BAC Sequence – LE_HBa0102J11

>C07HBa0102J11.1
AAGCTTCCTTTTGCTTTTAGCCTCTTCTTTAATATTCGCATTAACCCTTCTCTCTTTCTTAGCCTGAAAGCTCCCTTCCTCTTTCTCCCTCTCCTATAAC
ACATCCGCCACTCTATTTTACTCTATAAATACTCTATCTTTCAATTTTAACCACATTTCAAATTTCAGAATCTAATCCTTCATCGCTCCTCTTCAATTTC
AGGTATATATATATGTATACTTCTTCTGTAATCCATCCGATGTTTAATTTGTTGCATTCAATTTTTTCATGATTGAGTAATCTGGATTTGAATTTGCAAT
CGCAAAATCGGTTGCAGACTAGCAGAAACACTTTCCGCACGGTGTTTCAGAATCTAAACAATCATCGATCTCTGCTTTAATTTCAGGTACGTTTTTCATT
TTTTTTTCTCCGTTCTGGAATCTGCCGATTGTTGATGATGTTTATCTATCTATATGCATGAAATTTATCACGAAATCGCTGAAATTCTGGTTGTTATAAG
CAGTTTGCTATATATATATATTCTGTTTGTACGATTTTTGGATGAAGTTTTATATATATACTATATATAGATATAGATATCGTTGAACGTGAAATAGAAA
AGAATTGCTTGGTCAGATCTAGATAGTAAATTTTTGAATTTTGAGGAGAGTACAAATGGAAGTGTATCTGCAAGGTGACGTAAAAAAGGTGCACTGGTAG
TCCGCCACTCCATCCTGAATGCAGGAGCTGTACTGTTGTGTTTGCCCACTCAACTTGCCAAATTTCAAAAGCATGAAAAATTGGTAAACGAAACATTTTA
TTAAGAAATAAAATAATATTAACATAACAAACTAGATATTTTTTAGTCTTACTTGCTTATGTGGATTGTAGAATTTTTTTTAAAAAACGTTAAATTCACT
CTAAGTCCTTTATTTTTATTTTTTTTGGTAAAAATGTAAAGTCCTTTAATTCATTTTTTTTATATAAAATATATTGAAAAATTATAGTCAAAAATAAAAG
TGACGCATAAATACAAACGGACGGAGGTTGAAATTTATAACTTATGGGTGGAAAATTTTTTCCACTTTTTTGGAAAATAAGTACTTTTCATATTTAGTTT
CAATTTTATCTCAAAAATATTATGACAGGGATAGGATGGTCTAAGGATATAAAATATTACTTTGTTTTCTCTGGAACTTGAAAATACTTTATGAAAATTA
TATTTCGTTATACCAACTCACCTTATATTAGAGTTTACATTTATATCTTATATATATATATATATATATATATTTAAATACTAATATAAAGTCTAGATAA
AAATTATTATGTTCGTCTGAATCCAGACCTAATATTATAATTTAGGATTTCCCTTATAATTTCATTCAAGAAATTAATCTGTAAATGTCACCTTTCACTT
TATTTTCCACTATACTGTTGCAAAAGAGAGAAATCAGAAAAGCTTGTGAATTTTATTTTGTTGTTGCTCTTATTGTTATTTTTTTTTGAAAAGATTCGGT
TAGTTATGAGGATTGATGTGAACGCTAACCTCGTGAATCATAAATATTAAACCCACATTGATTCCGTTGTTATATATACAGCTCATCATACACACAAATT
TTGTAATATCTCATTTTAATTTATTTATCCAATTTTAAAAAATTAAAATGTTATAATATCATTTCATACTGTCAAAGTATTTTTACTTGGTATAACGAAT
TATTATTGTTATCGACTCTTTGTCTTTGTGTCATTTAAATATGTGTTGAAACTTTTACTAACAATTATGATTATGTTGAGAATTTTTAGAAGCCTCATAC
TTTGCTGGACCCACCTTGTATAGGTTGGTGAGACAACGCTATATTAATATGGGTCCCTAATGCCTTATACAAAGGAAAATCATATTCTAGATTCCTTCTC
AGATATTTAAAACAAAGGATTATTTTTTTATATACAAACACAAGGCAGTTCATTGCAAAATTCCACAGATTGTGAAAATAATAAAAAGCTTTTCGATATA
TAGTAAGTAAAGTAAATTAAATTTTTTTTGTTACTGTTTGTTTGTTTGCTTTTTTTTTTAATATTAGTTATGCCTTATTACTTGTCCGTTTTGACAAATC
AAGAAATGATAATTTTTTTTTACCTATTATATCCTCAATTAATTATTTTAAAAAGGTAATTTTTTTTTGTTCTTATTAATAGATGTATCAATTCAATAAT
GGATAAGTAGATTTTCATAAATAAAATATGAGTATCTCTTGAGGCGTCGTATTAATAAATCATGTATCTTCAAATTTCTTTTAATAAATAATTTTATAAA
GATTCAATAATAGTAATAACTAATTATTCTTTAATATAATTTTTTTATTTTTTTTATTTAAGTTTTGTAAAATTTAAAGGTATAAATCTTTCTTTTTACA
ACATATAAATTTATGATGAAGCTTTACATTTTTATACGGCTGATTATCTACTTTGTTTATTAAAGGTTTATCCCAAAATAATAAAATAACAAAAAATATA
ACATTAATCAAAATTAAAATTAATGATAATGATGGAGAATTAAAATTCGAGGTGGGCTAGATAGATGAGTAATTTTAGATTAATTCCAGGAATGTGCAGT
CCGCGCAGCCTTTGAGGCCTTTTAAAAATAGGAATCTGAAAAAATAAAAAATCTGTGTGTCAGCTGCATGGCTGTAAGGCTTTATGCACCTTTTAAAGCT
TACACGAGGATTCGTCTGCTCTTCCACTTCCCCTCTTTAGCTATGATAATAATTCCTCTGCCACCCGGTATTATCGATTTGCTCTCACAAATTCATCATC
AAATGCTACTAATTTTTAATAATTACTCATAATTATTGTTGTGATCAAGCTTTTCCGGCCGGTTATCGATGTTGAGATCAGATTAGGCCAGGAATCCTTC
CCCTTGTTTTTCACATCGGTTTTACAGGTAATTTGACACAGTCTGGATTTGATTTACCGTGGTTTCTGAAATGGGTTAATTAGCTGTCACAGAAATCTCT
GTGCCTGTGTTCTTTTACAGCTTTCTCAATGAATTCGGGGTTTGGTTTTCTGCATGCAATGTGTTTGTGCCGGTGTCCGCTTTGAATCTGATAGCTGTTC
TTTTTAATCTGGTGGGTCTTTATATGTTCGCACTTGCCTCATTGTATTTTGCTTGAACTGAAACTGGGATACCAAATGAATTTATATTTAAAATCCTGGA
CAGAAAAAGCCAAGACTCTTGGGGTGGTAGACCCCATTTCCCTAGAGAATTCTGTGGATCCCATTCTCCACACGTTATCTCTTTCTTAGTTTAAATCCTT
TTTCTCTCTAGTACTACTGATTTTCAATAATTTTAAGTATTGGATTTATATGGGTCTAAATGGAGTGACATGGTTAGTGAAGTGGTGTTATTGTTGTAGT
GGTTTATTCAACTAGGATGCTGATGTCCTATTCATTTATGTTAGCCTTGGCTGTGAAATTGCATTTTCACTGTTTGTACTTGAGGCTATTGTGGAATTGT
ATAAGTTTTTATATAATTCACGCGGGAGTTTCATCTTTTGTTACCTCTTATTATGAAAGATGGTTGTTTCCAGGGACATCATAACTCTATTAAATTCATC
ATAGGTGGTCTTGTTCTAGACAGATGCCAGGGAACAAGTATACCGGCAACCAAGCGGTTGCTAGCACTCGATTGGAGAGGCTATTGAGAGAAAGAGAGCT
TAGGAAAAGTAGCAAAGTTTCTCACTTTCCAAATGAATCTACTGATAACAATAGGGGAAACGAGCTCTCTGACCATGATTTTCGCCAAGGAGAAGCTGAT
AATGGAGGAGTTTCATATGTCGAACAGTACCTCGAAGGAGCTGCACTAGCATATAATGAAGGATGGGAGCGGCCTGATGGAAAGCCCACCAGACAACGAC
TCTTGGTTGTGGCAAACAGGTTACCTGTCTCTGCAGTAAGGAGAGGCGAGGAATCCTGGTCTCTAGAGATAAGTGGTGGAGGTCTTGTTAGTGCTCTTCT
TGGTAAGCTAGCGTCTTCCCAGTCATTTCTGTTTTTACATTTGATCTTATTGTTTACCTTAACACTAATTATCTATTTCGCGTCTTTCATATTCATATTG
TTGAAAAGAGTGCCTAATAGTTATGTTAATAATTTATTGAAGGTGTGAAGGAGTTTGAGGCTAGATGGATTGGTTGGGCAGGTGTGAATGTGCCAGATGA
GGCTGGGCAGAGGGCACTTACTAAGGCACTGGCAGAAAAGGTTTAATACATCACTTTGCCACCATATTGCAGTTTACCACACTTCTCTTGCTTTTTTGAG
TTTAGCAATTTGGAGATTGTTTTACATTTTTTTTCTCTCCAAGAAGATTGCTTTACCTATATTTTGCACTTGTTTACCCTTTTGATACTGTTCTTTGTAG
AGGTGTATCCCTGTATTCCTGGATGAAGAAATTGTTCATCAGTATTACAACGGTTACTGCAACAATATATTGTGGCCTCTTTTCCATTATCTTGGACTTC
CGCAAGAAGACCGCCTTGCGACTACCAGAAGTTTCCAGTCTCAGTTTGCTGCTTATAAGAAAGCAAATCAAATGTTTGCTGATGTTGTGAATGAACATTA
CGAAGAAGGTGATGTGGTATGGTGTCATGACTACCATCTCATGTTCCTGCCAAAATGTCTCAAGGATTACAACAGCCAAATGAAAGTCGGTTGGTTTCTA
CACACACCCTTTCCATCCTCGGAAATACACAGGACACTGCCGTCTAGATCAGAGCTGCTCCGAGCAGTTCTTGCTGCTGACTTGGTTGGGTAAACCCCTC
TGAACAACTTATTCTCCTGCATAGGATCTAACAGCTAACTTTTCATTTTAGTTTAACCTTCATAATTTTGGAGCTACTGCCTGGAAATAGTTGGTGGGAC
CTAGACTATGAGATCCCCGACTGTCTGTGCTGAGAGTGAAAGTTGAAGTAGTGAAATGCAAGCATCTTAAATTTTAAATTTGTGGATTCTAATTGCGTTT
TTTCATTACTAGATATAACACACTAGTGGTACCATTATAAAAAGAAATACTTACCATACTACTGGTTAGATCTCTGCCTCTCATTAAGATTACCTGGTGA
GGCATGTCTTGAAAGATACGATTGGCAACCCCTAGTGTGATTGTGCAAGACACTCGATCAATAAAGTATAACTTAAAAAGCTGCATGTAAAAGATATATA
TTTGTCCTAGTTGACTTGTAAAGGAAAAGTGCTGGCTAAGTTGACTAACAAATTGTAGCATAAAAGGGGATGTGCTGGTTTCACTGGTAACTTTGTAACT
GTCTGTATATCTACTATCCAATGATTATAGTATATTCTCATCTGTGGATTTCCATGTTACTGTGTTTCGGGTTGTATCACGCTGAATGTCCACTTCGTGG
TATGATTTTTTGTCTCTTTACCTGTATGTAATGAAAGTCCTTTGGACTTAGACCTATATTTGCATTGTTTTATAATTTAATATCATTTTTTGTTACTCAA
GCTAGGAAAGCTAATTATTTTTTATGGATTTAATTTGCAGTTTTCATACCTATGACTATGCAAGGCATTTTGTTAGTGCATGTACTCGTATCCTGGGACT
TGAAGGAACACCTGAAGGAGTAGAAGATCAAGGTAGACTGACCCGCGTTGCTGCGGTATGTTTAAGTTAAACTTCATACACATTCACCCTGCAGTTCTTT
TTCAAGAACTTCTGTAATCCTCATCTAAGCAATTTTATGTACTTAGCCTTGAGAAATATCTACTTGATTTATTTCAGAGTCATTTTAGAAATATCTACTT
TGATTTCTTTCTGAGCCATTTTAAATTGTTCCTGTTCGTACAGTTTCCTATTGGTATAGATTCAGAACGATTTATTCGAGCACTTGAAGTTACTCAAGTT
CAGGAACACATAAAAGAACTAAAAGAGAGATTTGCTGGGAGAAAGGTATGTCTATCCCGACTCTGGATCCTCTCTCCATCTCACCAAATTTTACTTTTTT
GGCATGATATCATTTTCATGAAGTAAGAAATATTTTGTTGTTTTGTCTAATTGTAAGTGTTCGATTTTACATGCTGTGCATCACCTTGGGGGAAAACTTG
CTTTTTGAGACTTTCTTCACCAATTTCATTGTCTACTTTTAATTGTGAAATCTTGGCCTTGAATTCAGTCGACGTTGTATTTTTTTCTACCTATAGTTCC
TTAAGCCAGATTTGGTCAAGACCTGAATCCATCTTGGCCAATTTTACCATCATCTTATGAAAATTATACCTTATGAGTGATGTCGTTCAAACCAAAGTGG
GTGATACATATATAATAGTATGATATTTTCAAATCCTACTGTGACCTGTCATCACTACATTTTCATGTGCTTTAATCAAACAAAATTTTTCCAGTTCACT
ACACACTAGAAAGGGTATCTTATATGTGTAATGATAAATACATGTTTGTGTTGTTTTAGATGGTATAGTTACCATTTACAGAGTCAGATGTTTCTTACTA
AAACTTCTTCTATTATCCAACAGTAGATATCTAAGTGTTGAAATTGGACAAAAACAAAAGAGAGAGAGAGAGAGAGAGAAGGAAAAAGGAAGAAAAAGAG
ATTTGTTTGCATTTGTCAGGAGTAATTGCGTTCTGTTGTTTTGGTCTTCAAGCAGATGTGGCTTCTTGGAATTTCCATGTGGCTTTACTAGGTTTAGATG
TATTTCCCCACTTTTCTGTTTATATATAAAGTCACAATGGCTTCTCTCATTAGAAGGTGAAAGTTTATTTACTTCTAATTCATGAACATTTCAGCTTTTT
TGAAGACTAACTGGATTTCCTCACCTTTAGTTGCAAAATTGTCAGTCTAGTGTTCTTGCTAACCATTTCTTATGTTGTTTTATCACTTTTATGTACATCA
AACTCATATCACTTTCTTCTGTTTTGCCCACTTGTATCTATTGCACAATTTTATGCATTGGCCATGCATTAGAGATATTTAATTGCATGTCCTAGAAACT
TCCATACTTGCTTGGTTTTTGCTAAAGAAATTTAATCACAGGTTATGCTAGGAGTTGATCGCCTTGATATGATTAAAGGAATTCCCCAAAAGATCCTGGC
ATTTGAGAAGTTCCTTGAAGAAAATCCGTACTGGCGTGATAAAGTGGTTTTGCTTCAAATTGCTGTGCCAACAAGAACAGATGTTCCTGAATGTATTTTC
TCGAGCAGATCCACTCTGAGTTCTTCTTTATGCCTTAAGTTAATTTATATTTTCCACTTCTCCTATTATCATTACTACCTTTAGGGAAAGTTTGTTTTCC
ACTATACTGGTTCAGTACGGTCATCAGATATTTTGATGGCTGAGTGGAGGTCTTTGATTCATAAGTCTATTGGTCGAAGCCTAAAATTTTTTCTAAAGGA
GCATCATATATTCCTAAACCAAACTGAAAATTTGAAAATCCTGTTTAATGATCCGGACTTAAGGGCCAGGAAAAGGACATACACCACCAGCAATCCATCA
TGAATCTATTTAGTGCAGAATATAATGCCCCCTTACTGTTCGATATATATGCTTAGGAACCATGTGATCGTCGTGATTAGTCCCAACTTATTACCAAAGA
CGCTGATAGATGCACAGTAGATATAACCGACTAAATTAGATTAATCTCTCTCCTTCTCCTTCTACTATTTTTTCTCCACTTTCCATCTCTCTGTCTTAAA
CCTAATGTATACTTGCCATATTGGTTAAGATATTTGAAGGCATTCATTGATGTTAATCTGTATGTTAAGAGAATCCTGCCTTATTTTACCATCCACACTA
GCCTTTATGAAGTTTTGTGCTGGAACAGAAACATCGAATACAAAATATCAGTGGATCCTTTATCAATCAATCAATACAATTAGAAAATTGTATTAAATCA
TTGCTTGTTCCTCACTTATGGGATTACACTGGGTTGTTGTCGCTGTGTATGACGTTATACTTGGGGCTCAATGATGATCTGTAGTCTATAGAACTTGTTG
AGAAAATTAGTTGAGTTGGTTATCTGCTTTTTCCTTTGGTTCACTTTATAACAAAATTGATGTTTGTAATGCTAATATATTGACAAAAACCAGGTTGGAC
CTTAAAACTGTCGAGTTTCAATGAGATTTACTTGGTCATAAATGCAGATGCTTGTCATACTATATGTTTGCTTAAGTATGATATTTTACTTGCTTTCACC
TTAATATTTTTGCAGACCAAAAACTTACCAGTCAAGTTCATGAGATTGTTGGACGCATCAATGGTCGGTTTGGAACTTTGACTGCAGTGCCTATTCATCA
TCTGGTTAGTTTTTTTTTTTGTCATATTCATTGTGCTTGAATGCAGGACCATTCTCTTGACTGAAATATGGATAATATGGGTTTTTAAATGCAGGACCGT
TCTCTTGACTTTCATGCATTATGTGCACTGTATGCTGTAACTGGTAATTCTTTTCATCTTGCACTTAATTCTGCGATTCTTATATAGTTCTGTTAGAAGC
TTCCTTACTTCTGCGATTCTTGTATAGTTCTGTTAGAAGTTTCCATACACCATTCGTGCCCCCCCCCCCCCCCCCTTCTTCAGTTGTTTCTCCACACTAG
GTGATTCTTCCCATCTATCCTAGCCTTGGTGGATAGAGTTACCTAGTACTTGTTGCTGGTGGGGGGGGGGGGATTAGTTGAGGTGGGCTAAAGCTAACCC
GGACACCACAGTCATAAAAAAGATAGTGTTGTTTCTGCTCATCTATGTTTAGTCTTGCTATTTTCTTCTTCAGTTCTTTTGAAGGCACTACTAGTACATG
CTTATCCTCTCACCTATGATCTCACCTGGTGTGAGTCCTATTGGAATTGACATAAACAATGAGAAGAGGTTAGCAATGTATGTTATAAATGGATGTCCTC
CTAAATATCATAGTTCTCGAGAAAGGTTATATCTCTGCATAGTTTTTCTTAAGGTTGTTTCCCCTTCAGGTTTGCTAATTACTCACCAAAGCTTAAAAAT
CTTGTAGTTTCACTACTCTTCTGGACATAACAAATTAGTTTGGCAATGGAATAGATTGATTGAGGCCTCTGTATGTTCTCAAATAAATCTGCATCATTTG
GACTTTCTAGAAATTGGATATAAGCTTGTAAATCTGGAGTTGGTCCATAACTTTATTCGCTAGAGAATGCATAAGTTGTGCTCCAGGATCTGAATGAGGG
ATGATTGGATAAGTATGTTTTTGACACATTCTGAAAACATATACATGCCAAAGTCCATATTTTCCTTATTGTTATCTTGAAGAAAACGAAAGGTTTTACT
AATGCTACTTTTTCCATCATATTTGTTATATTCCTATTTGTTCAAGATTATAGAATGGTGAAATAATAATATTGACATGATGATAATTTAAATATATATA
TATATTAATAATTCAGTTGTTTTTCCTCATTAGCTAATTTCTTTTGGTAGTTGCATGTCAGTTCCTATTTTATTTGATAAATTGGCAATGTTTTGTTCAT
CAGATGTAGCGTTGGTTACCTCTTTAAGAGATGGCATGAACCTCGTCAGCTATGAATTTGTAGCCTGCCAAGAGTTGAAAAAAGGGGTCCTTATTCTCAG
CGAAGTAATAATCATATATCTTATTGCAATGCTATTTCCTCTCATGTCATAATTACTATTGTTTTTTCTTTAAAAATTATTTTATGTTTTTCGGCATTGT
GAAGCAATAAAATGAAAAATAAAATTAGACATAACCTTATGGATGTTTTCGTGCTTATTTGCTAATTAATTTTGACAAAGCTAACCGTTTATAGAAGAAA
AAAAACAAGATTATAGTTTCCAATAAAAATATTTGACACAATCCTTTTTCCAAATGAAAAGAAAAGTATTTTGCAATAAAAAGATTTTGACAAAGCTAAC
CATACCTTCATTCTTCTTCCTACTTCTTCTTTTTTTCCCCTCTGTTTATGACATTTTTATATACTATTTTAAATTTAATTTTTTTACAACAATTGTTTTT
ATATGTTCATGAAAATAAATAGTGAATTAATTCTTAAAATGATAACTTTATAGCTTTGCATTTAAAAAAGCAAATTTCGAAAAATTATGCATGAATTTTA
TTACTAAAAATCTTATGATATTTTATCAAGTTTTTGTTTTAGGTCACTGATTGTATTGTGCCTCCTCTGTTTATAGTTTGCTGGTGCTGCACAAGTCACT
GATTGTATTGTGCCTCCTCTGTTTATAGTTTGCTGGTGCTGCACAATCGTTAGGTGCTGGAGCAATTCTGGTGAATCCATGGAATATAACAGAGGTTGCT
GCTTCGATTGGGCAAGCTTTAAATATGTCAGCTGAAGAAAGAGAAAAACGCCACAGGCATAACTTTCTGCATGTGACTACGCATACTGCTCAAGAATGGG
CTGAGACTTTTGTGAGGTAAGAAGACATTAAGAGAGTAAAGCTAACACAGAATTCACATTATCACTGCCACTTATGAGAGAACCTCTTGAATTATTCTTC
GGACTCCTGTAAAAACACTTTGTGGCGGCGAATGAGTAATAATAGTATAATGCCATGCAATGAGACCCCACTGTTTTACTTTGGCCCCAGCTTATTCCTC
AGGATTTATATATTTGTATTATTGGAGTCATTAAAATTCATCTACAGCCAGCCTGTTTATAGCTAGGGATCTTATGTCAGAATGTGCAAACTCTCATTGA
GGGTACGCCTACCTTGAGAATGATTAGAGGCATCATCTTATATAGTTTGCATATCTACCTTAGTCATTTCTGTGTTTAGTTTTACTGCTTCTCTTGATAT
TAAACAACACTCTTTTTATCAACTGTGTTAATCACTCATCAGCACAGATACTATAAGCATAATTCAACAATTGTCATGTTAACTGAGATTATACTTGAAG
CTTTTAAAGGGGCTTCATTTTGATAAACTATCTTAGTAACTATTCCTCTTCTTTGCAGTGAACTAAATGATACTGTTATTGAAGCTCAACAGAGGATAAG
AAAAGTTCCGCCCCGGCTTAACATCAGTGATGCAATTGAGCGCTATTCGTTTTCCAATAATCGACTACTAATATTGGTATAACTCGCTCCTTCTTTAAAA
ATATTTGCCTGAAACTCTTACTTATACAGAAGCTTACAGTTGACTTCTTTACTTCCTTAATGACTCTGACATTGATGATAAATTTTTGAGCGTTGAAGAG
TTCATATATTGCAGAAAGTCTATATATATGGCTTTAGATGTTGAATAACGTTTGTGGAAAAATCCTATGCAAATTTGAATAGCATTCCAACTATGTGTTT
GAATTTGACATGTGCGCTTGAGTCCAAGTTGGTGCTGCTTTTGTTTGCATATTTGAGCAAAGGGATCTAGGACGCTATCATGATTAGGGGCCTTGATGAT
CTGGGTAGACATTTGTGTTAAGGGGTTATACATATGGTGAAGAGTGGATGCAGCCTCCCCTCCCCCATTGCCTTTCTGAGGGAACTTAAGCTCTAAGCCA
AATTTTGTGCGATATTATATTCTTTTCGAATTCAATTTTCTTTTCTTTGATCAGTATATGCAGCAACTAGCTAAGTTAATGACAATTTCTTGATTTCATT
GTGGTGGTCCTCAAAAACAGGGTTTCAATTCTACACTGACAGAATCGGTGGATACCCCTGGAAGAAGAGGTGGAGATCAAATCAAAGAAATGGAACTGAA
ATTGCATCCTGAGTTGAAAGAATCATTGCTCGCGATTTGTAACGACCCAAAGACAACAGTCGTTGTCCTCAGTGGAAGTGATAGAAACGTCTTAGATGAT
GTATTGCCTTACAACTAGCAATATTTCAATTCCCTCAACTGTAGCGACGTTTCCCCATGTGAAATTTGTACTTTTGCAGAACTTCAGCGAGTACAACATG
TGGTTAGCAGCAGAAAATGGAATGTTTTTACGATCTACAAACGGTGTATGGATGACAACTATGCCAGAACACCTAAACATGGACTGGGTTGATAGTGTTA
AGGTATGATCATGTGTAGCTATGTTCTGGTAGTGCATCTTTCAGCTCTAACTTCTCTTGTCTTGACAATATTCAGCACGTTTTCGAGTACTTCACTGAAA
GGACACCGAGATCTCACTTTGAACAACGTGAAACTTCACTTGTTTGGAATTACAAGTATGCAGGTGATCTTACTTTCATCATCCATTTTCGAGATTTTTC
AGTCATGCATTTCTTGTTTGTAGCTATTCAAAGTTTAGTCTTGCCTTCAATTCTCTTTTTCCTTTTTTCCTTTTTCTTTAAACATTTCTTCCTTTTGGTG
GGGGTTCTTCCATGTCCTAGATGTTGAATTTGGAAGATTGCAAGCTAGAGACATGCTTCAGCATCTCTGGACAGGTCCAATATCAAATGCATCTGTTGAT
GTTGTACAAGGACTCCGCTCCGTTGAGGTTCGAGCAGTTGGTGTTACAAAGGTGACAACGTTGTTTCTTATGTAACAATTCGTTTTCCCTATCCTGTACA
CTCATGTGTATATACACACACATGCAGGGAGCAGCAATAGATCGTATACTGGGGGAGATCGTACACAGTAAAGCCATCGCAACACCAATTGATTACGTTT
TATGCATAGGGCATTTTCTGGGGAAGGTAAATTCTTTGAAGCCTTCAAAATGTCGTCACTTCAAATTAGTATTGCTATTGCTGTGAGCTTTGACCTTTAT
AATTCAGAGTAACCCCTGTCTGTTTAACTAGTTCCAGATTTTGATAAAGTAATCCGACTTCATCTTTCAAAAATTAAGTCGGATAGGTTGATCATTTGCA
TCTGTATCTTGAATTTTGATGCTGTTGTAAGCACTGTCCATTATATTGCTACACTTACGTCTGTTGCCTTTGTAAATATAGGATGAGGATGTATATACAT
TTTTTGAGCCAGAGCTTCCTTCTGACTGCATCGGTATGCCAAGAAGTAAGGTCAGTGATGCACCAAAGGTGCCCGGGGAAAGGCGATCAGTTCCAAAACT
CCCTTCTAGTCGAACTAGCTCAAAGTCATCTCAGAATAGGAACAGACCAGTTTCAAACTCGGATAAGAAGACTTCCAATGGGCGACGGCCCTCACCTGAA
AATGTGTCATGGAATGTGCTGGATCTGAAGAAGGAGAATTACTTCTCTTGTGCAGTTGGAAGGACTCGTACAAACGCTCGGTATCTGCTCAGTACGCCAG
ACGACGTTGTTGCTTTTCTAAGGGAACTAGCTGAAGCACCTATTTCAAATGGGACATCATGAAAAAGAAGGATAGATGATGCCTGGTTGCATCAAGTGAT
GAATGATCAGTACCAAGTTCTTGGTTGAGGGAGATTTGTATGGGATGATATTGAATAAACGTTTTATACCTTTACTTTGGATATAGATGTTTGCATTCAA
AAGTTTACAAAGTAGAGAGAATAACCTTCATGCTAGCTAGTACATCCGTGCCAATTATTTTGTCTAGTCTTTTACTTTGGCACGAAATTTTAAGAAAATT
AAGAAACTTTGGATTATGTAGTCGGAAAGAGAAAGTGAGACGAACAAATTGAAGCGGACAGAACCAAGCAACTCAAATCACAAGCTATATTTGGAGTCAC
CATCAGATACCGCAGAAGGCCGAATCCAAACTCTTGGGATTACACAGGGTATGTTATACGTTTACAAAACTAAATAAGAACAATTCAAACTAAATATGGC
CTTACATTGTTTACTGCTGGAGCTCAACAGAAATGTTTCTATACATGCCATCTGCCTAAAGAATACTGGCAAAACACAAAGCTACTTCCCAATCAATATG
ACAATATGTGAAGGAAACTAGCACAACACAAATGGAGCAAGAAACAAATCATAATTTCATATATATTAAGATCCAACAAATCGACCCGAGCTGATAAAAG
ATGAATGGTAACTCCTACGCAAACCACCTTATAGCACATTAAACTCATAAATAAACTGACAACATAGACCAAGTGTAGGAATTCTAGACACCAGTAAGAA
CCTAAATATTTTAAAATGATGGCTAATAATGACTAAACTAGAGTAGAAAGTCAAGTAGCATATTGATCCAAACCAGAAGTCTGCTCTCCACATCCTGATG
GGCTTCTCATGCAGAAGTTTTTCTATTTGGTTCAAACACATTTTTGATCAATGATTCTTTGATAGACAACAACTCAGGGAACTCCTTTTTCAACTTGGAC
GCGTCCATTTCATTGTTACTGCGAGGTGCAACAATTACCTTAGCCTGCTCTTCCAGTGTGAAGTTGGACCATTTAAATTCTGGGTTTATGTATTTCTTGT
ACATCTCCAAGATCTCGTTATGGCTCACAACACCAGGGTTTGTGAAATTCCATATGCCTGTGAGATTACGCTTTGCCATCTCGATTGAAATTGGAAGAAG
CTCATCCAAAATCGTCATGCTGTTGGGAATGTTGACCACTTTATTGTAGCGGCTAATCTTGGTGATGAAGTTACGGGGGTTGTTGAGGTCTGAAGAAATT
GGCATCCTGACTCTAAGGGTGCAAACATTGGGGTACTCTTTCAACAACTCTTCAACCTGGTGGAAGCAACAAACAGAAAATGATTAGTATTTGTAAAAGA
TTTGGGCACATGCAACGGAGAATCTTAAGGAGTACCTACCATGGCCTTGGTCTTTGAATAGAAAGAACCGGTGAAATTGGGCGTGTCTTCCTCTTTGAAT
CCAATGCCAGAACCTTCGGGGTGTGCAGCATCATATTCGAATATGCAACCGGTTGCAAAATTCATCATCAGTAAACCATTCTCTTTACAAACATCTGCCA
AGTTTAGAGTTCCAGCAACATTTGTACGGATTGTTTCAGTCTTATGACTCTCACACCAATCAACATTGGGCCTACCAGTGACACCAGCAGCATTGAATAC
ATGTGTGGGCTTCACAGCATGAATGTCTGACAAAAGTTGTGAGCGATCCTCCAGACGTCCCTTTCCATACTCATAAGGAATTCCCTGTTTCTCACACAGT
TTGCTTAGGAGACCACCAATCCACCCAGTTCTACCATAAATCAAAAACTTATAAGGTGATCTACTAGGGGAGTTGCTGATCTTGGAAGCTGGAACTACCA
TTCCGTTAAGTTTCATGTTTCCTGAGATCTCAGATGATCCAGAATCATCTTTTTCAGCTCCATCCGAATTTCTCTCTACCCCACCAGGCATCATCAGCAT
TCTAGGATGGGGAAGCAATGCCCCAGAGACATCTCCCCACCAATCAGGATTATTGACATACCACTCCATGGTTTTTTTCAGACCCTCTTCCCAGGTGGTC
TTCTCGGACCAACCCAGGTTCTTCAACTTCTGATCATCTAGGAAATACCTCTGGTCATTGAAGGGCCTGTTTTCCACAAACTGAATGCTTGTGTCTGGAT
CCTTGTTAAAAAGATTGGATATATCTTTGGCAACATCAATCACTCGCCTCTCTTTCTTAGTCCCGATGTTATAAACATGACCAACATCACCTCGGTGAAG
AACAACTTCGAAAGCCTCAGCAACGTCCTCACAATAGAGATAACTTCTAACATTTGAACCATCTCCGTGAATCGGAAGAGGCTTCCCATTCAAAGCTAAA
AGTATGAACTTTGGGATTAGCTTCTCAGGAAATTGATTGGGACCATACACATTGTTCCCTCTAGTGGTGATAACAGGCAATCCATATGATCTTGCATATG
CCATAACAAGCATTTCAGCTCCAGCTTTCGTGGCTGAATATGGGTTTGTGGGGAGAAGTTGCGATGCTTCATGATTTCCTACAACAGCATCTTCATCAGT
CTCTCCGTAAACCTCATCAGTGCTAACATGTATAAACCTTCTGATCTGACCAGTAACTTTGCATGCCTCTAATAGCACGTGTGTGCCATAAATGTTGTTC
TTGGTGAACTCAAAGCTATTACCAAAGGAGTTGTCGACATGGGTCTGAGCAGCAAAGTGCATTATAGTGTCAATGTTCTCGGTGATGAGAAGGTAGTTAA
CAAGATCAGCACTGCCAATATCTCCCTTAACAAACTTAAAATTAGGGGAAGATCGAGATGGGGAAAGATTTTTCAGGTTTGAGCAATAATCAAGCTTGTC
AAGAACCACAATATTGTAATCAGGGTAACTCCGAACAAGGCGGTTGGCAACATGAGATGCAATAAACCCTGCGGCCCCAGTAATGAGTATATTCTTTGGT
GTATAGTTAGACATTTTGATGTCGATCAAATATATTCAGAGCTTAACAGCAACTTAAACCCTGAAATTATAAAAAAAAATAACTTGATCTAATCAACAAC
TGTCAAAAAAAGCTTAAGAAAAGCACAAAGGCAAAAAAAAAGAAAAACTATATTGCTTGGACTCTTAGAAAATGTCGACGGGTGTGTTGGATTTTCCAAA
GTAGTGTGTTATTGGACAATCCGACACAAATGCAGCAACATTTTTAGAGAGTACGAGCAGTATACATAAAAACGAATTCTTTATTTAGATTAATAATCAA
AACAACATCGTAACACTAAAGATCAACTACACCACTTCATGAAAACATTCGCCAACAAAAACATCAACCAAAGACAAACTCCATGCACATCAAAGAATTG
ACAACACTAATGGTAGTAATTATGCATGAACAAATACATAATTTCCCCAGATCAGAGATGAAATAAGCTATAGAAATATCACATAAACCAGCAAAAAATA
TCAAACAAAACAATTATGCAACAAATAACAAACTAATCAAGTAGACAATATGATCTCATAATTCCAAAAAAAAAAACACAAAAAAATGATTTTTTTTTAT
CAACACAGAAATCATCAGATCCAAAATGATTCTCTAAAATACCCAACATTATCATTATCAGTTATAGATCTGGATTACAAGCTCCAATGCCAACACAATG
AATCAATACATATGAGTATTCCAAACACAGATCTAGCTAAAATCATGAACTTTTTTTAAAAAATAAAAAATACCCGTATCATGAATCGTAAACCAGAACT
AAAATATCATATAAACAAAACAAAATTCACATTAAAATTCGCTTACCGTTTTTGATTATTTTTTTTGTTTCAGAACCCAATATGTAAAAATATGGATACA
GATTTTTGAGTTTCTCACAGAGAGTGAGAAACGTAAAAGATTTTTTAGAGAGAGAAAGCGTGTATTGATGAGAGTCAAGTATCTTGTTGTTTGTGTATTT
ATACCCGCAAAAACCCTCTCTCATGCAAAAAAAAATCAAATCACCATCTCCATATTTTTTACCAGAAAATAATAAAATGGAAACAGAGTGATTTGAGAGT
AGTATAGCGAGGACGGTGACAGGGGAAGATGGAAAGTACTATATTGCCCTTGGAACGGTAGCTAAATTACACACGCGGATTTTGTGTGTGTCATAAATTG
TGGGAACGGTGGTTGGTAAAACCGTTAAGTTATTTTTGTTTTAAGTAACGTAATTGCACTTTTAATCCCTTAATTATTGGAGTGTTTTAGTTTTTGACCT
TTTTTATATTCGAGCGTTCCAAAACATCCCTGAATTTGACGCAAATTATTTGTTTCATCCTCGAACTATTGACAACTTTAGAAACACCACTCTATATACC
TCTGATTTGCCACAAGACATAGTAAGTGATGTCAAACTCTTGGATATGACATGTAAATCTTAATAAAACGTATTGAAAACATCTTAAAACTTGACGAAAA
TTTAGGAGTGTATTTCACCGGTATTGTAAGATTGGGGGTGTATTTAAGTTCAGTTAGTCAAGTGAAGGGGTGTTTTTAAAGTTGTCAATAGTTTAGGAAT
GAAACTAATAATTCACGTCTAGTTCAGGGGTATTTTCAATTTGATTTAAGTATATATTTATCTTGTTAATGAGATGCTTAAGCATTGGAAATATGAACTA
GTCACGTTTAATACGATATGATGAAAAAAAATCATGTTTTATTGTAGATTTTCAAGTTGAAAATTGATAAATTGAGCTTTTGTGAGTTTGATTTTTTTGA
ATTTAATTATTTCGAGCGAAAGTGAAATTCTTGTAAAAACTGATCAACTTGAAGTTAGGAAATTTTTTGAAGACGTGTTTTTAAAATACATGGTCAAATG
TTGTTTTGATTTTTTTTTTTTTTTTTTTGGGGTAGCATTAGACTAAAATAACGTGATTTTATGTTATTCTCAAAAAAAGGAGTAAATGACAAATTAAACA
TACTTTATTAAGATAGAAAAAAAACTTTTGAAATTAAAAAAATATTTTAAAAGATTAAGTTGTGTATTAAATGCATATTGAAAAGAAAACATAATAGCAG
TTTAATTTAGGTAGAAGGGTAATTATATTAAATAATTTCAAGATTTAGCATTAAATAGTTTATCGAACTTGTGATTAGATTTACTCAAAATTACATATAC
CAATTAATTAAAAATATATACGTATTTAGTTATAAAAAAACACAAGGATTAAAGTTGAATTTTATTCATATTTAATAAGACCAAAAGTTCAAATTTCTCA
ATATAAAATAATAGTGAGAATAAAAAATGGAAATTATTTATTGGGATTTAGGAGACAATGGAACGTGAGTAAAAAAGATTACATGTGATTGCTTGAATAT
ATAGTTAATTGTGGCATTTTTTGATTGGTTTATACCTTTTATATTAATGTTTTAGTTAATATAGTAATTATATAATGAGTGTCATAATCAAATTCTTTGC
TGGGAATTTTAATATTCCATAATTGTACAGACATATATTAGCTGTTTTCTTTTTTTGTCATGATGTGTACCATTAATTTAAGTGTGAAATGAATTTAATT
AAATTATTTTTTGACTGGCGATAGAAGAGGTAGTCAACTAGCAAGGAAAAAAAATATTCATAAGTAAATTTATGTATCTCCGTCTTATATTAGCTATGCA
TCTTACTAAAAATATTAATCATTTCATAATATTATCAATTACTAAATTTAGGTACGAATTGAAAATATTGATTATTTCATAATGGTATCATTTACTAAAG
TAAATATATAGTTAATTTTAGTCTCAAATAATTGCACTGAAATATATAGTTACTTTCAGTTTCACATTTACCTCATTTGTTCTTACTTAATTATAGGCGT
GTCATTCGAAATTTAAAATATAAATCATGAATTCGATTAAATTTAATATATTTCGATATACAATTAGTCATTTTATATATTTCAGTATAATGTGTATAAA
TTGTGTTTGTGTTTGTATAAAGTGAGAAAAAATTATATATACAAATACAATTATATATATTCATTCTATACACTTATATATAAATACATATCTTATTATA
TAAATTACAATGCATAAATAAATTACAAAACTGAACAATTTGAACAAAATTGGATGTTTGTAGCGAATTATACAAATCAAAAAATCCAATATTTGCTATA
GAGCGTAATTATGCAAACTATAACTATAATATACAAATTTAATTTATGTATTCGCTATATGTAAAAGTTACTCTTAATAGTACCCATAATATAATGCAAA
ATAAAACAATTTTGTAATTTATATCAAAATAGTAACTACCATTTATTCCAACCTCTCGTTCTTACCACAGGGTTTACCTAACACAACAACTCGAAATAAT
GTGTCATCAAACTCCTAGCAATTTTTTTTATTTTTCTTTTATCGTTCATCGTTAATGTATTTTCTCTTTGAGATGAAATTAGGGATATCTTGATTAAGGG
TAAAAATAGAGAAATACCATATACTCATATATAATAAATTGATATGTCATCCCAAGGCAAAATAAACTATTTATTCCCCTTCTTTGTCTTGCCACAACCC
ACCATCGAGGTGAAGTCGGGACGTAAACGATCGAATGGAACAATATATAGACAAGTAAATTCCTTATGGTTCCAAGGTATTCCTTTAATTATTAAGAGTT
ACCCTTTTCGACCTACATGACACTATCCTTTAAGCCCAACGTCGGTTGACTTTTTTTTTTCAAGCTAGTGTCATGTAGGCCGAAAAGAGGTAGAAAATTA
CTTATAAAATAAGTTTAAGAGGGTAATAGGACTTTAGTATAGTATAAGTGTGTCTCTAGATTTCGAGCATATGTTTAGAAGGTACTTGCACATTTTCATT
TTTTTTTTTTGACAAATCGTGCAATACATCAACTCAAACAACGCAGTATGATTTTTTTATTTTTTTTTGTAGACTCTTGTTCTTGCCACAAGCCTTACCT
AACACAAAAAGAGCCTCAAAAAGTTTGTGTTACACCTAACACACTCTAACTTTGTTTCTACATCGTTCATCTTAACAACCATTCACTAATCTTTGTTTTT
TTCTTAGCTATTTTTTATCAAGCCACATCCTCTTCAAAGAAAGTAATTTCTATTTAGGGGTCATACGTTTTGTAGGCTAAGCAAAATTAGTTGTACATGA
ATTATTAATGTGGTGATGAGTAATAATTAAGAAAAAAAAGTTTGTTAATTATTTGGCTGAATATAATTATGATCATGTGATTAGAACCAAAAAGAGAGGA
GTACTTTTGGGTTTATTGAAGTGGACAACAAAATTTATGATATTTTATTTCTTTAACTTTTATGTTCCAACTAGACTATTAACGATTTTTTGAGGACCTT
TTCATTATTAGTATTACCTATTGTTACGTATTTATGTTTTATTGTTGTGTTCAAATAACTTCATACACTACGTAATATGATTATACTCAATTAATTATTC
TTTTCGTTAACTTATTTGTCGTATTGAGATTTTGATGTACTTGTTAAGAAAATAATGATTATAATGATTATTTCATTATAGATTTCTGATTCCTGCTTAA
GAGGAAGAGATGGAAAAAGTAATTATCTTTTTCTAATATAATGTGAAAAGTGATGAATAAAAATATATTTGAAATATTGGACTACTAAAAATATACCGTA
GAAGTAATTTAGCTTTAATCATTTGTCACTCTTCGATTTAAAAATATCAACATGTTATCTGCCGTAATGCTCTTTAATTATTTTTTGGTTTATTTATGTC
GCCTTGTCTGGTGGAAAATGCCTTAGGAAATAGGGTACATTTTGGAGATTTCTCATGTACTTCTCAGCGTCGAATTTAGGATTTTAGAAAGACTGATGCA
TTATTATCGAAGATGGCTCTAGAATTTCAGAAAGATTGATTCATTATTAACGTTCTGTTTCTTTATGAAAATTTTAGAATCTGTCATCATAATAACATAC
TATCCTTGTGATATTAACAAAAAGACAATTACTTTAGACTCTCAAATTTGATACCTCAAACAATAATTATTTTTTTGGGGGGGGGGGGAGGGGGGGAGGA
GATTTATACTAAAGGAAAAAGTTATCGAAAAGTTCTATATACCTCAAGTTTTGTGTCGCAAAAAAAAATTAAATGTATTAATTATACGAATTATTGACTG
AAAAAGAATTATCAAAAGAAACTATTTATAAAAAAACAAATATACAATTTTGTGTCTCAAAAAATATAAAAAGTCTTTTTTATAAAAAGAAAATAAAATT
TTTTCAAAAAAATAAAAATAAATTCAAGAGCTCCCAAGCTTTTTTTAAAAAAAATAATTGTATAGAATGATAAACAAATAATATAAAATAAATATAGTAG
TTATCGTTTAATTTATTTGTGTTTTATATCAAACTGTTTGTCAGTCCCTCTCTTCCTTATATTCTCGTTCGTCACTCTCTTTCTCTCGCTTCATGCAACT
CGCCTCTCTCGTTTTATATAATATAATTATATAAATTGTATTTCTAATTATATAAATCGAGAGAAAATGGTATATACACATGCAAAATACATATATTTTA
CCCTATACACTTGTAACTATTCAATAAAAGTACTCCCCTGCCCAAGTCTCTTTTGTCTTTCTCTCTTTATCGTTTTATACAAATTCAACTTGTATATAAC
TTTTCTCTTTCTCGTTTTATACAATTCGATTCAATTGTATATTCCCTGTCCAAGTCTCTTTTGCCTTTCTTTCTTTCTCATTTTTATATAAATTCAAATT
GTATATAATCGTCCTATAAACTAATAATTATACAACTCGTTTTATATACTTCATTTAGCACAATTTTCTGCCTAAGTCTCTTTCTCGTTTTATACAATTT
GCTTCAACTGTATATGTATAGCGAATAATACAGTTTTTATGTTTGCTATGGAGCGCAATTATTCAAATTTTACTATAACATACAAATATAAATTTTTTAT
TTGCTATACGTGAAAGTTGCCCTTTTAAAAACTAACTTGACCATAAAAATAAATTATGATGCGTAATTCAGTAGGCCGCAAATATAATACACGTGAGAGA
ATAAATGTAAAGGTACCGGTGTGCCAAATATTACAAGCGATGTCCATTAAAAGACATGCGACAATCTTGTACTTCAGCCCCAGGAAAATAACTATAGTAT
TAACTAATTATGTTATTATACTCTCCCATTTTCATCACAAGACAAATTTAATTGATAAGTTAAACTTTCGATTCAAGTGATTAAGTTTGAAGTTTTGGAT
ATATACAAATTTTATTTTTTGATACTATTTTTGTACTTTTAAAAATGAATGAAATGATCATCGTCATATTTTTTTTTTTAAAAAAGAAACTTTTACATAT
AGTCACTCAAAAATAGCCTAATTACTCTTCATACCTATAGTTTGATAAATTACAATTCGTAGCTAGATGTTATATGGAGGAGAGAGGCGAGTGAGACTGG
GAGAGAGAGGAGAGAAGGGGAAAAGAGTGGGAGAAAGGTGAATTGTATATGTATATCGATTAGATAATTGTATATTATACATATGTATTTGTATATACGA
CAAGCGAGAGTGAGAGAGGGAGAAGAGATGCGAGCAAGACTGGGAGAGAGAGGAGAGAGGCGAGCAAGATTGGGAGAGATAGGAGAGGCGAGCGAGAGAG
GATAGAGAGTAAGAGAGGTGTGAATTGTATATGTATATAGGTTAAAAAATTGTATATTATACATATGTATTTGTATATTCTGGCGAATTATACATATACA
AACATAATTAATTATACAAACTCGAAGTCAGCCCACATAATTAATATATAATGTTAGTCACATTAATAATTATAGTAAATTATAGTTATGATGAGTAATT
AAATAATACTATAAATTTGCTTTGTTACATATTTTTCCAAAAAAGAAACAGAAACCCTGGTCCAAAAGAAAGAAAGAGGACACAATTAATATATAGGCCC
AAAAAACAAGCCCAAACAAAAGACAAGCAAAATCACCTCTCAACAGACTTGAGTCCTTACCATTAAATGTGACATTTCGATGGTTTTTATAGTACGTAAG
ATAAAATCTAAATCGCTCTTAAAATTTGTGTTATTAGCTATGTTTGGGTGTGTAACTGAAGTATTGTGAACCTTCGCCTTATAATTATGAAATTGTTGTT
TATTTCTGTCTAGTATTGATAATCCGTTGTTTCAATGATTTACATAAAAGCTATATTTTGACTTTTTTTAATTCTAAGATTGGAATTTTCACTGTCATTC
ATATTTCTTTTTTTCTTGCTTAATTTTTTTTTTTAATATGAGCCATATTATCGAGTGTTTACAAAATTAATTATCAAGTTAACTGAGAACATCAACTAAT
TAAGAAACATGTCACGATCTGGTCCCTTTGGCTTTGTAAATGACTATTGGACCTATAAATGACATATATTAATGCTTAAAATATAAGTCAGGAAAAATGT
ACATTTTTAGAAGGCCAAAAAAACATAATCTATAAACTGTCATTGTAATAACTTGTTTTTTCCATCTTTATTAGGTAATCGGATTTTATTTTAAAAAATA
TATTATATGTTTTAATTTATATAAATTATAATTTTTTTTAAAAGATAATTTTAAGAAAATAAATAAATTTTTATAGTAAATAATAATTTGACGTTAAAAT
GTATATTTTATACTTAGATCATTGATATGATTAGAAATAAAGTTATTTTAACATTCTCGAGAAATTAAGTATCTAGCTATCTTATCATTTATATGAGATA
AATTTAGAGATAAGCTATTCTAAAATTTGATGGTTTCTTTGGCTTCGTCTCAAGTTCTTGCAATCTGTAAAGATGCAGCTGGAATCGCCGGTAAGACTTC
ATTTTTTTTTTCTATGTAATTATTACTAATACTTTTTTAGTCGTAAAAATTTGATCTTGCTGATTTCTGCAAACTGTTTCTTGTTTTTTTGTACAAAATT
TGGAAATAGTTTTGAATTCTATATAGAATCATTGCAACTCTTTTTGGCAAAAATTAAAGGGATGATCTTTATTTTGTGGAAGATTATTCAAGCTAAAGCT
AAGTGAACAGATTTTTTTGCTAGAAGAATTGGGGAAGTTGTTGAAGTTTAGGATGTTGTGAGAAAAAAAAAATTGTGGGGGTTGAGGGATAGAAAATTAG
TTTGTTTTGAAGTCAGCTAAAGCTAGTCGCACGGGGCTTGTCTAGTGCGGCATGTGGGACTTTTGTCATTCTTTGACGGGACAATTTTGATTTTGGGGAT
CCCAACATTGGATGAGACGGGCTCTGCTCTGATACCATGAGGAGGATTGTCCAAGCCTTATAACGAGTCTACCCATCTCATTAACCACCAATGTGGGACT
TTTGTCATTCTTTAACAGTTTATGGACTATTGCGGTGGAGTGGGGTTTATCTTGTGCTCACGTGATGGTAAACCGCAAAAAGAAGTAGGCTGTTAGGCAG
AATCTGAGATGTAGGGTAGGTTTTACATTATCTGTACTACAACAACAACATTACCCAATATAGTTTCATTGGTGGGGTCTGGGGAGGATGTGGTGTACGT
AGACCTTACTCCTATCTCTATCTTTGTGGGTAGAGAGATTGTTTCTCATAGACCCTCGGCTCTAGAAGTATGGGTTTGATGAACCTATAGCCAAAAGGCT
ATATCTGCCTCAAGCAGTCATCTTTGGATTTAAACTTACCTTTTATTCTATTTCTAATCAGTAACAGAACGGCTGCACCAAAAGATGTGTTTCAACTTTA
AAACGGATTGATCATCCTCGTGCTAGTGAATGGCATGAAAAAATGTCTACCTGTAGTTTCCGTTGCATTCATATATTATTGATTGCTTGTACTGTGTACT
GTTTAGCAACCTCTTAATTTCTTTTCCCATATATGAGCTTAAGCCTGTAAATTTGAACCCGATTTACTACTAGCTTTTGCCGAAAGTACTTTCAAAAGTA
CAAGTAAAAAATATGTGTGTGTGTGGGTATAACTTGCACACATAAATTATAGTGATTCGCACGGTAAAGAAGTAATTTTTTGGGTGTATTTTACCAAACT
AACTTCTGATGGAAGTATAAACATTTTATTGAGAGTGGGCAAATGGTTGGTTCGATAGGCCTAAGCAAGTTTAGTAGCTCTCTTTGAGCTAAAATTTACT
TCTAGATTGAACTCTTGATGCAGTGTTTTTCATGTTAAAATTAAAGCACTTTTTGGTCAATCATATAGGAGGCATATTATTCCTGGCCGTGAAATGAATT
AGATTGTAGAGGGAAAATGAGATAATACCCTTTACTTCTCAGCTTACTCGCTATTGTCTTTCCAACAATTTTTGAATTTTTTCTTAAATGAGGTTTGCAA
ACTTATAGTTGAGACTTTATCACGACTCGAGGGAAAACGTTAACCATCTTAGCTCCTTGTTGCAGGGAATATCTTTGCTTTTGGATTGTTTTTGTCTCCA
ATGTGAGTCTTAAGCTTTTCATCCTTCATTTTGATTTTCGCACTTCCATAATGTAGAAAACAAAGTTCACCTTGACCAATTACTTCTTTGTCCACAATCC
AGTATCATTTATCTTTATTTTCAGGCCTACATTCATGAGAATAATGAGGAATCAATCAACTGAACAGTTCTCAGGGTTGCCGTACATCTATGGTCTATTG
AACTGCTTAATTTGTGCCTGGTATGGCACCCCTCTCGTATCTCCCGACAATTTGTTGGTTACATCAGTTAATTCAGTTGGTGCTGTTTTTCAACTTGCCT
ACATTGTACTTTACGTAACGTATACAGAGAAAGAGAAAAAGGTTAATACTCTTCTGTTGTATTATTTAATTAATAAAGCAGTTTCACACTCATTCATAGC
GTAATCTGTTAATCCGTATGCCCATCAATGTTGTTTGTAGTTCAGGATGTTTGGATGGATACTCACAGTCTTTGGCCTATTTGTTATTATTGTACTTGGA
AGCTTGTTTATACTTGATCTGGAACTCCGACGCATCATCATTGGCTCCCTGAGTTGTGCTTCCTTGATATCAATGTTTGCCTCCCCACTGTTAATTATTG
TATGTCTAACCGTTGACATTCAGAATTTTCTATCAAGTTCTTGTTCTCTAACGTTTTTCCGCGGATTCACTGACTAACTTGTATTACAGAATCTGGTGAT
CAGGACCAGGAGTGTTGAATTCATGCCGTTTTGTCTGTCCCTCTCCACCTTCCTAATGAGTGCCTCTTTCCTTTTGTATGGAATTTTCAGTTCTGATCCC
TTTATATATGTGAGTTTTCTTTCTCTCGCTTGGGAAATTTCCAATTTTTTCTTTTGTTCCTCTCGCCCGACTCACGAAGGATTTCTACTTAAATTTCAGG
TACCAAATGGCATTGGAACACTTTTAGGAGTTACACAATTGCTTTTATTTGCACATTACAGAAATTCTTCAAGAGAGGACTCTGCCGAAGGCCTTATAGT
ATCTTATTCATGAACTAGAATTCTAAGAAAGTAGTGTCTTTTGTGCATGAAAAAACACCCAGGAGGAAAGGTAAATTCTCGTTACGTGTGCATTTTGTGA
ACATATATCTTTCATTCTTTCTCGAGCTGTTAAATAACAAATATACCTTTTAATTGTACATCTCCCTTTATTTGTCCTAGGTGATCGTAAAATCTCACTT
GATTGCATGGAGAAATGGTGAGAATTCCAAGCTCAAGGTGATGGCAGTTCCCTAGTCATTGAACTCGTTCAGCTATACCTGTTCAATGAATATTTTTCTG
CATTGATTCTAATGCTTATATTTATCTTGTTCTCCTTTTCCTTATCAAATCATAGATTGAAGATGCAGAATTACGTTTAAATAAAGAAACTGATGGTATA
ATATGAACTTTTATAGATAGTGGATTCCTTGATATATATATACATATATATATATATACACGAGATCTGGACAAAAGCTATTGAGTATACGAGAACTTTT
AAGTCTGTTTTTACAGTATATCGGCCCCTAGGTATGACAGTAACAAATACAGTGTACTTCAGCATCCATTATTTTACAAGTAATTATCCTGAACTTATTT
ATACGTATGCTTTCAAAGTATAGTAAAAACTGAACTATGTATATAAATAGAAATTCTTCGGAATCATTAGATGTTGCTTCTCTTGATGTTTTTGCCTCGT
ATTATGTTTTACCTGATCGTATTTGAATCCATTTATCGACTTGATGAAGTAGCATGACCTCTCTGATCATAGAGTATAAGACCACTGAACTTTGGCAGCT
CACACTTTTCACCCATTAGTATAGGTCTTTTCCACACAGGTGAAGCTGAACCGCGATTTTGCCATCCAAAATCAGCTTCAGTTTGCAGATCTCCGCTAAC
GAGCAATGGAGAAAGCTTCTCTTTCTGGCTCCACCTCACAGAACTGGTAAGCACCTCCTTCACCGGACCCTGCTCTGCTGGTGGCTCTGAACAATCTATG
TCCTTTGAACCATTAACACGCGGTTCTTGATCCTCTGTTCTCCTTCTTACATTTCTCCTTAAAGCAGCAATAATGCAGGTTCCAATAACTAAGGAACAGG
TGCAAATTACCAGTAAGGCTATCGCTCCTCGTGTCGATATTTTCCATTTCTCTTCTAAATTCCATATTGCTTCCATGTTGTATATCCAGAAAAAATTTGA
TTAAAGCTCAAAACTTGATATTATGAAATGATTAAGAGAATGAATTATGTACATATATTTGGAAGGAAAAAAAAAACTAGTCGTTAGTTTGTTTTATTGC
TATCTCTAGGCGCCTTTGTGATGTTCACTTTAGTTTGGTGCTTCAAAATTCCATGAAGTGGGGTCTTCTTTACATTGAATAATTGTCATTAGCCGTTTGT
TACTATTGGGGATTTTTCCTGTATCCGTCCGAAATATCTGATTAAGAGTGGAGAAATTTACTAAAAAAATAACGTGGACATTGAAACATTATTGTGCGAG
CAATTATCTTGAAAGTGGTTTTTGCTTTTTGGTCGACCAGTTGTTGCCAAATATTCCACAACTTTCTCAATTACATTACTCGTGACTGAAAGTTCAAAGA
TAAAATTACTCAAATGAGAAACATATATCCGAAAAGTTATTGAAAGATATTTGTTTCTGAAGCAACTATAGAAAAAGAATCATTTTACGACAATTATCGA
TAATTAATTAAATTTTGTATGGACAAATTATGCTGGTTGGGTTGCTTGTAGTCTCCAGTTGACAAATTATGCTAAAGAGATAATTATAACAAGTTCACAT
TGAAAATATTTGTTCGTTTACTTTTTTTAGTATTTAAATATCTTAATTTTGATTGAATTATTTTAAAAGTGTTAAAAAATAAAATTAAGATTACCTTATG
GAGTATGTCAATTGAAGTATATCTTTTACTCGTTTGCTATTCTATTTTTTGTGGTGTTATCTTTAGAATATATTTAAAGTTAAAACAATATGTAGTAAAA
TTTATTTATATGATGATTAACTTTGTTTGAGCTTTAAATGTGCGAGAAGACATTTCTTGGTAATTCTTTTTTTTTTTTAAAAAAAAATCGAATATAACTT
GCAGTTTCTAATATGATAGCAGTATACAAGTCACATAGAGAAATATAAATTATATAGGCAAACACTACGAAATAGGCTCGATTCATAAGGTATCAAAAGG
GATTGTTGACAAAGTCATGTAAAGATAATCTTGCAAAAAGTTTTAAAAGATAATTTTACAAGTTCAATTTTAAAATATGATTAATTTAAATTAGTGCGAG
TTAAATAAATTAAGATATAAAAAAAGTAAAGTATAAATTTGATTAATTACACGAATTATTTTTAAACACAATACCAACAAATACAAACAATAAATACTTG
TTTTATTTTTAGTCCTTGGAAGCGCAGCGTTCATTCTGCTATGGCTGAATACGGTGCTTTTCACAATTAACAGTTTAACATCGCCTTCATCAGATTTGTT
CAGCTCCTTTTAGGTATGTATCTCCTCATATTCTGGGTTTACTGTCTCTGTTTTCGTTTTATCTTGCTTCTAACTAGAATTTATTTCTTTTTCTGTGCGA
TTTGGCGTCTTCGGATGTATATATGTTTGTGTTTGAGCTTCGTTTTTCTTATGCGTGATAATCATATATCGTTGTGTGTTTCGTTTGAACTGAATTTGGG
GGTTTAGGGTTTTTCAGGGATTTGTAATTTTGAGGCCCTTATTAGTTTCCACTGCTTTAGTGGCTTTAGGGTTAAGCGGCCATTGATTTGTTGTTTTTCA
TTTCCACCTTCGAAGTGCTCACTCACTTCATAAACGACTAGGTCACAGCTTTGGATGTCATCTGTGAAAAAAAAATTGATATTGCTTAGGGGTAGAAGTT
TTTTTCCCCTTTATGCTATGTTGATGCTCTGTCCCTCACAATTGATTTTAGGTCAAGGGTTTGGGGTGGGATGGAAGTCATTTACTAACACACCCTTATT
CCCTTATCCATCGTAGTTTTCATTAGTCACTGATATCAATTGGTGTTTTTTTTCTAACAGATATATTTGATCATTTCATAACCAAGACAAGATAAAACAA
AGAAGATGGCCGGTCGGAATCGCGGGCCTCCACTTCCTATGAAAGGTGGTCCTCATGGTGGACTTCCTCCACCAATGCATGAGCCCCAGTTTGCTAGGGG
TCGCTTGCCGGTGCCTCATCCAGCAATGCTTGAAGAAATGAGAGAATCACAGTTTGGAATGGGCTCCAGACCAATGCCTCCACACCCTGCTGTTCTTGAG
GAACACCTGGCTAGTCAGCATGATGAGATTCAAGGATTATTAGTTGATAACCAGAGGTTAGCTGCTACTCATGTAGCACTGAAACAAGAAGTAGAAGCTG
CTCAATACGAACTTCAGCGAACTGATCATTATGCCCGTTCTTTGCGTATGGAAACTGATGTGCAAATGAGAGAGCTTTATGAGAAGTCTGCTAAGTTGGA
AATGGATCTCCAAGTAGCTGATGGTATGAGGTCAGAGCTTATGCGAGTGCGCTCGGATATTAAGGAGTTTACTGCTGCCAGACAAGATCTTACTGTTGAG
TATCAAAGAATGACACAGGATTTGAGTAGAATGACTGCAGATTTACAGCAGGCTCCAGCAATTAAAGCTGAAAGTGAAGGTCTAAAACAAGAGCTGCAGC
GAGCAAGGTATTCTTTTCCCCAGAGTTCTGCTCTCCGTGGAACATTTTCAAATTGATAATTTTTTACTGTACTCTTGGTTTACAGGGCAGCTATTGAGAA
TGAGAAGAAAGGATACGCAGAAAACTATGAATATGGTCAGGTTATGGAGAAAAAATTGCTAGCTATGGCTCGAGAACTTGAAAAACTTCGAGCTGAGGTT
GCTAATGCAGAAAAAAGAGCCCGAGCAGCAGCAGCTGTTGCGAATCCAGGTACTTTCCTTATCCAAGTTCAGAAACTGTAAAATGCAGATATGAATAAGC
ACATTGAAAGATCCATCTTCTGATAAAGACAAATTTTCCTTGCTGTTGTGTTTCTCAGCTGAATTGTCTTTGTTTGATTGAGCACTGTTAAGCATGATTG
AATAGTGACTTTGTTTTAATGTATTAAGCTGCTATATGGTTCATGCAGTTACATGGTTGTCTATTTGATTTATTGCTTCATATCAGAATTCAGAGTTTCT
CTAATAATATTTACCTCAAGTTGATAGTAGAATTTATCAAATTTACCATTGGGTTTGATTCCTTCACAAGCTTCTTTCAAGTGTATTGAATTTGCTCTAT
ATAATACTGTTTATCTCCTCTTTTATTAAATAATAAATAACAAAAAACGGGTTTGTAATAGTTTATTGGAGGTGCAAATCCCTGACAAGCTCAGTTGGAT
ATGATTGCTTCAATTGGTGCGTTGTTTAATTTTTTGTTTGTATATAGACAGAAAGAGACGCATGTAATCTTTCGCAGCTGCTGCTTTGAAATTTCTCATA
CTTATTGGACATAGATTGTTAGTACTGTACCAGTTTCATGAAGTTCATCTTTACCTACACAGGTGCAGGGTACAATGCAAATTATGGGAATCCTGAATCT
GGTTATCCAGGGAATTATTATCCTGCTAATTACGGAATGAATCCTATGAACCCTGCTCATCCTGTAAGTAATTCTGTTGTGGTTTTGGCATTTCATGAGA
TTACAAAGTGAGCAGAAGGACAGCAGTATTTTGCTCTTTTTCATCTAGATGAAATGTGACTTCTTTTCCTTAGTATTTTAATGTCTAACTTTAGTTGTTC
TTTTATATTTTAGGTGCAGGGTGGTGCTGAAGGTTATTCTCAGTATGGACATGGGCCTGGTGCTTGGGGTGGTTATGATGTGCAGCGAGCTCAAGGACCC
AGATAAACTAGTTAATGTAGGCTGTCACACGGTGTTGTGCCTACTACTCTCTGGTACTTCAGAATGGATCTTAGAATTAGATTTGAAATTTTATACTAAA
TGATCTGAGATTGTTGTTTAATATTGTTACTTTCTTGCTTTTTGTGAGAAAAGTTTTAGCTGCCTGCTGGACTCTTATTAATGTCTGTTGCATCTAATCT
AAATAGTTGTCTGCAAAATCAGTAATTACATTTTCTGATATGTGGTCCTTTAGCCTCGTATTTACTTATAAAGAAATGAAATTTACTTCGTTTAATGACA
TTGCACTATTAAAACTTTCTTAGAGTTGATCTACTATCAGATTGTAAATTATGGGAAACCACTGGAGAAAGAATGTCTAGTTTCTGTCAGATCCTGAATG
CATTTTAAAATACATAATTACTTTTGTTCTTGTGAGTAATATTGAAAAAGAATATTACTGAATTGTTGTCATGTCTACATTATTAATTCAGACCCTATTT
ATAGACACTACAATACAATCCTTTACCAAGTAGGATACTATTTACTATTTCTATTTCTATTCTAAATAAGATTGTATAAATCTATTTCTATTCTAATAGG
ATTGTATAAAGTAATTCCTATTATAATAGGATTGTAAAAATTTATTTCTTTCTAATAGGATCGTATAAACTTATTTCTATTCTAATAGAATTGTATAAAT
CCATACCTGTTCTAACACTTCCCCTCAAGCTAGTGCATACAATTCATGTACTTAGCTTGTTACAAATGTAATTAATACGAGGACCGATGAGGGGCTTGGT
GAGATATCTGCAAGTTGATTAGTTGACTTCACAAAATTTGCAATCAATCTTAATGTGCTTAATCTTTTCATGAGATACTGAATTTGATGCATAATGCCAA
TAAAATACAGAGTGATAAATGATAAAATTACTGTGTTGAACAACCCAAGCCAAACTTGCGACAACTACTTTTACCATAGAGTGACTTACATAATCGACCC
ACAAGGCTACCAAAATCCCCCGAGCAACAAAGTGCTCAAAATCTAGTATGAAGTATATCGATCGTGTTGGAATCAATAGATGCGTCGTTATTAAACAAGT
AGGATACTATTTACTATTCTTATTTCTATTCCTATTCCTATTCTAAATAGGATTGTATAAAGCTATCCCTATTCTAGTAGAATTGTATAAACTTTCATAT
TCTAATCAGAGCCAAACCCCGGATTTAAAGTGCCTAGCATTAGCGAATTTTTCAATAACGATTAATGGATAATAGCAAATTTTTCAATAACGATTAATGG
ATAATAGCGAATTTTTTAATGACGGTTAATGGATAATGTCGTATTTGACTAGTCATTTATAGCTATTGGATGGTCATGAGTGTGAATCCCCTTATTGACA
ATTTTGATGTTATAAATAATCATCAAGTTTGTAATAAAAAGAGTAAAAAATGGGATGTTGACGAGAATTGAACCTAGGGGTGAATTTCCTTGCTTCTACC
AGCGTACTAAAGCAGTTTTATGTTTCTCTAAGGGTGCGCTCTTATTATATTCGCTGTTTCTATTGAGATAGATATCTATATATACATGATTTTTTTCGAA
GTTAATGGGTGCACGCGCACCCCACCTATACATGTGGGTTCGTCTCTAATTCTAATAGGATTGTATAATTTTATTCATGTAATAGGATTGTATAAATATA
CAAATCTATTCATGTTCTAACAGTTCTTACAACAACAACTACGCCTCAATTTCAAGCTAGTTGGGGTTGGCTGAATGAATCGTCGGCATCATAAATGCTC
TATTTGGGGTTGTGTTGTTTCAATACTCCATATTTAAGGATTCTCAAACATTAGAGGTCCCCTGATATACTCTAGTAACTTTATTTCTTCTAATATACCA
AGGCCTCAATTTGTTTGCACTTAATAAAGGTCTTCAGATCTCTGTTATTAAGTCTGAACTTACTGTCGTTCTATAGAACTTTATTTTTACTTTGCCTGGG
TATTCTCTTATCTCATAACTTTGGCAGTATTCCATTTCGATATTCCTACTATAGTGCAGTTGCTAGGCATAACATCTGTCAAATTGCTCTTCTGGAATAT
TGGAACTGCATTTCTGAACCGTCTTCATTAGATGCCTCAGTTCCATCTAATCTCACCTCAACTTCATTACTATCTTGCTGGCTGGACTCGCAGTGTGTGT
ATTTTGTCTTACTCTACTTCCTAAATCCCTTACTCTCTTAAGTGCTTCTCCGCTGCTCGAACTATTAATTGTTCTTGATGTTAAAAAAATGTAAAGAAAA
GTCGTCTTTCATTGTGAAAGAAAAATGAAGTCACTTAATCAAGTATAAAGATTCATTTATGGATTTGGTTGTCTATCACGCCTAAAAGTGCGCAGGTATT
ATGTTTTCCTCATGAGAAAAAGTTCCGGGAATCTTTTAGATGATCGTTTTTTTTTTGTCATTATTAAAAGAAGATTTGAATGCTCAGTATGGTATGACAT
TGTGCATATTATTTGTTCGCATCCAAAGTTATCCCAGGATTATTATCCTATAACCACGGGACTAATTTATCCCCCGGGTGGGATAAAATAACACCATCTT
TGAGGTATAAATTTCAGTTATACCTTCAACGAAACAAGTATAAAATTTTAATCTCCAAACTTAATCTGGGTATATGGCACCTTTCTGTTACACAGGGGTG
GGGTGGGGTGGGTGGGTGGTACTAAACTAGTAGGATATGTTTGACATTAAAAGATTACAAATTATAATCCCTCTCTCTGCTAAAAGGATATTGATTTTTC
TGTATATCCAAGTGTTGTAATTAAATGTCGTAAATTAGTTTAGCTGGTAAGGCAGACACTTTTCTTAGAGCTAATTCAATCGCATAAGACAGTTTCCATG
TGCCATTTTACCTTTACCATCTTGTCAGCTTATTACCTTTTTTACTTTTACCATCTTATCTCATAAAATCTTGATGACTTTTGACTTAAACGGGCATTGA
AATATTTGGGGCTCAAAGTCTGTTTGCAAATTTGTGATGAGCACTTCTCTTGTACCGTGTTGGTGTATCAAAGTTGATAGGTACAGAGGGACATTCTGCT
ATGCATTGTGTGCCAAAAATAACTTCAATCAAATGTGGTATATGGTAGCTTTCTAGTAGCGTTTGTTGTGATCCGTTCTCATTCCCTTATATTTGCTGGG
AGGAGTTGCAATTTCTGTATGAACTTGCACTTGTGGATGGAAATATGAGATTTACGATAATTCATTTAACCCAAGATGGAGTTTTAAGTTATCCCAGAGC
TCTTCGAAGTTCGAAGTATGACCTTAAATTGGGTTTAAAGGCAAACATTTTGAAGTGCTCTTACCTGTTAGTACATGTGATATTCTATAGGGCACAGGCC
CAGGAAACCATGTACATATGAACTCATGTGTGGACAGATGGAGTGCTCTGGGATGGAAACTTTACCGCAATAACTTTCCCATTGCTGCACCGCATCTCAA
AAACAAGGGTGAATAATGTACATGCTCTACAAGGGTGAATTCTTTTCATTCTTTATTGGTAAGGATGTTGACAGACATCAGAAAACTGAAGCTAATTGAG
TTGGAAAGAAAAAAAATTAACTGAAAAGAAGGAGAATGTATGGGGTTGAACTTTGGGAGATAATCTAGCTGTGTTGCTACGAGATTGTTTTTCTTGCTCA
AGTAGAGCTTCTTGATATTTGTTATTCTGTTCTACTGCTTTATTGATTCTGCGAAACCTAATTTGTAGTTCAAGTCACTGTTTTATTTGGTCTCATGGTT
TGAAGGCAAAGCACTCTTTTTAGGTTTTCAAAGGTGTCTTTCATTCATATGATGAAATCTGCTACTTTTTAGGACCCATCCTTGTAATTCATATTCTAAT
CTTCTTTTATTTCCAGGTTATAATCAATGTCTAAATGAGTTCATCGACGACACAAGCATGAAATTTTTGGGTGAGTGTTTACTTATCATTATCCAAATGA
GTACTTTTATCAGATAACTGCTTGTTTTAAAAGTAATTTAGCAACATTCTAAGACCAGTTTTCTCTTCTCTCTATCTTTTTGATTTTCTTTTGGATCTCT
TTAGCATTTAATAACAGAAATATTGCAATATTTAGGCCCTATTTATTAAGACAACATGTTTTTATTGATGAGTATTGTGAACTTAGGTTGTCCTGGACTT
CACATAATGGTTTCCTCATGGAAAAGTTTGACAGCAAATGTGGGGAAGAGATACATGTATGAGGGAAAGTCAATTCTTGCTTCCTTCTTTGATACCTCTG
TTCCATAAAATGATCCACTACCATTTAAATATTGCTTTTACTCTACTTTTTAGTACAAATTACCATAACTTAACACCATTATGGATTCCTTATCACCACA
TTGATCATTCATTATAAGCTAGCGAACTAGTGATCTTTACATTAAACCATCTGGAAGATTACTTTAAGGAAGTATTTTGTTTTGTACACTTTCCACCAAT
AGTATCTTTTATGAAGAATGTATTAAGTCAGACTAACTAGGTTCGCAGTTGCAAAATTATAGCTTGAAAAAGTTGGTCGAAATGCCAAGTTGTTTCATCA
AATGTTGTAGTAGTCATTTTCTTCTTCTTCTATTTAAATAATAACACCTAAACTTCTATCCCATACATGCTTGAGTTGGTTGTTTGAATCCTCTATATCT
GATGCATCTTTTAAGACAAAAATTAGAGATTCTGTAACACAGGGGGTTTCCCAAAATCTCCTACTTATGCCTACTGACATGCAAATCTCAAAACAAACTA
GGAAATCCTTGGCAAACACAGGATGTAATGTAAGCAAACTAACACTGTTTTGAATCAATACAAGCTGGATGAGTTGCTCGTATTGTTCTTTTTGCATGGA
TTCTTATAGATTGTTAAAAAAGTGAACTGATTGTAAGTGAATCATCTTCTTATGATTACGACTTGTGGTTGCTGTAAAGACCTTACTGTGTTTGGCTTTT
TTAGATCTACACCGTTGTTTGAGATAACTTGAACTAGTATATGCACGAGAACAGTGTTGTTTGTTTTTGCATATCGTCTAAAGAAAGTTTTGTTTGTTGT
ATGCAACAGGCAGAATCCGCGGCTAAAGTGGTTACTTATATTCAGTCTGGCAAGGCAATCGATTTATCTCAGTTATTTTGCAACTTGTGCTATCAAGTGT
AGCAGTTAACAGCAATGTAGATTTTCCAGCACTACCTGTTTTTTGAACAAATTTCTGGGCATATTTATATCTCCTTGTGAATTGTAATGCTATTTTGTGG
CTCCTTTTTCAGTCCTACTCCAAATTAGTTATCCTACCTTGTTGGCAATCAAAAATAGTGAAAATTTGATTATCAAAAAAATTCTTACTGTATGGTATTT
TAAAAACTTGACTAAAAAAAATTCGTACTAGTATTTTATATATGGTTTTAAAAACCGTTAGTGTTGTCATAAAACACTTGAAATGGGATGAAAGATGTTA
AATATGAAAAATCTCATTGTTAATCTTTTTCAAATTTATTAATACATCTTATTTCTTTTTTGTTTTTCAAATGCAATCTTAGATATCGAAAAGATATAAT
AGTTATTACATATTTCTTTTGTCCATTTTTATTTATCACGTTGCATTTTTTAAAAGTTAATTTGATTAATTTTAAAAAGTATATTAATTTAATAAAAAAA
TTTCAATATTCAAAAATTATATAAAGAAAACTATCAATTGCAATTTTTTGCATATCAATATGATGAAAAAATACATCATATGAAATGTTAGTCAGAGTTT
ATAACGTTTGACCTATAAAAGGAAACCATGACAAAAAAAAGTAGACGGATGGAATAGCAAATGGTACGTATATAATTCAGTCAAATATTCGTTTCGTTCA
CTTTTATTCGTCTTCTATACTAAAAATACATTCTTACTTTTAACGTATCAAGAATAATATTCTCCCTCTGTTAGAAAAATATTCATTAAGTTTCTTTTTT
TTAGTATGTTTGAAAAAGCTCCCCTCTCACTTTTTGGTAATACTTTAAGTGACGTGTTTAAGATCACAAAAATATTGGTTAATTATTTTTTAAAGAACGG
TGAAAGTAACGAGGGAGAGAACCACGTCGTTTTAATGCGGAGAAATTGGCGCAAAATTCTAAAGTTTGGAGCCACTCTCTTTAAACTTCCCGCTAAACTG
AAACTGCAAAAGTTCAAAATCAATGGCAGAAATTCAGAATTTTCAAAAACTCAAATAATTTAACTGCTAATCTTCCCGGGTTTTTGGTTCCAAATTTTCT
CTACTTCATCCTCCTCTTTTCCCTCTTCTTCCACATCTCAGTTTCTCACACAAATCTTCTAATGGGTGGCAAACTTCAAGTTTTACCTCCAGCCAAAAGA
TTCATGATGATGCATCAACAAGATCAAAAACAAAATGGGTCTGTTTCATCATCGAAACTTCCTGCTAAAAAGCGAAAATTCTCTCCAGAAACTCCCCCAC
CTTTTACAAATAACCACACTGTTACTACTCTCTGTTTGCCCGCGAAGAAACGTGTTTGGGCTTTTCATCCATTTGATCTCAATGAGGAGTATAACCCAGT
TTGTTTTAATGGCGATGAAATCAAGGAAGAAAAAATAGGTGAAGAAATAACAAATGATGACATCGATGTGGATGAAGATGATGGGATTGTTTGTGTTATT
TGTAATAGCACAGACGGAGATCCATCAGATCCAATCGTTTTATGTGACGGTTGTGATTTGATGGTTCATACGTCTTGTTACGGTCATCCGTTCACAAATG
GAATCCCAGAAGGCGATTGGTTTTGTGCTCAATGTTTAGCCTCAAAATCCCAAATCCCAAACCCAAAATCCTTCAATTGTTGTCTCTGTCCTGAATCCGG
AGGCGCATTGAAATCTACTGTGAGTGAAGGTAAATGGGCTCATGTTGTTTGTTCATTATTTGTTCCTGAAGTTTTCTTCGTCGATTCAGAAGGTCGTGAA
GGAATTGATTTCAGCGAAGTTCCTAAAAGAAGATGGGAAAAAAAGTGTTACATTTGTAAATCCAAAAAAGGATGTGCTATTGATTGTTCTGAGCCAAAAT
GCCCTTTATCTTTCCATGTTACTTGTGGGTTGAAATGTGATCTCTGCATTGAGTATACAGAAGGACGTAAAAATGGCGGTGTTGTTGCTGGATTTTGCAG
TAGCCATACTGAGCTATGGAAAAAGGTTGAATCTTTTTACCTTTTTTTCAATTTTTTTGTGGCGGATTCAAAATTTGAACTTTATTGATTCAATCTTTAA
TCCGCTATTTTCTGAAGTTAAAGGTTTAGAAAATATTAGATTTAGTTGAACTCGTTGGGTTATATTGTAGCGTAGATTTGTATTTAAGTAGTTGAAACCC
GATTCTAGAACCTATAGAATTTAAATTTTGAATCCGCTTCTGTATATGATCTCGTATTTAAAATTAGTTGTGTTTTACTGTCATAAAAAGTTTAATTTTT
GGGGTTTGTATTGCAGCAACAAAAAACTGGGAAGTTCAAGATTGTACCAAGAGAAGAATGAGAATCATAGATTTAGCAAGAGGTTTCGAGTTTGAATCTC
GAGTATGGAGAAAATTCTGTTGAGATAGTTATGGATTTTACAGTGAGCAATTTGAATTTAGTTGTAACTTCAATGCGGACACAAAAAAGAGAATCCTAGT
TTTTAGGTTGTATTACAGTAGTTGATAGGCAATAGTATTCTATGATGATTGAAATTTGTATTTTTTTTTATTTATCATACTTCGAAATTTCTCAGTTATT
ATTATTATTATTACTAGTACTTTAAAGATTGATATTTAACTCTATAAAGGATACTAACATTAATATGACAATATTTACGAAATCTCAATTTGGATAGAAC
TCTAACAAATTTACTTCTTTTTCAAATCAAACACTTTAACAACCTTATATTATGGGGCTAGTATTTTTTTATTTATTTTAACAATGATGAAAATATTGAA
AAACAACATGGCTTCGCGTTTGAGATTTTGGTTGATTTTTCAAGTAGTTTTAGTTATATTTTTTGCTAGATTATCATGTAGTTTCGAAGCGAAATCAGCT
ATTGGAGATCCAGGTATGAAAAGGGATAATTTAAGAGTTGCTATAGAGGCATGGAATCAATGTAATGAAGTGTATGAAGAAGCTCCTAATATGGGAAGTC
CTAGACATGCTGATTGTTTTGATCTCCAAAAATCAAATAACAATAGGAGTAAGTCAATATACAAAACTCAAATCTAATATCATTAGTTAAAAAACTATTT
TTTGACTTTGTAAGGCATAGAATAGTGTTTTTTTGCAGAAATTTGTGATGTATATTGTTGTAGAGAGATTAATATACCGTTATTGTTACTTGATTAAAGG
TTTCGAGTTAAAATTGTGATAGAGGCGGATTCTAGATTTAATTTAATGGATTCGACTTTTAGGATTCTTAGCATTGAACTTACTGTACTGTCAAAAAGTA
TATTAACCTCTTTTCTTTTGCTGTCTGTTGAAAATTTTTATCAGTAACACTAAAAATAATGTTGTTGCAGCAAAGCTGGTTCACTTGGTGAATGAGCTTG
ATAACAAACTAAGTATAAATGACGCCAAAAGCTTAGGACAATACTCCCTGAATGTGGATATGTATGCAGCTTGGAAAGAATTGTTCTTAGGATACAAATG
CAAAGTTCAAGATGAGCCAAAACCATGGAATTTTTGGATGATCATGCTCAAGAGTGGCAACATGGACACAACAGCAGCAATTTGTCCAAGAAATGGCTTA
CCATCTCAACCCTTTGATCAAATACCGCGATTTCCATGTTTTGGAAAAGGTTGCATGAATATGCCTAGGATATACCATGATTATACCACATTACATAGTC
ATAGGAAACATCCAAAGGTGACTAAGTTGAAAGGGGGGTTTCATGGTACATGGGAATTGGATGCTGATATGAGTACAGCGAAGACTCAGAATGATACTTC
ATTTTTCTCTGTTACTTGGCATAAGATTCTTGGAAAAGGAAGCTGGAAATTTCATCATGTGTTGAAGACTTCATCTAAGTACCCTTGGTTGATGCTTTAC
TTGAGGTCTGATGCAACTACAGGATTTTCTGGTGGATATCATTATGAAACAAGAGGCATGTCAAAAATAGTAAGTTCCTCCTCCTAGTCGTCGTTATTGT
ATCTTCATTGAGATTGAGTCATAGTTGTAGTTTACTTGTTATACAATCTGATGTTCTGTTTGCTGATATGGATTTAGGTCCCAAAGTCACCAAATTTCAA
AGTGAGGTTCACACTAGATGTGATAAAAGGAGGTGGTCCAAGGAGCCAATTCTATCTAATGGACATAGGTAGCTGCTGGAAGAACAATGGTCAGCCTTGT
GATGGGGATGTCACCACAGACGTAACGCGTTACAGTGAAATGATCATCAATCCTGATATTCGTGCTGTATCATCAGGGTGCAACCCCAAGGAGAATTTGA
AGCTGTGCCCAGTTTACCATACTTTTGCAAATGGAACTCGAGTTCATCGTACTGATGAGGCTAGATTTCCCTATGATGCTTATCATATGTATTGCTCCCC
GGGCAACGGAATGTATCTTGAGGAACCATTCAATCACTGTGATGAATATAGCAACCCTCAAGCTCAGGAAATACTTCAAATTCTTCCTCATCCTGTTTGG
GGAGAATATGGATACCCAACTAAGAAAGGAGAAGGATGGATAGGTGATGCAAGAACTTGGGAACTTGATGTTGGGAGACTCTCACAATCACTGTACTTCT
ATCAGGTAACTTGACTATATCTTGACGCGTTTAACTTCTCCACACACTATTAGATTGCCTAAAAGATAACTAACGCACCTGAAAAATAAGAATGCATTAA
CCCCTAGATGAATCGTAACGTTGTTTCTTGGGTGATATTGCAGGATCCATTTACTAAACCAGCTGAGAGGCATTGGCCATCTATTGATTTGGGAACTGAG
ATATATGTTAGCAGTAATGAACTTGCTGAATGGACTGTTAGCGACTTTGATATCATTGTGACTGATGAATAGTTTTATTTTTCTTTTGCTAGTTTCACTT
TTTGTTAAGAATAGTGTTTTTTCTTTTGTTTTTGTTTCTATTCTCTTTGCTTGTTTCACTTTTTGTATATTTCTCGCTTTATACAAACATAAACGCATTT
TATACACTTATGTTTGTATAAAAGTGAGGGAGCAAGAGATGGCGCGAAAAACAGAGAGGTGACTGACAAATAGCTTGCTACGGGGTACAATTAAATCAAA
GTGTAATTATAATACTTAATTTAATTTCTTAATTTGCTATTATATACAATTTTTTCCTTATTTATAATTATATTACCTCATCATTGTTTCAAATTATATT
ACCTCTTTTGATGATTCATTGTTTCAAATGAGTTCTCTTAGAGTTAAAAAAATGGGAAGAACAATATTTTTTCTTCATTATATCAATTAATGCATCGCGC
CTATATATATATATATGTACAAGGGGGCATAAATACTAACTCAACAGGGCAACCTGAACCTAAAGAATACCTATTTAGAGACCCTGACAACTAATAAATG
GTAAAATCATTAACCGGGTTAACAGATCCCTCTTCAAATCTCCCATGCTGATTGATTTGAGGGAAAATGCATATCGTGAACTGTCTCACTGCAAGGTGGA
TGTCCTCACTTGATTCAAAGAACCATCAAACAATAGTATCGACTAGGTTATAGACCATACTGAACGGTGCCGACCTCTCTGTGAGCAGCAACAGCGACAG
CTGCAGCACCGACTGCACCAAACTGTGTTTGTGCCTGTAGTAATTTTGCATCCATGGCGATTTGACCTCCCAACTGTGCTACCCTTGCCTGTGTATGGTA
ATATGGGTTAGTGTTCATCTCAAAACTCATACTAGCGGACGACTTGGCAACCATGCACTGGCCATGTTGCTGTTTAACTTGAGAGCGGTCCTTCTCTGCT
TCTGTCCCACACTTCTCTAGATGTGTAGAGTTACTCCTGAACAGATATTGTGGAGACATGCCATGAGGTTGGACGACAGAGTTCTGGGCATATACTCTTC
CATCAGTGACTTCTTTGATGCTTCTGTCACCATCATATACTGGTCCTAAAACTCTTCCAGGTTTGGCTGAAAATGATAGAAATGAATATCAAAGAAGAAT
CAAACAAGCAGACATGCACAACCCACTAAGTAATATTTGACAAGGACATTAAAAGCGATTCCAACAAGCACAAGAAACTTCCTAAGTTTCAGCATTCCGT
ATATACTCACTAGGGCACCTTTAAATATGATCTCTCCTCATCCTTATTTGTCCCCCCCCCCCCCAATCTCTTCCACAAGCAGGGGATATAACTTGAGAAG
ATTCCCTAAATTGACTTCTTGTGAGCCGAGTACTGAGTTCCAGTTCATCCAATGTATTATTACATGTGGTGAAATATGTGAGTTCACTATGAAGATGTGG
ACAAAAAGGTACATTATCACTATGAGTGCCAGCACAGACAATGTCAACCTTACCTGTGGGTACTCGAGGTGGTGGTCGCAAAACCTTCGGGTCTGAGACT
CTGACGCCAGCAGTTGCCTTTTCTGTTACTTGTCTATGATCAAACATAGGATTCTGCTGTGTTCTGGGGGGGATGGTACTGGAATTTACAGTAGATCTGC
AACACATTTAAGAATATATGTAATGAAGCCCCAAATAAGCACACTGAAAAAGGAAAGGAGAGAGCAAAAAGGAAAAGGGGGAAAGGGGCATGCTCTAAGG
TAACAGTTTTTCCAATGTGATGAACAAGTTAATATTCCAAATCCAAACTTCCTCAGTAGTATGCAAGTACAACTTCTTTTCAGGCAGGTTACTTTTCCAG
CAAATACAAGAACAAACAAAAACTTCTTTTTTGGGAAGATACAGTGAAGAGAAGCATAAAAGAAATGGAACAGGACATATTCATTGACACAACCAACAAG
ACAAACAACTCATGGAATCATACCGCGGGAGAGAGACGTGCTTTCGACCAGGAGGTATTACTGGGCCACTTTTACCACTATTCTCCTCTAGATAAGCAAA
TTGCCTTCTGAAATTACCAATGGCACTGCAATTCAATGATTGTCACACCATCAGTCAGTAATTTAGATTAGATATAGTGGTACAAGAAAATAGAGACTAG
AAATAGTAGAGAAGTATATTACAACCTAGGATAGATAAAATTTGCACCACTATTTCCAGCCATGTAGTCCTTCAGAAGTTGAGGATGATACTCAAGTATC
TCCCTAAATATTAGTTCACGAATGTCATCCTTTGTGACCCTTCGTCGCTCAAACTCAAACTCCAGCTTCGAGATTGGTTGACTAGAAGGTTCCCTCTCAA
TCTTGGCCAGTCCCTTGAAGTACGGATCAGCCAAAGCCTAAAAGATAGGAGGAAAAACACACAAAATGAAAATGAAATTAGAAAGAGACAAGCACGTGGA
TATGCCGTGGATATGCCATTCACGTAATCTTAACATCAGGAATATATGAGGGAGTGTACCTCTTCAGCAGTTGGGCGATCCTTTGGATCAAATGCTAACA
ACCTCTGCAACAGTCGAAGTGCCAAAGGATCTGCTTTTCGAAATTTCTCAGTAAAAGGAACTGGGCTTTTTTTCTTCATATCTGTCAAGTACTTCCTTGC
CTTTTCATTACGAACCTGCACTCAAGAGGAGTACTCTTCTATCAACATGCTGTCAGGCAATGCTAACATCAACAAAAAAATATTACTCCCAACTGACAGC
TCTTACCCCAGATACAATATCAACTGATGGCGTCCCCAGAAGATCAGTAATCAAATCCAACTGGTGAACAACACTTTTGCCCGGAAATAATGGTTTCCCC
GTCAAAACCTCCGCAAAAATGCACCCGATGCTCCAGATATCAATAGCAGGTGTATACTGCAGGGAATTCTTACACGAATTAGAAGACAAATCAGCAAAAA
CCTCAGTAAGGCCTTACTGAGAAATTGACGCAAGACCTAACACAGTTACCTGAAGAATAGAAAAATCAACTTCCAGGAGAGTTCAATAGTCCTCCCTGAA
CAAGAATGATTTTAACCTACACATCACTATTTAATACACTCAGAACTGAACAAAAATCTTCTATTCTACCAGAAAGCCCTTCCTTTTAACACTATGTATA
CAGTATACAAGTACCTTTTCACCTTTCTAAAGCATGGGAAAAGGGAGGCTATTATATGATGCCAAAAACAGCATCTTAACAACTGAATCCAGCAAAAATA
GACGTGAATATGTTCTGTGACTAAGCATGGGCTAGCAAGAAAGTGGCTAACTAACAGATGACTATACATGTGTGACTCTGCATTAGTTTAAGAGATAAAT
GGAACATAAACACGATTGTGTCTGATACCTACTCATTTACAACAACACCCTTTGCAACAGAGTTGGTTTTTTCTTTTCCTTTTTTTTTGGTACAGCTCCC
GGAGGGAGGGTGCTGGGAAAATTTATAAGTAGTTTGACATATCTTTTTGACAAAAAAGTATTTTGATCTATTAGAAGAACCACTAACATGAAGTTCTAGA
ATGGAACTCATAGATAAGGTTCAGAACAAAAAGTATCTTTTACATGAAAGTTAGAATAAGCTGCACTATTCACATAAATTACCTTAGAGAAGAAAGACCC
ACATAGTTCTGGTGCACGGTACCACCTTGTAGCAACATAATCCTGCATGACGTGAAGATGAAAAAAAAATAAGAAATTTTCAGTCAAATCAAAGATTAAA
ATGAATGAAAAATGTCCAATTTATAAAGTTCTCTACGATTTAAACTAAATCCAAGTGAATCTTATAGGTGGCTTTTGGGATAGAGCTAACACGAAAGCTT
ACCGTCCAGAATATTGTGGTTGGTGTATCACTAAATGCAACCCTTGCCAATCCAAAATCACATATTTTGAGTTTACAATTTGCATTTGCCAATATATTTT
TTGGCTTAAGATCTCGATGGTAGACATTAGCTGAATGAACATATACATATATGTCAGTCAAAACAGGGCTGAAACTCAACATATTTAGGAGATGTAGATG
GCAGATGTCATAAAACTAGTTACCGAATTCACAAGACTTTTACCTGTGTGCATGAACTTCATTGCACGCAGCATCTGATACAAGAAAAAACGGTGGTGCT
CATGTGTCAAGTCATCATTGGCCTTAATAACATGGTGAAGATCAGACTCCATAAGCTCAAAAACAACATAAATATCTCTGAACTCTCGTCTTGAAGGTGG
TAAGATGATTCGCTTAATTTCAACAATATCAGGATGCCTTAGAAGTCTAAGCAATTTGACTTCACGCAGAATTCGAATTGCATCAGAGATGTGCTCAAAA
ATATCAGTTATTTTCTTTATAGCCACTTTCTCTCCTGTATGAGTGTCAATTGCAGCACAAACTACTCCATAACTTCCCTTGCCTATAACTTCCAAAATTT
TATACCTATTAGCATCACCGTACTCGGTGAAGAACTCCACTTCTTTGGAACTCTGTACAATCAGTAACAAAAAATCAGACATGTTTACCATAGTCTACTG
ACTAATAGGCAAACTAAATATAAGATAAAAATCTGCATGTTGCTTGATATTCTCAAAGCATATGTCGATGAAATTTCAATAATATTCAGATCAGTAGACT
TCTGTTGTAACATAAAGAGAATCAAGGATCAATTTATGACTTGAATAGACAATACATTCCAATTTGAAAATCAGACTAGACAATTACGAAACACTATTTC
AGAGTCAAACGAGGCCCAAGCCAAGGACTACAACGTCAGATTACATTTCAAACTAACACAGAAGTTCTCGCATGAAGTAGAAGTCCAGAATCCAGTAAAG
GAAGAAAAGCATAGGAAAATAAAGAACACTTCAAAACTATGAAAGGAAAGTAAATAGAATGCTGCCCCACAAAAAAGACAAAACAATTTATCCCACAAGG
GCATTTTCACAAGTATGTTAATTTGCAATATGCTTAAAGATTACTAAAATAACTTAGTCCTCCATATGCAATTAATCCATCTCTGTTTAATGAGTTACCT
ACCTACATTTCTAAATACTTTACATAGCAGCTTAAATTAGTCAACAACTTCATATGGTTAAGAGATTACTAAAATTTCTGATAAATCAAATAACTTAGTC
CTTCATATGCAAATTCTCCAACTCTGCTAAATAACATATTCTAAATAAAAAGCAGCCTAAATTAGTCAACAACTTCATATGGTTAGAAGATGACTGATAA
TCAAATAACTCAGTCCTCAATTAGCAGCTAAAATTAGTCAACAACTTCATGCTTCCTGAAATAAACAAACAGTTACATAATCATCGTAGATGACTCAATC
AATCAATTTTGGCTGTAATGACTAGTCTTTTAAGGCAAATTTGGGTACTTTACTAGATACAGTCAAATCTTAAAAGCTAGAAATAACAAATCTAAATCAA
GATCTCCTTTTTATTAAAGAATTTCAAAGGGGAAGATAAAGAAAGAGTGAAACCTTCTTGCGCTGATCTTGCTGCATCTTTTGAAGACTTTAAACAATCT
GGGTAACGAATAAATTCAAAAAAAGAGGATATCTGAAGGTACCCTTTTCTTCTCTAGGTTCCCCTGATCTTATACAGAAGATCAGATCAAAAATATCCAA
AAATAAAACAAATCTGAACAACCCCAAATGGAATAAATCAGAGAATCAGCAGAGCACTTCGCCCCACCGACGTCAACAACGTATTGAAACGTACTAACAA
AGAGCGAACCCCACTTTTGAAGAAAACAGTATGATTTTTATACACAAAATTAGTATCAGTTGAGCCTAAAATCCTACAAAAAAATGAACAGAAAATGAAC
GAAGGGTGTAGAAAGAAGTAACCCTTTTTCGGGTTTTGAAAGATGGAGAAGAGAGAGAGAGCAACAAGGAGGCCAATTGAAGAGGAGGAAGAAAGGAGAG
GAAAATTGGTGAGCTTTTCGGTCTTTTTAAAGGCAACAAAAGATTGTGGCTTTGCGTGTTTCTACGGTTGTGTTTTCCCCAAATATTTTTTATTCCATAT
TTAAATCGATCTCGATCTGATATCTATAATAGTTTACATAAGATATACATACGGTATGAGTAAATTGTGTATGTCTATTTATTCAATTTTATTACGGATT
AAATATTTATTCATACATACTTGAAATTGAAGATTACATAGATTTTGATGCGTCTAGATACATGTGTCTCGAGATATATGAGGTAAAAATTAGATGTAAT
TTGTTTCTAGTTATATTGTGCCTAAGTGGATTTGCGTGTGTATGAAATACATAACAAATTTCACTTGTCTCCTTCTCACCTCGCTCTACACTCTATATTT
GGTACAGATAAATATAGCTCGTGTGATTTGTATATATCTGAAATACTCTGCTCCTTTCCCATATCGCTAGTCTATCTCTCTATCTTAGTATATCCAGTAA
CAAAAATATATGAATCACAATATATCAATTTTAATACACAATTAAAATAATTATTTAATGGTAAAATATATAGATACTTATATATGGTGCGTATATATAT
ATATCTAATAAGGCAATTTGTAATAAATTAAATTTAGTTTGACCCAATATAGAACAAAATAATTATACAAAAATATTTTGTATTTTATTTTATTTACTTG
AGAATTTTGTAGGTACACATTGGCATATGGGAAAGGAAAGGGGCGTTTTCAACTTTTCGACTAACAATTTATTTAAATTTATAATTTACTATATGAAGTA
TAAATACATTATAAAAGTACACTATAATGTAAATAAATATTAAATCTAAAGGGATTATTTTAATGTCACAATAAAGTCAATGTTAAAAATCTTGAAATTT
GATTATCTTAAGTAATGGTTCTGTGATCTGTAATTTATTTTCATAAAACAAGTGACTTCTTAGTTAATTAGATTTTTAGATTTGTTTTTGCTCATTAATA
TGTGACTATATTTAGTTCATCGTTCGTATTTAATATTTCTTTATTATATATTATTTATAAAGATTATGAAATTATATTTTATTTAAGTTGAAAATTTATT
AAAAATAATTTTACAAGATGACAAGATGAGATTTATTTATTTGAAATTTTATTTATGAAATTACATTAAATAATACTAATGAAACTTTAAATTTAATTAG
TTATAAAGATTTCCTCACTAATTATAAGGACAAAAAAGCTAGATTATGTTGCGATCCACTAAGATAATGATTTTGAATATTCTATAAAATTATAGTAAAA
TCATGATTTTGAATATTCTATAAAATTATAGTAAAATCAAGTTAATTAATGCACTTACCAGATTAAGTACAAAATATTTATTTATTACCTTCTTTTTTTT
ACAATTTGCATTATCAAATTCCTCCTTAATTAATATTTTTTTTAATTAATTGTTTTTGTCAAACCATGCAAGCCTTTTATTAATTAAAAGGTAAAGAAAC
AGTCAATTAAATTGTAACCATTCAACAACCATTAATTAAAATTATATAATCATCAATTAAAATACCGACATCATCACTTTTCACCTAAATTATGTTTAAA
AATTTTCTTTCGTTCTTTTTATTGATGTCTGATATTTATATTAAAATTTGACTAATTCAAATTCAAATACACGCTGTGTGCATATAAGACTTGCACACGA
GGCTCAAATCTCAAGACATTTCGTTGAAGCAACCATACAACGCACAGAATTATTATTTTTTTTTTTTGAAAAAATAGTTACCCTATCACATTAATGTAGA
TAAGGTTGTTCTCTTATCGTTCATTGACCACATTGTATTATCACAATTATTATGATCTTTTTTTCTATTGAAAAAATCAACTTAATATAAGGGGAAAAAA
AGGATAAGGGACTGTCGGTGATTGAAACAAATCTGGACATGTGTTATGGATAAAATTTTCTATTGAATAATTTATTAATTTATCCTTTTCTAAATATTTT
AAAATAATTCTAATTAAAAAAATGAATATCACGTGGTTTATTACATTTAGGTTAGGTGGCCCTATCAAAAAAAACCATGGTGAGAGTTGTACGGTTGGTG
GGGTTTGGTTTGATTGAACAATTTAATTAAAATATTATCATTTACTTAATTTGATACAAGAAAAATATTATTGTGGGAAAAGGTTGATTATACAAAAAAA
ATATTTATAGGCGAAATAAATAACATATTCTAATATATTTTTTTTTTAACAAAAATAATTTAAGAAGAAATCCTTTCATTCTTACCAATTATATTCAACG
AAAATTTAGATAATTTTATATTAATTGGAACAGATTAAAATAGTATTAGTTATAAAAATATCTATCTAATATGTCATACATATTTTTTGAAAATCTTAAT
TCCTTCCTATTTTTTCTTTCCCCACCACAATTTTAAAATAATAATATATTTTTCAATACTTGGAGCAATAAAAATTATTTTTTTAGAAAAGAAAGGTATT
CTTAATAGTTGTATTGACTAATAATTTCAAATATATATATTTTTTAATATATAGGACCTCTTTTAAATGAAAGAGACAACCCAAAGTTGATGGCAAAATA
TTGGGTGGTGGGCGTGGGGAATGACGTCGATAAAGACAACCCATGTGTGTCTAGGAATTTTTTTTCCGATTAATTTAAATTCATATCGAAATTAATAATA
TTATAATTTTTTTTAATATGTATATGGATTTGAATATAAATTTTAAAGTTATACTAACCTTATTTTGAAATAAAAAAATTAAAATTTGAATTATGAATCG
CTTGACAAAATTCGAGTAAAACTTAGAGCGCGGATAAATCTTCCGAAGAGGAGTTGATCATTCCTTCTTCTACAACTCTATTTCTATATTTTATGTAATT
GTTAAACCTTAAAAGAAACATTTTTATAAAGTATTATTAATCAAGATTCATATGCGTCACATCTTAAAAAAATTGAGAAAATGAGAAAGTCACAAATATT
TTAGAATACACTACTACTCATTGACCTTAATACTTCATCGAATTTATTGGACGGTGCTTGACTAAGTATATAATTTTAAAGATAACAAAATAAAACGTTT
GACATGTAAGATTAATAAATAATTTACAGAATATATTATATATTCTTATAGCCTATAGGAACAAGACAAAGACAAGGGAAGACAGAATAAATAAAAAATA
TTTTCTAAATTCTAAATATAAAAAAAATGGTTAGCGTTTTCTCTGAAACATATTAGAAGGAAATTGGATATGTTGATGAATTCTTTTTTTTTAGTTTTTG
TTGTTGATTAAAAATATTTAACGTTATTTACTTAACCAAATTATACATTTGTTTTGCTATAAAGAAAGTATTTCATATTTAGACTATTTTAACAACTATA
TTATCCTTGAATATGGAATAACACAATTTAACATAATACATCCATATTGAATTATTTAATAATTTATTTAATTTATAAATATCGATCACTTAGCGATCAG
AATTATATATACTAATTAATTGAAGGTCAAATGTACATAATCATAATTAAAGGACTAATTGTGTTTAAAAATAATACGAAATATGTGAGAATAGATCTAC
GAAAACTCAATAGCTTTAGCAAAAATCGTGTATTCATTTTGAAAAATCTAATAAACACATAAAAAATATTTGTTGGGTACCTAACAACGAGATAGTCTCT
TGATCTAGTGATAGAAAAAAGAATTTTGCTTTTAACTTTGTTGCGTTCTTTAATTAGAGTTTGATTCCTCTTGAGCACGTAATATAAAGTGTTTTGTTTT
TAAATAATTTATAAAAATTAATTCACATTAAATCTTGAATCTCCCTCTAAAAATACGAAGACATGCATAAACTAATTTAAACGCCATCAACTTTTAAAAA
TATGAAAATAAATCAAAACTAATTTAGACGATATTGAATCTTAAATTCACTTCTAAATAATATGAAAATATACACAAATTAATTCGAACGATCACCGAGA
AAAAACAAGGAACAAGAACTAGTTATGTCGTCTTGTTCATAGACATTGGTAGTTACAACTTGCAAGTTGCAATGGACTACACCAACCACAAATAAATAGA
TATAAAATTAGAATATGCTTTTTATTTAGTCAATTTTGGTATGAGTATCTTATTTTATATATATATATATTTTTTATATATATTCCAAAATGGTATGGCC
TTGGATGCTTCCTATCACAATTACAACTTTCTATTTACTTCTTTCTCTATGTGGTCCGTCCTTATTTGTTTTTTTCCTAATGAATCATATTATCATTTGA
TGTTGCTTTTTCTGGGGTATTATTATAATAAAAATAATAAATAATATACTTTATTTATATAATTATAATATTATTTGCGGACTTGATTATTATATAAATC
GCTAACGGATAAACCTCAAATATTTTGTTTCGTTCATTATTAAGCTGTAGTTTTGAATTTGCGAATCAATTTGTGCTTCTTGGATTTTTATATGTTTTTG
TATCCTTCGACAATAACTTGACAAATGTTTTTCTTTTTATCAAAATATCGTTGATGTTGCGGTTATTCCGTCTTCTTATCTTATTAATTGACCTCTTTTT
TGTGTGACTAGAAATGTTCAATGAATACTTTTCAATTGTGTCACCCCCTGTACTTCTAAGGTTTCACTCGCTTTCTTCTATATATTCATTTTTATTTTTT
CAAAATTCATTTCTCCATCTCTAATTAAAAAATTGGAATTTTTCTGATTTAATATTACTCGAAACAATAATTAATGTGGAGTATTTTAAAATGACTGAGG
ATATTTTTACCTATCTAATGTATTACAGGACTAACAATAATTTTATATATATAATTTTAACTCTATCATTGTTATGTATTTAGGCTTTTCATTATTTTTT
CTAGTTTTATTTATCACAATATAATTGCATAAAACGTGACAAAAAGATGACCACTATTTTACTGTCAAAAAAAAAAAACAACCAAAAATACCGCGTATTA
CTTTTTCTTTTTTCTAGTAAAATTTGAAAAATTCTTATATGATAATACATTTACATAAATTATAATGGGTCATAGGGACTACATAATTTAAAATTGTAGT
CAACAGAAATATTTGAAAATGTTCTTGGACAATTTTTTTTATATATTAAAAAAACACCAGAGAATTGAGATGGAGAAATAAAAATATTATATTAAAAGAT
TAAAATAAAATCAATAGAGAGATTTTCAACGGAATTTTCCCGTTACGTATTTGATTTATTTAAGTCCAAATAAGTGTTCATACAATTCCAAGTCCAGAAG
GTCCTCATCTTTTGCAAGAGTTGATAGTTTGGACTTTCTTTTCACTCGTCGTTAAGAACAAATAAACAGTTCTATACACAAAGCATCTCACATTAACAAG
TCCGAAAATGATCGAGTCTCACGAAGAAGTGCATAAGTTGTTTTATAAGCTAAATCATTTGCATTTGTCCTTTTATGAAATATCATGAAAACAGAACCAA
CAGTTAAATCCATCACTCTTTGTTTCTGCATTATTGAATGGCTTAGGTAAGGAACTAAAAAATTTAGGTTAGGTATAGAATTTTGGGTGTAATTATTAAG
TTTTTGGTAACCAAAAAGTGTATGGATATAGATAGTTTGAATTTAAACTATCTGCACCTAATGTTGTAAAGGTCGTAATATTTACCAGCATCAGATATTT
ACAACAAATCAATAGATACATGACTATTACTTAACCATGATCAGTTAACATATATATATTTTCACTTCATGAAATCAAACTCGAAAATGACAATACAAAA
AAACAAAGCACAAGAATACTAGCAAAACTAATAAGTAAATCTGTCAGAAACATGAGGCTCATATCATTCAAGTTTTTCAAAGCTGGCAATTTTTCCAGCA
ACAATCAGTAGCGATCCATCGTTAACGAAAATACTGTGCATCTGCTGCTTCATTAGTTTCCTGGCACACAGGACTAGCTATGCTAACCAACTTCCTGGAG
TTAGTTATCAGCTGAGATGACAGAAGCACAAGAAAAAATAATTTATCGAAAACTATGCTACACCAGAAGTTCTTCGGGAAAAAGAGAGAGCTAGAGTAAG
TAATCATTTCAGAGCTGTATCTTCAATCCCAAATTTAACAAGCGGATAGCATCATCAGCAAAATATGCAGATTAGTGCTACTTCCCGAAGTTAACAAGTG
CTCCACGGCAGTCCTGAAGTATATTGGATGCACAAGTATGGTGGTTTAGAAGATGGGAAGTCGAAAAAGTTTTACCAAAAGAAAAGAGCAAATCGATAGT
ATTTGCTCACCTCTTCATGAAAATCAAGACTCCGGAACTTCAACTCATCAACCTGAGAACCTTCATGTCAAGAAATAAAGGAATTTTTTCACCAACGCGA
AGCAATAGTGTTTCAATAACCAGAAACTGGAACTTGATTGAACCACATACAGCAGAGGCATATTTGAGGGAAGAGGGACATTCAAATTTCATTACTATCA
CAGTTTATAACAAAGTCAGATTTGGTTTGTTGTTCATCTTTCATCTACATTCTAATTTTTGGTTTCAAAATATTTGGGAAACCTATGTATATGCCGAGAT
TGTGAAGACAACATTATCTTATTATGTATTCCTCCATTTCAGCTTGTTTGTTTGGTTTTGATTTGAACGTACCAAATTGGCCTTTAATCTTATGGTCTTA
AACATGTTATGTGGGAAGTTGGAATCAAAGAGTTGCAAAAAAAAGAAGACATTTTTTCTTGATACGGATTAGAAAAGGAATGTAAGACAAACAAATTGAA
ATGAAGGGAGTAATTGTCAACTGGAACTTCATCTAGATACCCTTGAGTCCACTCTCGTTCCCTTTTTCGTAGGAGACTGTCCTTTTGAACAGTTTTTTTT
TCCTCCTATGATTAAGGTAAAGCACCAACTAATATAATCCGAAGTTCTGAATATTTAGAACAGTACCTCTTATTTTTTTGTACAAGGAGATGATAAAGGA
AACTCCAAGTCTTCAAGCTGACTGAAGAAGATTGAACACTGCTCTCTTTTCAGGCATGCTTGGAATGGCTCCTTTCACTTGAACACATAGAGAAGCGGCT
GCAGCTGTAAATGCACAAGCCTTTATTAGATAGGTAACTACAACAACAACATACCCAATATGATCCCACGAGTGAGGTCTGGGGAAGGTGACATGTACGC
AGACCTCATCCTACCTTTGTGCGATAGAGAGGTTGTCTCTGATAGACCCTCAGCTCAAGAAAAAAGCTTAACGAAACATGTTTGAAGAAAAAATATAAGA
CTAATGAAGCTGAAACCAAAATTGGGAGAAAGCACCAGCATGCTTACCAGCAAATCTCAAACATTCCTCTTTAGATTTACCCTCCACTAGGGCCACTGCA
AAAGCAGCTGTAAAAGTGTCACCAGCTCCTGTTGTATCAATGACTTTTGCAGCTTTAATAATGGGTTGCCGCAAGGGTTCCTCTCCTTTGGTGAAAAGAG
CAGATCCATTGGCCCCAAGCTTAACAAGGACCTGGTTAACTCCCTGGGAAACAAAAGAGCGTGGAAACATCATTCCACAAAATCAAATTGATATAGTGAC
AAATTTACAGATATCTATTGTAATTTGTGACACCCCAAACATTGAGCAAGAAATCAGGAAAAGTAGCTAAATCTAACTAGGAATGTCCTACTAGGTCGGT
GGACCAAACCAGAGCCCCACAAACAACACTGCATTAATCCATCATATTTATATGGAGAAGCAAAGCCATCACCAGACATTTATGACTCACCAAGCAAAAG
TCTGTCAGGACCACTACATTTTGCAAAATCAATAGGGCAGGTAACTATAACAAATCAAAAGGGACTTTTAGACTCAGAACCCGAAAATGTAACTCAGATA
GTTATTTTGGGTCACGGATACAGTCTAAATCAAGTGAAATGCTGCAAGCATATGTCCTGAATTTAGGATGCAAACTTTAGAAAAAATGAATAAACAGGTA
CGTGAAAAACAGACCATGTCATAGCACTGTTCCACTGCATTGCTGATTTGTTCGAAATTTCCAGTTGGCATTTTTGTTATTCTAGCCAGCTCAGTTTCAT
TCGGGCTGAAAATCTCAACACAACGAAGAAGTTCTAGAGGGATTGGAGAGTCTGCTCCACCAGCATCTAGAATAACTGGAACACCTGCATTCCTGGCAGC
CTGAAGATACCAAGATGTTTAAAGAAGCAATCAGCCAAAGACACTTGACATCTTCATGACACATGTGGGACACACACACTCATGAAAACACACACACAAA
TATACTTCCTTCATTTCAATAAACGAAAATGATTGATTAGACATGAAGCTCAAGATAGTAATTGCCTTGTGTATTATTTTAGTAGTGGAAGAAATATTAA
AACTGTTTTTGGAAAGTTAGTCTGATAGAGAAAATATCACCACCACAGATTGAGATTCAAACAGCTAATGAGTTTGGATTCGTGTAGTATAAAGTAAGTA
ATACATCAATGGAATGGTATTTTGGAATGTCAAAAAATGAAAAGAAAGTCAGAAAAATCAATGAAAGTAAGTTCTCTCCAATTTTATGTAAAATAAGGCA
TTTTCCTTCTCAGAGCGCGAAACTCACAATTACGACTGGGTAAGCTGATCTGACAGTGACCTTAATCATCCAAGTATACATTAGAAAAGATATCCAAGGC
GAATTTTAATTTACCACAAGAAAAAGGAGGGTGGGGAAAATACATTATTATGATCTACCTTCTTTTTTTTTGCATCGCCATCTCCTTTTACGCTTAGTAT
ACTAGCGGAAGACATCTCAGGATCCCCTAATAGTACACTAGTGACTCACTCGAGTACCTCTTAGAAGCATATTTTTGTATAGGGTCCATGTCTCTGCTTC
TTACAGTAACAACTCCCTAATTGATCGCCCCTTAATCACTACTACTGTAAGTAACTACTGCAATGATGCTGGACCAAGCCAGCACGATGCTCTTTGTACT
GCTTCACACTTTACTTAATAACTTAATATAATCTAATACCTTTCTTTACTTACGTATGATAACAGTTCCTCAAAAGGAGAAACCTAAGTCCTTAGTTTCA
GCAAAAACATAAAAACAAGATAGCTTAAAAGAAATACTGGAACAATGAGAAAATATAAATATTGTTAAGATATGACATGTGTGCCTAACTCAACCCCAAA
AGCAAGCTCTTGAGGGAGTACTGCCCAGGTCCATATAAGCAAACCATCCGTCCGTTCACCAACCAATGTGGGGTTGTAACACATTCTAACACCCCATTCA
CATCCAGGCCAGGTTGAAACGTGGACCGGGTTTCCCAATTTTGGTATCGGTCTTTACACTGGGCCTAACTTGATACCATGTAAAGCTATAGCACCCGACT
GGCATTGTCAAACTACGTATTAGCAAACCATCATTCCATTCCCCAACCAATGAGGACTACCAACCCTAACATATTCGATTCTAAGTTAAACAAATCCACA
CACAAATTGAATTTCGCTTAGACGAATATAGCTATCGAAAAATCAAAAATATAACCAAAAAGCTCAAACCTTTGCAACTTGGATGTTAACAAAATCTGGA
ATTTCCCTTTGGAGCAACACAATCCCTGCACTTCTCACAATCTCCAAATCCTCATATGACAATTCTTCAGGCCAGCAAGACATGTTTGCACCACCAACAA
TAATAATTGAATTCTCCCCATCAGACTGAAGCATCACCACAGCATTTCCAGTTGGAGCATTAGCAACAGTAGTAAGGTGATCCACACAAACCCCACCACT
CTCTAAAGCTTCAGTAATCAATCTCCCATGAGCATCTTCACCAACTTGACCAATAAAAAAAGTTGGATAATCAAGCTTTCCACCACAAACAGCTTGATTA
GCCCCCTTTCCACCAGCCAATGTTTGACCTGTTTTAGCTGAAATTGTTTCCCCTTCTTTTGGTAACCTATCAATCTCCACATAGATATCTGCATTAGCTG
ATCCAACTACAACCAATGGAGGCTTTGATTCTTTCAAGATTGGCTGATTTTGGTTCTCTGAAGCAAAACAAGAGATGGGTTTCACTTTTCTTGATATGGG
GTTGTTGTTTTTGCCATTAAATTGAACTGGGTGACTGTAAAGATTGAAACTTTCTGGGTTTTTGAGGTTGTTTTGGGCTGTTGGGTGCCAGTATTTTGAT
TGTAAAGGTGTTGCTAGACCTTTCATGTTTTCTACAGTATCCCTCTTTTCTTCTTCAAAATTTTGCTTTGGCGTTTGAGTCATTGATAAAGACGCCACAT
GTAACAACACAATATTTTATTGTAACATGTAACCTATTTTAAGGACACAACTTAAGACTTATCCAATTTATTATATAGTCAATTTGCTTACTATTTGGAT
AAAATTTATGGAAAACTACTTAATTATTATAAATGTTTTTATTATGTTTATTAATTTTTCCTACCATTTGAAATAATTAGATAATACCTCACTAATTAAT
AATTTTATATCAAATTTGAAATTAGATACGCTCAAATATATGACTTTTTGCTATCAGATATAACTCAGAAACACAATACATAAGGAAAGAGGCAATTGAG
AGAGGAGACGTGAGAGATGTGAGCGAGATAGGAAGGAGACTAAATAGAGACAATGTATCTCAAATTCATGTGAATCACAGTAGATACATCTATTCTGAAT
ACAAGATACAATCAATGACATTTTGAAATATAAATACATGGGGAGAGAGGCGAGAGAGTCAGTATATCCCAAATAAATGTGAATCACATTGGGAATACAA
TGTATCTGAAATAAATTTTACTCCATCCGTGCCATTTTATATGAGGTAGTTTGACTTGACACGGAATTTAAGAAAAAGAGGAAGACTTTTAAAATTTGTA
GTCCAAAATGAATAATAAAATTTTTGTGGCTGTAAATCATTTCATTAAGGGTAAAATGAGCATTTTTATAGCCAAATAATTATTTATTATAGAAATGTGT
TATTCTTTTTTGAACTGATTAAAAAGGAAAGCAAATCACATAAATAGGAACAGAGAGTGTAATAAATTTTGACCTCCATATATCTAAGGTACATGTTATT
AATACGCGCAAGATACATGTATCTTACGTCGAAATCTAACACAATTGGTAATATTAGATCCTAAATTAACGAAATTTATGTTATTTTCCGTTAATTCCAA
CTTATAGCTAATATGTATTACTAATAAGGACAATAAAGTATCTAACATTTGCTTAAAACAAAATAACTTTAATTGCAAAAACAATAATTAAAGAGTGGCT
ACCGCTTAAACACCACCGTACAAAATGGCTATAACATATAAACCTTTACCGTCAGAGGACTTGAGGCCCAATTAAGTACTAAAGCTTGTGGCCCAAGCCC
AGTATTTTTAGCAAGGCAAAGCCCATTAAAGAAATTTTCAGTTAACGTGGTTATCTATAAGCCTCAATTAAGGCCAACTGAAAGAACATCACTACTCAAA
ATCAGGCATATTCAGCTACACTCGACTTCACGATCAAAAGCTGGTCATAACCAGTAAGATTTTAGATAAATATAACGTTTTGTAAATAAGTAAATTCTCT
TTATAACGTATGAATTTTTAAAGTTATACTTTTAAAGTATCTTTCACTCAATTGATTAAAAAATAAGATATTTATTTTTGATAGTCATTTTTCCATGATT
ATCATTATAAAAAACATAAAACTATCTCGAAGTAGTTAGGAAGAACACGGAGAAACAAAAACTACCTAAATGAAAAACTCGGTTAAGACATAATACATAA
ACATGACCCTAACTTGGATTCAACGGATAACTCTGCCCTCCAACTCTGAGTTTATACAAGCAGACACTTAAAATTGTATAAAATTGAACAAGTAGGCACA
CGTGTCCTATATGACATATTACACGTAAAATGTCATGTTGGACACACAATTGCCACGTAGAGTGCCAGGTAAGACGAGCGCTTTTATTTGCTTAATTTTA
TACAAGTTTAAGTGTTCTTTTGTGCACACTCAAAGCTAAAAGCCATAGTTGTTAGCTGACGTTAAGTTAAAATCATTTTATGTATTATGCTTAAAATAAA
TACATGTTTATAATTTGTAATTTAAATACATAGTAGATCATACAAATTTGAACGGTTTAAGATGATGAAACCACCATCTTTTCCATGTACTTGCGAAGCA
TGGGAATTTTCCTCTACGAATACTAGAAAATGCCAGCATTTTCGTATTCAAGAATCAGTTTTAAGCATATATCCATGGCTTCTCGAACCATACAAATCTC
CTCTTTCAGCTCAGGATTGAACTTTTTATCGAAACCCCAATTGGGATTAAACGGCAAGCCAACTTTTGGAGGATTCAAAAGCAAAATTTCAGTCTCAATT
CGTGCAATGGGCTCCTCAGCTTCTTCTTCCAAATCCGATAGTGTTCAAGGTCACCTTTTTCTCTCTTCTAGTATAATTTGTATGAATAGAGAATCACTTT
TCCGTTTTTGTTTGAATGCTCCAATTTATTGCGTTTCAGACTCTGCTTGTCAGATTATACCGAATATGATGTTGTTGTGTTGTTAGTTTACAGGTTTTGG
ATTATAGAAACACATAACTCAGATATGTTACTTATATACATATTAAGTGGGTTTTTTTCAATATAATTACGGGTTTGAGCTAAAGCTATTGGGTTCTGTC
AATGGTAGCTCAGCTTACATTGTAGTGAAAATTGGAATATGAAAGAAATTTAAAGGTTCAGTCTTTAGTTTTTACGTTCTGAGCTTGTTGTTTCTCTTAT
GAAATTTGTACAAAGTTGTTATGGAGATTGATAGAATTACGTGTATTCATGCTAGTGGGAAGTAGCAGCCACTGTTGTAGAATAATCAAGAACCATTATA
AAAGAATTTTGGGTTATGTGCCTCTTGCGCAATCAATCACTTTGTGAGCTAGCTTTGGGGTTGAATTATGCCCAAAGGTCTGTATTCGTATCAGTGTGAC
AATGTACAAGTTGATTTTACAAAGATGTAAGAATAAGAAACTGCTGAGGCTGATTGTGTTTTTGAGCAATAGTCTCAAAATGGTTTGACATAAAAATAAG
CTTTGGAAAGCATATTTGTCTATTCATCTTATGGGATGTTGCTGAAATAGTTAAAGCAGGGACCATACATAAAAAATGAACATCATTGTGCAGGGGGCAG
TAAAATGGATTATAGCTCTATAAGCGACGAGGAGTGGAAGAAGAAGCTTACAAATGAACAATTTTATATTACACGGCAAAAGGGTACAGAACGGGCATTC
ACTGGGTATGATCTTTTTCCATTCATCTTTATTTTTTATGCTGGAGACTGGAGAGGATCTTTTGTCTTTTGATTGTCAGTAAATTCATTAATAATTGGAT
GCTCTCTCGAGGAACCATTAGTATTCAAATATTGGTGAGTAGTCTGATGCTTACTGTTGTATTGCTGATTGATCAAATGTTAGCATATACATTTGAGGAG
GACACGGCTGGTTAATTTAAGAGTTGGATTTTAGAAGGAAAAGTTAGATTACTTGGGGTATGTAGATTGCAGCAAATTTTTTGAGGGTTCCATTTATAAA
CTCAATGATTTAGGGGAAACAGTAGACTTCTATACACCAAAACGCAAAAAGAAGGAGAAGTATTTAGAGGGAATGTGTATATTTGGTCCTCATCAGAATA
CGATATTTAAAGTTTCTACAACAATCTTGGCCGTCCAGTTTCAGCTACCTGTGGCAACCATCACAATGCCTCTTAGATCTTTTACAAATGCACCCTACTT
TAACCTTCAGATTTCCTATTGTCTTGTAATAATCTGTGTCAAATGCTGGACCACTAAACATACTGCTTGTTATTTTACATGTGTCAGAGAGAGGAAGACA
CGGGGAGGTTGTCAGCAACTCAGCATATTGGGTACTGGGTTCTGTATTTCTTTGATCCTACTTAAAAGCAAGAACTAGGAACTAGATGATCTTTTAGGGG
TTGTTGGGTAAAGTGTATAAGAATAATCTAAATAGAGTGTATTAGTAATGCTTGCATTAATGCTAGATGATAATAGTCTATGCTAAATTTGAGAATCTTC
CCCAAAACCGATTCAGCTCTAAATTCAGAATTTATCTCTAAATGCCCAAGGATCATTAACACAGACATGATGTGGTATACTGGTACGTCTCCAGACGTTA
TGCGTGCAAACAAGTTTCTAACTTTTATCAAATTGTAGACGATATTAATTATGGATATCCCATGATTGCATTGCTTATATATGTAGTAGTCTAGTAGATG
TAGTTTCATTGATTGCTTAGTACCCTCCCATTGGGATGGTAAATATGGTGCTATAAATTTTTCGCTGCTGCCTGTTTTACCGATCTCTTCATTGTTCTTG
TTTCCAGGGAGTACTGGAACAGTAAGACCCCTGGAACATATCACTGCATTTGCTGCGATACTCCTTTATTTGAGTATGTATTCTCCTTATATTTGATTAT
TACTCAACCTTTCTTAATACTTTTGACATGTGAAACCTGAAATTCGATATTGCTTGTTGCAGATCTTCTACCAAATTTGATAGTGGAACCGGATGGCCAT
CGTACTACCAGCCCATAGACAACAATGTGAAGTCAAAGATGGACTTGTCTATCATTTTCATGCCTCGTCAAGAAGTTCTATGTGCAGCTTGCGATGCTCA
TCTTGGGCATGTATTTGATGATGGCCCTCCGCCTACTGGAAAGCGTTACTGCATCAATAGGTACATTACTTTACTTCCTTTACTACAGTCTATGCTCATT
CTCAGTTGCTCCATTTATATGAGATTGAAACCTAGCTTATACGTGCAGCGCTTCCCTGAAATTGAAGGCAAAGTAGAGCTGTGCTGTGTAGAATACCAAA
GGTTATTGATTCCTCAAGAAATGCAAGATATCAAGCTGCAGAATTATTCATATGCACGAATAATGTTGCTTCTAAAGTTTCAATCGAACTTTGAGAGAGT
TTCTTCTCTGTGATGTTGTTAAAGTTCATATGTTCACATATACATAATATATAAGTTGGTCAAATGTACTCATTTTTAGCCTACTATACGTAGATATTTT
ACCTGTTTATACTCTGCGTACAGTCTATCCTCCTCATATCTCATTATCTTGTGATTGTACACTAAGTTTCGATGCTGCAACAATATACACCAAGTCAAAT
ATGATTCATAACTATATGATTATATATATACCAATAAATTTTTTAGCTTTATTGTAAATTATTTGTGAATTTTTTATTATGAAATGCTTTTCGATTTTCA
AGTTTCAAAACACTTTGTCCGCAAAAAGCTTAACATCCTCAAAATGTAAATAATATTTTACTATATCACCTCTAATTATTTTTATCATGTTACTACTCAC
TAAGGAATGAATATAAATGATAAATTATCTACTAGCTTTCTAAATAAAACAAGTAAATATAACCGTCTATTTTTTTTATAGTATTGTTAACAAGTAAAAA
TGAATAGATACTTAGAAAAAAATTTATGAAATAAAATTGAAAAAAAGGAAGATTTTGGCGTCCACTTCAACTTTGAAAAAAAATAATCCTCTTTAAAATT
GTACGTGTCACATTTTTATTTGTCAATATTCAAACATACACAAGTCCGAGTTACACAGGATTGTAGCCAAATACTTCAATTTGGGGGGAACTGTAAAGAC
TAGAACCTGAACTGCCGATGACACTACCAAACCGTTAATTAACAGCCGTCAAGAAAAACCGACGCAGCCATTGTCGCCGTTGAGTCCCAAAGATTAAAGA
TCGTTTTTTTCTACGATTCTGTGCTTGTGGGTTTTTTTTTTTCCTGAAAAAGGGGTTCTATGGGTGTTAAAGATTACAGCTTTTTGAGAGATCTTCAAGT
GGAATTCAAAAATTATGAAGTAACAAACAAGTTCTCTTTGTGTTTCTGGTTATACTTGAATGAACCCTCAACTTTACCCTCTACAATCCTTTACCAGGTT
TTCCTTTTCTTTTTTTTTCTCACTGAAAAAATGCTGTTTTTACAGTTCTTTTTGAGTAGTTATGTGTATTTGCTGCTTCATTTTGTCTAACTAGTTAGTG
TATGACTGTTGGAATGAGATGGGGTTTTTGGTATTCCTTTGGTTTAACATTCTTATGGTGGTGACATTCTTTTTGCTGATTTAGGTTACACTGCTGTAGA
AAGAATTTTAGAATGCTTTGTCATGCTTTCTTTACCTCTTTGATATGCTTTTCCTTGAGCTGGGGTCTATGATAAACAGCCTCTCTACCTTCCGAGGTAG
GGGTAAGGTGTGCGTACACTCTATCGTCTACAGACCTCACTTGTGGGATGGGATTGGATTGGATTGGATATGCTGTTGTTGTTGATGTCTTGTGGAAACA
TATTTACTTTTTAGATCGTCCATGGTTTAGGCATTGGCGATTTGCAAATTGTTTCTTCAGGCTAGTGTGAATTGTTCATGTTCTTTTGTTTTTGCTTTTA
TGGATATGTTTTTCTTTATTGTGCAGATACCCTCCTAAGTTCAGTTTGTTTGGTAGTTTGCAACTTAACAAAGTCTTTTTTTTTTTTGTGTGTGTCTTCT
GGATTACCTTACTGTTTTTATTTAAGCCTATATTCTATTCATTATTACTTTGTGTGCCTGCTTTAGCTCTTGATGTTTGGTAATTGAATCTGTGACCACA
TATAGCTATCTGCAAATCATGCTTTTCTACTAAAGAACAGATTTTTTGAGAGTTGCAACTACTCACGATGAAGACATAAACCTAGCCATACCTCGTATGG
TCAAGGAAAAGGCTTTTGAATCTTTATGATCACTACATTGAATATGTTGTGCAAGATATAATTGTGTCCTTTGCGCCATTTTCCTTTGATATGGTTGATG
ATGTTTGTTAATTATGCAGGAGCATCCAGATGTCACATCCCATGCTCCTTTCCTGTTACTTGATGACAGGAAGAAAATTTTACTTTTCCCTTCACTAATT
TCAAGCCATTCAAATATTACTTCCTGGAGAGAAGTTGCACATGCAATTTCTGAAAGTGAATTTCCTACCAAGAAATGGGTTCATGTTGGATGTGAGGTAA
ATAACTTGAACTCGCCCTAGTTCCTGTAATTACATTCGTAGCACTTGATGTGTGTTTTGCAATTTATACACTCTTAACCTTGTTGTGTTACTACTTTCTT
ACTCCACCATGCCCATTGTTACCTTCTACAGTTGTTTTTTTGCTCATTGTCACTATATTAGATATATTGATTTTGTCGTTAAGTTTTCTCTGGAAAAGCA
AATTTTAACACAAGAATACGGAAACTAAAAGACTGGCCTACACCTAGTTGCTTTTCACTTTGTCAAGTGAAGTTTTTCTGCCCCAAAAGTTAGCAAAGCC
GGATTAATGTGAAGCTCATTATCCAATAGCTCCATGACTCATCTGCTTCACTGGTTTCCGTCCAACATACTAGACTAGTGACATCAGTATGCTTGTTCTG
ACAGCACAAACTAGGCCAGAATTAGTATAATTACTGGTGTGACATAATGTTTAAGAAAAAATTGAATGTAATTCACAAACGAGATCTTATAAGAAGTTCC
TTGATATGGAACAAAGGTAATACACTAATTGAATCATCATGTAAATCTATCACCAGTCCAAAGATCTCATAAGGTTGTTATCTGCTCTTCTCTGACAGCC
AGATTCTTGGTGACTGTCTTGTTTCATGGCTGTTTAAGCAACACTTATTAGTGGAGTATTTCAGGTCACACAAGATCTTTTGCACCTCTACTTTGATGGG
AAGATTGTAGGTGAGAAGTGTTTGACTTCCTCACTTAGTAATGATATGGGATCAGACAATTCTAGAATATCTTTGACTTGCATTACTGGAAAGAATTCTC
AGCTGGATGGTTATGTCCACAGTTCAGAGCTCTTTCCTATGCTATCAACTATAGAAAATCACTATGTTAAGGTAAGCAGAATTGTCATTTATTTTTGTGA
AGATTGTCTCTACTCATGTATTTACTAGTTTCTGCTATGTGCATCTATCAGGACCCTCCAGTACAACTATCTATTGATAGTTCAAGCGCCTATGAAATTG
AAGAAGACAGTGATGGTGTTTGGAGCATTGTTGGTGGAAAGGTAAAAAATATATACTGCTTCGAAATATATAGGGAGAAATATCCAGGGGCTCTGGAAAC
AGATCAAATCTTGACAAATTACTTGGACACAAATCAGTATACTAAGAAACATTATAAAAAATTGATCCCTGCTTCCCTGTACGAACTTCTAGCTCTGTAT
TGTGAATAATCTTCCCAAGATCGAGTACTGTTACTTTAGAATGTGTTGAACATCTGTGTTACTCCTCAATTTTTTCATGCATCTTCTATTTAAAGTTGAT
TTTTAAGTGATGAGGTCAAATCTAGGCGGTGAAAGCTAGCTACATTATATCAAATCCACATGACTCGAAGTCTTTGATAGACATCCTAATGTCATTGGCA
ACAGTTGAATATTCAAGATCAACAATGGTTTACTTTGATATTTTACTAGCAATAAAAGCATACTTCAGAATTTCTTGTAACACTAATTCTTCTTGTTTCT
CCTCATTTGTTCTGCAAAAGGTGAAATGTGTGGGTTTTGCGAGGTTTCTGCAAATATTTTCTGTAGATTTGCTTATTGTCCATACAGCAAAGTCCTTCAG
AAATGACAGCAGAGTAGGTTGAACTATGGAAAAAATTGCAAAATTTCCGCATTTCTTTTGTGGAACACGAGGCAGAGAACGAGGGAGAGAACCAGCAGAA
CTTGCATTGCGAAACTGCTAATCTTAAATGTTAAAATCTTCAAGGGTTGTCCATGAAGATCTGACATCTCTTTAGAACTTGGAGAATTGTGGGACCTGTA
TTGCTATGCAATATGTCATATAACTTTGCATTATATTGAGAGCGACTTTGTAATTTTATGAGCTGTTGCACAGTGACATGTACAATTGTTGGTAGAGCTC
ATTATCTGCTCATCGTTTTTCCTAATGTTTTTTCATTTTTATTTCACGAGGGACTATTTGACTAGGCAGAAAAATAGTTATCCTCGAAATGCACATTTAT
GCCTATTTGATTAGGCAGTTCTTCTTATATGAGGTAATAATGCAGAATTTATTAAAGTGAGACTGATCCAAGCACACTATCCTTCAAAGGTAATTAGTGT
GCTGGTTAAGTAGGGTGAGAAAGCACAGAGAGAGAGAGAGAGAATATTCTGAGATGAACATGGTGAAAAGCTGTTGTAAAATTGATGCTCTCATAAAGAT
TAAAATAGAAAGAGGGAGTTTCCTGAAGCATTTATGTCTTTATGTTATCTGATACGAGTTCTTTTACTCCTCTAACTATTTGTTTAAAGCAGGCCTCCTG
TCGGAGAAACTTTGATATAGATGTGACACTGATGGATAACTTTAGCCGCCCCATGACTGAAGAAGCGGAGGTTTGTCATTTATTTGTCTATATAAAAAAT
TAAGTGAAGTCTGTAAGTTGCTGCAACTGTTCTTATTGATATATGTTATGCTTCCAAAGGTTGTTGCTTCGCTTGTGTACTCTGATGATAATACACTGGT
TGAGAAGCCAGTTGATGCTGATGCAGCCCTTCTTACAAGTTATGATGGAATTGAATATGCTTCTTCTGATAGACCAAGCAAAGTAATTAGTGGACGTGCT
TCCTTTAAGCTCAAGATATCTCAGGTACTGGATAGTTGTATCTCTTCTTTTAGTACCTGTAAGACAAAGTGGACAGAAGTGTTTGTTGATTGCAATCTTG
AACTAGAGAATACTTGCTTTGGAGAAGGTATATTTATTAACACAATCTCTACTTGCGAAAAAGGTATGTGTAACAAGGCAAATACTGTCAGTGCTTGTTC
CTTTTACCATCGAGTTATTTTACATGATCATAGATGTTGCAAATTTAACATTGAATTCTGCCAATCTGTGTCACCACAGTTAGAATGATAATATTTACTG
GATGAGCACCTCAATATGGATATATTATGCCTCATAAAAATCATCCTAGTTTATAATCTGTGAACTTGACTACTTGTGGAGCGTTTTGTGTAGCTGGTCA
AACGCAAAGACCATTACAACATTAAGTAGAGTGCATTGTTGTAGTTCACTTATACCTGTAAATTGACGAGAGTTATGCTTGGAGATGAATAAACATACTA
ATGCTATCTGATTACTTAGATAATGCTTCTTTCTATTAAATCCATTTAGAAAAGTGACCTTCTGTCTCAATTGCAGCTTTCATCCAAGTGCGATAACAGG
CTGTTCCGCATTAGGTTTGACATTCCAAGACTGGGTAAATATCCTTTCCTTGAGGTATTTTCCAGACCAATACGGTGTATTTCTCGGAATCGCAGCACGC
GGGCGACCTCTCTAATGTTGAAGAAATCATCTTTGGGGATCCATTTGCTAAATGGATCTCAATCTCCTGTGTTGGACGATGGATCTTATGATCGTCCCTG
TATTGTACGTGAAGCAAAACAAAGTCCATCATCAAAACGGGTCAAATTAGGACAAGAGAAACTATGTGCAAATTTTAAGGATGATTTTGTGCTGAAGCAA
GCTAACGGTGGTTCAAGATCTCATTCCTGGACCTCTGAGGTATTTTTAACATCTGCCTTGTCATATTATTTTATAGCAGGTCGTGATAGATATGGTAGTG
ACACTATTGCTTAGATCACGTAACAAAGAGTATATGTTTATGAATGCTGCACCTTGTATAACTAACTTTTTTAAAAAAATTCAAATTTCCAGCTTTATTG
ATATAAAAAGGGAAAAACAATTACATCACTCATTTGGGCCTAGTGCCCAAATCCAAGTTCAAACAAAACGATAAGTAAAATAGGGCCATATAACTACCTT
ACTTGTTAAGTGGGTGAATAAGGTTGAATGTATAAGTCATTGCTGGTTTTGAAAATGAAGTTTCTTCTTGTCATCAAATTTTTGTCCTCTGCATTATTAA
AAGCCATCGTCTCTTAAGTGATGAAGCGATGCAAAGCAGGGGTTAATTGGTTCTTAGGTGAGGTCATGCTCTTCAGAGAACTGTGCCCTTCAAACCATGA
TGCACAAAGTGATCCAAATGAGAAATGTTCGGTTTTTGAATCTTAACTGTGAGGAATTAGATTAACATTGCCAATTTGTCATTATTGTATATTGGATGTT
ATCCTTAGTTTCTAACTGTAATTTGGTTATTACAGTGTCAAATTCATATATGTATGGTGTTTAATATTTTCCGTAAACCGTGCAATTCACTCATTTACCT
GGTTGCTTTTTCAGGCTTTCACTTCTAGAAACACTGCTACTTCTGTTTACTTCTCTTAATACCACTCAGTCTTCTCGGGAGTGTTTTCTAAAACTTCTTA
TTTGGCAATAAGTTTTTCCTATTATGCATGTCATCACTCAAGGGACTGTGATCTCGAATAATGTTTTTACTACCTGCATTTCTCTTTAATATTTATTGGT
GGTGCGCGATCATCATCATGATTATTCTTCTTTTCATTGTATCCTATACCCTTTTTTAATCCTTAAAATCTTTTCTTGTTGACAACTTCTTATACCCGAC
CTTGTTGTTATCATCACTCTCACTAAACATGCATTGAAAATAGGATAACCATGCACATCAGAACTCTTTGGTGGCAAGACCAGTGAGCCATGGTGGGGCA
GAAAATTTCTCCTCTGATTCAGAGAACAGTGAAACTACGAACTCGCCCGTTGATGACTTGCCAAATAACAGAGATCCGATTTCGGATATGGTTGTTTTTA
AATACTGTCTCGCTGATCTCAACGAGAGGCGTCTTCTTCTCAAGGAAATGGCAATGACTGCTAAAGAAGAAGAACTTGCAACCTTTGCCGAGAGAGTCTC
TTTATTCTCTGGATGTTCACACCACAGGTATATTTTTTTATATTGTTGCATTTTGAGGTGTCTTTGAATGGTTATATTAACAGCATCTAGTTCTTAGGGC
CACGTTTGGCATTTATTCCCTTCTTTCAGAGTTACGCTGTTATTTCATTAAAGTTCTGAAAGAACGAAATATGTATAGAGCATATGCATGTGCAAGCAAA
AAAACTTTTGCGATTTATCTCATGGCAGAAAATTAGAAGTTTTTTTTGTGTGTTATTGTTTATGTCATTTTCCTTTATATTTGTCCCCTGTGGCCCTGAC
TCCTGAGCTTTTAAAATTGCATACTCTTTGGAAGAAAACAAGTAACATATGAAAACGTAAAAAAATAGGATATTTGGAAGGGTAATACCAAAATGATATT
GACATCCAATAAGTAAAAGATCGTCATAAATGTGCTGCTTCTGAGAAAATTAAGTCGAGAGAAAAATGACTAGCACAAGGCGTAGCTGTTTTCCCAAGTT
TTTTCCTCATTAGTTCATGTCTTCATGAGGTTTAGAATCATGTGTTCTTAAATGACTAATATATAAGTAAACGTTATTTCTGAAAAGCAAAAATATTATC
TCTAACATCACAAATATGATCAACTATCAATTTAGGATGAAAGGATTGCTTATATCATGGTCGGGATAAAAACATGTGCACTTGCAATATGCTTCTAGGG
AAAATTTGAACTATTGGAATTAATACATTGATTTTAAATTTATGGATCAGGGTTAAATTGACACACAGTTCAATAGGATATAAACAAAATGTACATGTCT
TGGTTTCAGTTTTCATTTTATTGTTGTCATCACTATTTGGTGACCTTGTATGCTGTTGTCTGAATCACATTACCTTTTTAGGCATCAAATATCAATTTCA
AAGAGGCTGATAGAAGAGGGAATTAACTGTTGGAACTTAATATCCAACTATAACCACCATGTCCTCTGGGAGAATTTGGTGTCTGGGCTTCAAGAGCATT
TCCTGAAGATGACATTTGGTCGTATCAGATCTCTAACTCATCAGGTTCTCTTTTTTCTCTTTAAACTGGTAGGAAGTCTGAAAGAATACTTCAAAAAGGG
CTATTTAGAAGTTAGTGTGTTCTCTGAGGTTCCAAATCCACTTACTCACCAAATTCGGAACTATATTCCTTTTTTTAACTTGAAATGTCAATTGTGTTTG
GGAAGGTTTGGTGGATTTTTTCTGCAGAAGACTAGATTAAGTAAAAGGGAAAGTGAAAGGGAAAGAGAAACATCCCTTTTTGCCGGAGGGATTAATTATC
TGTCTTGGAGAATTTGTGAAATTCTCATTTTTCTATTTTGATGTCATTTTTCGTTGGGATGTGATAATTTTGGGCAGCGTGAAGGGCCAATATTGCATAT
TAAGGGTATGGCCAATGCATAGTGGGTGCAAACCATGGAGACCAGGATTCAAAATTCCAATAGAAACAAAAAATTCACTGAATCAGATTCTTCTTCTTCT
GATGATGATGTATCGTAAAAAAAAAGCAAAAAAAAAAAAAATAGAAACAAAAAAACACTAGGTTAGGTGGGGGCGTGGGGCAGAATCACCTTACTTGTGT
TGGTGGGAGGTAGCAAGTATCCGGTGGAATAGTTGAGTTGTATGAAAGCTGGCCTTTTGACAATTCCAAAACTGTTTTGACAATATTACAACTCTGAAAA
TTATTTGCTTCTCTTGCTGATGAATTCGTCCAACTTGCAGGATTTCAACCTCCTGAGGAGAGTCTCTGGTTGTCAAGATCTAGTGTCTCAAGACAACTTT
GAAAAGTTGTGGTGTTGGCTGTACCCAGTAGCTTTTACATTGTCACAGCAATGTATTTCTTCATTGTGGGGTTCAACATCACCCGTGTGGATCGAAGGGT
TCATTACCAAGGAAGAAGCAGAATCTTCACTTACAATTCTGGGAGCTCTTCAAGAACCAGGTACTTATATACTGCGATTTCCTACATCAAGGAGCTGGCC
CCACCCTGACGCTGGTAACTTGGTCGTCACTTATGTTGGAAGTGACTACACCATTCACCACAGGCTTATATCCCTCGAGTCCATTTACAGGTAAATGTAC
TATTTCTTCTTGTTCTCTTTCTTAACCTTTCACCTATTTCCATTGCATTGTAAGATTTTCCCCGTGGAAGAAAGTTTGGGAACATGTGAGACATACAGAG
TTGATCTCAGCATCACTAAGAGGGTCCTTTTTCTATTGTCCACTGTAGTTCTGGGGTCAAGGGAACGACGATAAGGCCAATTCAAGACATGCTGCTTGAA
CAGCCTGAGCTCAGGCGACTCGGAAGGCAAGATTTCTAACTCTTTTGATCATCCATTCATCCAGCTTACTCTTTAAGTAATTGTTAGAAACCTTCAAACC
GCAGGATTGTGAGAAGCTTGTAGGTCACTCAAGATTTATACTTGTATAGCCATATCAGAGAAATGACAAGAAGGAAGTGTTCAAAGGAGAAAGAGAAACT
AAGAGGGGGGGATGTTGTTTTATCCTTTGTATATATGAATGTCTGAGCAATTTGTGATCGTAAACATTGTAATAGATTTTTGTAAACTTGTGCTTGAATG
GATATTGAAAATCGGAGCGCATTCTATGAATTGCAACAACATATCGAGTGTAGTCGTAAAAATAACTTCAAATAGTGGCATTGCTTTGTTCGTGTGAACA
ACCCTCAACTACAAAAATATTAAATTCAACTACCTACCTAATTTAACAGTTAAACACACCCCAAAGTAAAAAAGATGTGCTTTTTTCTTTTCTTTTTTAA
AAAAAGTTGCTTGTTTTTCACAAGATTCATGAGGCAGTTTAAAAAAGAGTATTAATAGCGTGTAAACAAACATTTTCAAATCTTTGTAATGTTGATAATA
TTCCCAACATCCACATAATTGTAAAACGACAGCTGCTGCCATATTAATGAGACAGCAAATAATATGTCAATTTTAAACAATAATAAGAGTATTAAATAGT
CTGATATGTAAGCGTAGAAGAGTTGATTATGCAAATGTTAAAAGGCCATCATTTAGTTTTTGTTTTTAATAGTTCTACAAATATAGCCCTATGTTTGTTC
ATATATTGCTCAATGTTACAAGACCAAACATTAAAATCTCATCTAACTTACAAAATTTTACACTATAGTTACATTTTCTCATAAGAACTTTACTCTTGAT
CGATGAAAATTTCACGCGAAGAAGGGTAGAGAGACGGATCTATTATTTTATTTATATTTTTTCTAAAAATATAGAGTAACTTTCTCAAATAGTCACTATA
ATAAACTTAATTATGCTTTATAACTATAGTTTGCATATTTATGAGCTGTAGCTATAATTTAATCTGACAGTCTTGTATAATTTGCGGGTACATTAGTACA
ATTTAGTTATTTTTATATAAACTTGAAATAACAAATTTATAGAATTACAAACATCAAAAGTGCAAAATAGTTATACAAATTTCAAATTATACAAACTATA
TGATAGCTATATTAAGTAATTAACTAGTATATATTTGCTTTTGCTCGCAGGTTAATTCATCTTCAAAGTGTAAAAGGTCAACATTTTCAACAAAAGTTGG
GTATGTATAAGTTTCAATATTACGTTTACGTATATTTTTTTATTTAATTATAAGTATGTTGGCAACCTAACTCATAGAGGGGACAACAAAAAAGCACATA
TATGCATACATGAAAAATTGACAGGTCTTTGTGACTTTCCATGAATAGTAAAGTACTACTGTAGTATTTTTATTTTGTGAAACATGTATATCAATGATTG
AAAATTTAAAAACAGCCTTATCAGTAAGGGAAAAAAGGCAAAAATAAATAAATCATGTTCACATGAGACTTGTTCATACTGATAATGAGACAGGTGAGCT
AACTTTGGACCCACTATTATATTAGATGCTCCTAAAATTTTATGTCTTTTAGTAACTTCATTGAATGATTTATGCATGATTTTTTCTTTGGTTTTTTTAA
AAAAAATATTTGCTGGGGTACCTTCTTGATGTCTGCTTCAAGAAAATGAGCACTTTCTGCAATAAAGTTTCAAGGTGAAGTCTTATTCTAACTTCTTAAA
AGCTTTGTGTGTGTTTGAACTACTCTTCTTGATTCTAGTCGCTCTCCGTTTGATCATAGATTTTGAAGTTTAAAATTTGAGTTGTTGAAGTGGTGTTTGT
GAAAAAAAAAATTTGAACATTTCACGGCCAAAAAAGATATTTGAAAATGATTTTTCTAAAACTACTCTCAAAATCTATGGTCAAACGCTAAATAAATTTT
GAAGTCGTGTGAACGATATTATTGTCTTTTTTCTGAAGGCCTAGATAGTTATTTTTTTTCTTAGAAGATGGTTCTTTTTTTGGACTAATGACTTGCTTGT
TCATTACTGTGGACTGTTATAGGAAGATATTGTTCTGTTGGGAATATCAGTAGCTTTGGTTGTTGAATCTCGTGTAAGTTAAGTTGTGGTTGTATTTTCT
GCAAGTGGAATGTAGGATCTTTAGGTTGTGTGTTAAGATTGACCCTCGAGTGAAAAAACAGAAGGAAGATTGATTGTAGGGACGAAAATCAGCCTTAGTG
ATATCCAAAAACGCCAAGTGAAAAGGCGTTGCTCAAAGTAAAAAAAAAAAAATTTAGTCCAGGAATAGTTAAAACCTGCAGGAAGTTTAAACAGCTCCTA
TTCACTAACAATCTGTTGTTCCTTTGTGTTTTTCTTCTGGTACACCTGATTAACAACATTTTATGTAATTCACAGTTAAAGCTGAGAGGCCAAAAGTCTA
AAGTTATTGAGTATTCAGGTACCTGTTTTTTTTACTCTATATTTCTGCTCAAATGAACAGTGTGTTGGTTTCTAACTTGGTCTAACTACTTGCAGAACTA
AATGGGAAATTCTAAAAATATTGCTCTCTATGTAACAATATGTGTGATTTCTTTTATCATCTCGAAGATTATTATGACAATCGTCTGTTACCGTAGATGG
AAGAGAAAGCAAATGGTTGTTCAAGACAGCTTATCTGGTATGATATGATGTTCAGTATTCAGAATTCGATAGGTTGGATCAAGAATATCTTATGTTTTTG
TTATGTCCATATCCAGGTGGAAAACTAGTGATGTTTAAGTCACCGAAAATGAACACGTTGAAGTCCAACATGTTCTTGAAGAGGACCATGAAGCTGACTA
ACAAAGATATTATAGGATCAGGAGGCTATGGAACAGTCTATAAACTGACAATTAACGAATCAATTTCTTTCGCGGTAAAGAGGTTAAACAGAATAAGTGC
AGAACAAGACAGAGGTTTTGAAAGAGAGTTGGAGGCAATGGGGGACATAAAGCATCGAAATATAGTGACACTTCATGGATACTACAGTACAACGCAGTAT
AATCTTCTGATATATGAGCTTATGACTAATGGAAGTTTAGATGAAGCACTTCATGGTATATGTTTATGTCTGTTTCTTATTGTCTAAGTCTATGTTGCTC
GAACTCTCAAAAATGTTCCGACCCTCCATAAATGCTGTACTTTTGGAGGACCTGACTTGCCTACAGAGGTACTTTTTGGAGTCCAAGCAACATAGCTCTA
AGGATGGTCATTCTTTTAAGCTTATTTCAGCTTCTGCTGATGCTAGAATCAGAGATGCACAATAAAGACCTATCAAGTGTTTGATATACAGATGAACTTT
AAGAATGGTAACATCATAATGCAGGAAAATCGGCTGCCAGGAAGGTTTTGGATTGGCCTACAAGATACAAAATAGCAGTAGGAGCAGCAAGAGGATTATC
ATATCTACATCACGATTGCATCCCTCACATCATCCACAGAGATATAAAGTCAAGCAATATCTTGTTGGGTCATAACATGGAGGCTCGAGTATCTGATTTT
GGACTAGCCACTCTGATGGAGCCAGATAAGACGCACGTTTCAACTTTGGTAGCTGGAACTTTTGGATATTTGGCTCCTGGTATGTTTTTATTAGACCATC
AGAAGACTCGAATCTGTGTTTGGAAAACTATCAATTACATTATGGTCTTTTGCAGAATATTTTGACACCGGAAAAGCAACAGTCAAAGGAGATGTTTACA
GCTTTGGAGTTGTCTTACTGGAACTTCTAACTGGGAAAAAGCCATCAGATGAAGCATTTTTGGAGGAAGGAACCAGACTTGTAACTTGGGTAAGCTTGTA
GTTCACCTTTTTTCTTTTTTATCCTAGCTGCTTTCGAGCTGTCATTAATTCGGTCAGTTGATACTGTTCTGCTTTACAGGTGAAGACAGTTGTTCAAGAG
AAAAGAGAAGAGTATGTACTTGACAAAAACTTACAAGAGTTTCCCATAGATGAAGTTAACCATGTATTTAACATTGCATTAGTTTGCCTTGAGGCAGATC
CATGTAATAGACCGACTATGGCTGAAGTCGTTATAATGCTTGAGCAAATAAAGATAAATGCTTTGGCATGAGATTCTTGGTGTTCTGTTCCAATGCTTTT
TTCTCTCAAATAATATAACTTTATTTTTTTTATACTCATTTTGCATAATGCTTGCCCTTGGTCTGAATACATGGAAAGTAACAAAACTTTGAGCAATTTG
TTCCAATGGAGCTATGCTAACAAAACGGAAGACTAACTCATTACGTACTTCACTTGAGCGTAGCTTCCAATCCTTTGGCAACTGATGCTTTAAGTGTAGG
AGAAACTGGATCACCTCCAAGAAATACATCGAAGAGAGCTGATGCAACATTTGGTGACTCAATAGTTGCGTCAACCGAGGAAGGCATTCCATCAAAAGAG
AGTGAAACCTTTAAGATTTCCATAAAAAAGAGCAACAAATTAGAACTAAGAAAGCTAAGAAGAAAACAAAAGCCACATTTGATGCCTGAAGTTGATATAA
TCTAGGCTTTAAGAGAATAATGTAAATAAACTGCATACTTACAAGCATTTTATTTGGGTCAATCCAAGTCAAGAATATGGAAGTTTCTTTCTTAAGAGGT
TTCCCTTGAAAGACACCGCGGAATGTAGAAAGAGCAGACTTATCATCGGCAGTAGGGGATTTGATTCTCGGAGAGATGGCTTCATCTAAGGCATCCCAGA
AAGTTTTACCATCAACATCTCTGACCAGCACAATAAGTAAAGATTTCTCCAAATCCGCTGCAATTCATAGAATCATTTTTAGCATCACTTAGATGATATG
ATCTCCTCCCCATCTCACCAGTCAAACAATTAAGCATTGCCGACTCACCTTCAAAGATCTTGTTGAACAAGGAAGGATCCTGTTGAATATCTGCAGCAGA
ACGTCCTCGCCAGGCATCTAAGCTACTAAAGACGGAGTCATTGACATAGAGGCCTGCAGCATAGACCTTGACACCAATAATTGCAAAAATCTTTTCCCTG
TATCCTAAAATTTTGTTGGAAGAGCAGCAAAAATAAGCATAGAACATAACCATCTGAAAGAACTTGAGGCAGATAAACTAATAATTGAAATTTGTTCTTA
AATTATTGGGAAAGATTATTGATTGATTTGAAGCTAACCAGTTCCAAGCAATGACAAGGAAGTAGAGCAACCAGGTAAGCTCAATGATCTTTGAAATTTC
ACCTTAGTAGCTGGTTCTTCTGTGTATTCTGCACTTCCAACTGAATCCACGAAAAATGCCAAGTCGTCAGCTCTCACAGACAAAAATAAAGATATGATCA
AGTGTCTTCCTTATTTCATGAAGCCATAGTGTAGAAACATGAATCCACTTGCTTTATGTAAGAAGTGAGCACTAAGGATTAAAAATAGCAAGATCAAGTC
AAAGAGTATTTTGCTAGTTGAATCCTGTCTTTCTGAACTGAAACATTAAACTATATGATGACGCAGTATTTACGTGTTAAATGTGGATTAAAAGACTATT
TAAGCTACCTATTTGATGGTTTTTTGCCACTCCAGAATTCTGACTTTGTTTAATTCTACTCTCATAGCTTGAGGGTCCTTCCTAACATCTAATCAGAACG
AATCTAAAGTCTTCAAATAATTCAAGTAGGCGAAGAACTCTCAACAAACCAGCAATTCAACTGCATTTGTGCCAAGATCAAATCTTTCTTCCATACCATC
TTTAATTTTATATCGGTAATCAACAATTTTCATTAGTAAACCAGCAAAATGAGAATGCTGGAGGTCAGTTGCAACCAAAACAGATCGTCATTACAAAACA
AAATTGTGTAGGCGAAGAATTCTAAATAAACCAGCAATTTGGCTACATTTGTGCCAAGATCAAATCTTTTCTTCCATACTAACTTTTCTTTTTATTGGTT
AGTAAACCAGATAAAAGAGATGCTAAAGGCAGTTTCAACAAAAAAAGATGGCCATTACAATAGAAAAAAATGGTGAGAACTCTAAAAACAAAAGGCAGCT
CGGTGCACTAAGCTCCCGTTATGCACTGGTCCTGTGAAGGACTCTAAACAGACCAGCATCTCAAATATATTTATGCCAAGATCAAATCTTTTCCTTACAT
ACCATCTTTGATTCAGTGAACATTTCTTAGACTTGAATATAATAACTGCAAATTACGTCTCGTGGATCTAGGCCTAAGTCCATTTCATATCAGAGCAGGA
CCCAATTAAATTCTTATTTCATGACAATGGAACCCCATATTAAATCGTTCACGGTCTAGATGTCCACCCAAGGGATGTCAAGAAGTTCCACGTCAGAGGT
TAATGGAATGGGTGGTCTCTTTATATGACATGGTCAATCCTCTCCTCATGAGCTAGCTTTTGGTGTTGATTTAGGCCTAAAGTCGATTTAACAATAGATA
CCATTATAAAGCTAAAACCTTTATTGACAGTAGATACTCCACACAGGGTTTTCTCACTAAATTATGGCAAACATCAGATTTGTATAAACATTTAGTAAAA
ATTCAAGAAACCAAGAATACCCACAATCTGAAATTTAGTAAGTATTCAGTTTAAAGGGTTTCCTTCCACTTTTGCACAAAAGATGTAAAATTCAGCTTAA
AATCTACTAATAGTAAGTTAGACATAAAGACTTAAACTTGTTACAAGAATCAGTTGAATTATTACCAGAAGAGGAGGCAGCAGCTTTGATTGTGAGATTT
TGTTCGTATTGGCCATTTCTCTCAAATGTAGATAAGGGATAAATACCATTTCTTGAAAGTTTAAGAGGATAACAAATTCTGGGTATGGAGTTAAAAGCAG
TGATCTTTGTGGGTGTGGATGTTGAAATCCATACTGAAATGGCTCCAGCTGCTGCCATTTCTTGAAAAAAAATGTATTTTTTTGTATAGTACTAATTGTT
ATTTGTGTTTATGCAGAATATTTTGTTTATACAAATTGCTCCAAATTAATGGCCCACAAACAATAAATCTAGCTTATTGAATTATTTGTTCAATCTGAAC
TCAATCACTTAAGAACACAGTATTGACCTAAACAGCCTTAATCAATGGAGTTAATCAGTTTCTTTGAAAAATCCAATCAAGCTGATTCATGATAAGGAGT
TTTTTTTTTTTAACCTTTCCTCATAAATACTAATCCTTTCGTTTCGATTTACATGGTATGACAATAATTTTTAAAAAGTTGTATTTTTAAATTTGTTGCG
TAAAATAAATTTTAATATTTGTGTGTGGACTATGAGTAATATGCTTTATGAAACAGAAAAAGGAGAATAAAAAGAATTACAAATTAGGCATGTATTGTGA
TTTGTGATATAAAATTAAGTTTATCATTTTTGTGTATTAGATATGGAATAAGTCATTTTTCAGAAAAATGTACCCATATATCCAAGAACAAATATATGGA
GTGTGGAAAAACAACATCTACATTAGTAAATATTATTTTCTTTTATTACTATTAAAGATTAGTGTTTTAAAAGTCGTTTTTGAAGACGTGTGGAATGTAC
CAAAAAAACATTCTAATACACAAATAAAAGGCATAGGTTCATAGGAAATATATTTTAGAAATTGAGACGCAAATTTCGAATATAAAAAAGTATAGAAAGG
ATACGATCAAAGCAATTTATCTTTTTTACTTGCTTTATTTTCCTTTTTAACTTTTAAGTCCTTGATTTTAACTCACTTGGTGCATATACCATTACTACTT
TAAAAAGGTGGAAAATTTATTCATGGATTTAAGATTTAAATTCTAAATTTTTTATAAATTCAAAATGTTATTAAACTCATGACCATTTGAGTTTTTAGAT
TTGAAATGTAATAATATATATACTATTAGCAGATCTTTTTTTTAGCACAAATACATAATTTGAGCTAAAGAATATTTCGATCGAATCTACCCATTTTACT
TGGTAAATTATTTGATATAATTTATAAGCAAAGGGTTAAACAAGTTGTTCTATAATTTATAAATATTCATACTTAACTTTAATTAAAAGATGCAGAGAAT
AAGGGCCCGTTTGGATGGGCTTAATAAAAGCAGCTTTAAAAAAGTACTTTTAAAAGTGCTGAAACTTATTTTTAAAATAAGCAGTTATGCGTTTGGATAA
AAGTGTTGAAGTTGTTATGTCAAACGTGAAAAGGAAAAAATGGAAGAAAGAAATGTTAGGGTTATATGGATAATTTGGAGATTGTACAAAAATAGTAAGC
ACAAAAAGATAAAAATGTGGTCAACTTAAAACAGCTTATAAGCTAAAAAAAAAAGCACCCCTACCCCAGCTTTTAACTTTTGGCTTAAAATAAGTTTTTT
TTAGCTTAAAATAAGCTGTTTTGAGTATTGTCAAACAGCTAAATAAGTCAAAAACCAGCTTTTAAGTCAGTTTGACCAGCTTTTAAGCTGAGCCAAACAG
GCTCTAAAGCTATTGACAACTGAATTTACGTAGATCTCAAAATTTTTCATGAACACTTTAAGAGAAATTTAAAAAAATAAAAAGAAGAGGATTTCAATCA
CGAAAAGATGTAAAAGATTAATATAATCGATGAAATGATTGAAGATACTAATAGCATGCGGAGTTCAAAAATTATATAACAATATTACACCTTAAATTTT
TAATTTTTGCTATTTTATAAACGGAAATCAACAACATATATATCACGTACATGAAATATAATTAGAGTATAATTTTTTGACAAAAAAAAAACTTAAATAT
GATAAAAATTCAATTAAACCCCTTTTCCCCCACTAGCTTCGTCCTAGCACCTTATGTACTCCATAAAAATGTTTGCTTTGCTTGTGAAAAACAAAATTTA
CCAAAGTGCATATAGAAAAATATTGTAGAAGTAGTTAAATGACATGAGTCAAGACCAAGGCTGTGACTGTTAATATTGTGAAATTAGGTGTTAGGTCTAA
CTCACACCTCAAAAGCTAGCTCAAAGGGAGGAGGATTGCCCATGCCTTATAAAGAGTCCACTCATCTCATTAATCACCGATGTGGGACTTTTGTCATTCT
TTAACACCCCACCTCACGCCCAGTGCAACATCGGGTAAGACCTAACTCACGCCCCAAAAGCTAGCTCAAAGGAAGGAGGATTGCCCAAGCACTGATGTGG
ACTGACACCATGTGAAATTAGGTCTTAGGCCTAACTCACACCCCAAAAGCTAGTTCAAAGGAAGGAGGATTGTCCATGCCTTATAAAGAGTCCACTCATC
TCATTAATTACCGATGTGGGACTTTTGTCATTCTTTAACAAATATAACATGAAATATGAAATATATGTGAGTATGTTTATATCAAATTGATAAATATATT
ACACATGGTTTGATCTCATAAACACAGTTCACTTACAGTTATGTTGATCAAAATGACTAACAGATTAAGTTTAATGACTTAATCAGTCACTAGCCCTCGT
ATTATAAAATTCTCTCACCTGTTCTTCAGAGATATGGTTAATTGTTATACCGATAATCATATTGTGTTTTTATGTTAGTCTTTTAACTCCAAAAAATTCA
AACATAAGTTGTAACGTCTCACTTTAAAAAGTTTTCACTTTTACCTACCTTTTTTCCTCCTTATAAATGCCCAAACAACATATATTCTATCAACGATCAC
TTAACATCTCTGTTTCCTCTGCTAATCACTTATGGCTAAACTAATTCTCACACTTTTGTTCCTTCTCTTGTCCTACTTCTCAGGTTAGTTCACAATTTTT
CGTATTTTTCCTTGTGTTGTTACTATTAATGTTTTTGTTTGACTATATTCAATGTAGTCGTATTCGAGGCCTCTTATTATAATTTGACTTTAAGACAGTA
ATTACACTAATGAAATGTTTAAATCATGTTGTTTTTAAGCAGGGAGTCTGACGTTAGGGGATGATCAGGTAAGTTAATTATTTAAAGAGTTGAATTGGTA
GTTAATTAGATTGTAATTAAGAGTAATTTTGGTTTTGCAGAAGACTTGGTGTGTGGCTAAACCTTCATCAGATGAGAATGCACTTGAACAGAACTTGAAT
TTTGCATGTCCTATTGTTAATTGCAATATATTTAACGAAGGTGGTCCTTGTTTTTTACCAAATAATTCAATGAATCATGCTTCTATTGCCATGAATTTGT
ACTATCAATCTAAAGGATCCCAGTTTTGGGATTATAGCTTTGGTAATTCTGGCCTTGTTGTCTTGACTGATCCAAGTAAGTCCTTTTTTTGCTCGGAAAT
CGATTTAATTAGAACGGGTTTTATGAATTCGACTTGAATTGTCACTGTTACGAACGATTACTACTTTTTATGAATTCACTTTGATAATAGTCCTATATGT
ATCAGAACGAGTTTTGTGGGTTCAACTGTAACTCAATTTTTGACAATGACAGGTTATGGTAGCTGCATCTACGAGTGAAGTCATCAAGTCATGGTTGGGA
GAAGCAACTCATGAAGAGATTATTATTATTTTTTTTACTTTTTAAAAAAAAAATCAATTTCTTCTTATAACAGAATTAAGTTTAGCGACTCTATGGCTAA
ATTTATGTGATACATTTTTCCTTTTAATCTATTATAAAAGGAATGTTATATTTATATAATAAAAATAAATTTAACTTTACAATTTTTTTATTTTACCCTT
TAATGAAATTATATATATATATTCAAATAAATAACTAAAATTTATTTTAAATCACAAATTTTAGAAGAAGAAATGTTATATCAATGTAGTTCCTTTTTTA
ATGTTTGCATTCTTACTTTCTTCCTTGAGCCTTAAACTCTTTGACAGTGAAATAGTTGGTTGAGTAATAGTGCGGAACACTTGTAATATCTCTCTAGGTT
TAATAAAAATGAATGATCTCCTAATATAGTTTGAATGAAGATATATCGTTGAGTCCATTATAGCCTTAATTTATTTAGATTTCTTTCGGAGAAAAATTAC
ACTATTTTATATATTAGAATTCTATGTTGACCTAAACATGGTTAGACTTAGGTGAATATCAAATGCATATGTAAACATATCGTTTGTTATGTCTTTCTAA
TTTTTGTAATAATCGTCTTCTGATTTATAATTAAATATTTATGTTTTCTTTGACATCAATTTTTTTTATTGTTATATTTTGTTATTGACTGTATATTTAT
TATTGAATTTCCTTAATGCAAATAGTAAGTATTTCAGTACGCGACAAAGATTTTTTTTTTTATAAAAATAATATTTAGGATTTGTGACATTTCTAATATA
GTTTTTTAAGTTTTAATTTAATCCTACGACCGACCTAGTAAGATATGTTCCATATAAAATCATCACATAAATACCGTTCACATTTATCAAAACAAAAAAA
TTATGAACTATTCACGATCACCAAACAAAATAAAAATAATAAAATGGAAGTTTCTTAATAATCAACTTAAAAGGGAATTGGAAAAAAATGAAGAAAAATC
TCTATCATATAGGGTATAGCTTACTATTACATTGAAAACAGTTTTTAATAATAATAAAAAATGTCAAAAAATTAAAAAATACGTAACCTTTTTGTTTAAT
ATATAGTACTTCCCATTATACTAAAAGTTTAAATAAGAGAAACAATGAATATTAAAGGGACGAACTATACTAAATTCGAATGAATCAAAATAAGCTAGTT
AATAAATTAATATGTTATTAATTCATCTAATATTAAATAAATTAATCTATTTATATTTTTATAGAATAATTTTACCATGAACTAGTAGGTCATAATCAAG
ATTGAAAAGCAGCAAAAAAGAGATGGAGACATATGAAGAAACAATTAAAAATTAGTGTTTTTAAAGTGTTTTTGAAGATGTTTAGAATGTACCAAAAAAG
TATTCTAATGCACAAATAAAAGGCCTAAATTCATAGGATATACATTTTAAAATTTAAAATATAAGTCCGAAACGTAAAAAAGTATAGAAAGTAAAAAAAA
AAAGAAGCAATTTTATTTAGATTTGCCGGTGGAGAATTTAATTTTCAATTCTTTGTAGTCTAGATCAAAGCACATGATCTTCTTTACTTGCTTTGTTTAA
CTTTTAAGCTCGTTGATTTTAACTCACATGGTGCAGATGGTCATCCACCATTACTACTTTAGGAACACTAGTGGAAGATTCGATCAAATGGATTTAAGAT
TTAAATTTTAAATTTTTTATAGGCTTGAAATATCATTAAATTCATGACTATCTGAATTTCTAGATTTGAAATGTGATAATATATATACTGTTAGCATATC
TTTTTTTAGTACAAATACATAATTTGAGCTAAAGGTATTTAGATTGAATCTACTCTTTTCACTTGGTAAATTATTCTATTTAATTTATAAGCAAAGGATT
AAATAGAGTTGTTCTATAATTTTTAAATATTCATACTTAATTTTAATAATTAAAAGATGAAGTAGAGAATAAAGTTATTGACAAAAGATTTTAAGTAGAT
CTTAAAACTTTTTCATGGACACTTTTAAGAGAATCGAAAAAAGAAGAAGAGAATTTTAATAACAAGGAAATGTAAAAGATTAATATAATCGATAAAATGA
TTATAGATACTAATAGCATGCGGATTAAAAACTATATAGCAATATCACACGTTAAATTTTCAATTTTTTGCTATTTTAGAACCTACCTCTTACATAAACG
GAATTCCACAACATATATACGCGCACAAAAAAAAAATTATCACATAAAATATAATCTTTTAATGAAAAACTTTAATATGATAAAAATTCAAATAACCCCT
TTTGCACACCTAGGCTAGCTTCGTCCACAACATCTTATGTGCTCCATTGAAATGTTTCCTTTGCTTGTGGAAAACAAAATAACATAATGTTGTGACCGTT
GATATAACATGAAATATATTTACGTCATTTATTAGATGTTTATATTAAATTAATAAATATACAACATACGTTTTTTAGAAATATGATTAACTGGTTATCT
TTAAAATGAATATTAATCCTATATGAGTAAGTTTTTACCAATAATCATATTGCATATTGAATTTCTTTTTTATATTATCTTTTAACTCAAAAAGATTCAA
AGTAACGTCTCAACTTAAATATTTCGAGTTTTATCTACCTTTTTTCTCTTTAAATAAATTGCCAAACAACATTCCATTAACAATCACTTTACACCTCTCT
TTCCTCTTCTAATCACTTATGGCTAAACCAATTCTCACACTTTTGTTTCTTCTCTTGTCCAACTTCTCAGGTGCGTTACAATTTTTTCGTATCATTAAAA
GGTCATTTTTGTTATAGTATTACAATTAATATTTTTGTTCAACCATGCACGATAAGGAAATTGTGAATTAAATAAGAATTTTCGTAGAAATTAGTATATG
AAAATTTGCACGAAAATAAGTTTTCTGCAAATGTTTATACTAATTCCATATGTAATTCACAGTTTTCTTATAGTGATGTTCAGTGCGATATTCTTAGTTT
GATTCAGGGGCGTATTGTTATATATTACTTATCATTATGTAATTAATTGAGGCCTCTTAATATAGTTTGACTTTAGGACACTAATTACGTTGAATCGTGT
TTGGATGAAACTAATTAAATGTTTAAATGATGTTGTTTCAGTAAGGAGTCTGACGTTAGCAGATGGACAGGTAAGTTAATTATTAAAGAGTTGAATTGGT
AGTTAATTAGATTGTAATTAAGACTAATTTTGGTTTTGCAGAAGACTTGGTGTGTGGCTAAACCTTCATCAGATGATATGGCACTTGAGCAAAACTTGAT
TTATGCATGCAAATATGTGAATTGCAATATAATTAAAGAGGGTGGTCCTTGTTTTTCACCAAATAATTTGATGAATCATGCTTCTATTTCCATGAATTTG
TACTATCAATTTACTGGAAGACATCCTTGGGATTGTTACTTTAATAATTCTGCCCTTGTTGTCATGACTGATCCAAGTAAGTCCTTGTTTTGCTTGGAAA
TCGATTTAATTAGAACGAGTTTTGTAAATTTAACTGTTATTTTCGTCTTGAACTAGGACTATTACTTTTCGTAAATTCACTTGATAATTGATCGATGTAA
GTAAATACAATTTAACTAGAACGGATTTTACGGATTCAACTGAAACTATTACTTATTATAAATATGTTAATAACTCAATTTTTGACAATGGCAGGTTATG
GTGGCTGCATCTATGGGTGAAGTCATCAAGCCATGGTTAGGAGAAGCAACTCATGAGGAGATTATTATCATCTTTTTTAATTATTTTTTTAATAAAAAAG
TCAATTTCTTCTTATTTTTTCGCAAAATCAAATTAAGCGACTTATGTCTAAATTTATGTGATACATTTGTCTTTTTAATCTATTACAATGGAATGTTACA
TTCATATAATAAAAAAATAATTTAACTTTGCAATTCTTTCTTTTACCCTTTAATGGAATAATATATATCATTAAATAAGATTATTTTAGTTCACAAATTT
TAGATTGACGTTTTTTCTTCTTAGATTTTATCTTAATGTACTTCCTTTTTTAATGTTTGGATTCTTACTTTCTTCCTTGTGCCTTTAACTCTTTGAAAGT
GAAATAGTCGCCTGACTAATAGAGCGGATGACTTGTAGTATTTTTTTTAGATCTGGCAAAAATTAAAAATCTCCTAACATAATTTGAATGGAGACTTATC
GTTGAGCCCTCCCTAGCCTCAATTTATTTAAATTTCTTTCAAAGAAAATTACGCTATTTATATATTAGAATTTTATGTATATAATGTTGACATAAACATG
GTTAAGACTTAGGGGAATATCACCTTTGTAATTTCCACGATGCATATATAAAGATATCGTTTATTATGTCTTTCTATGTTTTTTAATAATCGGCTTTTAC
ATTATAAAAAAATTATAATTTTTTTAAAATCAAATTTTCATTATTATATTATGTATATGTTCTTTATAACATTATTTTGCTATTGATCGTATATTTATTG
TTGAATTTCCTTAGTGCAAGTAGTATGTATTTCAGTGCATGACGAAGAATTTTTAGAAAAAGATGGAATATGTTAGATTTTTGACATTTCTAATATTTAA
AAAATTTAATTAAATCCTAAAATCAATAAGATATGTTCCATATAAAATGATCACGTAGATACCGTTCACATTTATCAAAACAAAAAAAAAATTATGAACT
ATTCACAATCACCAAATAAATAAAAATAATAAAATGGAAGTTTCCTAATAATCAACTTCAAGGGAAAAGGAAAAAAAAAAGAAGAAAAATACATAATCTT
TTTAACTCTATCAATATAGGGTATAGCTTAACGACGATAAAAATAATTTTTAACAATTATAAAAAAAATTTAAAAATTTAAAATATGCAAGCCTTTTGTT
TAATATTTAGTACTTTTCGTCATACTAAAAAGTTAAAAAGAGAAACACACTCTTCCCATATAAATATTAAAGAAATGGACCGTATTAAATTTGAATGAAA
CAAATAAATTAGTCAATAAATTAATATATTATTAATTTATTTAATATTAAATAAATTTAATTATATTTTTATAAAATAATTTTATTATATCGTCTCGTAA
TGAAATAATAGGTCATAATCAAGATAGAAAAGCAGCACAAAAAGAGATGGAGACATGTAGCTAGTGAACACAAATGACAAAAACAGATAAGAATGACGGT
TATAATAAGTGTACTTGTTATTTAAGGATTTTGACATTTAAATAATTTTACTTTTTATTATAATTATTTTTATATATTTTAAATTATTAATTTTTATAAT
TTATAATATTCTTTTATGTGATTTATAAATATATAAATTTTATTTTAAAAAACTTGAAAATTTCATTCTTAATTTTAGTCAAATTCAAACATTTAATTCC
CGAAAAATAAAAAAAATTACATAAATTATTTTTTTAAAAAGTAATAAAAATAAATGAAAACTATGTTGACGTGTAGAGCAATTGGTCCACAAGAACTTTG
GTATAATATATATGGCCAACGAACAAGTAAATTGGAAAATAAAGCATATTCCCCAATTGGCTCCAAAGTCCAAACAACCCAATAAATAGTAACTAAATGT
ACCTAACGGGGCGACAAAATTAAACTCAATTTATTTAATTTATAGAATATTATAAAATAATTAACAGTTAATAAGAATTGAGTGAGTTGAATTATTTAGC
TCATTGAAGTTTAAGTAAATTTGAATATGACGGATCAATAATCTGTTCATTTGATATCTTTAATTATTTATTTAATTCTCCATTTCAAAGAATCATTCCA
TCTTAATTTACATTATATACGTGTAGTAAAATACGAGTAGATAGTGATAATCCAAATATAAAAAAAAACAAAAAACAGTTAAAATTATACTTTGAATTAT
GGAAAGATTTTATTTAAAAATATCCGTCATCCCTTTTTTTTAATCTAAAAATACACTTTTACTCTCTTTTTTTAATTAATCTAAAATTTACTCTCATTCA
GCTATTGGCTTTTATACCCATAAAACTAGCAATCCTCTCTCTTTATTTATTTAAAATACTTATTATGTATCTTTTTTTTTATTAAGTGAAATAAAAATTT
CACCTATATTACATTTTCCGCCATAATTTATTCAAACCAAAATAATATACCTTTTCAAGACTCCCACAATTTTTTTTCAAAAATCTAAGATTTTTTTTTG
TTTATTGTAGTTCTTCTTTAAAACAAATAAATATTTTAATATGATGAAGATATTATTTTGACTTCAATAAATTAAACAAACTTTTAGAAAACTACTAATT
TCTTTAATTTATTCAAATCAAAATAATATACCTCTTCAAGAGTCCCACAAAAATATTTTTAAAAATCTAATAATTTACTTTTATATTTTTGCAGTTTTTT
ATTATTTTCTTTTAAAAAAATTGTTTTGAGATTGTTTGACTTGGATAAATTATGGAAAAAATATTTTTTTAGAAAACTACTAATTTTTGTATTTTGTTTA
GCTTTTTTTTTTCTTTTTTTTTTTTTGGAATCATGGAGATATATTAATTTTTTTAGATATTGTTTGTGTATGATTTGGCTTAACATTTTGGTGCAGAACT
TGCTGCTCCTCTCATTTATAGTTCATATGTAATTCGTAGGAAACATTACTTACATGAAGGAGAAATCGATCGGTCGAAGGAAAGAAAATTCGTACAAACA
ATTTTTTTTAAAAGACTTTTTAAGATTTTCCCCATAATTTGTTGAATATCCAAAAAAAATAAAAAAAATGAAATTTGAATTTTCAAGAGGTATATTATTT
TTACTTTGAATAAATCATGAGAAAAAGTTTAGTTTTGAGGTAAAATTTTTATTTCATCTAATAAAAAAATAACACATGATAAATATTTTTTTTTTAAAAA
AAAAGAGACATTAGTTTTAAGGTAAAAGATGAATAGAAAGGTACATTTAATCAAAAGGTGGATAAAGGGTATTTTTAAGTGTTTGCATTTGTTAAAAGAA
TGACAAAAGTCCATATCGATGATTAATGTGATGGGTGGACTCCTTATAAGGTTTGGGCAATCAAATTTCCTTTGAGGTAGCTTTTGGGGTGTGAGTTAGG
TATAAGACCTAATTTGACACGGTGTTATTTTATTATTGTGAAAATCAATCCCACTACTTCTGGTTCTGAGGTTTCCACGCTTGAAAAAAAAAATTCGAAG
CGTATCGTCCAAATCATCGATCCGGTACTAGATGTAGCCTTTCCCCCGGCAAGATGCCAAATATTTATAAAAAATCTGGGGTGTGCCGTCCAAATCATCG
GTCTGGTACTAGATGTAGCCTTTCCCTTGGCAAGATGTCAAATATTTATAAGGTAGTTCAAGGTCGAGATAGTGTTGATCAACCAACTAATGTGGCTTGT
GAGGTACATCAATTATTAGGAAATAATCGAGTTAGGCTTGTAGCTATGAGTGCTACAGACGGTCTAACGAGAGGAATGACAGCGTGAAGTGGGGTGTTAA
AGAATGACAAAAGTCAGTGATTAATGAGATGAGCGGAATCCTTATAAGGCTTGGACAATCCTCCTCCATTTGAGCTAACTTTTTGAGTGTGAATTAGGCG
TGTTAAATTTAAAAAAAGGAACCGTTGATAGTTAGTATGACTCAAAAATACTCATGTATTTTTTTATCATTAATATATTGTATATTTTAGAATATATGCA
TTTCTTTTTCACATACGATTGTTTTCTGTTAGTCCCTGTCAAATGAAACCCAAAATAGGACAGCAATAGATGAATATTCACTTACGTAAATGCATATTTT
CCACTAATAAATTAAATTAGTGGAAAATTCATGTACATATATTCATAAAAATCTAAAATCCAAACAAAATTTGATCACTTTGAACCATTTGTTAACCTGA
TAATGGGATGTATGTCAATGAAATAATATTCAGAACCAATCGATTTTATAATTATTTTTTAAAATTTAAAAAGGAGACTCTTTTTTTTTTCTGATCTAAA
AGAAAGAAAAAAGGAATCTAAAAATATTATGTGGAGGAATGAAATTGCTGAGATTGAAGAAATAACTTAAATGTCAAACACTTGGAGAATTATTATCTTT
ACATTTTAGATTATTTATGAACTCGTGAAATGGACACAAAATCTTTCCACTTTGTTGATTGACGTGAAGACAAAAGAAGTTGGAGTCAAGATTTGAAGTT
TACGAATCTGAATTTGTTATTGAATTCATGAAACTCATTTCGTTTCGAACATGAATATTTGATGAATTATGTAGTACGTAAAAACTATTTGGTTCATGTG
TATCTGCACCTAATATTATAGATTTGTCACCTATGTATGTATAGAGATATAGTCAAAATTTGAAGCTTATAAATTTAAAATTTTAAAAATCCATTTAAAT
ATTTGAGTTCTAAATCAATAAGTTATACATGTTAATTAAATAAATCTCTTAAGATAAATATAAAATTTAAATCAAAATTATATTATTTGATTCGACTGAT
CGAACTCATACCATAACTTTTATCTTCAACCCTGATCGAACTCATACCATAAACTTTTATCTTCAACCCTATGTATATAACTTTCCTAGTTTATCATAGT
TATGAGCTTCATGCAATATAATTAAAATAATGAATAAGATACAAAAATACATTTGAAATATCATATTAATTACCTATATGTAATTTCACGAGTTTTAAAA
TGTATTATTGTTCAGTATGTGATAGCCTGATAGGAAAGATTATAGATAGGGTTACAAAATAGCTAAAAAAGGACATTAAATATCGATACGACACCTTAAT
ATTTTTTGATATTTTATTTATAAATTATGTGCTCATTTGATAAAGATTAAATAGGAGAAAATTTTGATAATATTCACAACTTTTATGGAAAAAATATATA
ATTTATGAAAGTTAAATTGTATTTTCAAATAAAATTTCAACTTTAAATCAATCTGATTTTGGATCATTATTTTATAACGTATATCTAAATGGATCATTCA
ATTGGACATGGAAAAATCCTCACTAGAATACGCCATGATGCATATATGAAAAAAAAATAGGGCACCAATAAAGATACTTATATGACGCATTTAAAAAGGT
AGGGCTCCAATATAGATACTTATGCGATACTATTGAAAAAATAAGTTTTCTTCAAATTGGGCCTTATGTGACACATATTCGAAAGAATAGGGCTCCAATA
TGGATAATTATACGGCATCTATTAAAAAAGTAAGGCTTCAATATAGATATTTACGCGGTGCGTATCCAGAAAAGTAAAGCTTCCTTCAAGTTGGGCCTTA
CGCGGTGCATATCCGAAAAATTAGCCTTCACTTACTTGGCTATCATACTACCTCAGAAAAAATGATAAAAATAGCTATACAATTAGTACATCATATTGCT
TTTGTATTGGATGATAAATTGATTTGAGTGTTTGAGAATTTTAGGAGTTGAAACACAGCCCAACTGTCTTTTTCTTCCATTTTCTGTCACTTAATCAGAC
CAAAGACTCCATTTTTTATGTGGTTCTTTTTTATCCACTCAATTATTTCTTCTTGGGACAGGATATAAAAGCACACCCAAGTGTTCAAATTGTTTCCATA
GTAGTTTTCTGTTCTTTTTTGCCTATTGGGGTGTCGAAAAAAGCAATCTTGAAGCATTGCAAGGCAAAAAATTTGGTGATTTAGCTAAGTGGGTGTTACA
AAGATGATGTCTGTGACTTGCCATAATCTTGAAATTGGGAGAACCCCATTGGAGTCTTTGGCTTGTGGCTGTTCTTTTTCAAAGGGTGTTTTGAGAAATG
TAAGTAGAAGATTCAGTGGGAAGAAGTTGTTGTCTTGCAGACAAGAATTTGGGCGTATTTCAACTAAGGCTTCACTTACTGGTATATAGTTAAATTCAAT
ATTTTTAAGGATTACAGTTTATAAGGGTATTCTTGGAATGATTTAAATTTTGAAATTTTGTTGTTGTTGTGGTTGTGTTGCAGGGTTGGCACCAGTTTTG
GATTTGAATAAGTCAGAAAAACCTATTTCATTGACTAATGTTTTTGAAGTGGTTGCGGATGACCTACTTACGTTAAACAAGAACTTGCATAATGTGAGTA
ATCTGTTGACACTGTTTGATTAATCAATCTTTCATGTTTCAACTTTTCCTTATGTTTTTTTCCAGCTATATAGCTTAATGGATTATATGTGATAAAATCT
TATTTTTAGACTAATAGCTGCCAAGGTAATACAATAATTATTTATCTGGTATGATTCGGAACACGTTCCTTTCGCTTTATTACTGCTGGTATTGTCAAAT
GACTAATGTACTATTCATAATTTAACTTCATTGATGCTTGGTCGAGTTGTTCCTTTTAACGAAGTGCTCTAGATGTAAGAGAGAGGTACAATTTTGGACT
AGTGGTGATGCTAGTGGGGATTCAAATCAATAGAGATGCTTATTTGATGATATTTGTGTTTATTGGCCTTACTAGAATTAACATATAAGGGGAACAGGAG
TTGCAGTATCACTCTGCCAAATGATATCTTAATCTTGGAACATTTGTGAGGATGGTTTTATTTGGTATTTGGTCATGGTTTGATTCAAATACCAGATAAC
TGATGGTTGTACTTGTCGTTGTGACTTCAATGATTCTAAGGTGAACAACTGCTAAGGTGAATATACTTTGTTCTCGAGTGAACTGCTTTATATGTATGAG
AGGTGCAATTTTTGGACTAACAAATGGTCATGGAGGATAAACAACCGGACTTAATAGATATATTTATTTGTCCGGGTTATTGGCCTTAAAAAATCTAACT
GTAGGAGTAAGAGCTACACAATTACTTCCAAATGGTATCTATAATTTGGATGATGATGGTGTTCGGGCCAGCATGTGTACACCTCAACTATTCTACCTGG
TTACCTTCTAACTCCCATTGGCACAGGTACCTTGACCTTGAGCTTATGAAGTTCATTTTAAAAGGTCCTAGCTTTTTGACAATTTCATTTACTTTGATTC
AAAGACTTGATACAAGAAATAATTGCAGTTGGGCCTGAGAGTATCTCAAACGTATATCCTGATAAATAAATACACATAACTGAAAAAGTTTCATATTGTC
ACTTGCTATTATTAGAATTTGTAAAATATGTGGTTAATTGGATCAATACCACATGAATGTTCAGATGGCATATCAGGCCAATTTACTTTTAACATATCTC
TATTCTATTCTGTATCTAAGAGAAATCATTTTTCAGATTGTTGGTGCAGAGAACCCAGTTTTAATGTCTGCAGCTGAGCAGATTTTTGGTGCTGGTGGCA
AAAGGGTGAGACCTGCTTTAGTGTTCCTAGTGTCAAGGGCCACAGCAGAAATGTCTGGCTTAAAGTGAGGAACACTATTTGGTTTTTTTTCTCTTGTGAT
ACTCAACAACAACATATCAGCTAAGCTAATATCTTAAAATGCTTGCTGCCAGGGAACTCACCACAAATCACAGAAGGTTAGCTGAAATCATTGAAATGAT
CCATACTGCAAGCTTGATACATGATGACGTGTTAGATGAAAGTGACACACGAAGAGGTAAACCATTTTAAGCAACTTGTTATTCTCCTCTGATGCGTCTG
CAAATTCACCGCCTTTAATTATTTAAAAACTCAAAATGATTATCACTCTTGCATTAATACTTTATGGCTGAAAAGGTTATTGTACATATTCAGTGGTTAT
TACTTTGGATATCACTCAAAATCTTCAGCTCTACCATTACTAGGAATAGGGTTATTTTCCGGGCATCGTTGCGCGTTATTGTTCTTAAAATAATAATTTT
AGTACTATCTTAGGAGGAATATTTAGAAGAAAACGCTAAAGAAGATATTGTCCTCTTTCTGATTCTATGATGATACTGTGATGCATGTTCTAACTCTCTA
AACAATATCAATCCTTTAAAGAATCTCATTCTGAAAATTTCAGTTGATGAAGAGTTTGTAAGGTATATCTAAAGAAAAAAGAAATAAAGATGCCCTAGAA
TCTACTGTGGATGCCAGACAATCTGGACAGATGATATTAACAGAATAACCAGACTTACAATGATGACAATACCTTTTATTGATTAGAACCCCCCAGTAAA
CTTTATTTGACACTACAACATTGGTTGGATGTGTATGAGATCTGGGCTTATCGTTTCTAAGCTATCTCTTGTGCATTTCCTAGGACTAGTTACTTATTTC
TCAAGTATTTTCTAATTGTTATTGATGCTGCCCTGATTGATTTACATGAGGTTCTTGTTGTCTAACTTGATGTGGTTGACTTTCTTCTATGAAAGACGAT
CTCTCCTGCTCTCCCGGGGGATCCAGAGACCTTAATAACTTCAAGGGTTAGTCCAGGAAATATGCTTGATTAGCAACAGGTTATGTGATGAGGTCATTAC
TGTTTAAATATTCTTCCTACTTTTCATTTCGGGTTTCTGAGATCTTCTCAGCATTTATCAGATTTGTATGCTTTCTGAAAAAAATGTGAGACTCTGTACA
ACTGTTTTGTGAAATGGTACACTTAACAATGGATACACCAAAAAAAGAGAGAAAACTGACAAGATTGGACTAGGTATGCGCTTTCCCAGGCTTACAAAAA
AGAGCAAGACTAGATTAGATCTTTGCTTTCCCAAGTTTGTAGAGACTGATAATATTAGATTGTTATTTCTACCATCAACACTTCCTTTTCCTAATAGTTT
AGCTTAGATCAATTGATGATTGATTCTTTTATAGCACTTCCAAATATGAGTCCTCTGTTTGTCAATCTAATCATTTACCCTTGTTCTTCTTCTAACTTGC
TTCTCTTAATCGCAATTTCTATTATACCTTCTCCTTTGCTTCTTTATATTAGCCTCCTAATAGAACTTCTAATGCAGGAAAGGAGACTATTCACCAATTA
TATGGTACTAGAGTGGCAGTACTGGCTGGTGATTTTATGTTTGCACAGTCGTCCTGGTACCTAGCTAACCTTGAAAACCTTGAAGTCATAAAGCTCATCA
GTCAGGTATCATAGGTTTATACATCTTTTAGAATTGGCAACATTGATATCATTATTAGTTCGTTGTACCTCAACGCCCTTTGTGGTTATTGGTTTTTATG
ACAGGTTATTAAAGACTTTGCAAGTGGTGAAATAAAGCAGGCCTCTAACTTGTTCGACTGTGATGTTGGACTGGATGAATATTTGCTCAAGAGTTACTAT
AAAACGGCCTCCTTGATTGCTGCAAGCACCAAAGGAGCTGCCATTTTCAGTGAAGTTGGCAGTGATATTAGTGAACAAATGTTTCAATATGGGAGGAATC
TTGGTTTATCGTTCCAGATTGTTGATGACATATTGGACTTCACACAATCAGCCGCACAACTGGGAAAGCCAGCTGGAAGTGACTTAGCCAAGGGAAACCT
TACTGCACCAGTACTTTTTGCATTAGAGAAAGAGCCAAACCTTAGGAATATAATCGAATCAGAATTTCACGATGCTGGTTCTCTCGAGGAGGCCATCAAT
CTGGTGAAAAGCTGTGGGGGAATTCAACGAGCACAAGATTTGGCAAAGGAGAAAGCTGATTTAGCAATGCAGAACCTAAAATGCCTTCCATCTAGTCCTT
TTCAAGCAGCACTTGAGGAAATCGTGAAGTATAATCTGGAGAGAATTGAATAGACGAAAACAAAGGACGAAACTATACAACTTTGGTTTATTATTCTCTG
AAAGCTCTTCATATCTAACAATATCTGGAGCACAGAGTAGAAGCTATTACTATAGTTTGAATGGCAACAACGATCAGAACGAAAGTGCTTCACTATGTTC
ATATATTATACCCATACAGGTTGTAATTTTCAGTTCCTAATACAGCAATATGGTGTTCCAGCATTCTTTATAATTTGGCTAATAAATTGTCAAATTTCAA
CTGTTGTTGTACACTAAAGAAATTTCACATTACAAATAATGTCATGTATTAGTATTTACTATTGGCTTTCTTGGATGAACATATATGTTATAAATTGATA
ATACAATAAACATATTACACCTTAAATTTTTGTGTCATCAGTTAATGTCATGTATTACTATTTACCCTTGGCTTTCTTGGACGGACATTTATGTTGTAAA
TTGATAATACAATAAATATATTACACTGGAGAATGTTTTACGACTTTACTTGGTGTCTTTGCAAATGAAGAGCACCTCTATTTATACTACACAAAAGTAT
AATTAATATTTACTTTACAAGTTCCTAAGATATTTATATTTTGATCCCCTTTTTAGAGAATTTTACATACTCTAGGATATCCTAAGACATTCTTGATTTG
TCTAGGGAGTTTTAAAATTCTTCGCAAGTCTCTCCATAATTCTGGAGTCTTCTACACTTGATGTAAAATTTGACTGGTCTGGTGGCGGGATATGACACTA
AGTTCTTTCTCTTTAATAAGTTTTTTACGAGAAGAAAATATTGTCTCTTTAAAAAACTATTACGTAATAATTCTATTTTATCATTTACCTTACATTTTTA
TAATTATTTTATCTTGAACCCTACTTTTTTTGAGGAAATTATGCCATCGAAATTTATGGGAAGACTCATATATGTCAACCATTAAAAATTTGGTTTATCT
ATATCATTTTCATTTGAGAAAATGCTCATCCATGCCATTATTTGTAAACTGAAAAAAATTTAATTTTGCAAAATGATTTTCACACGTCGTCAATTATGAT
TCGCTTACGTCATTAATTAAACATTGACTAAAATAGACAATTGAACTATAAGAAAAAAAAACTCATTTTTGCCATCCAGTTAAAATTTTGGCTCATCTAT
GTTGTTTCGTAGACAAATAATGACATAAAGAAACCTTTTCTCAAACGAAAATGACATAGTAAATAACATAGATGAACCCTTTTTGAGAGTTTGATTTTAA
CCTCACTAAGGGCCCGTTTGGATGGACTTAATAAAAACAGCTTTAAAAAAGTACTTTTGAAAGTGCTGAAACTTATTTTTAAAATAAGCAATTATGCGTT
TCGATAAAAGTGTTGAAGTTAAAAAAAAAGTTGTTGATGTGTTTGACAAATAAATGCTGATAAACAACTTTTTAAATCAAAATGTCTGAAATACCCTTAA
AAGTTGTTAACATAATAAAAGTTAATTAATTTATATTTTACAGCCATAAATAATTATATTTTATCATTATTCTCATATTTCTTTCTCATCACAAATTATT
TATAAGAGGAATATAAACTTATTATAGATTTTAAAGATATATAATTTGAATAGATCAAAGAACGATTTAAGATTTTATTTTAGTTTCATCCGTAGGTAAT
AATAATGGTCTATCATTCACATATTTCTTTATTATCACAAATTATTTATAAGTGGAATATAATTTTTTATTTAAGTTATATGTGCAACTTATTTTACATT
TTAATAATATATAATTTGAATAGATCAATTGAAAGATTTAAGATTTATTTTATTTTCATTCATTAGTAATAGTAATTGTCTATCATCCACACGTGAAAAG
GGAAAAATGGAAGAAAGAATTGTTAGGGTTAGGTGGGTAATTGGAGATTGTATAAAAATATTAAGGGCAAAAAGGTAAAAATGTGGTCAACTTAAAAGAG
CTTATAAGCTAAAAGAAAAAGCACCCCTACCCCACCTTTTAACTTTTGGCTTAAAATAAGTTTTTTTTTAAACTTAAAATAAGTTATTTTGAGTATTGCC
AAACAACTTAATAAGTTAAAAATCAGCTTTTAAATCAGTTTGATCAGCTTTTAAGCTAAGCCAAACAGGTCTTCAAGAGAGGATATGTGGTGATAGTACT
AATGCAGGTGAGGCAAAACGGGCAATGTCTTGTTTTTTGCTAATAACCAAGGAATAATACAAGTTGCGTGAAATCGATGGCGACAAGCAGAAAGTATATG
ATTTAAATAAAATATTTATTTTGATTGTTACTTAAATTTTAATATATTATATAATTTTAATTTATTGCTAAGTAACAAAAAAAATATCATTTCATACAAT
GATCGATTTAGTGTGACTTCGTCATTGATATAATATTTTTTTCTCATTTTATCTTTATTTATTTTTTAGAGAAGTATAAAAAATATCCCTAAATTTGACG
CAGATTATTAGTTTCATTTTCAAATTATTGATAGTTATTGTTATGGTTATAGTATGTAGTTACAAGAAATTGAATCACAGTTATTGTAATGATTATAGTA
TGTAGTTACAAAAAATAATGTAATTATCAATCAAGCCGTAGATGGCATCTCAATGTTCACAAAGGATATTCTAAACCAAAATTTCGACACATAATATATT
AAAATCTCAGAACATAATTTTGTGAGCACTTGAACTAACAAATATCCAACAATAATAACAAAGACGACCTTACTTTCCTAACAATCAAAAAGAAAAAGGC
ACGTTGCTTAACATATTTTTCAAAAGATAGTCCTTCGGGTTGTATCCAAGTTTACTGTTCACAAATTTAATTGAAAGAAACCAAAATAAAGAATTATTAC
TTCTTTATAAATAAAAAAATAAAAACTTTATCAAAAGAATAAGTTATCACTACAACAAAAATGATCTTAACGACAATTAATAGTTTAATTGTCGCTAAAT
ATGTATTTTCTGAGGCGATTGATACTATGTATAAATGTTCCAAAAGTCTATAGTAACATTGCATATGATGTCAATTCATTAATGTCGGTAAAGATTATAG
CACTCTCCGTGAACGTGCATATTTATTGCCGATAAAATATACTCTGTTATAGTGTATTTTTGACAGTTGTTAATTTCATGAAAACTTGATCTCTTATTAC
GCCCAAAAAGAAAGAAGAAGAAATATGACAAGTTGGTTAACTTGCGATAAAATATGTGGACTAATTGTCTCTATAAAAATATTCTTGAGAATGGTGCAAT
AACATACAAAATCTTTGTACCTAAAAAAAACAATCAAAATAATATACTAACTGTGGCATGCAAGAGAAGAATCATTTTGGTTCTTTTAACCCTCAAGCAA
TTTTTTCAAAAAGTATATGAAGAAAACCTATAGAAAGGAACAAAAGAGAAGATAAATTTTCAATCATCCTCACTGGAATTTCGAACATAATTCAAAAAAG
TCACCGAAATAGCAAAAAGAAAATGCAATAGATACATGAATCACTATGACTTATAGTAAAAATTAAGCTTAATGAAATAGGAGGAAGAAAACTTTGAGAA
ATGAAACACACTTAATAAGAAGCTTAATTAATATATTTGAATTAAAAAAAAAGCATATAAACAATAGCGGCAGAAATAAAGTATTTGTTTACTAAAGAGC
CAAATATAATGAATTGAACCATCAACCATTTCAACAACGTTATTAGTTGTGCACCAAGAGGCCAAGAGTATTAATGTCGCATTGCAATTGAAATCAACTT
CATTTGTTTATATGAAGAAACCCGTAGAAAGAGACAAAAGAGAAGATCAGTTTTCAATCATCCTTACTGAAACTTTAACAGAGTAAAAAAAAATCATCAA
AATAGGAAAAAGAAATATATAGCAGTAGTTACATGAATCACTATGACTTAAAGTAAAAATTAAGCTTCTTGAAATTGAAAGACGAAAACTTTCAGAAATG
AAACAAACTTCGGAAAAATTTAATTAATGTATTTGAATCTGACTATCCTATAACGGAAAAAGAAAACCCTACAAATTATAGTGTTGGGAAATTCTTATAT
TTATAGACAACATAGGATAATGGAACAAATACTTATCGTACCTTATCAGAAAGGTCACAAGTCTTTGAAAAAGTTACAACTCTCTTGAAAGATCACGACC
TTTCATATAAGTCGCAATTTTTCATAAAAATCGCAACTCTTCATCAAAGTCACAACTTTTCATGAAAAGGGACGCCTAATTTTGGAAATAATAAATTTAA
AAAGGAATCCTGATTTACAATAACGCCACGTAGGCAGACCTAGGATTCTCTTTTATATAAATATATGATTGGCGATACAAAATTGGTACCAATTGTGTAA
CACATCTAGTAAATTGCACAGCTACTATTATTACATATAAGTGAATTCTATTGAAGATAGAAGATAATATATAGTTGAACCCTAATCACTTATTATAAAT
ATTTTTTTATTTGTATCGACGCTAAATTTTAAACGGCCGTTGAACAACTTCCCTAAATCTTCAACTTGAGCATATGTGGTGATAGTAGTAACGCAGGTCC
GGCAAAATGGGCACGTCTTGTTTTTTGCTAATAACCAAGGAATAATACAAGCCGCATGAAATCGATGACGACAAGTAGAAAGTATAAGTTCATGACACGT
ATCGTCTTCTTGTTCAAATTCTCCTAAACAGATACAACAATCGTTGTTTATACCTCGAATTTTTCGATCATCATCGGGAATATCGATCACTACTTCCATA
ACCAAAGCTCTTTCTATAGCCACATTATGATTTTGTGGAATTTCTGAAATATTAACCGTCTGTGGTGAGAGTGACTCTTCGTGAAAAAACTGATATATTA
TTTTTATGAAATAATAAAGTACTATTACTAACCAAATACAGTAAATAATATCCAAGGGACTCCACATTTATTATTTTTGATAAAAAATTATGAGTATGCA
ATTGCTAAAGAACTAATAATTTCAAAATTATAATGAATAAAATAATATGACAAATCTCGAAGTATTAAAAAGCAGGAGAGTTTAATTTGAAGATGGAATA
ATTGAATGCAAGGCAAGGTTATTTATAATTTTAATTCTTTCATAAACCTGTTATGATTTGGAGTTTCAATTACATGCCATAATTAAGTCCTTTTACAATT
AGGATTAGGATATTTTATAAATAAAATAATCTAACGGATAAATAAAGAGTAATCAGTAACTTTCCTTTTTTAAAAAAAATAATTGCGTGATGCACAATTT
CAAGGAATTGTGTATATTTATTTATAATATAAGTTGTTGATTTTAGAAATCTTACAGGACTAGGACTAAACTATTTTTGGAAATTTAGAAACCTTTTACG
AGTAGGAAATGTGTGTCCTAATTAAATCCGAAATCACTTGGGTTTGCGGGCATGTTTAAATTTATTATATCGTATCGTTTAAATACATTGTTAGGTAACA
ATGAAAAAAGTCATTTCATGTAATAATTAATTTGGTGTGATTGCCTAGTTGATATAATAATTTTTTTCTTATTTTATCTTTATTTATTGTTCAGAGAAAT
ATGAAAGACATCCTAAATTTGACGCAAATTATTAGTTTTATCCTCGAACTATCGATAGTCTTAAAAACACCACTCTACTTGATTAACTAAACTTAGATAC
ACTTCCGATACACTCTCGATATGCCACATGACATAGAAGTGGTCTCAAACTCTTGAAAGAACACCCCTAAACTTGACGAGAATTTAGGAGTGTATTTTAC
TAATGTTACAAGATCAAGGGTGTAGTTAACTTGAGTTAGTCAAGTAATTAAAGTGTGTTTTTAAGGCTAACAATTGTTCATGGATGAAACTAATAATTTA
CACCAAATTTAGAGATATTTAGAATAATTCACTCTTTATTATTTAATAATTATATATTTCATCTTTTATCCTATTTTTTAAATAAAATTTTACCTATATC
CTACTTTTTATTTTAGGGAGAAGTATTAAAAATATGCCAAACTAAGCCTAAATATTGGTTTCATCCTCGGACTATTGAAAACCTTAAAAACATTCCTTTA
CTTGACTAACTAAACATAAATATACCCGATCTTGTAACATGAGTGGAATACATCCTTAAATTCGCGCTAAGTTTATATTAAGAGTGTTTTAAACACCAGG
GGCGGAAGTACATGGGGCCGAGGAATGAACCCTCTTCGTCGAAAAAATTATGTTGTATATATAGGATAATTTTTTTGATTTAGAGGTATATATTAAGTGA
TAACCCCCTGAATATAAGCAAAGGGTTTGGCTCAGTGTTTAGGGGGTTTAGGATTTCACAAGGCCAGCGCTTACTTCACGAGTTTGAACCTGAGTATTTG
CATCTTTTTTTAATAAAATAGTTTTAACTTTCAGTTGTTCTTATTTTTAATTTCTAAATGCGCGAGTTTCATAAAGTTTGATATCGTAATAACAATTTCG
ACCAAATTGAAGTATTTTTCAGACCATTTTTCTCAAAATTGTATGCACATGATAAAAATCACGGAGTACACTATAGTTTTACTTTTGAGTTGTCAATCAA
CATTATAGTAAAACATGGGATAAATAAATGGGCAACTTTCACATATAGCAAAAAAAAATTCATATTTGTATGCTACATCAAAATTTGCATAATTACGCTC
CATAGCAAACATATAACTGTATAATTCACTATACATATACAAATGTACAATACGCTGGCCTCGCTATACATATACAATTATATGATTCGCTGGCCTATTT
CGCTACAATTGTAATTCGCTGGCCTATTTCACTGCAATTGTATAATGCGCAATTGTATAATTCGCTGGCATATTTCGTTGCAATAAGTGTATAAAATTTG
CTTGCATACAATTGAATCGAAGTAAAATGTTTGTATATTGTATAATTATAAATGTATAGGAAGAAGATATATGTTTTTCTCTCGCTTTATACAAAAACAG
AAACACAATTTATACACTTCTGTTGTATAAAGCGAGAGAAAATTATATTTCACTACAATTGTGTAATTCGCTGGCCTTTTTCGCTACAATATTTGTATAA
AGTTTGCATTTGTATACAATTAAATCGAAGTAAAATGTTTGTAAATTGTATAATTAAGTGTATAGCACGAATATATATGTTTTTGCATGTGTATATACAA
TTTTCTCTTGGTTTATACAAAATAGAAACACAATTTATACAGTTCTGTTGTATAAAGCGAGAGGGTGAGCAGAGGGAGAGTGGCGAGTGAGAACGGGAGA
GTGGCGAGCGAGAGTTTTGGGAGAGAGGCAACTGACAAACTTTGACAAACGTTTGCTATGAGGCACAATTAAATCAAACAGTAGCTACTCCATTTATTTT
AAGTTATTAGTTTGCTATTATATACAATTATCCCTAAATAAATTGAAATACGATAAAGATATTATAACTTTTTTGACAATATATTACCGGGAAAGAAAGT
TGAGTTCGACGTAGAAATTGGTACCAATTGTGTAACACATCAAGTAAATTGCATTGCTACTATATATAATTACATAAGTGAATTCTGTTGAAGATAGAAG
GTTATTTTGAACTCTAATCACTTATTATGCAACTTTTTTATTTGTATATGCTAAATTTTAAGCGGCAGTTGAATGACTTGACTAAATCTTCAACTTTAAG
CATATAACAATCATGTTTCACATGAAATCATTTCAATCTTTCATATTCTTTACAATAAAGTTTCGTTAAAGCACTAAAAAAATATCGAAACAAATGATAT
TAATTATTATACAAAAATTTGACTTAATATACACGACAAGAGAAACATACCAAAATCTTTTAACAACGGATAATTTCTATCACCAAACAACAAAAATTAA
AAGTGAAAAGATGTATGAAATACTTGATCTGCAGAAGTTGAAGTTCCAAATAGAAAACCATTTGGAAATTCTGATTTCTTCACTTCTTCTTCAAAGCAAT
TTTCTCTTAAATTGGCAATTAATTATATAAATCACAAAACCCCTCATTTTCACGCATTTAATTAATATATCACCACATCAGATTCATGTATCTCGCGCAT
TAGATTAGTGTATCATGTATAAAATTTAATGTATCTTACTTAACGATTAATGTATCTCACACATCGAATTAATGTATCAGCGCTTATATTATTGTATCAG
TTTGAGAAATTTCTGTAATTATCGCCTCTATGTGGTTTTTGTCCTTTGCTCTAGTGTTAAGACACCTGTTACACATACACAAAACCTATATCATCCAGGT
AATGTCTAAGATATCAAATATCTTCACAAACATTAATTACATCGTAAGAACATGCCTTTTACATGAAAAAATTTTACGTTAAATTTGTAATGATGAATAA
GTAGATACATGTGTATTATGTCCTATATATACACGTAAGGTTACAATCGAGACTAAATTAAAGAACATTGTTATGTACTACAAGTAGTTAAAATTCCAAA
AGATGAGCTGTTATGGGCTAAAGTATTAGGCCCAACCTGTTAAAGCCCAACAAACAAAACTCTATATAAATGACCATGGAAGCTAGGGTTTAGAATATTG
CCTATGAGAGATCAGAGCGAGCTTATGAAACAATGGCGCTCTAGTTCCGTTGCGGGCATATACTGATTATCAGTCCTTTCTTCATCTCTGCAATTGTTGT
ATTTATCGATTGTTTCCGTAGAGAAAGGTCTCACATTTCTTTGTTATTTCTTTCTTTATTTTCACTTATTTTCACTTACGGCCGATCCAAATGAGTTCCT
TTTTTTGTGTGTGGGAATTCAATTTCACCCGGCCTATATGCAAATTAGGGCAGTTTCAAGGTTCTGCACGTTCCTTCATCGTGTTTAATCTTCATCGTGT
TTTAATTCACGGATTTTGCTCTACATTTTAGCTGCCTAATTAGATTAGGTTAATCTATCTGTTAATTATTTTCACTCTAATTTTTTTTGTTGTGGCATGA
ATATTAACTAAACTCTTCTAATTAGACCCTTTTTTGTTAATTTGAAGCTATCAAATATGAACTTGTGGCCATTTATAAGTAATATAGATAAATCTTCGAA
TGTATTATAAAGTATTTTTAGTTTTTCTGATTTAAATGTTCTTAATAAACCAAACTAACAAAAAGGATTTGTATTCAAAGTTTTCTAATTAACCCAAAAT
TTTAATAACACGCCGTTCAGTTTTCTTAAGTACATGTTAATTATGATATGAATTTTATTGCTTGATTTTGAAACTCTTAACCAATCACCTATTTTAGCGT
GCAGAGTTAAAAAATCACGTAGGAAAGGTAATTTGCACAGCGTGCAGAGTTGAAATTCTTGCTTCTAATCACGCAAGAAAGGTAATCCGCACATCTCTTG
CTTTCGCTGGCAAATAGTTTCGAATTTAAGATCTCCCAATGTGAAAATACTCAAGTCCAAATCACTGCGCCAGCCTTTTTCGATTGATTTATTTCAATAT
TTCTAATGTTTTTGAGTAATAATGTCGATTTAAACTCACTCCAAAACAAAAAGCAGTTATACTACTAGCACTAAAAATTCGTGAAAAAGAAAATTAAATT
TAAAAGCTCAGTTGTAAATAACATGTCAAAGTCTATAATATAAACAACCTTACAGTAATGCAAACATGAGTCATAATAACAAATCCAGAACAATATATGT
TTAAATTCTTCAAAATAAGTAAAGAAAATTGATCCATTTATGAAGAATCCGAAGAGTATTGTCTATAACTTATTCAAGATTAAGTGAGCACCACATTGAG
GTTGAAGTGTGACAACATAAGTAGGTGCATGAGTATAAGATGGAGAAAGTTCAAATGCAAAACGTTGAAGGATCATAGCTAAGGCAATTTTAGTTTCCAT
CATAGCAAAATTATGGCCAATGCAAATACGAGGACCCCAACTAAAAGGCAAAAAACAAAGCCTATCCTTCGTTGCCTTTGCAATTCCTTGAGAGAATCTG
TCTGGCTTGAATTCTTTAACATCATCACCCCATAATTCTTCATTATGATGAATAAATATTGTTGGTATCATTAAAATAACCTCAGATGGAATATTCATAT
TTCCTAGCTTTGTTTCTTGATTTGCTTTTCTTAGGAAATATGGTGCTGGTGGATATAGCCTTAGTACCTCATTCAAAATCATAGTAACCTGTTTATATTA
ATATAATACAAACAATTGAAGCAAATGTTAGATTCTAAATAGTACATGTTCAAATTTGGCTATTAACTTTTGTTTGTTATTTGTTTTAATTTATGTTACA
CTTTTAATCGGTCTAATAAAAATGACACATTTGTAAGTTCCTGACAAAAAGTTTATAAAGATATACTTTCTATTTAAAAATTCATTAATCTAAGCATAGT
TTTGAATTTTTTCATATTTGTGCACAGTTAAACTAAATAACACACATAAATCTCGATCTTACTTATTCTTCAACCACTCTTAACCCATAAAGAGATATTC
ATTTCGAATTGATTGTCGTATGTTCCTTTTTTAGTCTATTTTTTAAAAAGACGATCTTTTATTCTTTTTTTAAAACTTTTTAATTTCAATTTGGAAAAAT
CTTTTTGGCAAAAAAATTTGGCCAGAATGTTATTTTACCTTTTAAAACATTTTTACCTTTTTGATTTTAATATCTTTTAATTAAAAAATGGAAAAAGAAA
TCAGTATATTTCAAAGTAAAAAAAATTATAGTTTTTTTAAATTTCTGGCCAATTTTTTTTTGGCTATTTAGTACTTCTCTTTTAATTTTTCATATGATAT
GTTTAATACCTTGAGATTAAAAAGTAAATTTGATATATCTTTAAACATAAAATTCACAAGTATTCCTTACTTTTTGAACTCTATGTCAAGTTAAAATCGG
ACAAACAAATCGAAACGAACAAGAGTAATAGAGCACGTGAAAGGTTGTTTTACTCACAATTTTGAGACGCTTTAACCCTTCAAAATCTGGTTTATTGTTG
TGGAAGACTTGTTGAACTTCTTCTCTAGCTCTAGTTTGCCAATTTTGGTGCACACTTAATAAAACCATAGTCCAAACTAATAAATTTGAAGAGGTCTCTT
GGCCAGCAAAATAAAAAAGTTTGCATTCTTCTATTACTTCATCAGTTGTCATACCAAATTTGGTCCCATTTTGTTGAATTTCATTCACATTGGACTTTAA
TAAAATCCCCAACAAATCCTCTTGAGTTTCTCCCAAATTCATGGATCTTTCTCTTTTGTTGACAATTTTCCTTAAAGTATCTTTGAGTTCATTGTCAATG
CCTTTCATTCTTCTATTTCTTCTTGTTGGTAAAAACCTGTTGAAATTATCACAATAGCTTATATAATACTGACAATCAGGTCATTTAAAATATAACTATA
TGTAATATTGAGATACTTATTATAATAGATTAATTATTGTTTTACAAGGGTTATGGTGGAGCGGTAAGTTTAACCAGAGTGCTTTGCCCCAATGAGACTT
TTCGACATAAATCCAAACTAAGTCGGGCTCCCATGTGGATATCAAACAGCGAATGGAAAAAGAAAATTTTTTAGGCTAACTAAGTCTATACACACAAGTA
TTAGATAACTCTATTCAATAGCACTTAAATAGACATGATGAAATTAAATCACCAAGCACTTTTGTTTCAACTGGGATTTAAACGCAAGACCATTAAGTCA
TACCTTAGTATATACGTACAAGAGTTTAAGCTATATACATATATCGTTTATAGATATAGAGATACTTTATACTATCAGATCACCGTTGCCTATATTTCAT
ATAATAAACAATATATCTTATTTTCGAGATTATTAATCGTAGACTTACTAGTAGATATTTTCCGAGTGACATGATAGGGTGATAGAACTGGTAATTAACA
TGCATATAATTATTATTAGTATGAAAATTATTTACACCATTAATATAATATAAACTAATTTTTTACCTCCATCCTGGAATATAAACAGATTGGAAAGCTT