
AATCTTCTGCTGCTGACATTTCAGGAATGCCGTTGGTCCAATTTATAGGCAAAGGCCTGTTCATCAAAGTTACTCATAGAACCTTGGGGGGTGCTATAGC
CATTTCGTCCAGTTTGCTTTGGGAAGGTGTTGAAGTTGATTGTGCAGACACTCTGAGTAGCTTGCCACGTGAGGACAGCTCGGTGTGGACTTCAAACCAA
AATGGCCATTTTGTGGAGAATGGAACTCAACTTAGATCTGTCTTTTGGGTGCAAAACAGGAAGATCTATCGATCAAATGGCAGTTTTGTTTCAGTTCCCT
TCTTGGACGTAAAAATGGTACAGGTGATCCCTTATAAAACACAGGACATGGAGTGTCACAGTCTAAATGTTTCAGCTTGTATTTCTGGTGTCCGCCTTGG
AGGAGGAATGAATTACACAGAAGCCTTACTTCATAGGTTTGGAATTCTTGGGCCAGATGGTGGTCCTGGGGAAGGGCTTACTAAAGGATTGAAGCATCTG
TCTGCTGGGCCTTTGTCTAAACTTTTGAAAGCAACACCTCTTACCCTTGATGAGCATCAAGATGGTTGGACTCTTCAACTTACAATGATGCTATATACTT
TTTCCATCCTTATTTGGTTGCACTTTTTCTTTGGCACTTTGGCTAGGAGAATACTTGAATATATGGGTGGTTTAATAGTTGTGAGTTAATATAGTGGAGC
CAGAGTATGCCTTTTTCGCTGAAAGAATAATTAGACGATAAAATGATAAAAAAAGAGGATAAATGGTCCACAAAGCTGTCTTATTTTGAACGTGTTAAAA
CGTACCCTTTAAGGAAAGTGGCTGCATTTTGTAATAACTTGAAAAGGGAAATTAGGCACAAGCATTTCGAGATGGAGAGAGTATTCATTTTCTTTGCCAT
CTATGATTTCACTGATTAACTTTGCTTGTGATGTTGATCAATGATCTCATTTCTTTCTGGTTTTCCTTCTTTCTAGATGGAAAGGACACTGGTAGATTAC
AGTTGGAAACACCTGATGACGTGGATATATCCATAGAATTCAAAGATTGGTTATTTGCTCTGGAAGGTGCACAAGAAGAAGCAGAAAGGTGGTGGTTCTG
TGATCATGAAGATTCTGTCAGAGAAGAGCGGTGTTGGCACACAACTTTCCAGAACATTTGTGTTAAAGCAAGCAGTTCTAAGCATGTAACAAATGACAGC
GGAAAATCTCCTGGCAAAAAAAGATACCCCCTCGAGTTGATTACTGTAAGCACTTTATTCTTATTGTGCAATATATTTGCCTTGGTGGAAATGATAAACT
TGATTCATGTTAGAAAATACTTTATATCTTGCATATGGGGTTTTTCCGACTGTAACTTTAAAACAAGGTCTAGACAAGAAACATTGCAATGATTGTTTTG
CTGTTTTTCCATCTATCTTTATAGCTTAAAACAGATAAATATGCACTAACCTTAGTCTTTATGCAAATAACTAGTTTCTTTGTTCTCTTGTTTTAATAAT
GGCCTGAGATGTGTTTAAATGGAGCAACATGGTCAGTATTCATATAGTCGATCCCAACTTGATTGGGATTGAGGCCTTGCAGTTATTGTCACTTTTGCTC
ACTTACTTGTAACTTTTTTTCTTTTCATGGAGATTTTTAAGACAAGTAACCTAACTAGGAGCTGCTGCAGGTTGGTATGGAAGGTCTGCAGATCTTAAAA
CCACGTTCTCCACATAGTATCAGGCAAGATAGTCCTGAAGGACCTCTTAAAGAGACTGCTGAGAGATTTGGTGGTATGAACATCGAAGTAGACATAGTGA
ATTGCGAAGACGATATTGATGATGGATTGGGAAAGTGGATTGTCGAAAATTTGAAATTTTCTGTCAAACAGCCGGTACAAAAATTTTGCAAGTTTGTCCT
TTGATTTCTATCTCCCTGCTTTGTGTAATAAAGAAGTTTGTGTATTTGGCAGATCGAGGCAGTAGTGACTAAGGCTGAGCTCAAGTATCTTGCTTTCTTG
TGCAAGTCTGAGGTTGACTCCATGGGTCGGATTGCCGCTGGAATTCTGCGGGTACTTAAGTTAGAAAATAAAATTGGCGCAGGAGCAATCAGTCAACTAA
GTAACTTAGGTAATTTTTGCATCTTATTTAGAACTTCATTTTTCACAATATATTTCTTCATTCTGTAGTCTCGAGATTCTATACATAAAAAGCTT