BAC Sequence – LE_HBa0102N10

>C01HBa0102N10.1
TTGCTCTTACAACAAATATTGAGTGAGAAGAAAAAAAGGGCTTACCTTGATCGAGTCCTTGACTGAACCTTGTCCTCTGATGTAGACTCTGCACTCTGTA
ATGGCTTCAACCCTCTTTAGGGAATTCCCACGTGGTCCCAAAATTCGACCGACAAAATTATACTGCATGTTTTTTATTTGGTCAAGATCTGTTCCAAAAT
TTAGAAAGAAAAAGAGCAACATGAAACACCACCCTAATAACGTTCACATACATTTGGGAAATTCTCCACAGGAACATCCAGTCTTATGACTCTCTTCACA
ACAGGAGTGGTTGCAGTTCCCGGCACAACATGCCAATCCAGAGGTGAAGGTTGAAATGGTGCTATTTTCTGGAGAAGTCTATTTTCCTGTAGTAAGTAAA
AAAACATCAAGTGGTAAATCATCCAGTAGCAATGTCTGCAAGCAGTTATTCAAACTCCTTCAAGGTATTAACTATTAAGATGGACTCAGCGAATATATTA
TCAAAACCTACATACAATATCTGTAATGCGGAATAGGAGTAACAACTCCTATAATACCTGACTAAGGCTAACACCACAAAAAGTGCTAAGCTTTTTTTTT
CTTTCTATTTATGGCTTACTAGGTTATGTTTTGTGCTTTGACAAGGAAGCAACAAGTGTAAGGAAAAAAAACGGGGGTTATGTTTTCATTAAAGTAAACC
ATGTGGCAAGGATAGAATTCGGTGTTATCAAAGGCGAAAAGCGCAAAAAAGCTCCAAGGTATGGGTGCTTTAAGCGCAGATAAAGCATGGGCTTTAACAA
AAAAAGGCGCAAAGGGAGAAAAGAATAAAATATATATGTTTAGTCCAACACTAATAACTATAAACATATATGACATATATATGACCAAAGAAATTGAAAA
AAAAAATTATGATAAAGTAAAATATCAATTATTTAACCTCAAATTCTTCATTAGAGGCTCACTGGCCTTAGAACCTTGATGACGACACTAAAGAGCACAT
AAAGTGAGGCGAAGCGCTCAACACATTTTGAGACTTGCTTTAGGGCTTAAGCGCGCCTTTGATAACACTGGGATAGATTACATTTCTAGGAAGAGCAAGA
AGTCCATAAAAACATCTGAGAATTTTATTGGATGGCATATAAGGATAAAAACACAGGTCAAACAGTAAATTTGATTGCTGAAACTCCGCACAGAGTTGGC
AATATTATCCTCCACAAAGCTACTACTATCGATAATGATGCATGAAAAATCCACCTGCTGTACTTACATTTGTTTCTAACGTTTGCGAACAAGCATAGTA
TTCTACCGCTCAAGCCAAATAGATAATTGAAACAACAAATTGAGCACAATATTTCCTGAGCTTAAGAAAGTGAATCCCCCTGACGTGCATCTACATACAG
AAGCATTTTATCTAATATGCCTGTTAAGGTGGGTGGACCTAGTAGCTCGGCAAGCTCAAGAAAGATAGCTTCGGCTAGTGCAGTTTAGATTTTGCCAAGC
CAGCAAAAGACCAATGAAGCTGTGGGAATCGTTTTGTCCAAACAAGGGATGAGGTCTCAAAAGCTCCTGGTTGTGATGGCTACAATGCTTTCAAAAAGGA
AGAGGGGGGGGGGGGGGGGTATTCGAGAGGAGGTCACTGATGCAGTCTTGGGAACAGTAACACTGATTCCCAAGGCGCATAACCCAACTAAGATCACCGA
GTACAGGCCATTATCATGTTGTAATATCTTATACAAACTTATCTCAAAAATACTGACCCACAGGATGCAGAAGGTGATGGATAGATTGGTGGATGCAATT
TATCCCTGGTAGAGTGGTAGCGTAATTACTGATAACATTATTATGAGCCATGAGCTCATTAAATAGTAAGGGAGGAAAAAGATCTCACCTAGGTGTATGC
TAAAGCTTGGCATGAAGAAAGCTTATGAATCCATTGACAGGACCTCCCCACAACAGGTTCTCAAGGGTTTGAGCTTTCCCACACAGTTCCATAAGCTGGA
TTATGACCTGTGTCACACAGTTTCACAATTTACACTCATTAATGGCACCCCTTCCCGTGCCAAGAAGGGTCTAAGGCAAGGAGACCCCTTGTCCCAATTC
CTTTTTGTACTACCCATGGAATACTTGAATAGGCAACTCAAAACCTTGAAGAAGCAACCTGGTTTTAATTTTCATCCCTAGTGTGAGAAATTGTGCATTA
CTCACCTTGGGTTTGCAGATGACTTGTTGCTTTTTTGCAGGGTTGACCTTAAGTCTGTCTCTATGTGACATTTTTAATGCCTTCTCTAGTGCTTCTGGTC
TTGTGGACTGAGAAGAGAGCATTTATTTTGGAGGTGTTAATGTGGCTGACCAAGCAGCTATACTACAGCTTCTGGGATTCACAAAGGTGCTCTTCCTTTC
AAGTACCAAAGTATACTCCTCATGGCCTCACCTAAAAGAAAACCTCATTGACTCAGTAAAGCCCCTTATAGATAAGATGATAGACAAGACTAAGCCTTGG
CCTCTAGATTCCTATCATATGCTGGTAGGTTACAATTAATCAAATCTGTCTTGTTGTCTGTCCAAAACCCTTGGTCACAAGTTTTTATTCTGCCGAAGAA
AATGATCCACGTAGCAGAGTCCTTGTGTAAGGATTCCTGTGGGCTGGGGTTGCTGAGACCGCAAAAAGGCTTTGATTGCTTCGGAAAAGTTATGTATCCC
CAAAGACAGTGGGTGGTCTTGGTTTCTTAGACATGATTGTATGGAATAGAGCTACCATTTGTAAGCACTTCCTGGAATCTGTGTTTGAAAAAGGCAGGTT
ATGGATCCAATGGGTCCATACCTACTTCATTATAGGTGACACAGTACATGGCATGTGCATGATAAGCAAGCCTCATGGATGATCAAAAAGATCCTCAATG
CCAAAAGAACTCTGGAAGCAGCTGGCTATGAGGAGCAGGATGTTGTTGCTATGACTAAAATCAGCACACAAACTGCCCATTATAAGCTGAGGGGGGACAC
TACACTAGTGAAGGGGATTAAGTTAGGGTACCAAGATGGCTTTTTGGGGAACACTTTTACCTAGATATAGGTTAGCCAAATGGAGTATTCTACCTGCTAT
TTCCTGCCTTCTTTGCACCAACACTGATGAGAGCCTGGACAGTTTGTTCTTCAAGTGCCAGTACGCAGCTGCCGTTTGGGATAGGCTGCTCTCATGGCTG
GGATTCTAAGGGTATCTCTGGAGTGGCATGAAGAAGTGACGTGGGCTTTAGACATGCTAGTGGCAAGTCAGTGCAAGCTATCCTATACAGATCAGGATTT
AGCATGCCGTCTATAATTGGTGCTGCAGGAGAGAAACATGGCGTCATTTCCCCAGAAGAGAAGAAGACGTGATGTGTAAGTGAGGATGGCTGTTCAAGCA
ATCCTTTCCAGGGGCTCTCTATTCCTTAGGTTGAATAGTAGGCTGGCTTACTCAACAATTATCCATAGGCTATGTTAGATAGGTAATGCAGATCTCTTGA
TGTATTTTGATTATTTTTCCATCAGAGCTTGGGGCTTGTTGTCTAACACTGTAAGACTTCTGTACTACTTTGCTACTTAGATAGTTTGAGAATCAGGAAA
AATCAATTAACTGAAATCAACAATGTTATACTAATGACTCTAGCATACTCATTACGTGATAAGAACAAGTCTGGAAGAGTATGACCACATTACGCACAAC
GGTCGTGCCATAATTACATTCCAAAGTATGACCCATAACAGCCATACATACCTAAGGTAACCTCCATTAAGTATAGAAGCTTATCATACCTCAGTTTGCA
TTGCACTCCATGCCCCCTTATTTATCTGACCTCCATTCATATGTTGACTGACTGATCTATGTGGACTCTCTTGTCCCATCCTCTCCTGATCCACGAACTG
ATTTGACAACAAAGCTGTTGTTCGCATGATTTCTGCAGAAGTAAGAAATCCAAAACCTTATTCAGTCACTTAATTGGATGCTTCCCTCAATTTACCTTTC
ACAAGATTTCAGCGAAGATCGTCAGTAGTGGATTTACCAAGATATCCATAGACATCATTTTAGCTTCATTTTTAACCAAATTCACCTTCATCCCTTTTGA
ACATATAGTAATACCATATTTGAAGTTTGAAAAATAGCATGCATAGAGAACACAAATGAATCATTTTCCTTAGAACTACTGTCCCAATCCCTAGCTTCAT
CCACTGTCAAACACACAACTTAGAGAGCAAAATATTAAGCTACAGGGTCAAACTCAACATCAAACTTTGTATTGATGCAAAAAGTCCATTATTCCAGGAC
TATATAATGATGCTGAAGAAAAGTGGAAGAAAGTGGAAATCAGACACTTGTCCAGGTCAGGCTTTCAATCAAATTCTATGATTTGTAGATTTGAATTTAC
ACTTATTAATGTTGCATCCAGGAAAGCTACTTAGAGACTTCTGTTTGGCAACTTAGCATTTGGTAAATAATTCTTTCCTATTCCACTTACTGATTCTTTA
GTTAATTAGATATTAGTGTTCACATCTTAGTTTAGATTTTAGAATCCTCCCGATGTCAGAAGTCAACCAAAAAAAGTTGCCCTTTAAACCTCTAGACAAT
AGGAAAAAAGAAAAGTAGCAAAAAATTGACGGATTCTTTGAATCCAATATATTTGGACACTCTCCTTGGTTAAGCTTTTCTAGCTAATTTAGTGCATGAT
ATTAATAAATATTTAACTTAAAGCAGTGTACCTGGAGATTACAAAGGACTCCCAGAACAATATATTCTTTATTTATGTCTCAATCTTCTTCCTCTTTGTA
AAGCATTATTTGTAGCACCAATAAATCAAGCTTATTAGTTTTGTTTCAATACAAATCAAAAACCCCAAATTAATACAAATCAGTCCTTGGTTTTTTTTTC
CCTCTTGATAAGTAAATCATTCCTAGCCTATTAAGATTCCACCCCCATGGCCCAATCATAGGCTTACAAAACCTCCAACTTGCACTTTATCGCCTTCATT
TTATCACTAAAGAATCATGACGCTAAAAATTTTCCATTAATGACTGATTTCTGGCTATGATGCAGTCAGAATGATTGGACATCCAATAAGGCATCATGTG
CAACAGGGTAAGATAACGGACATCCAGCAAAAAGAAAGCTCAAGTGATTTGCCTTTAACTTGAGGAGAAAACTCATGTATTTAGACCACAAAATAAATCC
GTGGGTCAGTCTTACGTTTGCTGATATTTAAACATTTTAAAGAAAACACATCAGAGTAGTTGCATAAGACAGTCTGATCAAGACAATGAAAGATCCTAAA
CTTAACAAAATAACATCTACCAGTGTTGTGAAAAGCGAGCTTAAAGTGCGCTTCAAAGCGAGGCGGCCCTTGTGCGCTTTTTTATCTTGAGGCGAGGCGA
TCTGAAAAAAGCTCTCGCTTCAGATGAAGAAGCGAGAAGCGACCCTAAGGCAAAAGCGCAATAAAGCGTGCTTTTTATAAAAAAAAAAAAAAAAGCGACA
ATTAGGGTTTTAAAAAAAATAGGTTTTTTTTTTAAAAAAATAATCTGAAATATAACCTTCTCTCTCCTCACGACTCTTCTTTCACGACTCTTTCCCTTCT
TTCTCTCCTCGCGGCTCTTCTTTCACAATACTTCTTTCCCTTCTTTCTCTCCTGACGATCTCGACTGAGGCTGCCTCTCTCTTCAACCTCTCTTCTTTCA
CAATACTTCTTTCCCTTCTTTCTCTCCTGACGATCTCGACTGAGGCTGCCTCTCTCTTCAACCTCGACCGCGACTGCAGGTAACTTTTTGTTCATCTCTT
TTTTAGCTAATGTTTATTAGTTCATCTCTATGAGTTTCTTATCTCCTAAAATATACAATCTTCGCCTGTGCTTCATCTCTTCATCTCTCTGAGTTTCGAC
TACTCTAGTTTTTTCTTCTTCTCTTCTTTTCTTCATCTCTGTTGCCTGCTCTGTTTCTAATTACTAACTGCTGCCTCTTTTGTGTTTTTTTTTCAATTCT
TTTGTTGTTGTTTTTAATTTTGTGATTAGTCTAGCAGCCTTGTTGAAGAATAGGAGTTTGAATCTTTGTGATTTAGTTATGTTTTTGATTTTTTTGCTTT
ATATGTTATGACTTATGAGTATTTTTGCCTATGTAATTTCTTTCAATCTAAGACTATATTACCTTTATTTAGTTATTTAATATTTTTTTATTTTCATACT
AAATGTTGCTTTTTTTAAAAAAAGTGCGCGTTTCGCTTCACGCTTCTCACTTCTGTGAAGCAAGCCCTCGTCGCTTTTTTCCGCTTCTCGCTTCCCAAAA
CACTGACATCTATTAATAATTCTACCATTAAGGTCAACAATTTAGGCATATCAGGAGAACTTTCTTCGCCATTTATTTTGTAATTATTGGTTGTTGACCA
AAAAAAACCATTGCAGAAACAACAAATGTTTCCATCTTTTTCATCAAATTATTCAACTCCAAAGTACTTGAATTATTTGTTCTTTACATTTGGGAGATCA
AAAAGCACGAAAGAATGCAATCTATGTCGTTATATTATTAAACCTTAATATGCTTCGAAAGCAAATCCTTCTACACGTGGGCTGTCAAGCACGTGTGTAC
AAAAAAGGAACATTGAATATGATGTGTAGCAGCCGAACATGCAATTGATGGAAGTTAAACTTATATCTATGTGAGGCTGAAGAAAGGTATAAAGAGACTC
TTACTTGAACTTTTTGGGGTTATATATATTTCTTCTTCATGCTGGTTGGTCGGGATGTGGTGTTACGGAAAAAAGAAATAATAACTCTTAAGACCCTCTA
CTCACTTGGAATCTTGTGTAGCAACACGTCAAATTTTCCAAGAGTGTTCTGACTATGAGAGCAAGCTTTGGCGCAACGGTATTCTCCTCCCGTAACTTGT
AGATATATGTTCAAAGGTGGAAACTATCTCTTTGCAGAAACGCTATGGGAATATTGCGAACAGTATATGCCCAATCGCCCACTCACCTGCACCAGCCAGA
AGCACTTCGTACACAGGATAAGCCCAAGCCCGCCCACGACTGGTGTTTGAACTATGCAATCATTTACATCTTTTATTTTAAATTAACCAATCAGGCTATC
GTCATCAAACAATTAAACAGTTTGTTGGGATAAAACATTTAAAAAGCTTTCAACAGAAGAAAGAATCTTCTGCTCCAACATAGAGATACCCAGAACTATT
ATAAAAAGTTCTCATGGTTACAATTTACTACCTTGGTTTAGAAGTCTATTGCATATAGGAAGTATCTGCATGAATGGCCCCAATTTTTGCCTCTCCCCCA
ATAACTCTGCCAAATATCTGTCATTTCGCAACCAGCCAAATCACATATTAATAAGGAGAGATGTATCTAGAGTTGACAAAGAAAGTAATGGTAATAGGGT
ATACTCTATTTCAGTTATTTATAAAAATTGACCGCTTGAACTAGAGTCCAATGTAGATGCTAATCAGGCAGCAAATATGGACTTAACTCGTGGTTAAACA
TAGAACAGTCTTATGACAAACATTATTGACCTTGTACATGAGGTTACTGAGAAAATCGGCTAAACACCGAGAAATTTTCCTTGGTAAACGAGAACTTGAA
TAAACTTAAATCAAATAAAGAGTAGTTATAATCAGAATATCCTATTCAATTGAGAAAACTCAACTACTCAACCCGATTTTCATGACACAACCAAGAAAAC
CTTGATTCAACAGCAAAAGGAACCTGAGTCAAGTGATCAACCAAGCCTAGAGTCTAATAGAGTATAGGGAAAGTGGCACAGTAATATATTTGGATCCACC
TGGTTAAGCCCTGATGCGTGTTGAAGATAGTAGATGCAGGCACAACCACTGCTTTCGTCTTTAAGTAAATTACAACTATATATTCACATAAAATTTGAAC
CAATTATTAAAATAATTGTGGGTGCCTTGAAATCTTGGATCTTGTACCACAGAAAAGGATCCTAAAGTGTCACCACATGTAAGAACAACTTAGAAACCAA
TATCCAACAATCATATAGACGATATTATCAAGGTTTTATTGACTCAAGATGCCTATAGAGACAATTAACAGAAGAAGACAACCAAGAAACCACAAAACCC
AACAAAACAGATCCAGACCCAACATTCCAAGAAAGCAGTAACTAACGAAAGCTGATTGAAAACAATAATATAATTACTCAAACAAGAATCAAGATTTAAC
CTTTCACGATCTGTAAGAGAAGATGACCTATGAAGTGGACCATGGATTCCAGTTGGAGAGTACTGGAAGTAACTCCCAGGGGGTATTCTATTCTCCAAAT
TCATCTAAGAAACCAATTCTACAATAAAATCTTTAGTCAAGAAACAAACTTTTGATAATGTCTGCGATACATACATACAAAGATACAAAAGGGGGTCTTA
CTGTGAACAGCTGTTGATTGCAAGGCAAAAAGGGGAAGGTGGGGAAGAGAGACTTCAGTCTGCTTCCCCCCTTATTGGACCTTGAGTTGTTGTTGTGGGG
GGAAGAAAGGGACTGCTCAGTGGGAAAACTCCCTATAAATACTAATGGCTGCTACTCACAAAAGGGTGTGCCAATGGAGTAAGACCTTTTTTCACCATCA
CATATATTTGTTCTTTTTATCTATACATAAAAAATTTATAATATCCAATTAATAGTAAGCATTTAATTAATGATACATTTAAATTAATTTGAAACTAATG
AACTTGACCGAAATGTTTAACTACAGCACATTCCTAGGATTTCCTATTGTATAGAATAAATGTATTGGGCAATGCCTTTCTTTTCTTGAATTCCAAAATT
CTCCGCCTTTTCTCAGCTTGAGGGTCAGCTTCTACTTACTTCCTTCTAGAAGCGAAGGTTGGCAAGGAAGACCCATTGATGTTTTATTCTATGCCATGCC
GCAAATTCAGTATACCAATGTTAGCGAATCAGATTCTTCGAAAGAAGAGTCTGTAGGGGCAGCAAATCTAGTTTCCAAATAAGTAAGAATCTAAACTGCG
TAATCAAAGCGACTCCTTGTTGGTGGTTGATAGGTGTTCCTTCCAAAGCGAAATAATCACTCCTGTAACTTATTGCGCTCGATCTACATCCTATCTAACT
CGATTAAGCTTTTCTTCTTACACACAGAAGGTTTTTGCTCTCGTATTGCGGGTTTTTCACTTCGTATTCTTTTATCTAAGCTTCTTCCCTGTGCATTAGC
TCCCCCCATTGTAGATGGTTCAGCTACGCTCGGTGCCACGAAATGATTGAGAACTACGACTGGGTCGAAATGCATTTTCTTCTTTGTATTCAATAAGTAT
TGCATGACCGAATAATTCTATCTCTTGAAATCCATCTTTCTTTGAGCTAATTACACTAGAAAATTATTCGTTAAAAAATTGCAATAGAAAAAAATTAGCG
ATATAAATTTTTTAACCTATTGAAACTCTCTAGAGGATTGCACCCATACATAGTTTTCCTCCATTCACATAGTGTCTCTATCTAAATTAGAAAAAGGACT
TTTTTTTATTAGTTCGAGAAAAGTATCATTGATTTGGTCATTGTGCAAAAATATATATATTTTTTAATTGAATTGAACCAATATTTTTGAAATTTAGTTT
GATGCCGTGCGGAAATCTCCACCGATCGTTATCGAAGTCATTAAGTTTTGTTTCCCTTTATCCTTCACTGATTAAGTAAAAATTTGTTATTGACATTTTA
TAGCAACTTGATCGAATCTGTGAAGTTTTCTTTTCTAATATTCGATCCAAAGCTGATAATATCTCACTATAGCGAGACATTTCCATTGGAAAGGATAGAG
AACTGCTACTTTCTGATGATTGAAGAGTCCCAAGACTCTGAGAAATAACGAGTAACGAATAATTTAAAGAGCTTTATAATAAATTATACTAATAGCAAGA
ATTCAATTCTTTAATTGAAAATAATTTTATCAAATACGTATAAATATTTCTTTGATTATATATTATGTATAAAGAAAATTCCCACAAATAGAAAAACTTC
TGTGCACCAGGGTATTAAATGAATTAGTATTTTTTTGGTATAAAAAAAGGACACGTGTAACAGATTTTTAACTAAAATACGTTATTTCTTATTTTCCTTT
TCACTGTTTAAACCAAAAAAAAAAAACTTTTTGTGGATCTTAAGTTGTCTATTTTTTTATTCTTTTCTAACAAGTTTTGTGACAAAAAAACACATAATTA
GAAGAAGAAAAACAATAAATCGAATTTATTCCCACCTTAATCCCTTTATGTCATTTTCTTCTTTGCTGTCGAGTATCACTTACAATGATGTTCTTTTTGA
ATTTAGAATAAATGATAAATATATTTATAGTAATTTAAAAAAAATTGTTAAAAAAAAGGAAAAATTATAAGGCTATGTAAATTTATACTATTTAATTACT
CATTATAGCTATAGTTTGCTATAATTACCACTCGCGACTAACATTATACATTAATTACGTGGGTTGACTTCGAGTTTGTATAATTAGTTATGTTTGTAAT
GTATAATTCGTCAGGATATACAATTAAATATGTATAATATACAATTTTTTAACCTATATACATATACAATTCACCTCTCTTCCCTCTCCTGCTCGACTCT
CTCCTCTCTCTCTCAATCTTGCTCGCCTCTCTCCTCCCTCTCCCAATCTCGCTTGCCATTTATACAAATGTATATGTATAATATACAGCTATATACAATT
ATATATATACAATTCACCTCTCTCCCATTCTCTGCCCTCTCTCGCTCGCCTCTCTCCCCCCTCTCTCGATATCGCTCGCCTCTCTCCCCCTCTCCCATTG
TCGCTCGCCTCTCTCCTCCCTCTCCTAATCTCTCTTTCTATATGTACAAATACATATGTATAATATACAATTATCTAACCAATCTGTATATAAAATTCAC
CTTTTTCCCACTTTTTTTCCCTCTCTGTCGCCTCTCTCCCCCAGTCTCACTATGTGAAAGTTTTCCAAAAAAATAAGTATTGACAAATCGGTAAAAACAT
CTTTAAATGGAAGCAAAAGCATTTTCTGTTGTCGAAAAGAAACTAAAAGTTTTTTTTTTCTTAAAATTAAGATATTCTTTTTCATATGTACATATTTATC
AATATATTCTTCTTAATTAATTAGCATATTTCATAAGTTTTGTTGAATTTCATTTAAAAATTTATTTATTTTTATATATTATTTTACGTATTATTTTGTA
GAACTAAAAAAAAGATAACAACAACATTTTACAAGATTAGAAAAAAAACCACCCATGTAAAATTTAATTTTTAAAAAATATTAATTTTTTTATAATATTA
GTGCATTTTAGTTGTCTTTTTTTTTATAATTTGACTGTTAAAAATATTTTTAAAAAAAATTAATCAAACACAAATACAAATTTCAAATAAATTAGTCAAA
CACAAATTATCTTTTTTTTTTTAAGAAACTTTTCTAAAAAAAAAAGTTATTTTAAAATAGTTTGGTTTGATTTGTTTGCATTTACGTATTGACTGAATGG
ACACATGTTTCTAATCTTACCCAATTTAAATTTTTTTATTCTTCTAACAATTAACCTTTTTTTTTTCTTCTTCTTCTTAATATCATTGAAATATCTTTTA
TACATCCATTAAAAGTGTATTTTATTTATAGCTATCAAAAAGAATTTTGTAATAGAAATCATGCAACAAAAAATAAAACAAAAAAGCAATTATATATATA
TTTTTGTAAGAACAACTTTTTTTTAAAAAAAATTCACCGTATGACTCGACCCAAATAGATGACCCATGACTCCTACATAAAAAGTAAATTTATGCACTTC
AAAAGAAACAAGAAAAATCTATGTGCAGTATATCTTAAAATTGTATTTATATAATAAGAAAAAATAATGTATAATATTGTTGATGTGTTGAATCATATTC
GTTAATGTGTTCAGTAATTTTAAATATGATAATTATGTCTGTTTGACAAAATCTTTTTATTAAGTCTCCAATAATTAAAATTTTCTTTTGATAATACAAA
ATTGTATTGGTTATACAACAATTCAGCTAAATGAACTATATTCATAAAAATATTATAAAAGCTCCAAATAACTTGAATTATTTATGAGAAAGTAAGAAAT
TTGAGTTAATTGCACATATATGTCCATACTTATAAGACGCATGTATGTCTTATTTGTAGTTAAAATTCATCAATTTTTTTTATTTTTTTATAATTTATTT
TTTGATATTTTTCTACCATTAACATGAACCATCGTCACATATAAAAGTAAATAATAATAAAAATACCCTCATCATAATGTTTATTTTTTTTTCATTATTG
CATTTACACTTTATTTTATATTTATAAGAAATGTCAATATATCAAATTTATTTATACACACACAATTAAAAATGACTATTGCTTATATATTTATTATACA
TATTTAAAATTGCATGTCAACTAACATGAATAATTGTTGAACTTGATAAAGAACATACAAATAATTCACTTGTACATAATGGCAAAATTATTATTATTTT
TACCAATGCTTAATTAATAAGGTTGAATTGGCTTTTTTGAATTAATATAAAGTTCATGAGTAAGACGATTATTTTTTTTTACTTTAGGCATTTTTGGTCT
ATTTTTAATTTATTGATTTTAATTATTTTTTTATTATCAACCAATATTGTATTGATATATATATATATTATTAATTATATATTTAGATATAATATTTACT
ATAGAATAATTTTATTCAGTTTCAGTAAATCATATGTTTGTTTACTTAATATGGAAGATTATATAGTATATATAGTTTTAGGTTATGCGTAAAGGATTAA
ATCATCCGTTCTTCCTAGTACAATTTTTTTTTGTTCACAATCTTGAAGAAAATTGGAAATGTCATCAAGATAATTGAAGCACAAGATTATATATAACTTA
TCTTGATTATGAGAATAATATAGTTCCAACTCTATGTGTTTGTGTATTTTGTATGTGAACGAGACCTAGTAGATATAGTTACTTTAGATCGAGTAACAAA
AACACATTTTATAAACTGTTAAACATACGTATATTCTTAATCCTATTATAACTATTATGATATATATATATAAATTATCATTTTTAATTTATTCAAATAT
GAGATTCTGAAATAGGTCTATATATTTTATATATTTTGATAGATTGGATGATAATATATATATATATATTATATTTCGATTCTCAAACGACGGAGAGGAG
GAGGAGTCGAAGAAAAAGAAAAAAAAAAAGGCTTTTGACAGCACTGCGTCGAGTATCCGTATTCGTATCTCTATATAAGTAAATTCCCCTTTCGTCACTC
TCTCTATAATTCGTTCTTCTCTCTCTGGTTTTCTCATGCATGAACATTCGCAATGAAATTGGAAAAATTAGGGCAAAACAATTGTGAATTTCGTCAATCG
ATGTTGTGGAAGCTCTAAGGGGAGATGTGAATTTGTGATTTCTAATTTTCTTTATTTTCTTTTTCTTGGTGTAAAAGATCAAAGGAAAAAGTATTCGCAT
GAAGGGGCCGTTAGATCGATCAAAAGTAGTGCTGCGGCACTTGCCGCCGACAATTTCTCAGTCCATGCTTCTTGACCAAGTTGATTCCCGATTCGCTGGT
CGATACAACTGGTTCTGTTTTCTACCCGGCAAGTCCAGGTTAGGGTTTTGAGTTCTTGGTTTTCAAACTAATTTTGGCGTTTTTTTTAAATACAAATTTT
ACTTACTGGGACTGATTGATTGTGTAGTTAATTATAACCGATTATGGAAAAAGAAAGAAAGAAATCAAAGATTATATCTGGATTCTTGATTTCCGAGTTC
TTGATTTTTCATGAAAATTTTGTGTGTTTAGGTAATATGGTTCCTGGCTCCTGATTAAGATTGTATAGGCAATAATAACCCCATCCAACAAAGGATATAA
AGAAAGAAAGAAAGTAAAGAAAATCAAAGATTCTATCAGGAGTCTTAACTTCATGTTGATTTTGATAGGTTGTGAACTTCCGAATTTTTTTTGAAGATTT
TTATTTCTTGAATGGATAGAATTGGATATTATTGAAAAAACACAGCACCAACCAAATATTTATTTACACCAAGATGCAAGAAATCATGTTATGTAGGCAA
GCTTTGTAAGTATTTCTTTATATTGTATGTGTTCGTTTAGGTTTCAGATTGTCAGTAGTGTCACTGATTGATTGTTATTTGTTGTTGATTGGAGAGACAG
GTATGTTTTTGGTAGATTTGGTTGCACAAATACCAGATATCCTGTTAAAAAGTGGTCACGCTTAAGGAGTTGAAATACCCCTTAAAGAAAAGAAAGCAGC
GCTGCAATAAATATTCCCTCCCTTTTGTTTGCATGTAAAGGGCATGGTTGCAAATGAGATCGTTGTTGGTGTAGTTGTCTGTATTGTGCTATCATTCTTT
CGTAGCTTGTTTTCCTTGGTGAGAGACTGGGGTCTTCTGGATTTTTTATATTTTTTTCTTTTCTGGGTCTTCTGGATTGATTCACCTGTACCTATGATTT
TATCCTTATTTTCCCTTCTTTAATGTCTCTCATTATTTGGAGATCTCTTTTGGATGGTAAAACTTTTTGCATAATTAGTACAAATACGAATTGAGCAGTT
TATTCAGATAAGGTGATAGCGTTTATTTCCTTAACTTGTATAGGTATTTTTGTTAGAGCAATGACCGGGTGTGCTGCATATTGAAGAAAACTGTGAACTA
GATTGCCACCTGTATGAGAGTGTTTGCCAGTGATAGCTCTGAATCTAATTTAAAGCATTGTAGTTTGTCCAGTCTGTTCTTTTCTTATTTTGTTTTATCC
GGATATGCGTTGATACAGGTTATCTGGAAATTAATTCATCAAATTTATCGTCTTTTCTAGAAAACTTACCGGAATTTACGTTTTTGTCCTAGCTCACCTC
ATTTACCGTAGTCCTTGCTAGTTGGAGATTTTTTGTTGGATGGTCTATCTATTTTCAGAATCTATACGGAGTTGAATTATTTTGCAAATTAGGGAGATTA
TCTTTACTGCCTTTACTTGTTAGACTTTAGTCAGAAATACTAACTGCTGTGGTGCTGTTTGGAAGAAAATGCTGACTAGATTGCCACCGTAAGAGGGGTT
CACACTTTTGGAAAGCAGATTTTGAAGTCACTTATCTGTGTTTTTTCCTTTCCATCTCTTTTTCTTCTGGAACGGTATGCCTTCCTCAAATTTGCTTGAA
ATGGGGGGTGGAATGTTTATCAATGAAGGATGATCTCACCTCTATTGTTTTGATTACAAATTAAAATTGATGAGGTGCTGTTGTGAAGAGAATGTTGAAC
TAGATTATACTGCCACTTGGGCAAATGGGTTGCCAAAAACTGCTTTTGGTGTAATGTAACATCCTTTTGTGTGAGTATTTTAGTTCTTATCTTTGTCAAG
TTTGGTCCAAAAGACCCTTTATTAGTCTATTTATCCCCCCCCCTCCCCACCCAAATACACACACAAAAATAAAATTTTAAAAAGACACCTTTTTTTTGCT
TTCTTATATCCAGGTGATCTTTTGGATTGCTATAATCCTATAACTTCTTATCCACATCGATGCATGCTTAGACATCATAGAAAACATTGTCAGGGGATAC
TTTATCTCCATTTGTTGGTACTTCCTATTTACATTTACTCACGCGTGTTTAACTGTGTACACAGTACACACCTTTTTTTAAGAATGATAGTACGTATATT
ATTATGTAGATGCTTATCCTAGTTTTCCATTCACTGAAGTTTCAGTTGGATCAATGTCCTTGATGGATTTTATTTTATCCTTATGCCCATTGTAATTTTT
CTTTATTATTTACTCTGTTGGTAAGATTATTTAACTGTGTTCCATTCTAAAATTTTTATTTTCCCAGCTCTTTACACAACATGAACTTAATATGCTTTAG
GTTGCCAAAAGTGTACTTTGTTTTTCAAGTTTAGTGTCCCTCATAGTTTCCTTTACCTCAATTTTTCTCCTGCAGTCAGAAGCATCAAACTTATTCAAGA
GCCTATATTGAATTTAAGAGGCCAGAAGATGTTATCGAGTTTGCGGAGTTCTTTGATGGACACGTTTTTGTAAACGAGAAAGGTAAAGAAATTTGGCCTA
AATCTGTATTCTCCCTTCCATATGATGTTTAAAATTGTTTTAAATCCACCCGGACATCTTGCTACAGGCTTAAAGTTCTTATCCTGTTAATTGTAACAAG
AAAAGTTTGAGCCCTTGCTTTATCTGGGTCCTGACAGTTCTCAGTTTTGCAATTATATTGATATGTTTCTTACCCTAGTGTATGTCTGTACTAGGCACTC
AGTTCAAAACTATTGTTGAGTATGCTCCTTCACAGCGTGTTCCACAACACTGGTCCAAGAAGGATGGCCGTGAAGGAACCATCTTGAAAGGTACTAAATC
AATGCGCTGATTGCATCTGACCTACTGCTATCTTTTCTAGTCCTCACTCATGGTTAAGTTGATGCCCTTGTAGATCCTGAATATCTGGAGTTCCTTGAAT
TTATCTCAAAACCTATTGAGAATCTTCCGAGTGCAGAAATACAGTTGGAAAGAAAGGAAGCTGAACGCGCGGGTTAGTTTGAATTTTTATCGAATGCATA
CGCTATCCTCCTGCATCAAACTGAGACTTAATCTATTAATGAGAGATGCAGGATAGCAAACTATGAAGGTGGATTGCATGTTCTCTGGACTTAAGTTTGA
CTGCTTCTTTGGTTTTTAGGTTCTGCAAAGGATGCTCCTATAGTTACTCCTTTGATGGATTACATACGTCAGAAAAGAGCCGCCAAGAGTGGAGCTCGGG
TAGGTGATTTCGTTTTATGATACTTTAACTTGTTCGATTTTCAATTGAGGTTTCTTTCTCTCTCGTACCCCTTCCCTCCCTCTTAGTACATTCACCTCCC
CCCCCCCCCCGCACACACACCACCACCACCACCCAAAAAAAAAATAGTTCCAGGATTTTTACGAGCAGACTGAATCTGTTGGCAATGAGCTTTTCCATTA
ACCATCTTTTACATTGGCCACACTTCTCAGGATTATAGTATACTCTCAGTTTTGTGTTTAACAAAAATGATGTATTTCTCATGATTTGGAGCATCTTTCT
CCAAGTTTAAAAGATTAGTACTAAGTTTTATCCCTGGTCATTGACAGAAATCTATAGCTAATGGAAGACCAACCAGAAGAGCGAGTGGCACATCCGCAGG
AAGTCCTAGCTCAAGTGCGTCTAAACGAAGCTCTGAAAAGAGACGGGCTTCCACTACCATGGTAAGGGTGTCATGTTACAATCCAACGTTTGTACAATTG
GTACTCCTGGTTATAGATCTATTTATTTATCTATCTATAGTTGAGACTCTCTTTCGAAAGTGAGATACCGTTCATGCAATCATTCTGTGTTTGATCTTCT
CTCGGTCACATCATCTGTGATCTATGTGCTTGTGAAAACAGTAATATCCTGATTTGACTTCTGTATCAGCTTTTCACTGTTGATTTTCCTTACCTCTGAT
AATTGGTTGGAGATATTCTTTTGATTGAATTATTCTTGGTATAGTATTAATATATATGTATGCATGTCTGTTTTTATATTTTTAACTACGATCTGGACAG
TAACTTTTACTCTGGGGATATTTCTTTTGATGGATGTGGTTAGTGTCACTTCTCTTTTCTAGTCGCTTATGGAACTGTCTGATCGTGTACAGTATGTTCT
TCGAGATAGTTCTAAGGCTGGGAGTGGCAAAGACAAAACATATATTCTAGCTCCAAAACGTGATGATCAGCAGCGTGCTGAGAAGTCTGGTACCTCTGCT
CCTGGATCTGTGGCTAATGCAGTTGAAGAGGAAACTGGTATGCCTACACTTAAGTTGTCAGTTGTAATCACATGTTTGCATGCTTGTGTGTCTATTATCA
TCCCATGAGGGCAAGCCTTGGAGTAACAGAGAAGCGCTTGCGTTTCTACTGGCGACCGGGTTTCTAATTTTGGAGCCAACCTTTCCAATGGGTAGGTAAG
GCTGTCTACGTTTCCCTTCCACCGAACCTTCATGGAGAGCCTTCTGGCACTCTAGGGTCTTCCATTTTTCTTACATGTTCTTCTTTAAGCAAGAAACAAT
CATAAATCGTAATCATATTGACATGGTTTTGGACTTTTTTGAGAATGACAAAGTAAAAATATATTAATTGTACCTCTACAGTGCGAGCACTAGATTTACA
TAATAGTACAAGAACTAAAAATTTGCATCATAGCATCTTCTTAATTGACAATAACATTACACCAAAAAAGACAGCAGCTCTAAACATGTGGTTATAAGCT
ATGTGTAGGCCCTTGCAATTTCAAAATTTCAACAGCTCTGTTCCTTTCTCTCAATACATACTGTGTGTGACTTTCAAATACTTTGGATATTCACGACTTT
TCTCCCGTTCCAGCTTTGTATTGTCAATCTCAGTTTCTTTGGTATCATCACTTGATGGGCATCAAAAGATTTATGAACATACTTCAAATCTTAGTTGCTA
TAGGGTGATGAAGGAGAGGATTGGGGTTTGTCAGATCCTTTCGTAATACAATACTGACCTAATGTCATTCCTCTTTTGATCAAGTTATATTGGCTACGGT
GATGCAAAAGGAAAATATTGGGGTTTGTCATCTCCCTTCACAATAAAACACCTGCCTTGTTATTCCGCTTTTGATCAAGTTATATTAACATTATTTTACC
TTATCTAAAAGAATCCAAGTTATATTGAATTGACAAATTTTTCATACAAGGCAATCCAATCACACATGCAACTTTACATAGGCCTTTCGTTTTCCATAAC
ATTACCAGGGCCTGCTAACAGTTCAAACAGCAAGCTGTAACTTTCTTGACACTTACACCAGTTAGCAATACTTGTTCCTTTTTATTCATTCATTCTGGGG
GGGGAGGGGAGTATAGTCTGGTGGGAGTATCATCGGTCACATAACCTTTCTTGTAAGTTGTAACAAAAATTCTGTTGAATGCCTTTTGACCAGAGCAAAC
TCTAAAGAGTTTGTTACTGTTGTTTATAAAATGTGTTACAAGTCCCCCCCAAAAAAGTGGATGGAAGTTATTAAGGCCAGGTAGATTCTCTTTGTAATGG
TGCATTTTCAGTTACTTAATGTGGACTTCTACCTTCGCTTTTGTTAGGCAATAAATGATGGGGGGTTTCAACAGCACTCTCATGTTGGCTGCATATGTTT
TGACCTATCACACAAATAAAAAAGAAAAAAAGGTTCATTCATGTGTTCTTGAAGATACAACATTCCTTAATCCTGAGCAGACTAAGAAGTGCTTTTATTA
GGTAGAACTTGGTCCAAGATAAAATCATGCTAGATGATACTTTTATTAGGTAGAACTTGGTCCAAGATAAAATTATGCTAGATGATACTTTTATTCTTTA
TTAAGGAAATTGAGCGATATGTTTAGGATGGTTCAAATGGAAAAGAAAATCTTAATTTGTTGAAGGCTGGAATGAATTTACCGTGTTTTCGCGGTGTATT
TAAACATTGGAGCTTGTTATATTAAAATCTGATGATATTCTTGAAATTCATCTGCAGATGGTACTTTTGTAACAAAAAAGAAATAAAGAATTCCATTCTA
GAGGGATGACTAGTGTAAATGAGACAATGATCTTCTGTCCACTTGACATGTCTCACAGAATTTAGATTGAAAGTAAGGAAGCTTTTTTGCTGGTCTATGT
TTTGATGAGTAAAAGAGAATATCAACTCCATTAATGTGGTGAGAGAAAGTGGTTTTAGGGAAACTGGAAAGAACCCAAGAAGGCTGCTCTAGGAAACAAC
GAGAGGAAAATGGAAGGTCGGTAGGTGATAAGGGGGTGAGAGTTCTTAATCTACATCTTTCTGCTGCATTTTTTGGGTTAGGTAATAAGTAGATAGACAC
TTGAAAGTTGGCACTTACTGTCAAATAGACACCTTAACTATGTCAGTGTTTAGGTGCACCCCTATTCTTGGCAAAATTATCTCGTAATCTCACACTGACA
TGACAAAATGCATGTTTATGTTCAAATTTGAGCGTCTGAAAGTCCTTCAAAATCTATTTTATAAAAGATTGTATGGGCCCCACATTTTCACCCTTCGCAC
GCTCTTCCAGTTTTCCATTAACTATATGAGGCAAAGAACAAATATTTGCATAAAACTGAAAAGAACATTTGAAATCCATACATCGTTCTCTCTCCATAAA
GCATAACATGAACTATTGATACCTAGTGCCAGTAACTAGTAAGTAATTTTGTTTAGCCAACAGTTAGAAATTAGACTTCTACCTGCCACTTCCTGGACTT
TTCTCCTTTCTCATTATGAAGTCACAAGGTACTACTGTTACATATCTTTTGTCCGTTGCAACCTTTTGGGTTTATGATGGGGGCTCTATCAGTAATTTCC
ATCAATGTATGGTAACAACTAACAAGTGAGACAACAAAGTAAATTGAGGCAATCTCCTTATAAAAATGAAATAAAATGAGGCGCAATGTCTAAATGAGAG
TGAAGTCCGTACTCCGTTGCAAGGAAAGCAGGCAGATTGACTTGGTGGCTTCAAAATGGGACTATGGCCTCAAAGTTGTCATCTGCCAGAAAGAAAGTTG
GTTGCTGACAGTATGATAACATATTTTCTCATAGTAGAGCTCAAAAATCTCAATCTGAACTTCCACAAAGTCTTGCTGTCAGATCTTCTGATGACCCTCA
AATGGTGAATGCCTCGAAGTTAGACTTAACAATGGTACTATTTTGAGTTTGTTTGTTATGAAAAATGAACTAACGTGGAAGATGGCACAAGAGGAAAGGG
GTCCTGGGAGGTGGTCGGATTCCAAGTGTTCTGAAGGTGTATTTATTGTTTACTAATATGGAAGGAAAGCAGGCAGATTGACTTGGTGGCTTCAAAATGG
GACTATGGCCTCAAAGTTGTCATCTGCCAGAAAGAAAGTTGGTTGCTGACAGTATGATAACATATTTTCTCATAGTAGAGCTCAAAAATCTCAATCTGAA
CTTCCACAAAGTCTTGCTGTCAGATCTTCTGATGACCCTCAAATGGTGAATGCCTCGAAGTTAGACTTAACAATGGTACTATTTTGAGTTTGTTTGTTAT
GAAAAATGAACTAACGTGGAAGATGGCACAAGAGGAAAGGGGTCCTGGGAGGTGGTCGGATTCCAAGTGTTCTGAAGGTGTATTTATTGTTTACTAATAT
GGAAAGGCTTAAATTTTTAAAAATAAAATGGGGGTGAGGGCTGATCCTAACCATTTTTCTTTCTAATGAGGTGACTTTTACTTAATGACCCTGTCAATTT
TTCATATGTCATTTGATGTGTCATTGGCGATTGTATTTCTCACATGAAAGATCTAATGGATTAATGGGTTTCCGAGACACTTTTTCCAAGAAAAGGTGTC
TATTTGGTCATTTGCAAAGTTAAGTTGTCTATCTGATAGTTTCTGTCAACTTTATGTGTCAATCTATGTCCTTGGCTTAATTTTATTAATAATGCTATAA
CCTCCCATTCACAAGTAACATACCAAAAAGTAGAGAAGCTACAACATAATATGATTCTCTAATAACAGTTGCCTGTGTTGAGTGATGACTTGAAACCTGA
AATGATCCTCCCTCATTTGGATTTTTTTTCTTGTTGTGTTATATTCTTTATCTTTATTGTTATTAAGCTTATGAACGATAACAATCTTTTACATTTTAAT
TTATGATGTTGATTGAATATTCACACATTTAGCAGTTTCAATTTTTTTTTTTAATGATATTGATCGATCAGCATGTGCTCTAAAAACTGTCTAAGGGGGA
TGGGTAGTTGTTCATTTAATTGAGTTACCAAATTTAGATGTGTACTATCAGGGTCTATTTTTTTTATCTATTATACTAGATCTGGCTCTGAAGATTGTCT
AATTTAGTGGCTTCTAGCTTTTGATCGAAGAACTTTTTATTGTGCCTTACTTTTTGAGTGTTCAAAATTTTAGATTGTTGACCTCCTTTCCTTCCCATTC
GTGACATTTATTTTTGTACGTTGTTTATAATTGTCTAAGATCCTCTATATTTGTTTTAGGTGGAGCTGCCGATGTTGGGAAGAAGAAAATCCTGCTCTTG
AAGGAAAAGGAAAAAGAAAATCCTAATGTAAGCTTTACCATCTCAGACATTAGTTTTTTGGTTACAAGCTAATATATGTTTGGTTATAATTCCTTTTTGG
GGGAAAGGGGTGGGGTGCCATGCTGAAAATGAAATTAGCTCCTGTGCACCTTTCATAATCTCTGGAAGTGAGAGACATATAGGTGAAGATCATTGTTGCT
AATCTCTTTTAGTTAACCAGTCCAGATCATCCCTCATATTCTTGACTCCAAACTTCAGACAGATGTTATCAGGATCAGTGGAAACATTTTTGTGCATATA
AATTGGTCCATCAAACCCTTTTAGGTGATTTATACTCTGTAAGGCTGTTTTTGGTAAATAAAAAACTTGTTTGCCGTTCGACACGATTGTATGATAATTT
AAGGTTGTAATGCATGTGACAGAATAATCTTGCTTACCTTGACAAAGAAAGGGCGGCCTTGACCCCCTCCTCCCCCCCAAAAAAAACACCTGTGTCTTCC
TACTTTGTGCTAATATTATATTGTCTATTGAGCAGTCACAAAGTTCTGTCATTTCATCTGTTTTCTGATGTAGAGGGGAGTCCCTTGTGTAGATAGTTGG
CTTATTTCATTTGATGCGTAACGATAATTTGTATCCACCACTTAAATATATTTAACACCAACTCGGTCTTAATCAATAATATTGATTTATTCTTCTTGAA
AACTGTATCCTGGGAGATTATTTTTAGTTTATATGTCTGGAACTTCATACATGCCAGAGCTCGAGTCTGCTGTATTTTTGGTGTAGTGGATTTTTTAGCT
CAATTATAAAGTTTTTGCCTAGTTTTGGCTTTTGAAGTTACCCCCCAAGTGCTGTAAATCCCACGTCATCAGGTTTTACTGATGAGTTTGATGTGATTAT
AAAGTTGCCTTTATCAAAAAAAACTTTATGCTTGCCAGACTTCTCTTTCGTACATAGGTTTCTAGTGGTTCATCGATTCAGGACAATGTTGCACTTATTG
TTACAATAATTTCATCTGCTCTGAAACAGAACCAGCGTCGTGAGGCAAGTGGAAGAATCATTAGAAGTATTCTTCTCAAGGATGCTCGTCAAAATCAGGC
CCCATCTGCATCCCAACAAGAAAAACACAGGGTGGATAAGGACAAAAAGCCTCCTAGGCCACCAAGTGTCCAGTTGTTTCAGAGAGAAACTAATGGAGCT
AATGAAGATAGGGTTCTTGGAGCTGATTTGCATGTTGTCCACACTGAGAAACAGGAAAAACGCACTAGGATCAGGGATAGGCCGGATCGTGGTGTTTGGA
CTCCTCTTCGTCGTTCTGATAGTTTACATGCTAGTGATGAATCTTTATCTTCATCTGCCTCTCAATCTTCCGAAGTGCCAGATTTTGTTGAAGGTTTGTT
CAGTAGTATCAGTCATGTTTAGTTTGTTTTGACCTTCCCGCCAGATGGTAGATCTTGGTTGAAAGAGGACTTTTCTGCTTTTTATTCTCTCATCTCTCAT
TTGTATCAGGATAGGTAAGAGTACATTTGTCATTTCTTAAATCCCTTAATTAAGAGTGTTACTATCCTCTAAAAAAACTCTTTATTAAAATTGACACGTA
ATCATGTTTGTTAAGGATTAGAGTTCGCTAAGTTTTCTATTCCCTGATTTTTTCTTTTGGAGAAACCTTTCTATTTTTTTTCTTTTTCTTTAGGAAGTCC
AGGTGAAACCAAACATGGTCTGGTAAATGCTCGTGTTGCGGAGTTCAGACCCATGGGAAGTGGACGTAATTCTCATTCTTCTTTTGATAATGGTTAGTTT
TGTTTATGGTTCATGGAATTTTGTGATTCTTTGCTATATGTGAATGATATGCTCAATAGTCTTTTCCCTCTTTTCATCAGTGGGACCTGTTTGATCACTT
TTGCATTATTCGATGGATCTAGGTACTTATAAACATGGTGGTCGTCGTGGTATGAGGGACGATGGAATTTCAGTAGGGGAAGGAAAGCCCTTAAGAAGGG
GAGGTCCTTCTAGCTATAATACCCATGAGGTATGCCTTTTGTTTTACAATGTTCCATAATTTAGTGTATGCAGTTGTGTTTTCCTTTTGTGTATTTACTG
ATTTGCTCACATGTGGGTTATATGATTTTAATGCAGAAACAAGTGTGGGTCCAAAAGTCAAGTTCTGGTACTTAGTTATTTCTCTAACGGTAAGTTTTAA
ATTGGCTGTTCGTTTCTCTCTTCAAGAAGTTTGATTTTCATTTTCTTGATGTTGCACAAGAATGCTTGATAGATGAAAATATGCATCCAAAAATTGCTTA
ACAGAAATAACTGATTGGCATCAAAGTGTTGTGTATTGCCACAGCAGTCATTTGAATGTTGTGGTGTCACAAGGATATACTTTATTATCTACGTATTTTG
GTTTTGCCTAAAAGTCTGGCCTATATCTTTTGTGTGAGTGCGTGCGCAATCTAGTAGGCTAATCGATTCAGAGCACTGTGGACTCTTGAGTGATTACTAT
TCATTTTTTTAATGGCGTTAAGAAGGGCAATGAACTCGGGGTATTTTAAAAAACATCCATGTGAAAGTTTTAATTAAGAAATTAACTTATGGAACTCTTC
TCTCTGTGTGGAGTCTTCAACTGTGTAATCTGTTTTTTTCTGCAGCGAAATACTTGGTTTTTACCATATAAGGTGCATGTCTAGTGGCTGGAGCTCTCTT
TGTTGACACATCATGTATGAGCAAAGTTGATGGAGCAAAGATAAGGATTTGAAGGCCTTGATGGAATTTTTGACTTGCCAGGGTGATCTAAAAACTGGTA
TATACTGCTAAAGTAGCATTGAACTTACTAAATCTAAGATGGTTGGAGTAGGAGCAAGAAGGAAGAAAGTCGTGTCAGTGACATATATACACCACAATTT
TCAGCTGGTGTACCTTATGGGATCTTTTTGTCGGAGCTGTGGGTATCCTTGTTCCTGTGATCGGCTCATTATCAAATAATATAGTTCTATAGATGGAAGA
TTTCCTTTGTTAAAACTGTAAATACAAATGTGGAATTGTGTGAAGAGTGCGCCCATTAATCCTACACATATGCTGATTACACCATGTTAGTTCTAATCTT
GACTGATTGAAGATTGTCAAAGAAGGAAAGCTTGGAGTATGCTCTGCCATCTTTGTGGAGGCTTATTATAGTCGCGTCTAAGCAGGTGGTATTGCCAAGG
CATTGAACAGATGGATTCACTTGTTTTTTTTTGGTCTGGATTTTGGGGTATGCTTGTGTAAAGTGTGTTTGCTGAAATGAAAGAGCATCTTGATCTGTCT
GTCTAAAAAGAGTTGGTTCAGTTTATGTGTATACGGTTGTAGATTAATTTTTGTTGTACTTTTCTGGGGTACTTTCCTCTTGTTTGTTTCGTCTCCTGGT
GAAAAAAGCACCTTATTTTTTTGTTAAAAAAAATGCAACTTGCTACACCCAGTGAAGATGCAAAAGAGAAAAAAAGATGTGCTTGATACACTTTGGCTTG
GCTCCCTCTTGCTCTGGTCTACACTCCCCTTGTGAGTCGCCACCCTTCGACTAGCTTAAAACATTTGCTGCCTCAATGGCTACATGTTAACCACTAGGGT
TATATTCTCCAATTGATTTTAAGGTAAATTTCTCAAGTTTTGCTTTTTCCTTGAATTGTAGAGCACTTATTGTTGAATGATCTTTTGGTGTGTGCTCAGA
ACTTGAAAAAGATGGAAAAGTGAAGGATTTAGGATCACCACCCTCTAGTAGGCCATAAGATTTGGTATATGCTTTTTTTTGCCTTCACTTTTTTAGTTTT
GATGGTTGTTGAAAAGCTTCTTCTTTGGCCGCATGCATCTTAGCTTGGACCACTGCTTTTCTTTCTTTCACATAAATTGGCTATTATTTCTTAGCAAGGG
AATAGGCATAGGACCCCATCAAGGGGTGTGATTAGTTGATTGATCATCTAAATGAAGTCCTCTTTTAATTAATAGGCCAATAATTCCTAATACCAATGAT
TACACAAAAAAAAGAAGTTACAGGTCAATTGACATGTTATCTAGTCCCTCCTAGGTGGTCCTTCATTTAAAAGGGACCAGTCTATGTTATGTTTTTTTTT
TTTTGGTTGAAAGAAATTACGCGCATAAAAGTTTATATATACACTCAACCTTTTTCTATTCACATTCACATTATAATTATGCATGTATTCAAAAGTATAA
TATTTTATATGAGAGAAATTATTTTTCTAAAATGAAAATGTTCAACCACATGTAGGGTAAAGATGATTTAGAGGAATCACTAAATTATTGTACGAAAAAT
TCCAAATTAGAATTGTATACTGACCCTTCAAGAAGAAATATTCAAACTCGTGCTTTCTTAATATCATTTTCTATCGCAATCTTTCTAATCAAATGCATTA
CCTTCCATCCACCTATTGGCTCCAAACTATCCTTCCCACCCACCTATTGGCTCCAAAATACCCTTGTCATCCACATTTGTGTTCAAAATTGATCACTTTT
TTAATTGTTTTAAAATTAAACTCTTTAAATATTTTTTAAAATACTTGACGTTCAATTATTAATTATAATTATAATTTATTAATATAATTTATAAACAAAA
CCATAACACACTCATTACTAACTAAACCTCACCCAATTAATAATCCAATTATAATATCAAAATTGACAAATTGTCATACACACTACTAAAACACGATGAA
ATTATAGATTTCTGAAAATGACATTCAAAATTATTCGAGTCCGAATCGGAGCCCCAATTAAATTTAGGTTGAGCCGCTTATTTAGGAGGACGCTTTCTTT
CAAAATAGAATTAGAAATTTATGATTAAAAGGTAAAGAAGTAATGCATACCGATTGATTCATTCACCTTTTTTAAATATAATTTTATAAATATTTATGAT
TTGTTTTAAAACTTTAATATATTATTTTGAAAAAAAGTTATCTATAAAGTAACATTACATAATTGAGACGTAAGAATAATTAAGATAAACATAGTCAGAC
TTTTAAGTTTATTGGTGATTTTTATTTAGCCAGTTGAATGTATGATAATTTATTTCTATAATTTTTAAAAACACTCAATTGGCAGTAGTTTGCATTAATA
ATGTGACGGGTTCATTAATTTAGAGGGATTTAATTATTAATGGGGTGGGTAGTGGATTGATTTATAAATTATACTAATAAGTTAAATTATAACATATAGT
TGAGCACCACGTTCTTTAAAAAATATTTAAATAGTTTAAATATAAAACCGTTAAATAAGTGATCAATTTTGAACCAAAAGGTGGATGAAAAAGGGTATTT
TGGACCCAATAGGTGGGTGGGAAAGGTATTTTGGAGCAATAGGTGAATGGAAGATAATTTTATACAATTTTCAATACTTTAAAGATTTTTAAGCCTTTTT
CCGTAATTATAATTGCTATCACTACTGTTTTGTAAGCAGCAAACTAATAATGAAACCTCGAGAAATAACTAAAACTCATTTACTGTGCTAGTACCCTAGG
TATGTGGACTATGGTGGCTTTACTTTTTTGAAAGTAGAGAAAGAATAGTACTCCCCAAAAAAAATATATTTAAAAAGTCAACAATGTGGGATGGTCCATG
TTTACTTTTTTATCTTTTGTTTCCCCCCTCTGCATCATAGAATTAGTCCAATATTTCGTACTCCAATATTTATTTAAAATGTATATAAATATTTTTTAAA
ATTATAATTTTTACTTATCTTATAAATATACGAAGAAAATAAGAATTTTTTATTATTTATAATAGCCCGAACTAGTAAATTAAGTATATAATGAATATAC
GAATAAAAAATAAAAAATAATTGATAAGATTAAATTAGAAATTAAGTGATAAATTATTTTTTATATTTTAAATAGATATTTTAGCATAGTAGACAAATAA
AAAGTGGAGGGAAGGAATACTTCTTTTATTTTATATTACTTGCCCCTGTTCGATTGGATACATTCCTTAATAAAATTTTAATTATATATTTATTTTACTA
AACTGCCATTATAATGGTATTTTGAGAAACTTTAAGAGATCGCTTGGCCATAGATTTCTCAAATAATATTTGAGAGAAAATTTGATAAATAGTGTTTGTT
CATACACTTTGCTATTACTTGGCAAATATTTTTAGCAAATATCTCAAATTTTTAAATATTAATTTTTTCTAATATTTGGATCAAATCTTATTATTTGGGA
TTTTTAAAAAGTAGAAAGTTTAACCCGAACTTTTATCTTTTTTACAAAAATACTCTCTATAGTTATTGCTTCCGTTGTATTACATAATTTTTTACGTTAA
TTTCAAAGTAGTGATAAATATTCGGTGAATGTGAAATGATAATATGATTATTGATGAAAATGATGAAGAATCGGCTCAAAATAATAAAGTCATGTGTTTT
GTTTACTTCACGATGTATGAAATGATGCTTGTTGCACTCACTGCAAATTACCACATTGCTCTATTGTCATGGACACTATTTGTTATTGTTGTAACAAAGA
TCTAATTGACTTGTAATACAAATCAATGATTAGTTTTGATATTTTCAAAATTTATGTGTATAAACCATATTTTTCTATAAAATTGAAATATATTTTCCAA
ATACTATGATCAAATACATGGTAAAATTTCGAATAATATTTGTCAAGAATATTTAAAAATTTATGATCAAACGCTAGTTAGATTTGTTACTATAATTCTA
CTACTATATGTAGTTATTTAATTATAAAGATAGAATTAAAAAATTTTAATTCACTAAACTGAACAAGTAATATGAATTGTTTTATTTTGAATTATTTAAT
TTGACAAATTAATACACCTAACTTGCTTCTTGCAAGTTATATTTATCGTTTATCGCTATAGGTTGTCGATAATGCAAACTATGGGACCAAAATGATGACA
CGTGTCTTTATCACGTGAGAGGTCCTGTCTTAATCCAACGATTAAGTGGGGTCACGTGGTTTAAATAATTAACAACATTTTCATTTGGCCACCAACAAAG
AATATAAATGTCTGCATCATTTTTATTATTCTAAAACTTATAAAACCACTTGCTTCACACCCTTATCTGTTTGCCTCTAAATATTAAAAATAAAATAAAA
ATTGTAATTGATACTTCCAAGTTTCAACTTTAGACTTTGGGATCTTAACATTTCTTTTAAGAAATAACTTTTTCGCCCCTAATGAAGTAATAAATATTTT
TTTATTTTTAGTTAAAAATTTTGATTTCAAGTATATACGCTCTTTTCGTTTGTTAACATTAAGGGAATAAACAGTCCGTTTGTATTAATTAGTGAAGAAG
ATATTTAAAGGTAAGTTAGAAATGTATTTTGACTTTGATTTTATATGAATCATGTTTTAATAAAATAATACATGGAATCATTTCATTTATTCAAAGTTAA
AACAACTTTTTATATAAAAAGAAAACTTGGATCACCCCTTTGGAGTTATATGATTGTTTGGTTTTCCTTGGTTGCTTCTATTAGCATTTATGGATATCCA
TTTTACATTAATTCTCAATTCCAACCTTGGATGTATGACTGTGACATGGGGCTTCATCAGTTATATATTTAAGTTGTGGAATTAAATATTCATGTTTGTA
TTCACATGTGATTTATATCAGAACTTTTTAAAATTACAATTCTCTTTTGAATGTTTAATCATAAATTTGAGTCGTGAAATTAAACGCTTATATTTGTATT
AGGATAAATTATTTATATCATAACTTTTAAAGTTATAAATTTTTTGAACACTACGTGAATATGAAATGCTTGATACACTGAATTATCATTTATTTTATTT
TTTTCTTCTAGTAAATACTTTTGACTATGATAATAACAAAAGTTTCATAAGAACTCTGGTTATTAAATAAAATCAATGGAGTAATTTTAATGAAAACTTA
CTTTAATAAGAATTGACAAATATTTGGATTTTTTTAATTGGAGGGGGAGGTGAAAGGGAAAGAAAATGACTTTTGAAGCATTATTGGACCTATCTGTTCA
AGGTATGATAATGCTCAATCCTACAAAAGAATGAGATTACATCTAATGATTTGAATTATGGATTCTTCATTAAGTTTAATCTCACAACTGTAAAATAAAA
ATTACTATTTATTCTCCTTTAATTTATTTTAAATACGTAGAAATTTACTTTCAAAATTGAATTTATCGTGTAGAGATTTAAAAATTTACATCTCTTAACT
TTTTTCAAAACACCTCTCCATCTTATCCATTTGTTTCTTTATGACTCAAACTAAGAAACTTCGATGAAAACATAAAGAGGTGTTTGCCATTCAAGTAATT
CCTTGTCAATTATCACATTTCAAACATCTCAAATACCAAATAAACTATTACTAAGGTCTTTGCTTTTGCTCAATAGGTGTTTGAATTTAAATCTCGTGTA
TTATGACTTATCAAGTTTCGAAAACGAACCTAGATTAATTTTAGAGAAATATCACTTTCGCTTATAATTTTTTTTTCATTTTCCAAGCAAAATATATGTG
CAAATACAACTATTTTCAACCCAATTTTAGTATTTTTTGTTCTTTTAAAGTTTCAATTAAACCTTTGGGTATAATAAGGGATAAAAGACAAATATATTCC
AAACTATTGTAAATAGTATGCAATTGCCTCTCGTCATATTTTAGGGACATTAGTGTCTCTATCGTTAAAAATCTAGAGCATATATATTCTTTATGTTAGC
GGACATACACGTGTCATAATTTTATTCACCGACAACATTGAATGGATGGATAAGATAGCGTCACGTGTCCTGTTTAGTCTTATATTAGACTGAAGGGTAT
ATATATTCTAGTTTTTAGACGGTAGGAGCACAATATCTCTAAAGTATGACTGTATATAGTTTACGATAGTTCGATGATATATTTATCATTTTTTAATGAG
AAATAAGAAAAAGAATAAATTGATTGGGTGATTGGAACCACCATTAGTGGGTGTGAAAGCAGCATAATATCTCTCTTATGAGAGATAACGTTCGAAGAAA
AAGGGTCATCTTATACTCATTACACTTGTCAGAGAAGACTGTCACTCTCTAAAACACACTCTCTCTCTCTCTCTTCACACTTCTCGCATTTTAGAAAGAA
CCAAACGACGAAACCAGAAGAAATTATTCAAAAATTAACTCGTCTGCGTTTGATCTGACTCTTCAACTGACTTTTTCTATTCAATTTCTACAATTTGAAT
ATGCATTTTGTGGTGTAAATTGATTGAAAATCTCTATTTGCTGGAATCGTTGAAGAAGAAATGCTTCGATACTGCTTTGTATTCATCGAGGTTAGTTTTT
GTTATTACAATATATGGTTTTTGCTCTTAGACGATCGTTTCGTAACGGACGCGGATTTATACTTAATTTTCTTTCCGTTACTTGTAATTCGTCGGATTAT
GCGTTGAAAATCTTGTGTAATTTCACGTTTTATCATCACTGTGTGTATGAAGGAGTTGATCTAGTGTAAACTGCAATCTATTGGAGAGAAATTAGTCGTG
AAGATGGAAGTTTGAAATCTATGTTCATATTCTTAAGCAATATATCAAATAAGAAAGGTTCATATTTTGAGCAGCTCAGTTTGTCATGGTGAGTTAATGA
ATAGTGGTCAGAGAGGTTCCGCACTGATTAGGAAGGGTTAAGTATGTTACGAGAGAGCTGTTTTTGCTAAAATAATTGGGCAATTGCGGTCACTTATGCT
AAAATGCTTTCTTCACTCTCATTTCATCTAATAAAGGACTATTCATATTGGATATAGATCTGTTTATTTTACTTTCGGCCGAAGTATATCTGGTTATATA
GTGAATACCTGGACTTGAATTAAATGGAAAAAATAATGATAACCACATGACTTAGTTTGGCTTTGAGGTGTAGTGATTGATTGATATATAGTTCTTTTAT
AATAAAATGAGAAGTACTTGTGTTTCTGCTGATGTTTGACTTCCATATTTGCATTGTCTTCTCAATCGAATTTCTATGCAAAACAGAAATTTGTTATTTA
TCAGGAATATTTGATCGTATTTTGCCCTTTCTCTTAGGTACTAACCTGTTGAATCTTTGCCTAAGTCCCTAGCTGTGAAACGTATGTGTTGACTTCATGA
GAACTTAGTCAGATGGTTCATTGGACATGGTGTGTACTCGGTTTTTCGGTTTTTCTTTGTCAACAATTGACTGGGCTATAGCTAAACCTGCCCTTTGCCT
AAAGATGTGGTGCCACAAGATATTCAATTTGAGTGTACCTTCTCCTTGGGGCATGTTGACAATCTTGTGCCTGAGAACTATCTGGTGTAGGAGTAATCTA
TCGAGCTAAATGCTTGGTTGAGTACTCTGTCGCGCCTAGTAGAATAAACTTCCTTGTACTTATGTGTTTACAAGTGCCATTGAGGTGTGGCCGAAGAAAC
TGGTTCGTTTCTTGATGTTTGAACTTATAGAACCTGGCATACAGCGATAAGAACCATAAGCACTCTATATTTAAGACTAACATAATGAGGTTCTTTGACT
CTTTCATTCAGCACCCTGATTGATGGTTCATTCCGACCCCCCCACTCCCAAGTAAATCTGGAATATAAATGCCATGCAGTAAATGTGGCATTTATTGGCT
GGTTTTGTACATTTCCCTTTTATCTGGTCTTCTCAATTTGGTTAATGCTCAATGAATCAATATTTTTATTACTGTGTTTCGCTTCCTATTTGCAGCATTT
TTGTTTATCTCATACCAACTATCTGATTTTGCTTAATTATAGTCAGAATTTCTCTTCAACTATACTGAGTTAAGGACCTTGTCATCAAACTAGATAGACA
GGAACATCCACGGAATGGAGGGCTGCACCAGAAGGAATTATGCAGAGAGGTGCAGAGATTAGTGTCTGTGACTTCTGCAAGGTTCATTTATGGCGTCCAC
TGGCCTTGGCCACGGAGGAGCAGGCAGTTCTAGAAGTGCGAATGGATTCAAGAGTTCATCTAGTTCAGTTGACTGGTTGGGAAGAGAGATGTTTGAGATG
AGGTTGAGAGACAGGGCGGACCATGATGATGATGGGGTGAGCTTCTAAATTTTCACTATACCAATTAGTCAATGTTGCATAGTTAACCTTATCACTTGTG
GTCTTAGTTACAGCAATTACTAGTTTTTCTGATAAGCTGAACATACCATGTTACGTGTTTCCTGGAGTTCGTTGCTAATGCTTCAGTATCCACTCTAGGG
TCCTTCGATAGACATATTGGTCCTATGTAATTCAAATCCGCTGGCTTAAATACCCCGCCCCTTCTTGGACATAGACAGGATTTGAATTTCTTACTTAAAT
CAGTTCATATCAACCTCTATGTTGTATTCATTCAAATGAACTTGATAACGAGTCATATGAAAGTTGAAAACCTTGACTTAGTGTTGAATCCTTGCAAATC
CATATCTCTCCCACCCTATGAACCTATCAACGAAGATATATTACAAAGATTTTTCCTGTTCGATGCCATAGAAGCATGATTAGTTATTAACATGGTAACT
GTAAGTACACACATCTTAATGATAATTATGGCCTTAAGTTAATATTCCTAAGGAGTTCTCTATTGTTATCACTGTATGACTTATTCATTCTATAACTGAA
TTTTTCTTGCTTTCTTCCCTTCATTGTTAGATTCAACAAGTAAATTTGCTTCTTTTTTGTTTTTGCTTATAGTGCTCTGGTATACATATATGTTAAATTT
GTGTCTCTCAAGAATACTTCTCCCGCTCAGCTTATTGGAGCCTTACAGCTTCGATGATCATTTATCTGAAAACATCATTCTTCCTATCTTTTGGTGTAAT
ATCATGCAGGACAGTGAACCAGATATAATTGATGGTGTGGGTGCAGAAACAGGGCATGTTATTAGAACCAGTATTGGTGGTCGAAATGGTCAACCTAAGC
AGGTTCTAATTAGTTATGAGAAGTATTACTTATCATGTGTTTGGGATGAAAAATGACTATTTTTATTTGGATTCACAGAATGTAAGTTACATAGCAGAAC
ATGTGGTTGGAACTGGTTCTTTTGGTGTGGTTTTCCAAGTAAGAACTGCTATAATTTCTGCTATCTTTGTATCTTTAAGTATGTAGATATATGAGCGTGT
GTGTCAATTATTATTGGATTATCTACTTCTGTTTTTCTTTACAGTGTTCTATATTATTGTGATATAAATTTTCTATTGTCACAGGCGAAATGTAGAGAGA
CTGGAGAGATTGTGGCAATTAAGAAGGTTCTTCAAGATAAACGTTACAAGAACAGAGAACTGCAGATTATGCAAATGTTGGATCATCCTAATATTGTTGC
TCTTAAACACTCTTTCTTCTCAACTACAGACAAGGAGGAAGTATACCTCAACCTTGTCCTTGAATTTGTTCCAGAATCTGTCAATCGTATTGCGAGACAA
TACAGCAGAATGAACCAGAGGATGCCATTGATATATGTCAAACTCTATACCTATCAGGCATGTGGCATTTTCTGGTGGTTTTAAACTTTTAATTATACTC
TAGCTTAAAATATCTTGAATTATTCTATTAGAAAATACCATTATTTACTTGCAGAAGTTTCAAACTTTTAATGCTGGACCAGTTATTGATTTGAGGCCAT
GTAATGTCTCACTTACAACAGGTTTTTCCGTTGTTTGTCTCAGATATGCAGAGCACTGGCTTATATTCATAACTGTATTGGCATCTGTCACCGTGATATT
AAGCCTCAGAATTTGCTGGTTAGGTGTTTCTTTTATGATAGTGAATTTCTGCTCTTTTGACTATATACTTTGTTAATTTTTACTTTTTCTTGTTCTGGAC
CTCATTCTTTGGTTATTCTTTCTGGATAAAAGGTCCTCTAATCGTATTAGATGAGTTGGTGTGTTTTTCTTTTCTTTTCTGGATGAGTATGATAAGCTGA
ACACTTTTTGTGCACGTGCTAATTTGTAGCTTAATAATCTAGCTGGATCAACTGTACCTTTTTGTTTGCATAATAGACTTTGATATGTTTCTGTATTGTA
TATTTTAAGGTTAACTGAGTGAAAAAAATTCCATACTTTATCTCATAGAAAACGCGATTCTTCATTAAAAACTCTCACACAGAAAGCAATAAAGAATCAC
AGATTGTCCTATTTAATGAAGAGTTAAACTCTACAGCAAAAAGTAGGAAATGAATTGAAAAGAGGAACATCTGACCGTTTTGTATAAATGCTTACAAATT
GTATATTTAGGGTCTTATGATGTGTGTATAATGATATGTTATTCCCGGTAAAATACTCCAATTTTGGATAAACTCTTAAGGTCATTACGAGTGAAGTGGT
AAAGGGCATTGAAAAGTTCTTTAACATGCTATTATTTGTTAGACAAGCCACTGAGTAGACTCTAGAGTCCAAGTAACTTAGTATCTAGCAGATAAGAAGA
CAAATCTTTTTAAGTTGAACTGTCTAAGAGGATATCATTTACACCTTTTAGAAAGAGAGATGCAATACTATAATCTTATGGCAGAATCCATGATGATATC
AGCTTATTTTTGGGAAGTGTTATGGCACTGCTATATTGATGGTGTCTTCTGATTATCACCGTGATTTTTTCTCACTAAACTGAATTACTGTTTAATACTT
AGGTAAATCCACACACACATCAGCTGAAGCTTTGTGATTTTGGAAGTGCAAAAGTTTTGGTAATTTTTCTCTGCAAAGACCACTTTGAATTTAAGAATTG
CACTTGCTACAGTTTTCCAACCGAATTCTTTAACCACTGTTTAGGTGAAAGGTGAACCCAATGTGTCATATATCTGTTCGAGATATTATCGTGCCCCTGA
ACTCATATTTGGTGCCACCGAATACACAACAGCTATTGATATTTGGTCTACAGGTTGTGTGATGGCTGAGTTACTTCTTGGACAGGTAAGTTCCTGTCTT
ACTATTTTTGTGCTATTCTTAATCATATGTTGTATTCTTTATTCTAATACTTCTAACAATTCTGTTTAACAGCCATTGTTTCCTGGAGAGAGTGGGGTTG
ATCAATTAGTAGAGATTATAAAGGTGAATTTTAGAAAATTTTCTATTATTGATATTATCTTCTCAAAAGATACTTTGCTGATTTTCTTACCTTTACAATT
CAGTTGGACCTTTGTTGCCTCAGTAAACAAGAGAAAATGTCTCCTTTCGGGAACATCCAATTGTAAAAAAAAATTAGACTTAAACATTATGGCTTAAAAG
TTCAAACAGTATGATCATAGACAAATTATCTATGTGATGTTAATACCTAATGTTATATGAAAAATATTCAACTTTCTTAGTTCAATGGGCAACAAATCAG
AGAAAGCAAAAATATTAGATCCTGCATTTGTTGAAGTTTGTGCAACTTGCACTCGTTCGTTTTGACCTATATTGGATATCTTTTGTTCTATTTGTACCAA
TTAAAATATATTTTGTTCGATACTAGATATCTCTCCTTGAGTCAATGAAGTTTCTCTCATCCACTTTTTTTACTTTTGAAAGGCCCAACCAGTTTTAGGG
GTTCTTGTTGATGAACACATTAATTCATGTCTCTGGTGCTGTCATACACTTTAAAGTGTTTTTATGCTCCACCCGGAAGAGAATTGGAGTGGGGTGGTGG
GGGGTTGAGTCCTCTTTGTATATACCTTGAGACTAAGTTTTTGAGGACTTTTGGTTGTAATGTATCTATACATGTTGACAGAAAAAGATGGATTGTTATC
TGTCAGCCTACTTTTGTCAGTATTTGCTATGGACCATCTTCCTCAATAATAAGTCAACTTTCCTATTCTACTTCAAATTTTATGCAGGTTTTGGGGACAC
CTACTAGAGAGGAGATAAAATGTATGAATCCAAACTACACTGAGTTTAAATTTCCACAGATAAAGCCACACCCATGGCATAAGGTATGCTGTGTAACGTA
AAGCTGAAATTCAATATATAAATGTTGATTATTGGTGCTCATTAAATCATGCTTATGTGCTCTTCGTCATTCCATCACTTCGACTTTTTGATGAAAATGG
GTTATGATCGTAGCTTTTATTTTATTCTTCCCTGTACTGAAAGTCAGATTTAGGTAACTAGAAAATACTGGCTACTTGATTTGATTCATTTTTTCCTGAC
ATCAGTTATGAAGGATGACATTAGAAGTACAGATGTTAATTACTTTAAGTTGGTAAAGGACAGGTTTGGAAGTTGCTTCTTTCTGCTTTACAACTTAAAA
GTTCAAAGGTGGATAAAGTACTTGCGCCCAAAAAAAGGAGCAAGATATATTAAAAACATAAGTATGGGTGGAAGTGTATGTCTAAATAAATCTGATAACT
TAATTTCCCTTTAGGTTGTATTTGCCTCATTTTATTGCTTTATTGAATCTGGGCTGATGATCTATAGGCAAGAGTCGGTGGTATAAAATTCTTCAAGCGT
GCCCCTCTCTCTTGCTGACTACGATAGTAAATGACATTTAGAAATTTCTAAAAGCTAGTGGAGAACTGGCTCTTTGGAGAAAAAAAGTAGGACTGGTGGG
TGACTTTTTTACTCACCCCCTTCCATGGTGTGGAAAGATGGGACCCTGGAAATCAGGAATTAAGAATGAGAGCAGTCTCTGTCAAAAATCGGAGCCTGTT
GGCAAAAGATAAACATCTTGCGCTTGGATCCAGAATATATGATAGGGTGGTGGTATATTGGTGCTCCTCCCTAATATGATGCTTGAAAATCATAGTATAC
CATCTAAGACATTAACATTCTTCCCAGTGGTTCACATGTGTCTGATGGTAAGACATTGTAAGATCCAAATTATACAGAACAAAATGTGAGTAGAAATTTA
AGTCTGGACAAACAGAGAAGAATACCAAATTGGAAATATTCTTAGAAGAGTTTTACAATGAGCCTTAATTTCATCATGTCTTACATATATAAATACTTCT
ATTCGAGGCTGTTTGAGATGCTTTCAAGCCTGGAAGAGCCTTTGTGCCTCAGAATGTACACCGTGTCATATTGGTTAAAAAAAGTATAAACACCATGTCA
TTGCCAGCTGTAGTACTTGAGTTAAGAAGCATTTCGTGTGATGCACCTAGAAACTTTTGCTATCAACTAGTCCAGTGAATGGGATCATTCTCATTTATTT
TCTTTTATGCCATATATTCTGATAAATTGTGCTTTTTTCCTGATTGTTTTCCGTCATATACAGAGAGTTCATATTTCTCAGTCGTCGTTTCCCTTCCGTA
AGTTATTTCCTTTATACAAGTCTAACTATATCTCATGATGCATCTTGCAGGTTTTTCAGAAGCGATTGCCTCCAGAAGCAGTTGACCTGATTTGTCGATT
TTTCCAGTATTCACCTTATTTGAGATGCACTGCTGTAAGTCTACATTCATTCTAAATTAATTCAATCTCATCGTCTTAAGGTTTGGCTGTAGTTGCCTAT
TGATTTCTGCTTTGATCGTGCAGTTAGAGGCCTGTATTCATCCATTCTTTGATGAATTGAGGGATCCTAATACTCGTCTTCCCAATGGTCGTCCTCTTCC
ACCACTTTACAATTTCAAGCCCCAAGGTAACGTACACCAATAATGTTTTTTCTTTTTTTTTAAATTAAAGGATTAGTAATGTTGTATTATTCAGCATTTG
CGAATGCTGGCCACCATCAGAAACAAGTTACAAAGCAAGTAGACTCTAGCTTTACAAAGCTCCTAGAAATTCTACTAACTCCTGTATTTCCTCTATACAG
TTTTGTTTACACCAAAAAAATAAAAGCCTTCAAACAATTTCGTTTCACATCGTGGACTGATCTGATTTTGTCTTCAAAACACCTTCCATTTCTCTCCCTC
CAGACCGACCACCTCATTATAAGCATATTATGTGGGTGATTTATTACATTAGATACGACTGGTTTCAGACTGAGGCTTTGAACTGAATAAACCTGATCTC
AACTGCCACCACATAAGAGAAAGAAAAGAGATGAAAGAGAAGAGGGGCTACCTGAATAGGGCTGAATTGTACATATATGCCTTCAACTAATTTATTTAGC
TGTAGTTGTTAATTATGATGATGTTCTCTAATTATGAAGGAAGTTTAACCACAACTTTGTTTATCAAAAAAAGAAAAAAAAACAGAAGCATAACTCGATA
CCACATGGGCAGATCATATGTTGGTTGGTTGAGCTGTTTCTGCTCCAGCATGGTTCTTAGTTCTGAGTTAATAATCATAGTCTCAGATAAAAAGATTTAA
GTTGTTTAGACAAAGAAAATCTCAAAACAAAGGAAAAATTAGAATAGGAGAAGAAGAAACACTAGATGATTTGTTTGTCGATACTAGATAGATGACCCTA
ATGGAACCTAGTGAATGTCTAAGTAGATAATCCCACAACCTTGCGATATCTAGACAACAAGCTCCTCATAGCATGTGATGGTATTAGTTATTAGTATTGT
GATATGACACCATTGATATGTTTTGATATTAATATTTCACATATAGCATTTTCATAATAATAGACTAATTAACTATTGGTATATTTTTTCAATTTTTGAC
TGATATGAAACATTTTTATTTTTTTGTCATATTAGTGTTGTATTTTAATCTTTGCCTGATCATGTGACTGTTCAGTGTCTATGTTTGATTGAACCACAAT
CAAGTAGATTTAGAGTTTTATCGAAAAAGTGTGAAGAAACAGATGAAAAATGGAAGTCTCTAGTCCCTACTAATATACCTTCAATCTCCAAAATGATACC
TGGTTATTTTCTTCAACTCAATTGGTGTTTATTTTTGAATTTCATATTTGCTACTAGTGATTAAGCCATATAGCATTCAACATTTGCCACTTGTGTGGCA
ATATCTTAGAAATGTCTGAATATTCAATTTCTCAATTTGTTGACCCTAAATTTTTCTCTAGCTCTTTTGATGTATGTATCCTCATTATTGTGGTATGCAC
CTTTGTAGAGCTCACTGGAATTCCTACTGTAACTCTCCAGCGCCTTGTTCCAGAACATGCTCGAAGGCAGAATTTATTCATGGCTTTGCGACCCTAGTGA
CTATTTTGTGTTCTGCCACTGTCCCTAAGTACAATATGATACAAGTGTTTGCACCTCATCTGTGAGTGCTTGCTAAATGTGGCTGTAGATCAAGTTCACA
ACGATGTTAGACTTGCCGTTCCACATACGTGAGAGAGCATCTTGTAATTTTTTCCAATAGCTGGTATGAATACCGTGCATATATGTCAAAGCACATTTTG
TATACTTGCGAAAACACAGTGAGATTTAGGTTTGGATGACGAAAAGCTGAGGGTTTATATATATAATCATTTCAGTTTTTCTTTAATTCATGGGCATTAA
TAGCTGATTTTCAGATAAAAAAGAATAATACTAGCTATGTGTCTTTGGTATTTCCTTGCATGTGTTGTTCAGTGAAACATGATCACATACGCCCATGTTA
TTTACTGGAATCGAAAGAGCTGATCTCCGCAAATTGGATTAATGTTGGTTTTGATAATGGCATCTTCAATTGACTATTGGTATTACATTTTGAAGAGCTA
ATCTTATGTGGCCAAGAGTAACGGGCTTCAAAGGTCTTATACCATGAGCATGGATGTATATACCTTTTTGCTCTTGAGTCGTGACATGTGAAGTTGTAGG
TACTCTTGGCATTGTCAATTGTCTGTTCAGTTGCTTCAATATCTTTATCGGCTTATCCACATTGTGGTTTCTTCATACTCCTTGCTTATAGTCGTTAATT
GGTTGGCACCTCTTTGGACTTTGTTAGATCCCTATAAGAATAGAGCTCACAGATTCACTTTTGTACTTATTATCTTTTGTACTATTTGCATTCTTGATGC
TATAAGAAAGCAAGAAGACGTTTGACGCTGGGATAGCAATTTCTTTTCATTGTTTTGTGAGAGTTCGATAATTCGATCCCCTTCCCCTATTCTTAATTTT
TTGTTAAAAAATAATAATCAAAACATAGATTTATAGGGGGCATTTGCACTTTTTGTTTCTATTTTGTGTCGTCTTCAAAGCATCTCAAGGCAAATAATCT
TTTCACATGTATAAATATACTAGATACGGATCCCGTGTCAGCATGGACCCAATATATATTACACTTTTCGCTAATTATTGTGGTTTATAATATTTTTACG
TAATTTTCACATAATATATATTACTTACTTTGTGTTGATTTATGTGATACAAATGAAATTTCAAAAGTTAAGTCAATTAATTTTTTTATAATTTTTTTTA
TATTTAAATTATTAATTATTGTGAGTTATAATATTTTATGTGTTTTGTATGATATTTTTCTCTCTTTATCTCAATTTATGTGGTATAGACGAAATTTTGA
GAGAATAACAAAATATTTTTATATATTTTCAAATATTTTGAAGCTATAGTTATTATGATTTATGATATTTTTTTACATAATTTTTAATATATTATATAAT
GATAGAAGATAATTTTTTTTTAAAGAGAAACTTTAAGTTAACAAACTACCGCCAGCTACAAGCAAGCATGTTGACGAAGTGTTTGTTGCCTGTAGTACGG
GATCCCTGTGAGCAAGGGTCCAATTTATATTATTTTTATTTTAATTTATGTCACACAAATGAAACGTGAAAAGTTGTTCAAAATTTTATATAATTTTTTA
AAAATATTTCAAGTTATTAATTATTGTGATTTATAATTTTTTTAAGCGATTTTGAAGTAATATATACTATTTCGTTTTCCCAATTTATGCGACATAGATA
AAAAAAATATATTGTTTTTATGTCTTTTAAATATTTTAAAGTGTTAATTTTTGTAATTTGTAGTGCCTTTTATTAATTTTTAAATAATTTTTTGTTATTT
CTCATGTCCCAATTTATGTGGTATTGATATAATATTGAGAGTCAACCAATTTTTGTTAGTCTTTTAAAATTTTAAGTTTTTAATTGTTATAATTTATAAT
ACTTTTTACGTCATTGTCAAATAATATATGTCATTTCCTCTAACCCATTTTATGAGTCACTCATATATTTTTTGAGAATATTTTTTTTTTTGACTTTTAA
ATATTTTAACTTATTAATTATTGTGATTTAAAGTATTATTATTGTAAGTTTCAAATATATAGCCGGATAAAAAAGAAAAGTAAGAAAGAATTAAAAGGAA
GAAAGTACAGAATTAATGGTCAAATTAATGTGACACAAATGAAATTCTTTTATCCTAATTATGTGGTACAATAGAATTTAGAGAGTATTATTTTTATATA
ATTTTTCAATTTTTGAATTCAATAATTATAATAATTTATAATACTATTTATATGAAATCTAAATAATAAATATTATTTTTCTATTCTAATTTATATGACA
TTAATAAAATTTTGAGTATATAAAGAAGGGAAAATTGTATGTAATAGCAAACTAATAACCTAAATTAAATGGAATAGCTAGGGTTTGATTTAATTGTTCT
CCATAGCAAACATTAGCTAAAATTTGTCAGCGTCTCTCCCCCAAAAATCTCGCTTGCCACTCTCCATTCTCGCTCGCCTCTCGCTTTATACACAGAAGTG
TATAATTCTGTTTCTGTTTTGTATAAAGCGAGAGAAAATTGTATATACACATGCAAAAATGTATATCTTCGTGTTATAACTTAATTATACAATTTACAAA
CATTTTACTTCAAATATTGCAGAGAAAAAGGCCAACGAATTATACAATTGCGAATTATACAATTGCGGTGAAATACAATTTTCTCTAGCTTTATACAACA
GAAGTGTATATATTGTGTTTCTATTTTTGTATAAAGGGAGAAAAACATATATCTTCTTGCTATACACTTATAATTATGCAATATAAATACATTTTAATTT
GATTCAACTGTATGCAATACAAATTATACAATTGCAGCGAAATAGGCCAGCGAATTATACAATTGTATATGTATAGCAAATTATACAGTTTTATGTTTGC
TATGAACCGCAATTATGCAGAGTTTGTAATAGCATACAAATATAAATTTTTTGTTTGCTATATGTGAAAGTTGCCCTATAAAGAATCATATAATCATTTA
AATTTTAGCCTTATTAATGTAATGAAATATTAAATTTTATTAGTTAATTTTATCTGCATGATCTCAAACACAATAATAAAGAAAGCCTAAAATAATTACA
AATGAATTCTAAATATTACTGATGGGAACATTAGCATTTTTATGCCTTTTAGTAATGAAAAAGGCTCAAATTTCACTATATTTACCAATAGATAGCAATG
GTTTTGTTGTAAAAAGATACAAAAGAAGGGACAAATAAACTTTAAAAATACTGCATTATCAACAAAAGGACACAAAAGGAATTAGAGAAAACAAAACATT
AAACGCACAACTCTTAAAACAAACTGTATAAACAATCACAGCAGAGTAAAAGCAGATTAGGGAGTAACTTACCAAATTACCCTTGTCTACGAAGCAACCA
TGTTGACGAACAACTGCTTCCTAGACTCTTTTATATATTAGTAATATATTTTTCATGTAGTAATATTCTACGAGTGTCCCGCAGGCCTCACCGTAAAAAG
ACGTTGAACTTCTTCGAGTATAAATTCGATCGATAAAAATTACAATTAAAAATGAAATGTAAATTGTGCAATTAAATTTGACAAATTAATAGAATTTAGA
TAAATCAAAATAAAATTAGTTAAAATTGATGATATCAATCAAAATTACATAAATTGAAATGAATTTAAAAAGAAGATCATAATTCTATCTATGAAAATTT
GAACATTCAAAAAGAAATAAAATGAAACAAGATTGTCAAACGTTTACCAAAAAACAATTAACTAAAGTTTTCTCAAAGATTTGCGTTAAAGTCATTTGAT
TCGCCGTCACTTAACGGAAAAGGGCTAATTAGTGCTAAAACCCCAACAGAAATATTAAAAAGTAATTAGTCTCTCTCTTTGTTAAAACATCACTAAAACC
TAAAACACTCTGTCTTCTTCATCGCATAGCTATTGTTCTTCAACTTTTTTTTTGGTTTTGAGAAGTGAAAGGAAGGAGGTGAATTGGTAAAGAAAAAATG
GCATGTATGTCACTCAATATAGGAGCTGCTTCTGCTTTGAAGTTTGTAAGCAATTCCCAAAATCATCCAGTAAAGCTGTTCTCGGCTAAAGAACAACGTT
GTTCCAACTTCAGTTCCAGCAATTGGGGTTGTTTCAGTCTTCGAGTTCGTCGGAGTTCTTGCCTTCGTTTTGATACACAAAAATCTTTCGCCGTTTTCAA
CAGCCTTCCAGTGGATAATAGCAACCCCAGTAAGAACTACAGCACCCATTTTGTCTTTCTATGTGTTTGTAAGAATCGGAAAAACTGAGAAATTCGGTGT
TTTGATTGCTTCCCCTCAGTTTTTGTCATTTGGTTGGCTAAAAAATGTCTTGGGAATTTTGCCTATTCGAATGTGATTCTATTACCTCTCACTGAAGGGA
TATGTTAATACCTGCTTCTTTTATTAGATATTGATTTTCACTTCCCCTTAAGAGTAGAGAATGAATTTTGAGTTGTTATTCAATAGCTTGGAATTGCCTT
GTAATGCCGGAAGACCCTTTCTTTTCGTCTTTTTCAATACTAAGTATTGTCTTTTGGTGTTTATATTTATCTGGCACATACAGATACAGTAGCTGTTGCT
CTGCGATAGATATTGTACAAGTTCCTTAGCATTATTTATTGATTCCTTTCTAATTGTTATTATAGAGGAAAGTGTGGTTGTCTTGGTAATTGGAGGAGGT
GGGAGAGAGCATGCGCTTTGTCATGCTTTGAGGCGATCCCCTTCTTGTGACGCTATTTTCTGTGCACCGGGTAATGCTGGAATTTCCAGCTCAGGTGATG
CGACTTGTATATCAGACCTTGATGTTTTAGATAGTTCAGCTGTGATTGCTTTCTGTCGTAAATGGGGAGTTGGACTGGTTGTGGTTGGACCAGAGGCTCC
GCTTGTTGCAGGCCTTGCTAATGACCTTGTCAAGGAAGGAATTCCTACCTTTGGCCCCTCATCAGAAGCAGCTGCTTTAGAAGGTTCTAAGAACTTCATG
AAGAGCTTATGTGATAAATATGGAATTCCAACTGCAAAGGTCTGTGCGTACTTCTAGTTCCATCTATATTTACTTGTTTTTCTTGTTTTGGTTCACTTCA
TATCTTGACTTTATCTATGGTGGAATATCTGCAGTATCAAGCATTTACAGACCCATCCGCTGCAAAAGAGTACATCAAACAGGAAGGTGCCCCAATTGTT
GTTAAAGCGGATGGATTGGCTGCTGGTAAAGGAGTGATTGTTGCCATGACATTAGAGCAAGCATATGAGGCTGTTGATTCTATGCTTGTAGACAATGTTT
TTGGTTCTGCTGGCTCTCGAGTCATTGTAGAGGAATATTTGGAAGGAGAGGAAGCATCATTTTTTGCTCTAGTAGATGGTGAGCATGCCATACCTCTGGA
ATCTGCTCAAGACCACAAACGAGTTGGAGATGGAGATACAGGACCAAATACTGGTGGGATGGGGGCATATTCTCCAGCTCCTGTCTTGACAAAGGAACTG
CAATCAATGGTCATGGAGTCTATCATTTTCCCTACAGTGAAGGGAATGGCCGAAGAAGGCTGCAAGTTTGTTGGGGTTCTGTATGCTGGGCTCATGATCG
AGAAGAAATCTGGTTTGCCGAAGTTAATTGAGTACAATGTACGCTTTGGAGATCCAGAATGTCAGGTTAGTTGGATTTGACTTGCCAGGTGCAATCAAAC
TTTTTATGTTCTAATTGCAATTTGTGTTAGTACCATTGATCCTAGTTTCATATTACACATAGGAAAGCATCAGACTTTTTGGTTCTTCACTTTGGTATAT
GTTGAATTTGTTATGTGAAACATACTGCTTTTCTATTACATGATTTGGCATTTGCTATGCTTAGTTGCGCGGACTCTTCACTTTTGATGCCGCACCCGTC
TCGGATTCTTCAAAAATACACTACTTTTGGCGAATCTGACACGCACCCATTGGCGTTTTTGGAGAGTCCGAGCAACATAGTTGCTATGTGCACAAGGTTT
TAGTCTTTCAGAAGCAATAGAAAGCTAGGTGCTTTCCAAAGTAACATGTACTCTTTTTTTTTCCTTTTTTTGTGAAAGAGATTTATTACCATCATGTCCT
ACGTGTGAAGAATATTGTTAAATTGGTTCAAGATCATTTTTGTTCCAAGAGGTGGATAACTAGAGTTGTTATTACTAAGTAAGCGGGTGCTCTCACTTCA
GTTATGAACTTAGAAATATCTGATCTGTTATACATACTCAACAGTCTTTTGGTTTTGGGATTCTTATCTTGGATGACAAGTTACAATTGTCACATTAGAA
CACCACTCCTTGAGTGTAGCTTCATGCCTTCATAACATTTTATCGGAGTGTGGAAGCTATTATACTTCCTCAATCCATAACTTTTTCCAAGACAGTATTA
AATTATAGATTTAGCTTGCTATGGACCCTCTATTTCCTATTTAGTTGCATCTGCGGTGCAATTTGAGTAGTTGAATAGGCATTCAAGTGAACATTTGGTT
GAGCCTTTTTTGGGCAATTACTATCCCAAAGAGTGGGTAACATTTTTGTAAAATGTATACTACGATGGAAATCAATTACTGTATAGTGAGATAGGTGATT
CCGAATTTACAGATGACTTTGTGTTTAACTTAGGTTTGCATACTTTCTTTGTTAAAGCAACAGTAATTAAGTTAGTTCATCCTATATGTTTGTCCTGTGC
GTTGTGTATTTGGGAAGGCAGAATTGTAGGGAAGGGCTATGTTCATCACAGAAAGAGTAGAAGTTTGATGCTTGTCAATACTATTTGGTTATAGTTGGCA
AATTTTTCTGGATACTTTTTTTTCTGTAGGTTTTACATGGTACTTGATGAAACATGTAATGGATACAGGAGTGGGATATAATTGTGCTCAGTGTAATTAC
TATATCTCATAAAACAGTTTTGAAGTCTTTTTCTTATCCTTTGCAGGTATTGATGGTCCGGTTAGAGTCTGATTTGGTCGAAATTTTGCTGGCAGCTTGC
CATGGGAAGCTACATGGGATGTCTTTGGACTGGTCCCCTGGATCAGCCATGGTGGTTGTAATGGCAAGTAATGGCTATCCTGGCAACTACCAGAAAGGAA
CAATCATCCATAAGCTTGAGGAAGCAGAGCAAGTTGCTCCTTCAGTCAAAGTATTCCATGCTGGAACTGCTTTTGATGCAGATGGAAATTTCATTGCTAC
TGGGGGACGTGTTCTTGGAGTCACAGCAAAAGGAAAGGATCTTGAAGAGGCTCGGGATAGAGCTTATCAAGCCGTTGAACAAATTAATTGGGCCTGTGGT
TTTTATAGACGGGATATTGGTTGGAGAGCACTGCCTCAAAAACAATATTCTTAAGGTGAGCTCCTACAATCATCCGTTCCATTGGGACTGCAGCACGACA
TGGCTATCAGCTTTGGCATGATGTTTACGAAGAGACTGAAGCATGGCATGGCTCTTTGAGAAACCACGTAACACTAGGTGTGAGGAAAAGGTCCAGGAAT
AGATAGAAAGTCTTGAATTGACTGTAGAACTTTCTAACAAGGTGATTGATTCTATATTGCCTAATGAAAGCTGTTGTATCGTTATTTTTTTCTTCTTGTT
CCCCCTGCAGTTTAAATGAAATACTCTGATTAGGAGCATCCTATATGTTGTATCTTATCCATATCTTCAACAAAAGCAATTTGTTGTGTGAAAATACATT
AGAGTAGTGGCCTAAGTTCGTTCTCTCCTTGCCTTTGAAGTTACATTTTGTAAGTTCTTGGCAATGTGACAATGTATGTCTAATGGTATTTAGTAATTTT
AACTACGCAAGTTGCTTATTCGAGAAAAAAAAATACCATTTTATTTGACCCGACAAAATATTCCTAACCAATTATTTAACATTATTATTTCCTTAAATAT
AGAACTTGATCACAGAAGAAACTGATTAGGAGGAAATCGAGGAATCAATATCTTGTTAGAGTGTTAGTTATATAGTCCTTAATATATGGGGAAGTATAAT
TGATTATTAAATACTTTATTAATTCAATTTTTATTTTTATTTTTTGAAAAAATTACTGTTTGAGGCAATAAAATGGGTATTGGTATATTAAGAGAAAAGT
TTGTGATTACCGGCCTATATAAGTCCATTGGGCCTGAGGAGCGGGCCCAATATTAAATGAACCAATCAGAAGCTTTAATTTCAATCACAAACGTGCAAAG
CCAAAAAGATGATTCTAGAACCGTCCACGTGTACTCACCTAACCCTCACCCTCCTCCTTATCTTCTCTTCTTCTACACTTTGCTTTCAACTCCTCTTTCT
CCTAACTCGCCTTTTCCTCTAATCCCCAAATTCTCAATTCTTCTTTCTCTTTAGGGTTATTTGGGGTTTGCTATGGCGTCTTCAACTGCTCAAATTCATG
CTCTTGGAGCTACATATTTCGCTAATTCATCTTCTTCCACTAGAAAACCTTTAAAGTCTGTGTTTTTGGGCCAGAAACTGAACAATAGAACCCTAGCTTT
TGGATTGAAGCAGAAGAAGAGCCGGGGGAATAACGGTGGTTATGCACCGATGCGTGTGGTGGCGGAGAAGGTGGTGGGAATTGACTTGGGGACTACTAAT
TCTGCTGTGGCTGCTATGGAAGGAGGGAAGCCTACCATAGTGACGAATGCTGAAGGACAGAGGACAACTCCTTCAGTGGTCGCTTATACTAAGAGTGGGG
ATAGGCTTGTTGGTCAAATTGCTAAGCGTCAGGCTGTGGTGAACCCGGAGAATACCTTCTTTTCAGTGAAGAGATTCATTGGAAGGAAGATGAATGAGGT
GGATGAGGAGTCGAAGCAGGTGTCCTACAATGTCATCAGAGATGAGAATGGAAATGTCAAGCTTGATTGCCCTGCCATTGGCAAATCATTCGCTGCTGAA
GAAATTTCAGCTCAGGTATTAGCAATCTTGTATTCTGCTTCATAAACACGCTTAAGATTTGTCTTGCATGTCTAGACTAGTATTAATTGTATGCTTAGAA
TGAGATTGCAGCTGGTGTTTCTGAACATTCTGACAAAGAAACTGTGGTCCTTGAGCAAGTCTGGACATCTAGGGTGCTTTTGGTATGGAATAGGTAGAAG
AGTTGATAGCAGATGATATTGCAGGGTGTAGGAAAAAGTATTAGGATAGCGCTCAACATAAGGCAACAATATCTAAATATTGATTACCTCGAAATATCTA
AGTATTGATTGAAGTAAGAGATATGTAATAGGAGTCGGGGATTGTAAAAGAACATTATTTTTCCTATGAGACAACATAGTCCACAGTTTAATGTAACATT
CACTTCAAGTCCAGGAAAATATTCCTCCATATGCCGGAAGGAGGAGGTGTACATTTTTTTAGACAGTCTTTTACTCCACGGCAAGAACACCGGCAGTGTA
ACTAACTGTCTTTGCAATTTGAGATCTTGAAGTTCATTAATTTATATGCCTTTTGCTGTAGTTAGTGTGAACAATATGATTTTGCTGTTCAATAAAGCAT
TAGTTATGTGACACTATTGCAAAGTTGATTAGAAAAGAGGGCATATAGAGACTTGAGCATACTGCCTGATACTTATTTCTTGGATTTTTATTTTTTGGTT
CCATAGTCAAGTGAGCTGACCTGAGTTTGCTTCCATGGTTCTGTTGACTTACTAATGATTTTATTTTCTGGTTTAGGTCCTGAGGAAGTTGGTGGATGAT
GCATCCAAATTTTTGAATGACAAGGTTTCCAAGGCTGTTGTCACGGTTCCTGCATACTTCAATGATTCTCAGAGGACAGCAACTAAGGATGCAGGTCGCA
TTGCTGGATTAGAAGTTCTTCGGATAATTAATGAACCCACTGCTGCCTCCTTGGCTTATGGTTTTGAAAAGAAAAGTAACGAAACAATTTTGGTTTTTGA
TCTTGGAGGTGGTACTTTTGATGTATCAGGTAATAATTGCACTATGGTTCCCTCCTGGGTGTTAGCTCTGTTGTGTCTTGAGACCGTTCCCTGCTTTTCG
TGCGTGGCTATGTTGTTGCGACCAGTTTGGTGTTTTTCATACTTTGAGTTTCCAACAATCATGCTGTACGTTCAGCCATAATTCATTGGAGAAGGGGATA
GGTTAAAAACAAGTTTGTAGGGGTACTTTATAGAAACTAAAATTAAAGGTTTGAGCTAGTAGCTGCTCTTTACTGCTGGTTATCCCATAACTTTTTGAGC
TTGAGCTGTGGTTGAAAGATTCTTAGGAATGGGCTTATAGCTGGTAACTCTTAACTGTTGTTTCTTATATTATACGACCTCTGTGCTGGGTTTTTGCTAC
TGTAGCTTTCCTATATAGTGTGGGGAATTCTACTATAGGATGTCTTTTAACATCATGACTTAATGACTTGACTTTATCCATGTCTCTGTGAACTCATGCT
TGTGGCAATTGTAACAAATTTTTTTCTTGCAGTTCTTGAGGTTGGTGACGGTGTCTTTGAGGTGTTGTCAACTTCTGGTGACACCCATCTTGGTGGTGAT
GATTTTGACAAGGTTTATTTTCTGTCCCCTAAACGAAAATGTATTTGTCACTTGATTGAGCAATTTACCTCTAAATCACTAGTACCTGCTCGAAGTAATT
TTGAAGTATTCCACTCATGCAGAGGATTGTTGATTGGCTTGCTGCAAGTTTCAAAAGAGATGAAGGTATTGATCTTCTAAAGGACAAACAAGCTCTTCAA
CGTCTGACTGAGACTGCTGAGAAAGCTAAGATGGAACTGTCATCGCTGACCCAGACTAACATCAGGTATTTATGACGTTTTCAAGCTTTATTTTTCTTCT
TTGCCCTTTGGGGGTGTAGTCCGTTGATTTTGAAATTACATTTTCTGTTGTAGTTTACCATTCATTACGGCTACTGCTGATGGTCCTAAACACATTGAGA
CCACTATCACACGTGGGAAATTTGAAGAACTATGCTCAGATCTGCTTGACAGGTAACAGCAATATAACACACTTCCTTTTATAGCTTATAAACTTTAATG
GTTAAGTTGCTGGCTTTTACAAGATTAGAGGATTTGATGTCAGCTTTTTTGCGCTTGTTCTGCAATTAGGCTTAAAACTCCTGTTCAGAATTCCTTGAGA
GATGCCAAGCTCTCCTTCAGCGATATTGATGAGGTCATCCTTGTTGGTGGTTCTACACGTATCCCAGCTGTTCAGGAACTTGTTAAGAAATTGACTGGAA
AGGACCCCAATGTTACAGTTAATCCCGATGAAGTCGTTGCTCTTGGTGCTGCAGTGCAGGTAAGACCTTTGTTTGTTCCTGGTTCTTGTATTCTGGTCTT
GATTAGTGTATGTTGGTGCACATTTCAATTTCTTCATTATTCTAGGCTGGAGTTTTGGCCGGAGATGTCAGCGATATTGTCCTTTTAGATGTCACACCAT
TGTCCATTGGTTTGGAAACACTTGGTGGTGTGATGACAAAGATCATTCCAAGAAATACAACATTGCCTACCTCCAAATCAGAAGTGTTCTCTACCGCTGC
TGATGGTCAGACAAGTGTAGAAATTAATGTCCTCCAAGGAGAGCGAGAATTTGTTAGGGACAACAAATCTTTAGGTAGCTTCCGGCTTGATGGAATTCCT
CCTGCCCCAAGAGGGGTTCCACAAATTGAAGTGAAATTTGACATTGATGCCAATGGTATTCTTTCCGTGACTGCTATTGACAAGGGTACTGGGAAGAAGC
AAGACATCACCATTACAGGTGCCAGCACATTGCCTGGTGATGAGGTATGATTTTGACTTCCAATTCTACTAGGGACTGTCTCCTTTAACAATTCTAGCTT
GGTCAACAAGTTTTGTGTTTATAAGTTGCTGGAATTTGCCTTTTTAAAAAAATTTCCTTCTATTATTGGCTTTTATTGCCGTTGGTTGTATATGGAGCAA
TATGTTTTGCGTGTCATTCCATTTTAGCTCCCCTTGCTGCTCATATGTGATGGGATTTCTGGTTGCATGGAAACAGGTCGAGAGAATGGTTAAAGAAGCT
GAAAGATTTGCCCAGGAAGACAAAGAGAAGAGAGACGCCATAGACACAAAGAACCAGGCCGATTCTGTTGTCTACCAGACAGAGAAGCAGTTGAAGGAAC
TTGGAGACAAAGTACCAGGGCCAGTGAAAGAAAAGGTTGAGGCTAAACTTGGAGAGCTTAAAGAAGCAATCTCAGGAGGGTCAACTCAGACCATGAAGGA
TGCTATGGCTGCCCTTAACCAAGAAGTAATGCAGCTTGGTCAGTCACTCTACAACCAGCCTGGTGCTGCACCAGGTGCTGGTCCAGCACCTGGCGGTGCT
GATGGACCTTCAGAATCATCATCTGGGAAGGGACCTGATGGAAATGACGTAATTGATGCTGATTTCACCGACAGCAAGTGAGCATAGAAGAGCAATTTTG
AGGCTATATTTAATTTTCAGCTTTTATACTCTTGCTTAGGTTGTGTATAAGGGATTTAACTTTGTGCACAATTACGATTTTGGGGGACAATTTCTGGTGG
AATGGGGTACGCTAAAAAGATAATTCATACAGGGGAACTAGAGGTTAGAAGTGTTGAGGTAGGTGGAGTTATTCTTGATTGCAAAATGAAACAGTGTCTG
TCTGTCTACCCATGAATATTTTTAGAAAAATGTTAGTGGTTCAAACCTTAAGGTTAGAGAAACTGACCTTTCTGGTTCTCTCACCCTACTTTTCCACAAT
TCTATAGGTAGTCCTTGTGTTCTTGGATTACTTGCTGTTATTGGAGTGAATGAATTTGTACTTATTTCTCAGTACCTATTTTATCTTTTCAATCTCACAC
CTGATGTTGATGCTATCATTAATGGACAAATCCTAGCAGAAGAATTCCGGCCTTGCAAGTACAAAATGATGTTCCATCAGAATATCAGTATTTTTTTTAT
TATACAAAGCCCATGGTAAAATTCAAAAGACGAATGTACATCCCTTCTAATATGATATGATAAAGATAAATGATATAATGAAATATAATTATTTACTGTA
CAATAACGTGTACCAAATAGGTTGGGGCGTGTGTGTGTGTGTGATGATCTCTTAAAGAGTTTTTATGTATCCGCTGAACCAGCCATATTTGAGAAGCGAG
GGCTTAATGGAATGGGACTGGGAGAAAGACTACTGGTTCTTCTTTCCACAGAATAACCTCCTGGAGAAGCACAACCATTTCCATTTCCTATTTCTATAGA
GTAACTGCATGGCGATATACTTCCATTTCTCCTTTCATAGTCATCAAAATGCATACATTTTATACAACATCCACCACCACGGCTGTGCCTATAAGAGGGT
GACTGATAGTAATGTTGGTTAGGATCCATGTGATACCTTAACCCTTCCGCTCGGCCAACCGACCTAACAGAAAACAACCTGTCTGGCCCTTTGATTGGAT
CACCAGGACCATGACTATGTTTGTTTAAATGATAACCATTGTAGTGTTGTTGTTGTCTATGGTTGTAATAGTGATGTTGTTGTTGCAAGTTTTGATGTAA
CCCATGCTGCTGCTGGTTACTGACATTGTAAAAGCTAGGGGAACTCTGCACTTTGTGCAATTGACTTCTATTTTGAAAAATACTTTGCAGCAGTGACTCA
TGATTAACACCATCAGTAGTGCAACTGTCAGGAGATCTTGGTGAAGAACAAGCAGAGGAAAACCCAAAAGAGGCTTGACTTATGCTTAGAGCTGGTTGTG
GTGGTTGCTGTATCCTAATCCCTGCTTCCCTTGCACGTACTATACCATTAATCGCATCGATGTATCGTTGTTCTAAAGGTTCTGGTGGCGTTGTGTGGTG
ATCCACCACAACAGGCTTTGCTGGGAACAGAAATGCACGTAGTCTCGGGATCCCTGCACTCTCACAACGATCATATTCATCCAACATATGGCGTAGATCC
TCCTCTGTTTTAACCGAGATCAATGCATCAAGCTCCTCGTGTACTAGTTGATATTTCAGAACCATATCACCTTCAATTTGAGGAGTTAGCTTCTTCATCA
ATTCTGCATCAAGGTGAAACATCGTCTTTTCAATTCCCCACACACACACATATATATATATATTCATATAAAATCGTACTGTTCAATGCATAAAACATAT
TTTTACCTGAAAGTTTAATGTCTCGAGGAACGGAGATAACACGTGTCTCGCCACCGACATACTTGAGGTGGCCATCAGCTGGTTGAGGAAGAATTTTTCC
TCCCTGGCTACAAAGAAATTTAATCCTACTCTTAGGGGAGGTTGGGCTGGACCCTAGTGGTGAACCACATAAAACAGGTTCCTCCACTATTGGCATTATT
ATAAAAACAAATGCTAAAAACCCAACAATAGAAAATAAAAAATTAATATACACAAAGGGAAGAATTTAGAATAATTTAAGAATATAACTATGTTTCAAGA
ATTGAGATAAACAAAGACAAGAACATTCATGTATTTGAATATTTATAATAATACGTATAAATTTTATTTATTTATTTTTTGCCACAGATTTGATTGTCTG
GTTCTAACAATAGTGAGAATAGCAGGAAAAAAAGAAGGGACTTTCTGGTATATAGGCTATTAATTTGTGAATTTTTTTATGGTATTTCGTATTATTCTGA
GGATTCTTTCATTTTGATTCGATTTTTGAGGGGGATAAAAATGGATTTTTAAATGTTTCCTTGTATTCAGGAAATTAAAGGTTGATAATTTAATTGAGTT
GCTCTACATTCGTTGAGTAATATTATGGTATTTTATAATAATGTTAAAGAGAATTGTAAGGCACCTATTTTGGAATAACAATCAAAAAGGATAAGATACT
TTATGTTACGTTACTAACACGGAGGATGTGTTTGGATGAAACTAAAATAATGGAAAACACATATATTACGTGAATTTGTGTCATGTGTTTAAATCAAATT
ATGTAATTTCTAATATAGTTACATAATTTAATAAGTATAATATTAGCTAATCATTATCAAGTCATAGTAAAGCAAATACTAAGTTGAAAAATAGGGTACG
TTGATTATTTGGACCCATTAGGATGCCGATTAGTATGGTGTATTTGTCAACTTAACATGTACATAATTTTTGGGTAATAGTATCAAGCCGGGATGGCATT
TTTACGTCTTTGAATAAAAATAAAAATAATATATTTAATATAATTTTATAATTAAAATTTAAGAAAAATAATTTATAATAAATTGTACTAGATAGGAAAA
ATATTTCATATACCAGTAGCTCAAAAAAAACATTATAAAGCGATTTAAAAAAAAAAAAGCTGATAAAAAATAAATTAAAAAAACAAGACAAAATGCTAAA
CAAATGACATAAAAAATGAAACAATCACCATCCTAAGACAACATGAAATTGAATTAAAATTGAAAGTTACCTGACTTTCTGAAAAAGAACGAACGCATAG
TTGAGTGATTATATGAAATTGTTATTAACAAAAGATATAAATGATCTATTTGATCTATAACAATTTTGATCATTTTCCGTAATATAAATAGAACAAATTA
GCTGACTGATCAAAATTCTTTTTAACTTTATACACTTTAAAGTTAGTGCTTTAATTTTAGTGGCACCTCCACTCTTACATCTTTGATTGATTTTCGGAGT
TTTGCAAACTTCACAAGCCACTTGATTTAATTGTATTTCTTGCTTCAAAATTCACAGCAAGAGTAGAGAGATTCGGTTCTTGCCTTTGAACGCCATGGAT
GTGCAGTTAATCGAGTATAAATTGACCTGCAATTGTAACCACAGAATCTACAATGTCATTCTGGACGACACTGAAATCGAAACTAGTGTCACCGTTGATC
CTTGTTCCGTCGCCTCATGGATCAGAAAAATCGAAACCCAAAACAGATCCCGTCTTCACCGTTTGATTGTAGGGCTTGACATCGAGTGGCGCCCAAAATC
CAATCCCGTCGCCGACCGAAACCCCGTCGCCACTATCCAGCTCTGTGTCGGAAAATCCTGCCTCATCTACCAAGTTCTCCACTCCAGACACATCCCCCGC
CGACTCCGACACTTCCTGAACAACGACGACTACACATTCGTTGGAGTTGGTATTCGTAGTGACGTGGACAAGCTGTGGGAGGACTATAATCTTGAAGTAT
CGGACATTGTTGATCTCCGGGAGTGGGCGGCTGAGGAACTGAACAAGAAGAAGCTTCTTAATTCGGGGCTCAAACATTTGGGGAGGAAAATTGCGGGAAT
AGAGATTGAGAAGCCCAAGAGTGTGACAACCAGTGATTGGGATGAGCGCTGGCTTAGCCGTGAACAGATATGTTATGCTTGCCTTGATGCATATATTTCT
TTTGAAGTTGGGAGGGTCTTAAGTGCTTGGTACTAGAAGAGTGGACACAAGTAAATATGTAAGTAAAATATACCAGTTATCGTTTTCTTCTACTCAAATT
TGTAAGTGTGTGTGTGAAACTATTTCCTCTATCTTGTGTTGATTCTAGTTTACTATCTTGATTATGAGAGATATATGATTTTGTGTTCCTTTGTAAATAG
TTGTAGTATTTTAACTTAAATGACTTGTTCGCACTAGATTGTCATCTGATTTCTTTTACTACTTTGTTGTTTCTTGTACTTCGATTATCGTATAGTTATT
GTTTAGAATGATTTGTCAAAATTGGTATATTTGTATTACATCTAGGATGGGAAAAAGGTAAAGACTCAATTAGATAACAATGTTTCAAAGGGATCATTAA
ATTCAGTATTGACATGCTATGTTGAATTGGACTCGTTGGGTGCGTGTCGGATCCTTCAAAAGCAGTGCATTTTTTGGAGGATCGGATGCTGGTGCGTCAT
CATTTTTGGAGAGTGAAGAGTAGAAAAGATCTTATATAAAAAGAGTCTTGGGTTGAGTTGTCCTTCTCCACTGCTTGATCATTTTTGAACAATTAAGAAA
CCTGCTCAGTGTCTGATTTTGATATTTGTGACACAAGGATTGTGTTATTATATTGTTTTGTGCTTAATAGTTTATGGCCTCATAATTGATCCTGTGTGAA
ACCAATTGTGAAGTCTTGGTACTTCCATTTTTGTCTTCATTGTCTGATGTCCACATGCTTGTTGATAATTATACTTATTTTAAACTCATTTTCCTTATTT
TGTTATCTAGACTTTTATTTGCTTTTTCTTTTGTTTTTTTGGACCCATGTTCCCTCAAAAGTTCACCTCACTTTCCCAGACAATTGTTATGTCACTATTA
TAACTACTGGCAAGGCTTTGAATTGAAAAGTCATTAGTTTATGCCTAGATTTGGATCTAAATAAGCTTCTTCATAGTCAAACATGTGAATTTGACTTCGA
CAGTTAGATAATTAGGGATTAAGCATCTAAAATATAATAGAACACTAAAAATTTAAACTTAATTATATGACAACCAAATGTAGGGGGGTAAGGTATGCTT
ACATTCTACTAACCTCACTTGTGGGATTACACTGGAAATGTTGTTGAATACCAAATTTAACTCAAAACTCAACTTGCACTTATAACTTCTAAGATTATAA
AACCCCACTTTTTGTGCTTATTATTATACTACATAAGATTTAACAAAAGAAGAAGTTCACAAAAGAGAAAAGATAAAATGCCAAAGATTTAACATTCTCA
AGATACAAGTAGGAGTGTCTCCCTTGAGTACAATACACATACAAACTTCTCTTCTTAAGACAGTGAATTCAGAGGGAGATTTAGAGTGAATTGAACTGAA
CTCACACCGTCCGACTCAAACTATATATGTATATGCAAAAGAAAATAAAACTATAAATATATATTAGTTCACATCTGTCTTGAAATTGTGGACTTTAAAT
CTTGAATTCTCTCCACTCATGAGCTAGGCCAAAATGGTGAGTGTGGGGACTAGGGGGTAATGAACAATATAATAATACTCCATATGTTCTTCATTGTGTA
GCCCCAGTTACTAAAGAACTCTTTTGACGTTGAAAAAGCAGAAGTACTGGATTAAGTTTACTTTTAAAAGAAAAAGAATGAAATGATTCATTTTAATGGT
GACTTTCAGATTCCAAAAAGGCGCTTACAGGCTTTTAGGATTCTGCCACTTCCATTTTTCTTTTTCTTCTTCTCCCTACTATCCTCGTGAGCTTCAGCAA
CATCATCCAATATCGGAGACGAAACGGTGAATCCCTGATCATGAATCCTGCAATACTTCTCAGAAACTGATGAAGATCTTCCCATTGAGAAAGCTCTTTT
CACTGATTCAAATGGTGATGTAGTTGTATTCTTGCTCCCTTGTCTTTCTAGTCTGAACCTGTTTGCTGAAGCTGCTGATGAAACAGAGCAAGCCCTGCTC
AACTTCACAGCATTAGGATTGTTGTTGCTGCCCTTCATATTTTCTTCATTGGCAATGGCATCTTGATTCTCTTTCTCATTCTCATTCTCATCATGGGGTT
CTTGTTTCTTGCTTTGTTGGCTTTTGGGCATGGATTCAAGATCTATGACATCATGAAAAACAGTGTGATTTGGGCTAAGATTCTCATTGGTTTTCTTGTG
GTGGAGATCTGAGAAATTGTTGGATCTTGATTTGTTGGTTCCATTGATCTTGGTGTACCCATCCATTTTCTCTTTTGACTAGAAGCTATCCAAGAAAATG
TGTGTATAAATATGATGTGGAAATGAGGTAGAGATAGGTTTTAAGAGTTGAAAAGCATGGTCAGGACAAAAAAAAAATGAAGTTGATTGGAAGGTAAGCT
GAGATAGATTCACCCTACACATAAAAGTGATAACATATTATTATGTCAGCATCTAAAGATTAAAGTAATACAGGTAGATATGCATGTACTTGACTCGAAT
CATGTATATGTGTTTAAAAGTAAGTAGAATCAATAAAATTTGAAGGTATATTCTAACATGAACCAGAAATATTGGAATCTGTATCCAGCTACGATATAAT
TTGTCAATTATTGACTAAGAAAACAGGGATTTAGTTATACACTTTGGAGTTTGGATATTAGTGAATGAAGTAACTGATGTGTAAAATACATTTTACTTTT
ACCATTGGTTTTTTTTACAGGTCTGCACATGTATGCTGGTTAGGCAAAACTATTCAATACTTACCTCAAATTTAAATAATTTAACACGTGAAAATATTAC
CATACACCACTTGGCGTGCTTCATGAAGATCTTATACAATGTTACTCCATACGTTTATCTGTTTATTACTGTTTGAATAGTACATTAGATTTCAAGAACT
TGGGTACATTGCTAAAGAAAAAAAAATGCATTCAGTGGTTTATATCAACATTCAATTAAGTGTATTATCGTTCAGATCTTTTTACAGTATGTGTGCCAAT
AAATAATATTAGATCAATTTTTTTTAAAAAAATAAATGTATATGTAAAATACCTAGTTTGGCTGAGAGACGACATGTTGGCCTGCACCATTATTTCGAGA
GTAGATCCGGCCTTTGGCACTTTTGTATTTCTTTTTAGTTGTTATTTTTTCAATGTTTATGAATGATTAATTACTAATGACTGGTAGTATTTTTACACTC
GATTAGGATCATTGTTTTCTGTTGTTGCTTTATAATGTAATGTATTGTACAGTACTCTATTATATTGTATGGTAGATACAATGTTTGACTAGACTTGTAA
TTTACAGGACATTTTATTAGTTGGTTTGATTGAATTATATTGTATTATAATTTATAAATTTATTAAAATATTCTTAATTATTTTAGAATAGAAAATTTAA
CTAAAATTAGATAATATACGTATGATGAAAAAGAGAGGGTAATGAATGTGAGGATCCTATAAATGAACATCAACGCGGAGCCAGTTGTTTCTGTGAGAGG
GGATTCGAGTATAGGGCGGGCGAACCAAAGCTATTGCCCATAATGGGAGGAGTCAAAATCATCATTTCACACTAGCTGTCTCCCACTTCTAGTTTCACTT
TCTATTTTTAAATAGTTGACTGATGCATATTGTTAGTTTTTATTTATTGAAAATAAATATTTATTAATTTTGACAAGTGTTAATTTGATCAACATAAGAA
AATTATTTATAATTATTAATCAATTTAATAATTAAAATAAATTAATTTATATTTATTTAAGAGATGTAAAATTTAAGATGATAGAGATTTTTTTTTAATA
GAAATGGAAAGTATATTACTTACTATGTAAATTCAATAATTTATGCATGTCGGTTTGTATCACTTCTATTGGTGCGTGTACGATGAAGACACATGGTTGA
GGCTGACACTTGAAAGATAAGATAAAGTCTTCGTAAATTTTTTATTCCTTTATTAAAGATAATTCTATTTTATATACATTGCTCCCTAATTGAAAAGAAA
AAGATCGACTTATCATTAGCCCAAAGTTAATTCTATAGGAATGAGTTCATTTAGTTAAAGAGTACCCTTGGTACACATTCTTGATTTACCCTCAAAAATA
AAGTAAAGACGTTTTTTTTCTCCAACAAAAGGAAACTTCTTCAAACAATTGGTTTTGAATTATCCGAAGCATTCTCTAGATTTAACAGCTTCAGATAGTC
GATAGCAACAACTTCAGACTTAATTAAATATGTAAATAGAAGAAGTGTCTCTGCTGATGGTATCCTAGCAAGTTGTTCTACTTAAGGTTAGTAGTAAACA
AAGAACATTTTCAATGACCAACGAGGCGTGAGAAAAAACGAATAAGAAATAATAGAACAAATAAAGAAAACAGTGAAGCTTCAAATTTTGGTTCAATTCA
ATTGCGCAAAAGTAAGTTGATCGGCGTACGCTATAAATGCACAAGACTTTCTAAGTTCAACCTAACAAAGTTATTCCATCTCCGTACATGAAAGAACTTT
GGGAAAGGATAACAAGGAAAAGGGCAAACAAAAGTCTGAACAAAAATGAAATAAAACAAGCCCTATAATGTTTGCTGTAACGGCACAATTTTATAATGTC
CTTGTGGTCACACAACCTGGTAACTCTCCGTGGCCAGCAGTGTTCTTTGAGAATGCTTGGGAGTGGCCCCACCTTTTAGAGGCAGCACGTTGACAACCTG
AAAATTTTAAACCAATTCGTGTTACAAAAGTATCAGCAGACAGTGAAGCGAATCTAGGAGAAACGAGACAAGTTTTTTTTTATTCTCAGAGCCTTTTTGA
TATTCAATATTGATTTCTTTACTGCAATAATACTTCTTTCCTAGTAATCTGAGAAAAAATTAGGAGGCTATAATATCATCATCCACCAAAACAATTGCTT
CTAAATTTTATATGGACAAGATCAACTGCATAGAATCACAACACAGCAAATTCCATCGACATCGTTTGAACAGTTAAGGTTGCAAGAGAGTAAACCATAA
CAACCACAAGAAGAAGTTACTCACGCTAAATGAACAAGTATAATAGCAGATCAGATATAATGATTGCATGCAAATAAATCAAAAATAGCAACAAACATGT
AGCAAGAGCATCAGATAATCTCCAGACACTAACTGCTAATGGTCAGCATAGAGTGGGGAGGAATTAGAACTACACCACATAAACACCAAAATGACTGAGC
AATATCACATGGAAGATTAGGAGCAAACCTTCACATCACTGAAGGTTCTCGAAGAAGTAAACTGTGCAGAAATTGGAAAGAATGCTGATGGATCAGCAGC
TGGAACAACAAACTCTAGTGATCCACTGCAAAGTACGCAAACTTTCACATTAGAAAGACTGAAAGACAAACAACCTTAAGAGCTGTGTACTTCAATTGAA
CAAACTTTTAACATTAGCTAACCTGCGGTTCGAATTGTCAATGAGAAGAACAGACCACTCCAAAACAGAATTTCTGGAATCGTACCTGCAATTGGAGAGT
GAAAAATATTAAAATCTACCAGAACATATGATAATCTGTACTGCACAAATCCAGCAGTTCCATTCAAGTTCCCAGTCAATAAGGTCAGTCAATCATCTAT
GCCTCAGAAAAGTACTTAAGATTATACCAACTACAATTAGGTCTGTCAATAAGGTCTATGAATAAAGGGATGAAAAATTATACCATTCTGCACTGCATTT
TAACTGACTTACCATTTTCCTCAATATTATCATACCACACAAATAGAACAATATAGCTAAACTACAGCCAGTGGCCCCACTACCATTTTTTACCTTTTCA
TGTCAGTTTCTCTCCACTGAATTTCGCTTAAGCACTACAGACATGCTACTAAACAATCTTATTTGATAGTTCTTACGAGGTGCAACCAAAATGAATATAG
GAGTTCATATTTCTTCTTCAAGGAAAGCAAACAGAATTGAAGCTAGCTTTTGAAGGAATAACTGTGTGACATTCATCCCTCCCTTTGAAGAACCACATCA
TGTGTGAACTTTCCAAGCCAATGATTCTACAAAAATCCTATCGATATGCAACCACATCAAATAATAAACATGAAGCAGCTGCTTCGCACTGACCACAGTG
AATGCAAACTAGTTATGCAAAATGGGCATTTTTAAAAGCAATAAACAAATTAGCATCTTAAAAGTACCATGGTCTTCGGTGCAAAGCCATTTCTTAAGAA
GATTAGTGTAAGTTTCAGTTTTAAAATCCAGTGAGAATAGATCTCTGATAAAAGGATGATTGCTTAAACATAGCAGAAGAACAAAAGCTTGAGTTTTAAG
TTAAAAAATCACCTCCACTCTCCATCAATCTGTTGTACATTTGGAGCCTCCCTGAGAGCTGGAAGGGGTACAGAAATTACAACATTTTGTAAATCAATCT
GCGCGGGGGTTTCATACTCGATATTCACATAGGTTTCACTTCCAGAAACTGAAGGCCAGCAGTTAACTGAGACAAAATATTTGAAATCAATGATGAATAA
TAACATTAATTAAACACAGAAGACAGCACTGAGATTTAGAAAAGTGTTAACTGAAATTCATGAAGCTTACTTGTCAAAGGCAAAATTGACTCATCTGTGC
TTTGCATTCTCCACCTCAAAAGACTAACACCATCACCACCTTGCCCTGTGGGAAATGACCTATTGGGATCTTTAAGGCCAAGAATATTTTCATTTGCAAA
CAACTCCTTGTTCATGTTTGGGTGTGCTTTGAAGAGGATTGCTGGATTACCACTGGTTTCAATCTGAATATATAGTATGGAATGAGCAGTAAACTACAAT
ATCACAAAATTCACAAGCAAAGCAAATATGAATGCCTTCTAAAAGTCAGATAGACTTCCAAATGCAGAGCTAGACAGTCCAGTTTGTACAATTTCAGACG
GAAAGGGGCCAAGTGAGTCTTCAGCTATATTGTAAAGAGTGCATATTGGAAATGTTTTACAAATTTTCTTAGAGAAGAAGTCATGTATTGCAAGTAAATG
CAGAAAAAAATATTTAGGTTCCTCTTTACCCTTTTCAAAATTTCAAATGATTGCCAGTCGCATATCAAATGCAATCAAATGAGTAGAGCTGGAAACGGTG
TTTGGCTGCAGATGACATAAATGATACACTACACTACACCAAGGAAATCTACATGCACACTGCATCATTTTATTTTTCATTTTATTTTTTGGCATAGAAA
GGGAATATAACTAAATTTGTTGACATTGGACATTGACGGAAGTTTTCACAATGAACTTTTCAGAGGAGCCTAAGCATACTTGAAGAGAGAGAGAGAGAGA
GAGAGAGAGAGTACCTGCACTTGGATAAAAGCATCTTCTTGGTTCAGAATTTGGAGAGACAAAGTACCCTGGACGACAAAATTGCTGAGACCACCATCAC
GCTTTAGTGTTACATTTATCTTCTCTTCAACAGTCAACGTGACGGGATCAGTTAGTGGAGCAGCAGCTGGTTTGGCCTGACCAACGCTTGGCCTCACATC
CTCGACAATTACCTCACCCTCAGCTTTTAGGGATTCCAGAAATTGGTTGGTCTTCTGTGTTTTACCCAGTTGCATACCAAGACCTTTCGGTGGAGCAGTA
GCAGATGCAGCTGGACGACCTGTACACAAAATTGTTATAAGATACATCTTCATAATTGGTTTCCAAAAAGTTCTCTATGGTTCTCCAAGAGAACCTGCAA
ATTTGGTATTTCAAAAGGATAAACAGGAATGTGCTTCACAACCAAGATACAGTAACCCCATCTAGATGCAAACTTTTCAGATATCAAGAAAGATCACCTC
AATAAGTTGTCACAAACACAGCAAGTCGGAAATATACAACTATCACAACTAAAGGAAGAAGACAAACAAAAGGAGGTTCCGTTTTCCCTTCTTCCTTAAG
AGACTAAAGGCGAGGGTTTCGTAGGAATTCTAGATAGTTTTCTCGAGTGTGTCATATTTATCAAAACCTTCCGTTCTGCAAGGGGAACATTTGGAAGAAA
GTTGAGTGTCCTCCTTCTCCTTCATTTTCATTCTTCTTAATCACCTACAACAGCATATCTTTTTCATACTATATTCTTTTGGGTCACCACTATATACCCA
ACTCAGTTTTTTTTAAAAGGTGGATTTTTCCTTCCTATCAAAATTGTGTGCTGCTTCTTTACACAGTATATGTACCTATAACATCAGAAGGGTGTGTCTG
CAGCTTAAAGACATGTAAAAGAAGTGCACGAGCAAACATGAAAAAAGGGTTGATGCACCCCCTCTACAGAGATCTAGCAACGATCCAAAGACACGTCACA
TTGCAGGGTGATTCAGAAACAAACCCTTGGATTTGGTGGAAAATGTGTCCACATCAGGGGGTAGAGCAAATCCACCAGAACCATTGCCTCCTATGTTGGA
TATGCCTGAGTCGCTGCCAAAGCCAGTATCAATTCTTCCAGAACTCATGGATTGCAGTGACATGAAACCTCCTTTGTCACCTCTATTCCTCTCAATCTGC
AGTAAATGTGTAGAAAATTATGTTAACGGTACAATCAAATAGACCCAAGACATGAAATAAGATAATAAATTTAACATTTAGCATAGCTGACATGCGCCTC
CTGAACTACCTTGCTTTTGTCAATTTCACTGGCTTTACGCTTCATGACATCCTTAGTTTCATTTATCTTGTTCTGTAAGACTAACTTGTGTAATCTCTCC
TCGTGACTCTCCATTTCACAGTACTGCTTGACTTGTGTAACTGTAACATTTTCCTTGTGCCCAAGAGAGATCACTTCATCAAATGCAAAAATAAGCTCAA
AAGCCGTCCTGCCAATTCCTTCCTCATCTAGTGAATAAGAATATTCAGGCACCTAATAATGGTCAAGGAATTTTCCAAACTTCTCCATTTACAGAAAAAT
CTCTTGTAGCATGAATATGAAACTTGCTTATTTAGATTTATTTGGATTGAACTTGGAGTTACATTTTGCAGGTTACAGAAATTAAAAAGCAGTAATATTC
TATGAACAAAGACGGATAAAGACAATCTAATGCTGAGAAGAAAGGATAATATAACTCCAGTATCAGAGGAAGAGAAAGGATACTAGTTTAGACAGCAGCC
TCAGTGTCTCCAAATCTTCAAGAATGTTGCTCTGTTTGTTGGTCACAAGGAGCAAGTACAGAGATTCTATCGGCTGATAAACATATCGCACATTTTCAGT
CTCAATATATGTATGCTGCTTTCCTATACCAACCAATTTGGGAAAAGCTGCAAGATATCCTTCAATTCTTATACGAGACATATCAACAAATTGCCTCGAG
ACAAGAGCTGCAGAAGACAATGAGATGACATGGTCAATATTTGTCGGTGGCAAATCTATCCTATTACATGAATAAAAGAATATTGAACATCAACATGCAA
GATATGGTTGAGTAACACATCCTAAGTCCTAACACAAACAAACAAAAGAAGCTTCTTCTGTAAGAGCAGAAAATCAAATGAACTAACAAAACAGAATCAT
GGGATTACTGATACCCCACAAGAGGGTTATCATAGTTGACAGAAGCTCTTACACCTTTCAAATGAAAATATAAGAAAGAATAAAATTCTGACCTAGACCT
ATGGAATTAGATGATGGAAACATCACAGTTATGTGAAAAGCCAAACTGAGGAAATAGGACCTTTTGTGGTTACAACAAATTGACCCTTTCCCAGCTTTGT
CATTATTGTACCACTACGCTCAAACACAGCAGCCAGAAAAGACAAACAGTTACAGTTATATTCTCATTTTTAGAATGTTGACATTGTCTCTTTTCTGCCA
TTTACTTTCTAGTTTAAGTTTGCGTTTCATGTTTTATTGCTTTCTTCTACATAACTTTCATTCCCTTCCATTCTCCTTCTAGGAAAATATTATTTTATAT
TTATTAGTCACATCTATACTACTACAAAGAAGGACATAGCAGTGGCAGCACAAATACTCATATTTTCTCTTCCCTTGTCTTTCTTCCTCTGTTAAAAAAA
AAAGAATACCACAGGAAGCCTGTCAACATTGTTTTTTTCTTTCTTTGATGGGCGGAAACCTCTCACATTTCTTTTAACGAGATAGTCTTATAACATCCAA
ACTAATTAAGTAGGAGTAAACATTACTAATTCCTAAAAGCAGTCCAAGGCGTAATAATTCTTTTCTGCACTTTTCTTGGAATGAAATGTTTTTAATCCAC
CAATTATTACGACAACCACTACATACACTAGCAACACACCGAAAAGCATCATAAGAAGAAGTAACAAGCCAAAAATGTAATTTTGCATGAACCAACAGTT
GTTTATGATGACAAATATATTACTTGGAATACAAGTGTCAACCATTACAAATAATCAAACACAATGATACCAACGTGAACACTTCAGCATCTTTGCAACT
AATACTAGTTAAACAAAAGAGATGTTGAAAAACTCTCCTTAATCAAATGATGATTAACTTGAGACATTCCAACTCCTTTATAAAGTACTTCACTGCCAAT
TGTTCAGCCTATTCTTTGTTGCAAGCTTGGATTTTACATGTCCAAAATCACATTCTTAGAGGTTATTTTTGTGCCTCTAGCTATAACTTAATGGAACTAT
TTCCTCTGCCTTTTACTGTAATTTTTAAATTTGACCAGATAAGTCTTGCATATTAATGTGAATGAAACGGCAACTTCTTTAATGTCAAATGTTATTTCGA
GCTTTACACTCCAACAACATTCTTCCACAAAAAAATAATAATAATAATAATGAAGAGAACAGTTCTTTATATCCATGAACTCTTTAATCTTATCCCATTT
TGCCATTGTAAGTATGCTATTCTTAAACTTCATTTCCAATCAAACATATAAAGTGTAAAGGATGGAGTAGCAATTTTTGCTTGTACATTCTCTGACTTCA
GTAGAATTCTGCCAAAAATCATCAACTAACATTGCACTAGTCTCCACAAACCAGATAATTCCAAAAACATATGTAGAATGTGACATACCTTTGCCAGATT
TAGAAATTATGGAAGCCGCTAGAACAACCTGCACAGCATATACGGAGTATAGTTATCATTGCAGTGTTCTCCTTAGCTAATAATCTCTAGCTTTATTTTT
AAAAAATGACATATCATTCAAATCTACACAACTATATCGATACAAATTTATCAGCTGAAGTATTACCATCTTTGTTGCTTAGTAGATTTTGTTGTATCAG
ATCCTGGGCAATAGATCGTATACCACCTGGATTATGAATGCAAACTCAAAACAGTAAGAAACATCAAAAAAATTCCAAACAACAGACAGATAGATTAAAA
CATCATTTACTTCAACAATGCGATAAAATTTTAGAAACAACGAAAAATGACATACACTGTACAAATTCACTAAAATTACACATAAAACGGTGAAATCCAC
GCAAATTTCTCGGATCTTTGTACAGATTGTTAGATAGATGAGTGTATACAAAATTAAAACATCATTTGCTTCATAGACATCGGCAATGCGATAAAATTTA
GAAACAATAAAACACGACATACACTGTACAAATTCACCAAAATTACAACATAAAAGGGTGAAATCTACGCAAAATGATCGGATCTTCGTACAGATTTGAG
AGATGAATGATTGAAAAATCAGATCGGACAGTAACAAATCCCTAGATCTAACGATGAAGATCAGAAGTAAGAAGCTGGCGAAAGATCAAATAGTGAGAAG
AAGTATACAGAGAAATCGGCAGTTACCTTACTGAAGATTGAAGATTGAAGAATGCTTACAGAGTAATGAGATGGTGAAGAGAATATAGGCGCTCCACGAA
CTTATATATGACCCGGGAGTTCAAGATCTTACGGTGCGACGACACTACTTGTTTTTCTTCCGGCTCCCTTTTAATTAAAATTGAAGCAAGTTCGAAAACT
TTTTCTAATTTTGCAAATTTACATTTATTATTGTAGTAGTTTTTCCTTAGGACGTATTATTTCGTAATGTTAAAACTCAAAATTAGTGGTTCAAAAGTCA
AATTGTCAAGTTTAATTGAATTGATAAATTAAAAATAAATTTATGATATAGTTTGATTGATTTAAGTTTTAACGTTGCAAATTTTTTTAACTATTCTTAA
TTCGATTTGTTCTTATAAAAAAAAAATCAAAATCAAATCAATAATATATATATAAATATATATATATTACATATAATCTCCTTTATAAGTATTTTTTACG
TTATTATATAACTTCCAATGTTTAGTTTATTATTTCATATTTAGCCTTGTAATATGATTAAAATGTGACATGAATTATATTTTTTTTTATCAGCTTTGAT
ATGTTTCCTAACAAAATATCTAGTAAATGTCATTGCTCATCATATTTTTCTAATTTTATTTTGTTCAAATGTCTTGAAAATGCCAGTAAACAATATAACT
AGTTCGCATGTATCGACGGTACCATGTCATTTCAAGTGTGAACTTTGATTAAATAGTTAGGCGACGTTCATGGGCGGCTCTTGCTTATAAAATTTAAGGC
ACATGTCTTAGGCCCCTAATTTTGGAAGAAAACGTTTTTTTGTCTTATCACATTTCATTGCTAACATTCACATTATTTATTTTTTAAAAAAAATTCACTC
TTTTTTCTTTAAATCTTTGATAAGTTTAAGTAATACTCTATCAAAAATTTATATCATTAGTCGAACAGTGTTGAACAATGTGAATCACATTTTTTTAACT
TAAATTTTCAATCAAAGTTAGGTATATCAAGTTATCAAAGTCAAATTGTATGGTTTTAACTCTTATTCTTGCTTAAAATTTATCAATTTATTACATATAG
AATTATGTTAACAATTCATATAAGGATTGCTTGAATAAAAGGATATTTTTCAGCATTGAATTAATAAAATTTTATCTAAAACTAATTTTAAAAAAATTTA
GAAGTACTCAAAAATCATCTATAAAATAGTTAAAGTAATAATATGCATCTAAACAATCAGAAAATAATTTTAAAATAAATATGTACTCAATTTTATGGGT
CTCAGTTAAAATTTTATTTTAGGCCTTCAATTACATTAATAATAATCATATAAATATATTGGACTAATTTCTCATTACTTAATTTATTCATTAAATATAT
CAACAAAATAATAGTATAAGAATAATTTTAAGAGACTTCTTACTTTAAAAAAATGTTAATCCAATATATTTATATCATGATTATTATCATTTGCAGATAG
TTCTAAATGTCTGTGTATATTTTAATTGGAAATGTTGTATGATCAACTATAATTTGTGATAAGAACTTCAATGTAAATAGGAGTATGTACTTTTTCCTTT
TTCTCTTGTATGATAATTTTCTGTTCTTTTATTGGGACACAGGATGATAATTATCATCTTTGTAGACTTTTACTAGTTTGATATATTAAAATTAATTATT
TGATTTATTTGCTTATTTTTAAAAAGATAAAATATATCATTATTTCAATCAACTATAATAATTTTTTTTTAAAAAAATACTCAAACTTTATAAAGGTCCA
AGTTGAAAGTCAAGATGGAGGAGAGTGAATTAAAAATTCGTCCAGCAACTTCCTGTGAGGAGTAGTCGATTCACCTGCAAGTCAGTTCAACAATATAAAA
CAGAGTAATATGTTGAAATTAAATGAACATGAAAAGTTTATACTGATATGGTGCCTAGTCCAATCTCCTTGGATTTTAAGGGTTTCTTTAAGAGCTCGAG
CAAACTTGGTTATAAAGAATGTGTAGTCTTCGAAGCTTGTCTGATATGCAAATCAGAATTTCTATTGTGGACACTACCTCTACTTGTATAACCTATCCTC
AGAATCTTTCCTTCTCTTTTTCTTTTACAATTGTTCACTCTTGTGTACAAAAATTTATCAAAGCTGGAAGAAGATTACAAATAAGTTCAATTGAAGTTGC
GTACCTCACACCAATGATCGAGAAGGTTTATATAGGATGTGCTCTTATCAAAAATCCTAGGGTGTTTGAATGAATGATCATTGATCTTATCTTTGATTCA
TTCATAATTGATTTGCTGATTCATATCTATATCCGATATGTGCATGACAAATCAATTTTTTTCTTGTGGGATGATTTTGAATTTTGGCTTGATTTTTATC
TCTTGATTTGATTTCTCTCAATTGTGATTTTTGACTGCTGACTCAATATTTCCTCTTTAATTGTCCCTTGATTTAATCGCTTGTCCTTCTTGATTTACTT
GAGAGGTTTTTCCTTGTATGTCTTTCTTTAATTCTTACAAACTGCGAAATTTGATCTGATTGATCAAATATTCACTTTCCTCTCTTAACTAGATTTGCTC
ATAATTAACTTGATTCCCGCAATCATCTAAATTTCTTAATTATGAGAGCTTGTGCTTTGTGATGTATCTCGTTCCTTTCTTTCATCAAGTGACTAGTTAG
TATATGCATTGTCATTATTAAAACATTCGATTACGAGGTCAACACTAGTAACCCCTAGAACAATTTAAAAATGGTAAAAGTGTTCTCTTTTTGGGTCAAC
CCCCATGTTTAACAAGGGAAGTGAATAAACGCACGTGTCAATTATTTTATTTTTTATATAAATATTTTTATTTTCATATATGTTATTTTTATTCTACATG
TTTTCTAAAAAAATTGAAATCTCTATTCCTCTTCTTCAATGTTCAACTGTGTCGGTATGTTTCTTCACGCCACCAGCAACTCTCTACCATACCCACCACC
CACACACTTTAACATCATCTAATCATTTTCTCTAGCAAATCAAAAATAAAAAATACTAACAAATCTCCGGTTGTTCTTCTTCGATCGTTCAACCATTTGT
GTAATTTGCATTTAATGTTTGCTCAAAATCAACATTTATCGTATTCACATAGGGTATTTTTTACTGGGTTTGAACATGCCCCCGACGATTTTCCCTCCTT
CGTCATCAAATCTTCGATGTTTCTCTCACTAATCCTTTTCGATCTTCCTTTGCAATCTCACTCCGCTTTCATCTTTTTTTTTGTCTATAATCTCATTAAT
TTGAAATCCCTCAGCTAAAAATGAGTCAGAGAACTCTTCTGGATAGAAGTAGACAAAAAATGATTAATTTTTTTTTTTTTAAAAAAAACGTAAAACAGAT
AAAGTGAAAAAACAGAATTTTTAATTAAATAAATGTTAAAATAAATAACAATACTTTTTTTTACTCGTCTCACTTGCTAGTGGCGAGTAAAGTATACTCC
ATGTGCCACATAGGATCATAAGGGAATAATAAATCCACCTTGAATAAAATTACTCCCCTTCGTTTTACAAAGAATAATCTAGTTTGAATTGATATAGAGT
TTAAGAAAATAAAATAACTTTTAATCACGTGGTCCTAAATTAAAGTTATGTCAAATGTACAAAATTGTCCTTTAATCTTTTGGCCTTAAATATGCCACAT
GAAAAATTGTTATTAAAAATGAAAGGGATCATTCTTTCTTAAACAGAATGATAATGAAAAGAGGTTATTCTTTTTTAAACGGAGGAATTAAATGGGTATT
AGGATCTTTTCAAAGTTTCGATATCTTTTTTTTAAAAAAATATCATAGTTGAATGGGATTATAATGTATTTTCTCTTTTTAAAAAAATAAAAAATTAATT
TATTATTAATATTAAATATTAATTTTCAATATTAAAATAACTAACATTACTCATATGAGCGATATCATTTAATTATCTTCTTTCTTCTTTTAAGGGAATG
CCCTAATGCTTTCTTTAATCTTCTCGTCAAAGTTATTTCCCAAAGATATATATTTTTCACGACTTCTTTCGTATTTTATTTTCTCACTCCAAAACTGATT
CTTTTAAGAAATTCATTCAACAAGATAGCTTTCATTTCTTTAATGTCGTAGTCATAAGTTTAGGAATGTGCTACTAGACTTTAGTAAAATCATTGAATTA
ACAGAGATGTGAGTGATTGAGTATTAATTATTCGGTGAGCAATTCAAATGAAATTATAGCAAAGAGAGAAAGAAAAAATAAATAGTACTTATAGTAAAAT
TCATTTAGCTAGCACGCTCCTAACTTCAATACTAGACTTCAAATAGTTATTAGTGTCAAAATAAAATTGAACGAGTTAAGGGAGTATTATTTACGATAAT
TTTTAGCGTCTCCAATAATTATGAAGTTATGGTCACTAGGGTTATTCATAATTGTGGTTAAAAAATCTAATTGAACCGCAATACGAATCAAACTGATTAC
AAAAATTAATATTTGATTTTGTTTGGTATTAAATTTTGAAAATTGATATTATCTTTTTACAATAAAATAACCAAATCGATAAATTAGATATATAAATTTT
ATAAATATTTATAGGGATAATGTCCAAGTACCCGCTCAACCTATGCCCGAAATCTCAGAGACACACTTATACTATACTAAGGTCCTATTACCCCTGAACT
TATTTTATTAATATTTTTTTACCCCCTTTTAGCTTGCGTGGCACTATCTTGTGAGCCCAACGATGGTTGACTTTTTTTTCCGAACTAGTGCCACGTAGGC
TAAAAAGGGGTAGAAAATTACATATAAAATAAGTTCAGGGGGGTAATAGGACCTTAGTGTAGTATAAGTGTGTCTCTGGGATTTCGGGCATAGGTTGAGG
GGGTACTTGGGTATTTTCCCTTATTTATATGTTATTCATAAAATAATATTTTTGCTAAATTTTAATTAACTTAAGTCTTTAATTCTACCATTTTCTCGTT
CAACACTTTAGTCAAACTATTACAATCCTAAGTCCAAGTCCAAATTCATTAAAATTCATTATGCTAGTACTCCTTCCGTTTCTTTTTACTTGTCTATTTT
TCCTTTTATAGTTGTTCCTAATTACTTGTCAATATTGACAAATCAAGAAAGAACAATTTTTTTACCTATCATACCCTCAATTAAATGACTAATTACTTTG
AAAAATGTAGAACTTTTCATCCATTTCATAATTAATAGGGATAAAATGATAAATTCACCACGTCATTAATTATTTTCTTAATATGTGTGTCAATTCAAAA
GTAGACAAGTAAAAAGGGACAAAGGGAGAACTATTTACCTAGTGACCTCATATTATAAAATAGTCACACTTTCTCTTAATTTAATCACCTTCTTCGTATA
ATTATAACTTTAGTATTGCTTAATTGAACCGACATTTGCTTTCATGTGAATTGTTCATATATTATGTGTTTGTGTATTGATTGAGACACTTATATTCTTA
ATACTCTTGAAGTATTGAAAATGATGCAAAATTACCCTTCATCCACCTATTGGATCTAAAATGTCCTTCTCATATGTCTATTGGCTCTAAAATACCCCTG
TCATCCATATTTGTGTTCAAAATTGACCACTTATTTAATTGTTTTAAAATTAAACTCCTTAAATATTTTTCAAATACTTCGCTTCAACTATTGGTTATAA
TTTAATTTATTAATATAATTTATAAATCAACCTACTACGCACTCATTACTAACTAAACCCTGCCAATTAATAATTCAATTATAATATCAAAATCGACATA
AACACTACTAAAACACAATGAAATTATAGATTTCTGAAAGTGACATTTAAAATTATTCGAGTCCGAATAGAAGCCCCAATTAAATTTAGGTTGAGCCACT
TATTTAAGAGTACACTTTCAATAGGATTTTTTTTCAAGATTGAGTTAGAAGTTTATGATTAAAGGCAAAGAAGTAATACATCCCAAATTAATTCATACAC
TTTTTTTAAAATATAATTTTATAAATATTTATTATTTGTTTTAAAACTTTTAATATATTATTTTGAAAAAAAATTATCTATCAAGTAACATCACATAATT
GAGAAGTAAGAATAATTAAGATGAAAATAGTCCGACTTTTAAGTTTATCGATAATTTTTATTTAGAAACTTGAATATATGATATTTTTCACCTCAAATTT
TTAAAAACACTCAATTGACATTAACTTTTCTGTTGTTGGATTACTAATGTGACGACCTTATTAATTTGGAGGGGTATAATTAGTAATGGGTGGGTAGTGA
ATTGATTTATAAATTATACCAATAAGTTAAATTATAACAAATAGTTTAGTGCCAAATATTTAAAAAATATTTAGATAATTTAAATTTAAAATTATTAAAT
AAGTAGTCAATTTTGAACCAAAAGGTGGATGACAAGAATATTTTGGATCCAATAAGTAGATGAAGAATAATTTTATACCATTTTCAATACTTTGAATGAA
TTTTAGGCCCTCTTCCAAAAAATTTATTACTTTTAAATCGAAAGAACCAAAAAAACCAATTACTTTTTCATTTAATTTTTAAAATTTAAAAAATTAATTA
ATTTAATTTAATTTTAATTAAATAACTAATCCAAATCGAACCATAAACACTCGTCGTAACCGAACCATAAACACTCGTCGTAATTCTTAGTGTAAACATT
TTGCCGTATATGCAAAAATAAATTTCCCTCTTTTGTTGGGAAGAGTACCAGTCCAGACACGTTTCTTTCGGTGATTGGCTGTATTTAGACCGCAAAAAAT
GTTAGTCAACTCCGTTGACGTGGTCACTCAACTCCTGTCACTGTTAAAATCTCCATTATCATACAAAAAGCAAAAATCCTAAAAAGAGTTAAAAGAACAT
TAAAATACAGAGTTTCCATATCAAGCGCATTAACCTCAAAATCGTCTTCTGAAAATTCATCGCCGTCGTCTTCAAAGCTCTTCTCTAGATCTGAGCTTTG
CTTCAAAGTCAAATACCAAATCTTCGGATCTCCAACTCTCCATTTCGATACACACCTCTGCTAGGGTTTCGAGTCCGTACTAGACTGAAATGCTCGCCGA
TTCATGACGGAGGTTTTTCGAGTACTTGCGTGATTCTAGGGTTTCAGTGTGTGGTTGATTTGGTGCAAAACGAGTATCCTCGATATAATTTTTCAAATTT
CTAGATTGATACTTCAAGTTCCGAAACTTTCAGTTAGTTACAGCTGTATTTTGACCAGTCTAGGAACACGCAGGGGCTTTTTCTTTTACACGGTTCATTT
ATAGGTTGAACATTTCTGTAACTTGAAGTCGGTTTTTGATAGTAGAAGAATGTTGTGACAAATGGCGTTGAAGTTATCTGCTGCTGAAGCAGCTAAGGTT
GCGATTCAGTCTATAGGATGTGGATATGATATATCATTGGATTTGAGGCTCAAGTATTGTAAAGGTCATCCAGATAATAGTCGTTTAATTGAAATTGATG
AAAATGAGAGTGGGGAGGTTGTGCTTCCTGGTGGAATTTCAATACCTAATGTGTCAAAATCTATCAAATGTGATAAAGGAGAACACACACGGTTTGGCTC
TGATGTTCTTTCTTTCCAGCAGGTATCTCTGTTTCTACTTGTCTTTGGTCATTGGGTCTTATGTTGCTACATATATAGTGATATCATTTTGCTAATGTTA
TTTGCTTTAATATGGAGAGGTTAGAATCTTTTCTGGTTGCCGTAGCGCGTGGATGGTGTTCTTTTATCTGTATTTTATGATGCCAACTGTTTTCTATATT
AACTCTTAAAAATATATTAATGTAAAATTTCTTACCATACGAACTAGGAAGAATGATACTATCTCCATGTTATTCGGTTTTTGTTCCTTAATCACTATGA
AGAGATAGCAGAAAACATATATGAGAATATTATTCACCTTTGTGCATTTACTTGTAATCTCAACTTTGCTGTTGATTATTAAGTTGGTCAGAGTAGCAAT
TCTCTGCAAATTTTCCCATCGTGTTTCTGTGTCAATCTAAGAGTTAACTTTTTTACCTGCAGATGTCAGAGCAGTTCAATCAGGAAGTATCCGTGAATGG
TAAAATTCCTTCGGGGCTCTTCAATACTATGTTCGAGTTTTCTGGTTCTTGGCAGAAGGATGCTGCATACACTAAAACCCTTGCTTTTGATGGTGTGTTC
ATCACGTTGTACTCTGTTGCTCTAGAAAAATCTCAAATGGTGCTGTGTGATTATGTTAAAAAGGAAGTTCCATCAACATGGGATCCTGCAGCATTAGCAA
GGTAATATTTGTTGCGTATTTGGAACTCTTAAACATTGACATTTTTTTCCTTCGTATTTCAAGATAGTCTTCATTGTCTGAAGGAGGTCCAATTTTAAAA
ACAACCTTAGATCCATACTCTATGTGGCTCTCGCTTTTACTACCCTTACTGTCTAATCAACTTTTTGACCATTTTGTTCCCTTTTTATATGAGAGAAGAG
AAAGGAAAGTAAACAGTTAATGACACCTCAAATAGTAACTGTATGTCAACGTCCTTCAAGTTTTATGTGAAGTCTTTTTTATTTACTTGAGGCATTCTAG
TTGATCAGAACCATAGAGCTCTCCAAGTTACAAATTGAGTAAGAGGGCTTTGATGCAACTGCTTGATACCTCAAATAATGATTGTACGTCAATGTATTTT
GAGTTTTTGCATATTCCTTTTTATTTACGCGAGGCATTTTAGTTGATCAGAATCTTAGAGCTCTCCAAGTTACAAACTTGAGTTCTGGGCTTTAAAGCAA
CTGCTTATTAGGAGACTATCTGGTATCCACCTTCAATTTACTTATAAACTGGTCAATTACAAGCCACACATTGTTTACTGGAAAGTTCTAGTCTATTAGA
CTTTGTCATACTAGTTCTGACATTATGTTCATTCTCCAGGTTTATTGAAAAATTTGGTACTCATGTCATTGTTGGTATAAAGATGGGGGGAAAAGATGTA
ATATATATGAAACAACAGCACTCCTCATCGCTTCTGCCCGCTGACGTGCAAAAACGTTTGAAGACAATGGCAGATAAGAGGTTTTCAGGTGCAAATGAAC
AAGGGGGAGTAGAATCGCAGCAGACACATCAGAATGAGAAGGTAAAGGATATCATCTGACCCTCCAATTTCCATAACTATGACAAACACTCACAAAAACA
TGAGTTATGTTCTTACGTGAAGCTTTTGGAGCCTGTGCACTAATTACATTTTCTATTTTAAGAAAGGGATTGTGAAGGCCAGATTGATGGATGTATCAAT
CCTTTTGGATTCAGAAACAAGATAATGTGAAGTTTATGTTTTTCTATTTCTCTTGTACCTTTATGACTCGGAAGTGATTCTGACCCAAACAATTTAGGGT
CTTTATGTGTCATCAGTCATTGCTATTGCTTGAATGGTCATAATTTCCAACCTTATTCTCGGTTATTTTGTAAAGTCCTTTCTCTCTCCTTGAAATGTTA
TTTTAAAAATCTCTGCAATATTTGCTGAATCAGAAAGGCTTGTAAGATCTTCTATGGCCGCATAGACAATGTCAATCAATATCTGCAGATGGATTTACTC
TGTAGCTCATTTGTCTTACAATTGGATATTAGTTGAAATCCTTATTGTCAAGTTCTAAGTAACGTCTTTTGTCATAACCATTAGATTAATAGAGAAAAAA
ATCATGACATATTATTATGTATTACGTCACAATTATTATGAATCTATTGTCTCTGTCTCTGATTTGATAATGTTGCCTCAGTTTGAAATCAGGGAGCACC
GACTGAGGTTTGCCGATCCCAATATATCAGGTTCATATGCACATAAGGAGGTAGGTGGTATAGAATTTTCATCAGGTCTGTAAAATTTTGTGCACTTTAG
AGTTCTGAAACAAGTTTGTCAACTTGCCCATTGGCTACTGAAATTGCAGGATACTGTTTGTATTTGCAAGAGGAGAGGTGGAAGTGATAGCAGAGGCCTG
ATGCATAATCAGTGGTTACAAAGTGTTGATCAGGAGCCTGATGTGATCTCAATGTCCTTCATTCCTATAACTTCACTGTTGAATGGCATCTCAGGAAGTG
GATTTTTAAGTCATGCTATAAATTTGTACTTACGCTGTAAGTTAGAGCATATTATTTGTTATTTTCTTGCTTCTATCCTGTGTGTGATATAAGTTTTAGG
CTTCCATGTACAATGCACATTGCTAAATGTAACATTTCCATTTAATAGTTATGGTGCTCAAACTGTCCAAAAATGTCGCTGCACCTGTGTTGGATCCTCC
AAAAATACACTAGTTTTGGAGGATCCGACATGCACCTATTGTCAATTTTGAAGAGTCTGAGCAACATATATTATGGGCAAACAATAGGATGGAGGAGGGC
CTGTTGAGTTCATGCTAATTTTGAACCTCTTACAATTAGTAGTTTTGGGCAAAATATAAGTTGGAGGAGGGCCTGTTAAGTTCCTGTATTTTGCACCTTT
ACGTTTACATTTTCTTAAAATATTAATGATTTTATCAAAATAAGAAGTGGAAGTGCCTACTGAGCCCGGCTAATTGTGGGTCTAAAAGATGATGGCTGAT
TCAAATATGTTTGCATTTTCTCAAAAAATTAATGTGTTGTCTGATTTTGGAGTATTTTTTAAACCTTGCAAAACCTTTTTCACTTTCAGCCACAAATCTT
CGACTCTCGTTAACTTATTTTCCAAGTGAAGTTCATGTCCACAACTTCAACTTCCACAACTTTTTTCTTTTGAGTTCCAACTTTAAATATTCTTTCCCCT
TCCCCAATTTCAACTCAAATGTTGTCAAACAGCTATCCTTTATCAAGATTTTTTTTTACACTGTATTAATTGCATGGGATATTTTATTATGTAATTACCT
GGAAATTCTGTCCTTAATTCTTCACCTTTATATGGAAGTGTGTCTATTTATGCAGATAAACCACCAATTGAAGAGCTTCACCAGTTTTTGGAATTTCAGC
TGCCAAGGCAATGGGCACCAGTATTCGGTGATCTTCCGCTTGGTCCACAGAGAAGGCATTTAAGTTTTCCGTCTTTGCAGTTCAGTTTACTGGGTCCCAG
GCTTTATGTGAACACCACTCCGGTGAGCTCCCTTAATTTTAACACCTCAATTTTCTATAGAAGACCTGCAATGGAGCAAAAGGTGGTTTATATTCTCCTT
CTGCTCCTTGTGTAGCAGCACCAACTCAAAACAATCCCGTCATCTTCCTTAAGTCATTAACATTGCATATAACACCACCTCAAGGGAAAAGCTATGTTTT
TCTTTGGGAGTGGTGTTCCATATCTTAATCCAAGCCGCCTTTTTTCCCATCTCAACTAACTCCATGTAATATGATCCCAGTCAAGGGTTCTGTTTCGACC
CTCACTATATCATCTGGTCTTCCAGTCTCACCTTACTAGCTATCATAGTATTCGTCAGATACTCCTCAACCTTATTAATTTTCAACCCTAGATGTCTTTT
TGGAAGCTTCTATCCCATGTGGTCCCTTGTCATCCTTGTTAAGTAATACATTTTTTAAAAAAGTTATCCTTCAAAAAGGATCAGTTACATCCTCTCTGAA
GTGTATCCTATTTACTTTTCCTTCCATCTCTTGATCACTTAAGTAAATTCGCCCCATGAGAGGTTGTCGCCTCACCCGATAACCATCTATTATGAAGTTC
TTACTAAACAGCTATTATCTTTTTCCATAAAGTTTTCTCTTCTCAGACAAATCTAATTATGCTACTGGCAGCACCATGTTAAATGTGGACAATCCAAATT
CTAACTCCAAATTAACTGGGGGTATACTTTTCCAATCTTCCAAATGAAATTTCTTCTCCCTCTTCTTTCCTAATAACAAAGAATTTCTCATCATTATCTC
CAATTAGTTTGCAACAATTCATGGAATATAAAACAAAAGTCATGCTATTTGTGGTTATGTTAAATAGGTTGACTTCAAACTATGCCATCTTTGGATTTTG
TAAGGATTTGGCTGTACTTGTACACATGATCCCTTAAAATAATGTTTTTAGCAGAGGATGTGAGACAAGAACTAAATCACAATGTGTGCGCTTGTGAATT
ATTATGGGTGAGGAGCAGCTCGGAGTGCATAGCTAACTGTTTTCAATCTTTAGGAAGATTGTTTCCATTTACTTCCATTTTTAGCTTCTAATTGGGTTCA
CTTTGCAACATGAGATGGAAGCTCCCACTAGCTTCTTTTGGTCTTGTATCAAATGCTCGGGATCAGGAAAGGAAGAAAAAGGAGGGGAAAAAATTGTTGA
TTAGTCTGCTTAGTACCTTCTTTCCAGGCGTCCATGTGATTCATAATATTCTTGCAGGTTGATGTTGGCAAGAGGCCGGTGACTGGACTTCGTTTGTACC
TTGAAGGTAGAAGGAGTAACCGCTTAGCCGTCCATTTACAGCATCTTTCATCTCTTCCTAAAGTCTTCCAACTTGAAGATGATCCAAAAGGCAACTTTCG
CCGAGAATCATATGATCGCAAATACTATGAAAAAGTTCAATGGAAGAACTTTTCTCACGTTTGCACCGCACCTGTTGAATCTGATGAAGACCTTAACATA
GTTACTGGAGCACAATTGGAATTAGGGGATTATGGGTTTAAAAAGGTCCTCTTTCTGAGACTCCGTTTCTCGACTGTCATGGGAGCTACTATGGTAAAGC
ACGCTGAGTGGGATGGTTCCCCTGGGTTGGCTCGCAAATCTGGCCTGATATCAACTCTCATTAGCCAGCACTTTACATCAGTTCAGAAGCCACCTCCTCG
GCCAGATGATGTGAACATAAATTCTGCCATTTACCCTGGTGGTCCTCCAGTTCCTGTGCAAGCCCCTAAGCTCTTGAAATTTGTCGATACTACTGAGATG
ACTCGAGGACCACAGGAACCTCCTGGTTATTGGGTTGTTTCAGGTGCAAGGCTTATGGTTGAGAAAGGAAGGATCTCTGTGAGGGTCAAATATTCCTTGC
TAACTGTAATACAACCCGATGATGAAATATCAGAGTAATTTAGAAGAGGTTCTCTTTTATTCATACTCAAAACAATGCAAATGCTACAGGGAGAAGTTGC
AGTGTAGTTTGTTGCTGGCTTTCTTGATGTTGAAACACCTGTTGTACAAAATCTGGCGGAAGTGCCAAAAAAGGGGATGAAGCAACTGTTCTCTACTTTG
AGATGTCTCTAATCTTTGTTCTGATTTTGTTTGCGCTTAAATGTAAATCATGACAATATTGATTGTAATATAATTCTCACTTCTCCAAAAAATCTCTTTG
AACCTCTTTCCTATGCTCACTATGATGTTTAACCAATTAGGGAAGTCACAATTGTTTGATTGATTTCAGATTTATGCACAAAACATTAGCCATGTTTCCT
AGAATTAGCATCAAGTGACACAAAACTGCTGGAAATAGAAAGAAGTGCATAAGCTCAATAGTCAAAAGACAATACATGGTAAAATAAGCTTACCTCAAAG
CAACAAACTAAAAACTCAACCTACTGAACTTCCCAGATCATCCCCACATCTCACATATTGGAAAAGACAATACAGAAAGAGGGGAACTCAGTCAATATAC
AAAGCAAAAAAACCAAATATGTCACACAAAAACAATGAATGTCCCTTCTTCCCAATGTTCCAAACTTCAGTTTTCGCCCGACAGCTAATTTTACAGGTCT
GAGCATATGGTAAGAGAGTGCTAGATTCTGCAATTGTTGAACTTTTTTTATGGTCACATTAGGATTCATAAATATGATAATACAATAATTAGTCTTGTAG
AATCATTAAGAGAAGGGAAAACTATGTTCATGGGAAGGCCAATAAACCCCTTCCCTTGGACAAGCCAATGGAGTTGGCTTAGCAATGAAGGTAGGATACT
GTTGTCCTGGCATCATAACTGTATAATCCGATGAATATCGCGTTGGTACCTGTTCATACAAAAGATGATCATTTTAAGATTAAATCAAGTGGAGGGAATG
ATGTTTGAACCAAAAAAAAAAGAAAATGCTCCACACTTACTGTTTCTGAACTTGCACGTTTCTGAATAGGCCCCAACTCCAAGGAACTGTGTCTACTACC
TAGAGGCGAAGAGAAAGGAGGGCTAGGTTTGAATAGATGTTCAAATATGGCCATGATGAGAAACATGGATATGAGTATAGCTGTAGCAACAAAGCCAAAA
GAAATAGCATCCATTGATGTCCCGAAATTCTTCCATTGTCCTTCTCTGTTTACTTGTGTTTGGGAAGGACTAGGTTCTGAACTTGTGTGAATATTGTTCC
ATGGATTTGATCTTTCTGAACCAACCTCACTCATATTCGTATCCACGTATTTCATTGATCAATATCAACCAAGTTGAGGTCGACTATATGAATCTTCACT
GTCCATGTCAGACCATATAATCTTATCTCAGTCCAATATTTTATCAAAACAACAACAAACAAAAGGACAAGTTCTCTAATAGGACTAAAAGACTCATTAG
AAAAATCGACACGACGAAAGAATGCTGACAAATCTATCATGGGAATTTAGAACTTTACTTCTATATGATAAAGCCATAAGAAAACAACTTCATTGTAGCA
AAAGTGGTGTTTTTTAGCTTTGAAGTGAAGAGAAATATCATGTTTTCTTGTTTTTATTAATTTATTATACAAATGATGATCTCCAAGAAAAAAGTATAGC
TTAATAAAAACTATGCATACCCTTAACCTTAAATCAACACACACAATATTCACTTCATCATCAAGCAATATCAGTTTCCCATTTTTTTTAACACACTTAA
AATAATACAGGTAAAAATCATGAGCTGCAAAAATAGAGGAGAAAATACCTTGAATCTTGCTCTGTGATGTTATCTACTTGGAAATAAGAATGTGATAAAT
AAACATAAATTTTTGAAAGAGAATTTAATCCTGAGAAAGATTAAGGACTTCGTATATTCTATAGTTTCATGTGATAGAAAGAAACAGACAGACATATGAC
TCCAATTTTATTGAAAATCACAGCTCAAACTAGGTAGCTTTATACCTAGTTGGAAAGAAATATAAAGACAAAATTATAAGATAATCTTAGTTACTAGACT
TTTCTTTGGAATTAAGTTAAAAAAAATCAATATATTTTAACTATAGTGTTATACGTAACGTTAGACCTAATAATATAAGAAAAAATCATACACCTAAAGT
CAGTGCACAAAAGTTGAACTCTTTTTGTTTTCTTTTGGGTTATGTTGTTTATTGTACATGATCTTGATGCCAAACTTAATCAGTACTATACCTTTGTTTG
TACATTTAGGGAAGCAAACTTAAAGAACTCAAAAAGTGTTGGCCCTCTTTGTCTGTAGAGCCTAAAGCAAAGAGTGTGACCCCTCTTTGATGCTTGCAAA
AGCATTCATTTTCAAGATACCATAATTCATGGCTTTCTCTTAAGCTAAATTCAATTCCAATTTTATACGATTAATATAATTTTACATGTCATGATACTTT
ATTTTCTTTTATTAATAATGATATGTCTGATTGTCTATTTATCAAAGAGGCTAAAGCTCGCGCGATTGGACTCATACTAGCTGCCTAACCCTTTGCTCCA
AGGGTCGGTAGATTAGAAAGTGCTTTAATACGAGATGTAATAGACTGAGATCTTTATTAATTTTGAAAAATTAAGAATCGAAAAAGAAGAAAAGGTAATA
TATATAAAAGGGCATAAAACTATAAATTTTATTAATCAATAATATATTGTATAGTCAAATTTAGAGTTTCTTTTTACGAAGTTTACATAGAAATAGATGG
TAAAAAAAAAAAAAAAAACTTAAGGTTTCATTATTCAAAGTTAGCAAAAACATACAAACAAAAAAAAATGATTTCCCACTAGATAGTCAGGATAAGCAAA
AACTGCCAAACAATTTTATTTTTTTATTTTTCTAAAAAAGAAAGAAAAAAAAAAGCTGCAGCTGGTGGAATTTGTGATAATCTTACAGCTAATGCTATAC
CAGAAGAGCCATGATTCAATTGAAGAAAGAAAAATAAAGTTTTTTTTTTATAACCAAAAGGAGAAAAGACAGAAAAAAAAAGTTAGTGATTGAGACCATT
TTTCTTGATTACCTTAACTAATTATATTAGAGCTCGACTATTCTAAATTCACACTGCACAGAATCTATTAAAGAAAAGCAGTTACTTATTAAGAATATTT
TCATATCTCATATTCGAATACAAAATATCTAATTAAAGAAAGAAGCAGTCTCATACGCTCCACCACATATCATATCGGGTGGTACACCATTTTCTTTGAT
TTATTGTTCAATTTTACCTACTTAAAATCTTTGTCTACTAAACCCCACAAGCTTTTTGTCAGAAGCACTAATAGTAGCTTAAGTTTCTTGAATTATTTGC
ACAATATCCACTTTTATGTTGAAACTTTATATCCATCCACCCCACTTCAATTCTGGCTGCTCTCTATGAGAATGGTCTAAAATATGATAATTTACTTGAA
GCAGAAATGAGAAAAAAATAAAAATGTGAAAGTTCTTCTTTCTCTTTTTTTTTTGTTTAATTGTGACGTGTCTCATTTTCATTAACCTTGACTATTTCTC
ACTAAATAAGTTCAATCGTACTATATGTCATGCTCACTGATATCACTAATTCGATTACTCAGAAAATAGGCTAAAACTTATGGTATCTCATTTTTATTAG
TCAGACTAATCTAATTTCGTGTTAAGTAGGTACGGTTTCTAAGGGCCCATTTGGCTATAAGATTTCCCAAATAATATTTGGAAAAAATTTAGCAAATAAT
GTTTGTCCATACAATTTGTCATTATTTGGCAAATATCTCAAATACAAGTTTTTTTTAATATTTGGGCCAAATCTCATTATTTGAAATCTTTTGAAGATTA
AATTTTTACCCCAAACTTTTATCTTTTACAAAAACACCCTCTAAAGTAGTTGCTTGCATTGTATTACATAAATTTTTATGTGGGACACCAAAATAGTGAT
AAAATATTTACTGAATATTATATAATGATTTGATTGTTGATGATAATGATGAAAAATTGGCTCAAGGTAACAAGGTCACGTGCTTTGTATATTTCACGAT
GTATGGAATGATGTTTGTTGCACTCACTCCAAATTACCAAATTGCTCTAGTGTCATGGACACTATTTGTTATTGTTGTAACGAACATCCAATTGACTTGT
AATACAAATCTATAGTTAGTTTCGATAGTTTTTAAAATTTATGGGTATAAATTATATTTTTCTCAAAAGGTGAAATATAATTTCCAAATTCTATGGCCAA
ACACATGGTGAAATTTTATCAATTTTTCACTCAAATAATATTTTCCTAGAATATTTGGATATCTATAGCCAAACGCTAGCTAAAGATGATAATAGGAAGT
GAGGGGAAGGAAACATTTTGTTTAATTTTATTTTTATTTTTATTTTATTTTGCTTTTCCAGAGTGTTTAGAAACAGCCCACAAAAAAGAGAAAAAGGAGG
GGGGATTTTACAATCTAAATTAGATTATGTTTTCTTCATTTTGGTATTAAAATTATAATGCCTCTGCTTTATTTATATTGGGGTCATCTCAAGGAAAGAG
CACAAATTTTTACTACAAAGACATTTTTGGGGGGCTCCAGTTGGCCCATGTCTAGAAGAATAAAGCAATGTTCAGACATTGTCTGCTCTCTCAGTTTTTC
CACTTTGTGCCCCCAACCCCCCACTCTAATTTTTAATCTCAAGTTTTCCAATAAAACAAACTTGGCACTTACAAAGTAGTATAATTTACCTTGAAGTGGC
AAAGAAGGTAGGAGTGTTATATATAGCAGGTATTAGTTGAGGTGTATAAAAGCTTTGCTCGAGTCTTGATGGATCGAGATATTCAGTGTATTGTTATAGC
GAGATGCAGTATTTGATGTAATAGTTGAGTCGTACAAAAAGTGACTCCAAACCATCTTAGTAAAGAGGAAGTTGTTGTTATCATTCATATCAATTGCTTC
TTTTCCACATCGCAGGTTTCCTTTGTTTGCTTTATAGGGCATAAAATCCCACTCTCCTTCCATTTCTCTTTTCTCATGATATTTATGTTGACGTTCTTGC
TTCCCATGTGAAATGATGCCTTTATTATCTTGAGCTTTTACGTATGATCCCATTTTTCTATGAACAAAAACTAAGCATCAACACATCAGCAAATTTAATG
GTATTATCCTGAGCTTTTATCTATGATCCCATTTTTCTATGAACAAAAACTAAGCATCAACACATCAGCAAATTTAATGGTATATGATTACATGTATCTT
TAAATATGAAAATCATTAAACATGTTGGTCAAAAGACAGATTATAAATCGTTCATTGTATGTCACGAATAGCTTAGAATCCACAAAAGAGAATAGTGTAA
TTGCTTACCAACACCAATTTAGGTACAGAAGAGGAGCCAAACGGATTAACATAGAATCATTCTTATAACGAGAACTCAGGGAAATAATTCACAATCATGC
CCACGGGAAATGCTAAGCTCTACCCTGTGAAGATAAAGATATCATTTCTGACTCTAGTAAAACATATATCAAGTATGAAAAGGGGAGGATACGGGACATA
AAAAAGATGTGCGTCCAAAAAATGCTTATTGAAATAACAAGCATCAACTTTAATCTGACAAAATTGTCACAGTATTGAGAATAAATAAGAAACGACATAG
CAACTTATAAATGAAGTTCATCTCCTGACAAAAAAAAAAGCCGATATGATCTTGACAAATTCTCAAGCTTTAATGCGTCCATAGAATTTTGCCTTCTCCT
GTGTAGTCTGGAAGCGTCCATGGCCAAACTTGGATGATGTGTCAATGAACTTGAGCTTGATCTCCTCCATTGCAACCCTAGATGTCTGGTTCAACAACGA
CTGCCTCAAAGTCACAACACGCTTCTTTGGTCCAACACAGCAGCCCTTAATCAACAGGAAGTCCTCTTTCACAACACCATAGTGAGGGAATCCACCGATT
GGAGTGATTTCCTTCTCAGTCCTGTCAAACTCAGTAATGGCAGAATGAGACTCCTGTCCAGCCTTGCCCAGCCTGTAGACTTTCTTGTTCATCTCAGTAC
GATGGTGATAACCATTCTGCCCAGCCCTAGCAACAGTAAATGACACCCTAGCTGGATGCCAAGCACCAATACAAGCCACCTTTCTAAGACCACGATGAGT
CTTACGTGGGAGCCGGGTCACGCCCCAACGAGTAACAACACCCTCATACCCCTTACCTTTAGTCACACCAATGATATCAATCATCTCATCCTTTTGGAAA
ATTGCATCAACGGGAATCTGTTTCTCAAAAAAGCCATAGGCATAATCAACCTTCTGGGCAGCATCCCCACCATTAACCTGAATCTCCATAAGATGTGCCT
TCTTTTGCTTGAGACCTTTCATTTTCCTAATCTGCAAAGAAAAAATTATAGGGATCCTTAATCTCTCTAAAGAGAACAATAAGGTAAACATAATGACATT
CAAAAAGAGCAAATACCTGAGTATGGGCAAGAACGCGGATCACAGAACAATACTTCTTCATCTTCTCCAACTGTGCATTAATATCCTTCTTACCTTCATC
AGTTTCATACTTCTTTGAGTACTTGGCAAAGGCCTTCTTTTTGGACATGCACCAGTTCTTGTAGAACCTCCTTTTGATTTCTTCACTAAGATGCTGAGCC
CAGACAGTGCTCAGGCAACGAAGTCCACGTGGTGTTTTCACATAACCGACAACACCAACAACAATCATTGGAGGTGTCTCAATTATGGTAACAGCTTCAC
AAGTCTCTTTCTTATGGAGCTCTGCACAAATGCAACTCATAAATGACAGAACTATGTTGTATTTGCTTACTAGGAAACAGTTAACAAAGCTCAATATGGG
CATTTTCCAAGTAGCCCAACATACGAACATAGTTACTTATCAAGACATTCACAATATAACTTTAAGATTTGTAGCGTGAAGAAACATCTAACATGTATAA
ACCTAGATCTTTAACGACACATAATTTTCTTAACCCTAATGCCAGCACTGGCATTTGACAGCAGAATCTTCTAAGTAGTAAGCAATACTTACTTGACCCT
GGTTTTTCAACTTCTCTGACAATATGGGTCATGCCAGCTTTATATCCAAGGAAAGCTGTCAACCTGCAAGGTTTCGTTGGATCATCTTTGGGGAAAGCCT
TCACTGCATAAACAAAAATAGATCAAAAGATTAGATTCACCAAGATATTTTAAACATTACATCCACACCCAACTTCAAGGTGATAATAGACTGGTTGGTT
CAAAAATGTCTGTCACCCCTAAAACAAGAGAGACTAAAGTTGTGGAATAAATCCAAAGACAGCACATTCTTAGATTTCTGTCCATTACATAGTAGGTAGG
CTTTGAAGTTGCGGTCCATTGTTAAATAAATAAAAAAGTTGAATTTCAATGGTGTTAGTAGTTTCACTTCAAAAAACTCAAAAACTTCAAGACAAATATC
AAGTGGGAAAACACACTACCGTATTTGAACTCCAAAATAAGTAACACCTGCTATCAACAGCAATAATGCAATACTAACAAAAATAGAAAAGGATTTGAAT
TGAAACCTTTTCCTCTGTGTCGCGCAGCTCTTTTCCTTGGAAGAAATCCCAAAGAACCATGTCTTGGGTGCTCAAACTTACGATGCGACATTTTTCCTAC
CTGTAATAGCTAAAAAAATAAAAGGCTAAGTGGCCTCAACCTTCAAGGAGAGTAAACGAGACAACATATGGGAGTACAAACTTGTAGCTAAGAAAATGGA
AGAAAGTATTGCAAGTGGTTTCAATAAAATCAAAATATCCACAAGAAGTGAGATATTTACCATACGGAAAACCAATAGACAGGCTGTCTGTAATCTAATT
CAATAAAATAAACACAAATCTACAAACATCTTTAAAATCACTACCGATAATAAACTAATTAACACAAAAATAGAATATCAATCAAACCAACAAAAAGAAA
ATGCAACATAGAAAAGAACTGAAGTAGAAATACAAAAAATTAAAAAAATGTAAATTAAATATCAAACCAAGTGAAGTACAAAGAGAAGTATAAATATTTC
AAGGGTTATTTAAAAAGTGCACAGAGTACATAGAAGTAATTTGTTTCAAAAAATAGCATAAATATTAGACCAAATAACATATACAAATTGAGAAAAAAAA
TATATCGTGTTGCTCTAGTCAAGTAAGATATGCAGATCAAACACCAATTCTAGAAGATGAATAGAAAAGCTCCCTGACCAAAGGCCTATGGCAAGTAGAA
CATGCCAATTCTCAGGACTCAACTGTCTTTCATTCCAAAAACCCAAATTAATGGTGTCCTGGTGAAAGAGCCCTTCTGAGACTCCAGCCTTGATTACTTT
TCAAGTTGTTATAGGGAATACATTTCTACCACTCCTAATAATTTAGTGCAAATCCAACATTCTTACTTGTAATATAGCATGAAAAGCACGGAAAAAAAAT
AATTTAAAGAGAAAAAAATGATTTATAAGAACTAAATCACTCAAAGTTCAGTGCAATCGATATTACATCAATCAGATTAAAACGAGAACTCCTTGAGATA
AACATTACTTAAATTTGGAAAACGTGTAGCAATCAATCAAACCTCAAAACCGCACTACAGCTATAGGATTATACGAACATTTAAATCAATTCCAAAGCAG
TCAGAACTATTCCATTCCGGATTCAACAAAGACAAACATGCTAAACGTTTACCAATAAGTGCTTGAAAAAGTATGAAAAATCAAAGCTACACGGATGAGA
TCTAGATCAAGATGAACAAATTTCAGTTATAAAACATTACATGCCGAACAGTTGTCAAAATTTGTTAATCAGCTGTATCTAATCACATTACTACTCTATA
TGTGATGACTAGAATCAGAAGTTCATCAATTTGCTAAGAAGGAAACATAATTGAGAATATTTTGCAAAATTAACCGATCGGAAATTGAACGATATTACCT
CAGAGAACTGACGGAATCGGCGCCGGATACAAATGGTAGCTTTCTGGGAACTGTAACCCTATGACACTTTATATAGTAACGGGCGGATAGAATTAGGGTT
TCCAGTTGCTGTCTTTTGACATATATACCCCCGTTGTATGCCGCTAAATGATGGAGAGTGGCTGAATGGGCTTAAAATTTGTTCCCATTAATTTTGTGAA
ATATTTTTATTTAAATACTAGTACAAATTTTTTGCATTTGATTTTTAAAACCTATTTTAAGTTGAAATACTAGTACAAATTTTGGCATTTGAATAAAACT
TAATAGTTTAGTATTGAAAAATATAACCACAAATTAAAGAATTGTAACATTTAAAATGTGAAAAGATATTTTCAAACTATGATATTTTTGGTATACTAGT
GTTGCAAGAATTAAAATCACACTGATGCAATCTTGTTGTTTTGAAAACCTATTTCTGATATATGATTAATGGGGTTTTTAAATTATAAATTTATCAAACT
AACACATAATATATACATTAGATAAAAAGAAATAGATCTCATAATTTGAAGGAGACCATTGGCTTTGAAGATGGTGAACTCATATTGAGATTGTATGTGG
TATTCTTAAATTTGACATCATTTTAGTATATACGTAACCAAAATATGTTTGAGTCGACATATTTTTACTTTTAATAGAATATAATACGTCCTATATATTT
GGTTTGTGAAATGACATTGACAACCTCTATCATTAGAGCAGGAAATGTGTATATATATATCACATGTCTTGTATGTTAGTATATATCATTGTATATATCG
TGTATATAAATTACATACAGCATATGTTGCTATAAAAGTATAAATAAAGAAAATAAAGTGGAAAAACACCAAGAGAGAACTCTTAAAGAGGTAAAGTCAT
TTTGTATAGTTTTTATTGCTATTTGTTTTTTCTGGGAAAAAAAAATAATATTGTCAATACGATTAACTTGAATTTATTTCTTTAGATTCGTTCAAAAAAT
CATAATAACAATGATTCCATATGAGTAAAGAAAATCTTTAGCTATGAATGAATTTTTGGAGGGCCTGTTGATCGGCTTGGAGTTCCATGTCTCTGAAGAG
TAACTGCTAGAGCGCAACGGCTTAACTTGACATAGCCCATCGGCTTGGAGTTCCATATCTCTGAAGAGTAACTGCTAGAGCGCAACGGCTTGACTTGACA
TAGCCCAAGCTCTTGCTCAGCATAAATAGTAGCAAGCAAAGGATTAAGTTATTCATTTCTCAAGTAGAGCTAGCTTAGGAGTAGTTCCTCAATAGAAGGT
GCATTGATCTGGCCATTTTACAAGACGACTTTCATAAAACATTGGGCCAGGCCCAGTTATTGAGTTGGTGGTCTGAAAATTAGGGCCTATATATTTATGT
ATAAATTATAGGAACCACATATTATAAATACAAAATAACCATTTATCCCTTTAAGAATTGAAATTACAAAAAATCCCTTAAAAAGCAAAGAAGCGGGATA
CATCACTCTGGCACGGGATACATAAGAACTGATACATCAAAGTTAAAGGCTGCTGCGATTAATTAGGGTTAATTAACGTGATTTCTGTTATTCTTAACTG
AAATCACGTAATTAATGGTCATCAGATTGTGTAACGGATTAGTAGGGATACATCACTCTGGCAAGGGATACATCACTCTGGCACGGGATACATATTAACT
GATACATCATAATTAAAAAAGGCTGCTGCGATTAATTAGGATTAATTAACGTGATTCCTGTTATTGTTAACTGAAATCACGTAATTAATGGTCATCAGAT
TGTGTAACTGATTAGTAAATTCAAATTTTAAATCAGATTAGCTTCATAATTCAAAAATATTCTTGTAAAGGTTGATCTGCATACTAAGAATTCAAAAAAA
AAGGTTTTGAAGATGAATATCTCAATTCTGCTGCGGCATTCTGGAATTTGGGTAAGCGATATTAATTATGAAGGTTACAAAGTTGATGGAATTGTTGTTG
GCCATTCTATTTCGTTTGTGAATCTGAAAACGTTGATTTTAGCAGAGCTTGAGATCGACAATGTTACAAAGGATATTGAAATACGATACATTGTCGAGGG
AAGCTCATGTCCGTTGAAAATCAAAAATGACATGGGTGTGAAACTTTATTTCGAAGTGAAAAAGAATGCAACTGGAATTGGCATGTATCCGCTTTGTATT
GATACAACTGATAAAATTGTTGGGGATATACGTAATTTTGATTGTTCATCAGGTGAAGTCGTATGTGTGGAAGGTACCGAAAGAGATACTGAAGCTCTTG
CTCTGGTCGAGTCTAGAATTTGTGACATTGATTATATTCCAGAATTAAATGCTACGAATTACATAACTGATTCCAATAGTACTGAAGTGAAGACTGGGTT
GTTGTATAAGGACAAAGATACACTCGTTGCTGTAATGGCTAAATATAAAATAAAGAACAACTTCAATTTTCGAGTGAAAAGATCGGATAAGAAAAGGTAT
TTCAATGCTTACTCAATGATCTGTTTGTTTTTCTCTGTTTATATTTCTTTATATTGTATCTGATACATAATTCAAAAACAGTGTATATCTTGTTGTTATA
TTTATAGCATTGCTTTTCTTTGTAATTAGGATGCATATTGCCATTGGCATATGGTGTTGTAGACACTGAAAATGACTGTTCGTGGACATGGTTCTTCGAA
AATTTCAAAAATGCATTTGGTGAGCGTGAAAACATGTGTATTGTATCGGATAGAAATGAAAGTATCATAAAGAGTGTAAGCATTGTATACCCAAACGTAC
CTCATTGTGCATATGGCATCTGTGGAAGAATGTATGTTCAAGCTTCAAAAGGAGTAAAAAAACACTAAATGATATATTTTACTCAATGGCAAAAGCATAC
AGAAAGGAAGATTTTGATAAATTAATGGCTAAGGTTGTGAAGGTTGATCATAGGGTGAAGGATTACCTTGAAGAAGCTGGTTATGAGAAGTGGTCAAGAG
TTCATTCAACCATAAACAGAGGTAGAATGATGACTTCGAACATCGCTGAGTGTATCAATGGATGCCTTGTCGATGCACGTAAGTTAACTATAATAGACTT
CTTGGAGGAAGCTAGACTTTTATTTGGTAGTTGGAACTATAAAAATAGAGAAATAGCGTCATATACAAAGGACACATTGGGCCGAAGATTTGAGGAGATA
TTGATTGTAAACGCATCTAAAAGTTCAAAGATGAAGGTATTTATCAATTTCATTGACCTTCTGTTTTATCTATAAGATACAAAGTAATTTTCAATGTTAA
TTGTTTTTTTTTTAAAAATGATATATAAATTGAATATTACGTAATGTATCACTAACTTCTTAAATTTGTAGGTTGTTCCATCATCGGAATATATTTTCAC
AGTTCATGAAGCCGGAAAAAGATACATTGTATGCATTGAGAGGAAAACTTGCACATGTGGAAGGTTTCAACATGATGAGATACCTTGCGCACACACAATT
GCAGTTTTGAAGCACAAGAATGTTACCAATTTGCAGCCATATTGCTCTGATTACTACAAGCCGTATGCATTAGAAAAAACGTACGAGGTTGTAATGGTTC
CAATGCCAGATAAGGAGGATTGGAACATTCCAGAACATGTTTTAGATGAAATTGTCCGGCCACCTAGGTACAGAAGGTTGGCTGGACGACCAAGAAAGCG
AAGAAAGAAAAATGCGGATGAGAAAATAACAGTGAACAATAATTGTTGTGGGCAGTGTGGACAAGAAGGACATAACAGGAGAACATGTACTTTCTTCCCG
AAAGAGGATTGAAAGAATAAGACATTAGTGTTTTATGGTACTTCTATCTATTTTTTTCTTTATAATTTTGACTAAATAAAGTGTATTGGTTACACAACTT
AATTTGATGTTCAAATATATGGCTTTGCAGTTTAATTATGTGCCAAATTTAAACTCCAAATTTTATAAATAAATAGATTCAACAGTGGTGCGTTTCCAAT
GTAACAGTAATGATATAGGAGTTTGTTTGTGTATGTGATGTATCATATACATGAATATTATTGAAAAGATGTTATGTGTTCCGTGTATATTGTATTTTGA
GATATTCAAGTGTACAAAATATTGATTTGTTCAATTTTTTACTATATGATTCGTGTATACATACTTATGAGTTATAAATTTGATATATTATATTCAACAG
TGTTTGGGTTTCAGTTTTACAGTAATTCAAGCTGAGCTTATTTGTAACAAGTAATGTATCAGATACATTCATTTTAGTGAAAAATATGTTATATTTTTCG
TTTATTCGGCAAATCATGAGTTATTCTAGTGTCCCAAAACTTGACTTGTTCAAATGTGTACGACATGTTTAGTGTGTACAGCCTTATGAACTGTAATTTT
GATATAGTACATTCTAGTGGTGCGTTTCACTGTAATAGTAATCAGGGTTAAGTTTGTTTATGTATATGATGTATCATATACATTCATATAATTCAAGTTG
TTAAATATATAACTGCAATATTTTTTCAAGTGTATATTATACTTATGTATCATATACATCATTTGTATAAAGTGAAAAAACGTAATAATGTATCATACAC
ATTAGAACTTAAGTGTAATATACTTCATTTTGTAAATTAGCTGTCAAAATTACTTAAAATGAAACACTAAAAAATTTGTAAAGCAACAACTGTTTCTAAA
ACAATAACTTGAAAAAATATAACATTCATAACTAATAAAATATTGTAATACCAATAATATTTTAGAAAAACACAAAAGATAATTGTCTTCAACACAAAAC
AACACATAAACTTGTTCATCCTGTCCCAGCTAATTACTAATCTATATTAACAATGTCATCTTCAGTTGGTGTTGTGAATTGACTCTTAGGCTTTGGTGGA
TCGTCATTGTCACTTATGTATCCACCATTGACCTTGTCACTGCCGTATCTCCATAACAATGCAGCATATCTATTGCGTAGGTAATTTGCAAGATGTCCAT
CAGTATCAGGTGGTATAACAAGTTGGTCACTCAAAAACTCTGCAAATGTAGCTACGTATAACCCGCAGTCCCTACAATAAAACAAGAAATACAAATTTGT
AAAATGCTTTTAGGATGTATATGATACATTCTATAACTAGCACATAATGTTTTAGGATGTATATGATACATTCTATAACTAGCACCTATTATAATCTATA
ACAACCATCATATTCAATTTTAATTGAATGTATATGATACATTAAAGTTAAAATTATAAGACATAGGAATCATAATATGTATATGATACATCTTATAAAC
TGAACTTCTCAACATTGTAAATAGACATGGTGTATCTGATACATCACACAACTGTACCACATAGTTTTATTTTACTAATAACAACCCACAAAATTATTAC
CATATTATAGACCCTAAAACTGAAAACAACATAATGCTTTTACTAATCGAAATTTTACTGAAGAATCTTAAAATTTTACAGACAGTGTGCTTTCAGTGAT
ACACAATTCAAAATTATTGACAAAAATTATGAATCTGATACACACTATAAAATGTACAGAAACATGTTGGTTGTACTTTAATTTGAATGTATCAATCTTC
ATTGTTAATTACAGTTTACAAACGCATACAACAGTTTACACTTAGGGTATTATAAACAAAAAAACAAAATTATCAATTTTAAACACATACTTTAGGAAGT
GTGGGTCTTGACACTGTTGATGTAACTTTTCTTTGCCTTTTTTTCTTGATTTCTTCAGTCTTCTTCTTTGGCTCATCATTGTTGTTCTTCATCAACAATG
GGTCATGCAATCGCTTAGATCTATTCTCAGCCCACAGCTCATCATCAGAATCATACACACGTTTGGAGTTACCACACTCTTCCATGATATTTGTATACTA
ACACGATGAATTGAATGAATGAGAAAATCTATTTAGATGTAAAGATAGTCCTACAAAATAACAAATAAATATGGATGAAAATTTGAAGGGAATTCAAAAT
TTTCCTGCAAGAAATAGACTGAAGGAGAAAATTTGGTAGATGGAAAGAGAGTCCTAGAATATCAAATAGATATGGATGAAATTTGAACTGGAATTCAAAA
TAAACCTGCAAATGTAAACGTGTGGAATAAGGGAATTAAAAGTAGACAATTATACACCTACAATGTAGGGAATTAAAAAGGAAAAGGAATAAAAATTAAT
ATGGTAAATTTTAATTGGGGATGTTAATGGGGAAGTGGGTAGCTTAAAAATAGGATTTAGTTTTTGGTAAAGTTAAACTTGCCAATTGGGTGAAAAAAAG
GTGGAAAATCATGATGTATCATTTATATTTTTTTAAATTGGAGGAATAAGGGATTTTTGAAATTTTTAAAATAAGTTGGGATAAATGGTTATTAAGATAA
TTAAAGTAGTGTATTTAAGTAATTTTTTCTATATTTATTTAGGAAAAGCCCAAATAAGCCCATTTTTTATCCCAAAAAATCACGTGAATGGCCCGTAGAC
CATGATCTACATGAGCCCAGTGTTGTCCAAATCACTTAACAAAATACGAACAGCTCGCTAAAGCATTAACAAAATATTTATGGAGTTATTGTAAAGTCGT
ATGTTTTATTTATTTATTTTTTTTGTATAAAATTGTCCCCTTAAATTATATTTTATTTTCTATGATTATGTTTCAAACAGTTTCAAGCAAAGAAGGGCTC
GAAACATGGAGAAACTCAACACATTCAGATGTTCAATTTATTACCAAATATTTAATTTTTGCTACAGATTAAATCTTATACGAGTGACATTAATATTTAA
AAATTGGCAAAGTAAATCAATGATATAGGTAGATGGACTAGTTGACAAGGAAATTTTACAGACCACATTTATTTATCAAAATATAATGCAATATAAAAAA
CTAATACATCAATTATATATACACACTCGTAAATAACTTATACATTTATTGGCTATTTTACATAATACAAACTCCTAAAGAATATCATCGCGTAATATAA
TTATTAAAAATATCTACACTTTTAAATAATAATTAAAAATGTCAAATCAATATTTTAGCAAAAAAAGTGTATTTTAATATAATTCATTTACATTCGTTTT
ATTTCTCACACTGGGCACACTTTCTAACTCTTTCACGGGTAAAAACAAAAAATAAAAGACTTCATTATCCACTTTTCGCTCTCCAAATTTTTTAACCCAA
ATTACATCATTTCTATTTCTCTCTTTATCAGGATTTATCTTATTACTAGTAAACTTAACCGCGCTATGCGCGGTCTTAAAGTTTTCATTTTTATTTAATT
TTTAAATTCAAATAGATTAGTTAATAAATTTTATCATTTAGCTTTGTAATTTCAACTCAATACATAAATTAATTTTTTCAAAAAATAAATACTTGTATGG
TCAAATATCTCTACTTTTTTTTGGTTGAATAGTACCTATTATGTTATGTTAGTTATAATATATAATTAAAAATTTATGACTTCATTATCCATTTGAATGA
GTTCTCAAAATTAAATATGGTTAACTTTGATGTTTTGTTAAAAAATTAAAGTGAGATTTTTAGTCTTTTAATTTTTTTTAAAAATATCAAAAGAATTAAA
ATAGTAATAAATTCAAAAACAGACTTTGAAATATGAAAAATTATTCGTAATAAATAAGCTACCTATAATTTGAAGACTTAAAAAAGTAATTCAATATTTA
TATATTAAGATATAAAGTTCTCTGTATATTGATTCTTTGAAAGAAAATGGGTGATACATGATTTTAGTTCGGTAAAATAATTTTTAGTGATATAGAGTTA
ACATAAATATAATATATTATTGTTAAAATGCATAATAAAATAAGTAATAAATGAACAATTATAGATGAATGATAAAAGGTTTTATGTTAAGATTAAAAAA
AAACTTATATATCTACTAAAAACTTATAATTAAACTCTTGAATTTTTTCTGAATAAAGTAAATATAAAAAAATTGTTCACAAATAATATGAATATTTATA
ATTATTAACGATAAATAATATTTTCTTATAATTAAAGTGTAGGAAAAAAGTTAAGTAAATTTTTAGAATCATTATAATGGAGGATGAATGGTTAAGTAAT
AAGTATATTTGAAATGATTATCTGTATTAATTTTTTCCTTGATAAATTTTCTTCTATAATTCTAAGTTTTTTTAAAAAAATTTAATTCAACGCTATTTTT
AGTCTCCCCCCTTTTTTTTAGTCTTTGCGTATTTAATTCTATTAAGAAAACATAAACAATTAGCATCATAATTAACAGAATGAAGTTTTCTCGTCTTTAG
TATTTTTACTAATTTATATATATTTTTGTAAAACAGTAACAATTAGCATCAAATCGTAACATGATCAAGTTAGCTTGTCTTAAGCTTTTATTAATTTAAG
AAAAATGTTTAAATGAATTCTCTTGATTAATTTTTATTTTTTTTTCATGATTCATATTTTATTTAAAATTTAAAAATAACTTCATAATAATTTTGATTAT
CTCCCGCCGCTAAACGTATCTACAAATACATTTTAATGTTTTCAAAAATTGTTTTTGTCTTACTTTTAGTATTATCTTGCTCTTACCAACTACTTAATTT
TCGCTACAGATAAAATATTATACGAGTGACATTAATATTTTAAAATTGACAAAGTAAATCAATGATATAGGTAGATGGACTAGTTGACAAGGAAATTTTA
CAGACCACATTTATTTATCAAGATGTAATGCAATATAAAAAACTAATACATCAATTATATATATACACTCATAAAAAACTTATACATTTATTGGCTATTT
TACATAATACAAACTCATAAAGAATATCATCGCGTAACATAATTATTAAAAATATCTACACTTTTAAATAATAATTAAAAATGTCAAATCAATATTTTAG
CAAATAAAGTGTATTTTAATATAATTCATTTACATTTGTTTTATTTCTCACACTGGGCACACTTTCTAACTCTTTCATGGGTAAAAACAAAAAATAAAAG
ACTTCATTATCCACTTTTCGCTCTCCAAATTTTTTAACCCAAATTACATCATTTCTATTTCTCTCTTTATCAAGATTTCTTTTATTATTTCATATCCCCA
AGTAACTTAAATTGTCATTTTAAAAATTAAAATTCTCCATTTCTTAAGAAATCTTAGAAATTATTTAAAAGATATTCATATTTTTGTCAAAGTATTGAGA
TATAAAAGTATTTCATATGTTTGTATGTTGGATGTGAATGTTGAATGGAAGAAGTATTAGGTGAAGAAGTGTCATTTTTTAAGTGTCAATATTAGGATAA
ATTGTTCAAAAGTATTGAATTAGATTCAAAGAATTGAAGCGCCTTTTTTGAATGTCAATATTTGAATAAATCATTCAAAAAGTATTTTTTTTAATGTCAA
TATTTAGATAAATCATTCATAAGTATTGAATTGTTTGATTTTCTTTTATATGTTGGATGCTTGGAATACAAAAATAATCTATAATACTATTTAGTAGATA
CTTTATAAATTAGAAAATGAATATAATATATATTTTTTGAAATATATAACATATAAAAAATATATTTTTGTCATGAAATACAATTTTTTTTTAAAATCAA
ATTTTAATTGTTACTATGATTTCAAATTCATACGTTTTTATGATGGAATACAAATTTTGTTGGAATTTAAAGAAAGAATATATGTTATTTGAAAAATACA
CAAACCAATGTTGTATCCTTTTTGAATGAACACAAGTTCTTACGTAAGTATATAGATACAAACACAATTCTTAAATAACTAACTAAAAATTCATTCGGTA
TATCTATTGGAATGAATACAAACTAATAAAAAAATACAATGTCATTATACAAATCCAGACATGAAAATCATAAGAAATACAAATGTACATATTGTACGTA
TTGAAATGAACACAACCAATTATTTTTAAAATTGTAATTTATAAGATATTTAAGTGATATGTTCCTTTTTAAAAAAATATTTGCTCCCATTATTTTCTCA
TTTTTGTTATTAAATAATTGTATTCGTTCAAATCAAACAAATAAAAAATACATAAATAAAAAGAATAACAAACTAAAACTTTGACATTTTATCAATTATT
GAAAATATTGACAAGAGAATAACAAGCTAAAACTTTGACATTTTATTAGATATTGAAAATAGGGTAACTTTCACATATAGCAAATAAAAAATTCATATTG
GTATGCTATAGCAATGTTTGCATAATTGCGCTCCATGGCAAACATAGAAACTGTATAATTCGCTATACATATACAATTGAAGCAAATTGTATAAAACGAA
GTGTATAAAACAAGAAAGAGAAAGACACTTGGGTAGAGAACTGTATAAAAACGAAGTGTATAAAACGAATTGAATTATTATAAGTGTATAGAACGATTAT
ATACAATTTGAATTTGTATAAAATGAGAAAGAGAGAAAGACAAAAGAGACTTGACAATGAATATATAATTGAATCGAATTGTAGAAAACGAGAAAGAGAG
AAATTAGATACAATTTGAAAATTGTATAAAATGAGAAAGAGAGAAAGGCAAAAGAAACTGGGCAGGGAAATTTTTTTTTTGTATAATTATAAGTGAATAA
AACGAAAATATATGTACTTGCATTTGTATATACAATTTTCTCACACTTTAAACAAACATAAACGCAATTTATACATTTCGATTCCGTTTGTATATGTGAG
AAAGGCGAGGGTGGCGAGCGAGATTTGGGAGAGTGACGAACAAGATATGGAAGAGGGGAGAGAGGGGAACAAAAATATATGTATTTATACAATTTTCTCT
GTTTATACAATTAGAAACAATTTTATAGACTTGTGTTTGTAAAAACAGTGAGGAAGCGAGCGACAGATTGGAGGAGAGTGGCGAGCGAGATATTTGGGAG
AGAGGCGTCTGATAATTTTTTGCAAACGTTTGCTATGAAGCAAAATTAAATCAAACCCTAGTTACTCCACTTATTTTAAATTATTAGTTTGCTATTATAT
ATAATATTCCTTTAAATATTGACAAGTGATCCAAGTAGATGCTAAAATAATGACATTTAAAAAGAAAAAACCTTCCTTAATAATTATTTACATTCTTTAC
TCAATAGAAGACCCAGATACTCGTGCTATGATTATTATTTCATAGAGATGCCTATTTGAATGAGTGGAGAAGTAATTTAAGATAATTATAAAGCATGTGC
AATTAGCATCTTAAACCATATGGCAAATTAAAAATTTTAGGATAAACAAGTGGCATTGACTAAATAAATTTGAGTCATCCACTTTGCAATAATAGCCAAG
AAATATTACAAAAGAGTACTTTAATTGTTGATATTATTCTCTCCACTTGATAAAACTTTCAAAGAACCACCCCCTCCCCTATATTTATTTTCTTCTTTTC
CCCTTTATGGTGTATTGCTTATAACTTTGATGAAAAAAGAAAAAAAATTGAACAATTTAAAGAAATAGTGAATATATTCCTTGCTTTGTGAATGAAAAAA
TGTTTTAAAGTCAATATTCCTATTCCCTTTATACTTGTATAATTTTTTCCCTTTTTTAAAGACGATAAAAAGATTTTCAATCAAATTATCATATTATATA
GTTGATTGATGTACAGAAAATAAGACATGTTCATTCTGCACAATATTGCTATTATGAATTCTATTTCTTTTAATCCATAAAAAATAAAAATTAGAGTGAG
AAATTAATAACCCAATCATCTTTATGTAAAAACAATAGTACAATATAATTTGGGACAAAATTATTTTTTTTAAGATATATAAAAAAATTGAGGGTGTGAG
GTAAGTGGAGAATGGGGGATATGAGTGGCAATGATACTTGTAAAAGACAAAGAGTAGACAAAAACAATTGAACATGAGTTGGAATTCCACCAATGACAGA
GTCTAATGAACCCTACAAAAACCAAAGTCAATTTCCATAATGTCAAATGGGGACAATATATATTCTCATCAATTTATTATATTTTATTTGCGTTTGTTAT
CGTTATTTTTTTAAAAAAATATAATAATACTTTTATTTTCATATTTTCGAATTTAATGACTATTGAAAATAACGTATTCTTTTTAAATTTCATTTGTAAA
ATAACTAGGATAGCTAGGTATATTATTATTATTGTAATAACGTGACTTGTGAGAATATCGCCAATATTCATGACTTTTTTTTCCTACTAGTAGAATATAT
TCTCTCTTTATTTATGACGTGAAGAAATAAACAATGTTCTTGAAATGGAACATTTATAATGGACATAAAGAATAAGTACAAAGTCTTATTTTATTTTCCT
AAAAAATATTTAAAGTTGTTTCGAAAAGCAAAACAGCAGAATCTCGAGTCATTAATTAGAAGCAAACATTAAATTAATTATTGTACTATGAAATAGACAC
TTGGCGGCTTGATGTTTATGTTATTGCATCGAGTAATGATTATTACTAATTATACTCTTTAATTTCTTCACATGTCTTAATAATTTGGAGGTAATATAAG
TACCTTTTATTAATATTATAACTAGTAAATATATATTTTTTATGCATATTATTATATGATATACGTAAAACATACATTTCTGATATAAAATAATATGTAT
ATTTAACTAGAAAATATAATTATTTTATCGTGGGATTAAATGTGTTTGTGAGGATAAAGTAAAGATAAATGGAATTAATATTGGAATTGTATAGGACAAA
GATTTTGCAGAGGTTTATGTGATACGATTCTGGGTAGCAAATTGAGATAGTGCTTACATAACGACAAGAATCTTAAAGAGATTTTCATCAAAGACATGAA
TCTTTGTCTTGTAGCCATATATAAAATTACCAATAATGTGGTCCTTTTAAGACAGTAATAATCTTGTTTTTTTCATGCATATTTAAGTTTTGTGTGCAAC
GCACGCGTGTACGTAGTTGATTACAATTAAATATAATTTTTCAATAAAGTAGTTCAATTAAGTCCTTCAAATAAAAATCTTTGAATTTCATATGAAGATA
AAAATATAGCATCTCTTTTGACAATTATGTATACCTTAACTAACTAATAATATCGAATCAATTCGATAATACCATAAAATTAAGTTATAATCTTTATAGA
AAAATGAAAGATATTCTGCAAAATTTAGTCATAATTAAGAATGGTATACATGTGAGGCGGTGGTTAACTTGGGGCCTAGTTATATTATCATAATGATAAT
GAAGTTCACATAAATGTAGTCTAAGCTTCTGACTTTAAGGTTTGCACGCTTGTCCATCACTTCAAATAGAAAATTAGATAATAATGATCGTGTTCGTATA
GATTATTTTTGAGATTTAATTCATATGGTATCTCAACAATTGATTCATAACTCATTTTATAAGATGATCGTTAATTTTATCCTTTGAGTTCAATGTGAAA
TTAGTCGCCTTCATGAACGTCATCGCGTTTTAATGACCTTATATTTTAAATATCCTCGTTAAACTTTTCCCATATATAATGAAGTTCAACTAAAATGAAT
ATTTCCATATTAAGCAGCTTATTATATATAGTTAATTATAATGTGTACACATATATTTCCATGTTGAGAGTAGCTTACTGTTTCAAGCCTGGAGTTATGT
TTTGCAATATAATTTTAAAGTAGAAATTAAATATGTGAAGTATATATGTTTACTTCACATATTTAAATAGCAACAACTTTTTGTTTTCCATATACATACA
TGACAATCTCTCACACATTGATGATGTTTAACCAATTCCTTTTTCCTTGTACTCTTCTAGATGAATTTATTTTTATAGTATAGGGTGTGTTTGGTATGAA
GAAAAATATTTTCTTAGAAAATGTTTTCCTGAAAAACAAGTAGATTTTGGATTTATTTTCTCATGTTTGGTTGGTGAGTAGAAAATATTTTCCGGAAATG
ATTTTTAGTGTTTGATTTATAAATGAAAAATATTTTTGAGGAATATATTTTATTTTTATTAGAATACAAAATAATTTATGAAATTGAAAATATTTTTAAA
AAACAATTCTTTTTTGGTGGTGGTGATAGGTGGGTAGTGGGTGGGGGGGGGGGGGGGAGGCAGAGGGAGGGGGTAGGAGTGAAAAAATAAAATTTTGAAA
TTGATAGTATTTTTAAAAAACAAAATTATTTTTTTGGGGGACGAGAGTGGGGGTGAGGGGGCTGGCTCGGGGGGTGGAGAGGTAGAAACTTAAAAATAAA
ATTTTGGAGTTGAAAATATTATTAAAAAGCAAAATTAATTTTTTGGGGAGGGGTGGTGTTGGGTGGGGGACGGTGGTCAGAGATCGGGTGAAAAAAATAA
AATTTTGAAATTGAAAATACTTTTTTTAAAATTGATGTTTTTCCCAAAAAAAAAATGTAATTTGAAATTGGAGGAGAGCTTTGAAAAATGTTTTCCTTAA
TTTTTGAAGGGAAGTCATTTTCTTTAATTTTGATGAAAATGAGTTGATTTGGAAAATATTTTCCAAAACTTTTGTCCCAACCAAACATGAGAAAATTGGA
AAACATTTTCCAGAAAATGTTTTTCTTCGTACCAAACACACTCTAACTTACTTATGTATGTATACATGATAACAATTTACATTTTATTATTATTTATTCC
TAAATGAAACAGATATAAGAATTTTGTTGTTTAGCTATAAATTTTTAATCATAGCTAATTCCTTATTTTCTAGTAGTATATAAACTCATACAATCTTAAG
ATCGAAATTTAGAGAATTTTCACCGCCCGAACAATCCTTTCTTTTGTCTTATGCTATAACCTCAACGAAAGCATGATGAAAGAAAAAAATCAGCAATTTT
GATGAGCACAATCAATTTGTTAATCACTTGATTTAACTTTTATAGGAATAGTTAAAAGTGGCATATATATATATGTGTGTGTGTGTAAGGATCGATATAT
GTAGTAATTTGGGACCCTTAGACAAAGTATTGAAGATTCACAAAATCAGAAAAGAAATTCGTAGCTTACCACTTGAAAATGACATTCATATATTTATCAT
CAACTCTTTGAATATTTGTATATGCATGCTAATATTCCATAAATTGTGACATTGACTATGTCCATCACAATCAAATTATATATAACTAATTAATATATAT
TGCACCAAACACACGTCACTACAAAATTCAATTGGATTATCGATGATTGATATTGGATCCCTGATTCATTATTTTGATTTATTTTGCTAATTATTAAAAA
TAATTAATGTTAATTGTCGCATTCACTAATCACTACTACTTAACTGGATAAACTGATAAGGATAATCTCTATCGTCATCCGCAACATCGTTAATTTATTT
ATAAAAATTACTAAAGATCTTTTTAGCTTTATTAATTTGTTGTTGTTATACGTGCGTGTATAAATATAAAAAAGAATTTATGAATTATTATCGAAGTAAA
TATTATATATCACATAATATTAATAGTGTTTGAAATTAGTGTGTGATTCAAAAACAATGTGGAAATGTTAAAGTGATGGCATGTTAGTGCTCGACTTAGC
GTGTAGCTTAATTGATTTACTATTTTTTACCAATTGTTTGGAGTAACGCAGACTAGAAGAATTTAAATTGTGAGTATTGAACAAGAGATGACAGATTGTA
AATCTTCATTTGATAATGAATTAAGTGTAAATTTTAGTTCACAAGACTTTGATGAGTACATATGAATTTAATTAGAAATTGACATCTTAATACGTTAGGT
GGCGATTCTTCTTTTTTTATCTTAAAATAATTATCACAGCACAATGTATTGAGAAAAAAAAAATTAAGTGATTAACAGTATGGAACTTCATTCGAGCTTT
TGAGGTGGAAATTGTAATATGTGATATTCAAAAAAAAAATTATATTTTTTGCAAAAAAAGAAAAAGAAAAAAATTTCTTTAATGGGGTCAAGGCCTTTTT
TCGAAAAGAATCATGCAGACTTAACATAACTAAATTGTACAATATAATAGTATTATATATATAATAATAAAAATATTTTTGGATTTATTTAATTTAGCCT
ATAATTTTTCAGTTCTATATAAGATTTCTCTTTTTGAGAGAGTAAATTATTTTCCTTTTTTAATATTTGCTACTACTAAAGGCAAAACAAATAGGACCCA
AAACAAGATGTCTCTTTTTCTTTGATTAAAACAAACCTAACTTTGATGGAAAAGAAAGAAGAAGAAAAAAAAAGCTTCACAACACCATTTTCTCTAAAGC
CAAAGATGTTCCAAAGGAAAAGATAAAATGACACAAAGCCATCTCTTTTGGACTGATGAGTCATTATATATCTTTATTTTACTCATCAATTGGACACCTT
CTTTTAGTCAAAAAGGCAATAATCATTAATATATATTTACCTTTAATTTCATCCTAAGATTTTAAGGTTATTAACTTAATTATATATGATCATGGTGGTT
TTGTTCTTCCTTGGACAATATGTTAATTGTTGAAATTTTGATACATTATTATGATTAGAATTTGATCCTCTCTCTATATATTTGTCAAATAGTTACACTT
TATAACTTTAATTTATTTTTTATGTATACTTATTGATAGAGCGAGATAAGTTTTTAAATCTGGTGCCTTTTTATTCTTTTCCCTTTTCCATAACAAAACT
TTTTCTCTTAGCTATTTTTAAGATAAAAAACCAAGATTAAATTGAGTATCTATAAACTAAATATCTTTCCACTTTTGAGAAAGCATATTTCTCTCTCATA
TTCCTTTTTATCTTTTGCTCCATTTAAAGTTATTTTTCTACAATTTTAAACCATACTCGATTTTCGATATAAATTGATCCTTACCACTAATATATAAGAG
AATCAAAGGAACAAATTTTGAATTCCACGCATGAATTATTCATGAAATTTTGTGTTGGAGTTATTCCCATGTTTTAGTTTGAGAGATTTCCAAATTTTAT
TTTTGGATTAAAACATGATTACATTTGCATTAACGGCTAAACTTTAAACTCGATTCAGTTCAAAAACTGTCCATGTCATCTAATTTATCATATGCGACAT
CAATATGGAATATCAGACACCGAGTGTGAAAAACCAATAACTACTAAATTGAAGTATAAAATATAATCCAATAGTTTGTGCATTATCTGTAACTAGCTTA
ATTTTGGTTTAAAAAAAAATTAAACTATAATGTAGGTGCATGCATATACATAATTGAGGGGTTAAATTTGTTGTTGTACAATATTGGTATTGTAGCACTA
ACTTGTCTGTTAGGTTTTGGATGGTAATTAAAAAACACCAAACACAGAAGTTATATATCAATATTTTAGCCATGCTACGTACGTACAGAGGGGGACCAAA
AACACAATACATGTACATATGTCCAAATAATAGTTAAAATTTTCTTTTTATTACTCATTTGAGAAGAGAAAAAAGTTTTTCTTATCACTATGCAAGTTGA
TTTTTCCCAAGTCACAATCTCTGATCAAAACAATGATACATGTAATAATTGATATAATATTTTGGGACATCTTGTGTTAGCTAGCCATGTACGACTACGC
AACATCGAATTTTCACTAAGAAAAATCAAAATACACACAGCAAGTCTTTATACGGTAAGTTCCTCCGATGATAGATACTCATGAGGGGCAGGACTAAAGT
GTTTGAATTCAGTATCTTTGATTCTAAATTTGTATTAATCTTAGAATTTAAAATTCGTAATTTTTAAATTTTGATTTCGCCTCCACATGTATCATGTTAT
GAGATGGTGGATACACATGATGAATTTGGAATCTTGTGTGATGAGATCTAGAATAAGTGAAAACAAATGAATACTTCTAAGAAAAACAATTCGGAAATAT
GTCACGTCTACACCATCATATACAGACATTATATGTCCCTCTTTAGTAACTATCCAACGTCATTTAATTTTACTCACGGTCATCGTAAGTCGATAATAAT
AATTTGGACTTAATCATGATATTCACTGTAAACGTAGAGGTTAATTATTTCATCTTTTATTATATATAAAATAATATCTATCATAACTTGTACTAGAACA
ACTGAACAACAGATTATTAAATTTTCAATCAAACGTCGTATAAGTTATACGAAAAATAATACATAGACAACTTATTTCTTATCTTGCTATCACTGGAATT
GAATGTTGAATACCAAAAGATATGTAAACTTTCAAATCTTTGAAACATTGCATATGCTTTTAGTCAGTCCTTGATAATTGAATTATATATTGCAATGGTA
ATATAGATATATATAGGAATTGATTATGGCGTTGAAATTGAAAGGAAAAAGAAAGAAAAGCTAGCAAAGGTGGGACTTTATTTTGGATTTTGAAGTAAAT
ATAAGATGATCATATTGTTGAATCAATTGTGACACAATGTATCTTTTAGCTAGTTTTTAATAAGAGGGCCAATATAAAAATAGGCACATGAAAATGACCC
TTCACAAATTGTAGATCTGCACAACAAATTCATGGACAGGGACACCTCAAAAGGGCACTCCTCCTTAGCTTGTCCTAACAATAGTCTACCCTTGCCATGA
GAGTTTTAAACATCAGTGGAATCACTATTTTGTACTATATATGTGCTAAGGACACTTCCATTTTCCTTTACATGACCAATCGTGTCTGAGTGAATTTACG
TGATATCTTAAATTTTCTTAGGCTGAATTTATTGTCCGTCTGATTTAGACACTTTAATATATTGATAATAAAGTGATTTTATTTGGCATTTCTATTTTTA
ATTTTTCAAAAAAACTTTTGCGTGTGTTCTAAAGTTGTACTCGTTGATTATCATTATTAATATCATGAATATTGATTTTATTATCCCACCAAATCTACTT
ATCAAAAGATGAACTCATCTTAAAAAAATGATTTCGAATTAATTAGTCTTTATCCTTTCTATCTATTTTGCGATTTGAGTTTTAAATTTCTCGTAATTTT
CATTTCAGGCTATTGAAACTATCATCAAAAGTTGAAGTACTCCTTTATCCTAAGAAAAGGTCTCAACTCTCAAAGTATTAATCCTATGAATGAATCACAT
TTAGCGTGAAGTACTATTTTACCTTTTAAAAAAAAATATTTAATATAAATCGATATCAATCAGACTTCACCGTGAATAGTAGGCTAACAAAAGAATAAAA
GGGACTCTACTAGAACTGCATATATACACAGATATTGCCGCGCCCACAGCACAGTTTCCCATACATATTTGGGTCCATGATTTTTTCTTTGAATGTGTTA
CAAGTTAAACACAATACAATAGCACACTTTTTTATGTGAAAGAGCTATTAGGGAAATCAACAAGTTGTTTTTATTTTCCCCCTTTTACTTTTCTCTTGTT
ACTATACTTTTCTTTTGACGTGGAAGATCAAAAGCAAATGTTTATATGATCTCTCTCTTGCTTTTACTTTTGCAGCCCTCTCTTTAGGACTATTCCATCT
TCTAATAAAGCTCAAATAATACACACATTTTCACATAGAAAATTGGTCCAATTTTTTCTTTAATCTAGCAGGGGCAATCAAGAATAAAGCAAGTTTACTA
TGCCAATCGGGATCGTGGTTGAGTGTTAAGTACATATTTTTCTTTAATTAACAGGTCTCGGTCAATTTGAATTCCTTGTGGTTACAGAGTTATCTTTGTT
AAGAGTATGTGACTTTTAATCGAAATTTAAATTTAGTCAAGCTTTACTATCGATATTAAAAGTCGCGTGAAAAAAAAAGAAGCAAACTTACCATTCAATA
AAAGATAGAAAAAGCTTCTCTGGTTGTTTCTTCCATGCAACCTATCTATACAACATAATTATATATTGATCATTCCTCACAAAACATAGTAATGATATAT
TAATAATCATCATCTTTTTACTACTGTGTTTGTTGCAGGCACATGTCTCCAACTTCAAGAAACTGTACTGTAAGAAAAGAATCACAATTTTAGGACTTTG
AAAATTAATTAATTCCTTTTTTTTTATTATGCTTAAGATACTCTATACCAAGTACATAAATTGTGTTTTTCTAGTATAGTTTTTAGGTTTATTATTTCAT
CTATTGCCAGAACAATAACCCATGCAGAAAAAGTTTTTGTCCCAAAGATATGAAAAGAGGATCATCACTACTTCTTTACTTGTTCACCCTTTACAACATA
AATATTATGCAAGCAAGTAACGTTTGTGACACGTAGGCGAAACTAGAAATTTGAGTTTATGTATTCTAGATTTTTTTAAAAAAATTATTAAGTTTTAATA
AAAAAAAATTTAAACAAAAATAGAGTTTTGTCGAATCGGCATGTTAACGTCATTTGGTTTGTGATGTCACTATAGGTTTTGGGCTAGTGAAAGATATATA
GTACATATATATTGAAATTAAGTGAGATGTTCGCAAACTGACTTATCGGAATTATAATGCATAAATTAAAAAGTGTCATTATGATCTTAGATGTAGATAT
TTTTGTTAGTGCTCAATTATGACATAAAAGGAAATTGAAGTAACAGAATTTGAAACATGTATTTCCATATATATGAGTGTTTATAATATAGAAAAAAAAA
GTTATTTTTATACACAGACTGAGTAAAACATCTCCTATAAACAACTGTTAATAATAAGATAGGTCATAATTTTATAACAAGCTATATACATTCATGATAT
ATGTAGTATAAAAAATTCTTAGATGAGAATTCTTCTGTGCAGCCTAAATTATATTCTCCATATGATCAGATAAGTAGCTGGCCTAGTTAGCTAGCACATA
CTAAATCTATAATTCTCCATTATGTGTCCTTAATCATTATCAATTTTGGGTCAACATTTGCTATGTAATAGTGGCATGCATTGATTACATATACACACCT
TTTCCCTCTTTCTTTTAAGTTATTTTATTGTCATAGGCTATTTTTTTCCGAAATGCTCGATAGAGTTTGATTAAATTTGGATTCGTATTAAAAATTTTCA
CATTATGGATAAAATGTTTTCTAACAAAGATAATTTTATATCTCTTAGATTTGAACCTGAGACTTGTGATTGAGAATAAAAGAGTACTTATCACTCCATC
ACAATTCTCGTTGGTGGCTAAAATTCTTTATCCATACTTATCATCATCATATCAGAAAATTGAGACCAACTCAGCCATTCCTTCATGAATGATTTGAAAG
TGCAATTTCATCATCTCTCACTTAAATTAAAGTATCTTTTCCACTTAAAAGTTAAAGGGTATTCTTGTCATATTGAATAATAATGTAGAGTGTGAGAAAG
ATAATAGTATAGTATCAACTTTTTTCTCATAATCTCAACTTTAAATTTCTGTTTTTTCATCCAACGGCTGTTTTTTAAAGTCAGTAGGGACCTGCTTTTT
TTTTCTTTCTTTCTTTGTTACTTTGCTCAAATAAGTATAATTCATTATATGTATATATACACTTAATAGTTAAAGAAAATACCATTTAATTTAGGCTAAA
AACTAACTTTGATCTTCTATGTAATGTGTTGTTCTTCACTGAGAGATAAAAGGAAAAAAAAAGAAAGAGGAAAAGTGAAGGCTTAGCTTCTTCCTTGATC
TTGAAGACTTACTTTCTTTCTTTTGAAGATGTTTGATTCTTTAAATCTATCTATACCTGAAGTTTCTCAGATTCCTTTAACTTTTTTCTCCTTTTACATT
GCCTCAAAGTTTCATAATAACTCACTTTGTTTCTTCTTCAAGTCCAAACAAATTCACTTTCTTTGAAAAAAACTTCCAAGAAAATATGTTGCCACTTATT
CTTGTCACACTCTTTACTCTTGTAGGCACTTCCCTTTCTTCTATTAGTACTGATGTTCATGCCTTGTTGAGTCTAAAACAAGGATTTGACTTCTCAAATT
CTGTTTTGAGTTCATGGGATGTTTCAAATCCTAGCTCAGTTTGTTCTTGGGTGGGAATCAAATGCTTACAAGACCGAGTTGTATCGATAAACTTGTCCAA
TATGGAGCTTTATGGCTCTGTTTCCCCTGTTATTTCAAGGTTAGATAAGCTTGTTGAGCTTTCAATTGATGGTAACAACTTCACTGGTGAAATCAAGATT
GAGAACATGAGGAGTCTTAAGTCACTCAACATTTCAAACAACATGTTTAGTGGGAGTCTTGATTGGAACTACACAAGTTTGGCTAATTTGGAGGTTCTTG
ATGCTTACAACAACAACTTCTCATCTTTTCTTCCTGTTGGAGTTGTTAGCTTGGAGAAACTCAAGTATTTGGACTTAGGTGGCAATTATTTCTACGGACG
AATACCGGAGAGTTATGGGGATTTGATTGGGTTGGAGTACTTACAACTTGCTGGAAATGACCTGCATGGAAGAATCCCTAGAGCATTGGGGAATCTTACC
AACTTGAAAGAGATTTATTTGGGATATTTCAATGTTTTTGTAGGTGGGATTCCTAAGGAATTTGGGAAGTTGGAGAATCTTGTTCACATGGATATTTCTA
ACTGTGAATTAGATGGTCCAATTCCTCCTGAATTAGGGAATTTGAAATTGTTAAACACACTTTTTCTACATATAAATCTTCTTTCAGGTCAAATACCAAA
GGAACTAGGCAACCTTACTGGCTTAGTCAATCTTGATCTTTCAGCCAATGCACTTACTGGTGAAATCCCATTTGAGCTCATTAACCTTCAGCAGCTAAGT
CTTTTCAACCTGTTCATGAACAAATTACATGGCTCTATACCGGATTTCATCGCTGATTATCCTGACCTGAAGGTTCTTGGTCTCTGGATGAACAACTTCA
CCGGTATAATCCCGCAGAAGTTAGGCCAAAATGAGAAGCTGCAAGAGCTGGATTTGTCTTCAAATAAGCTCACTGGTACAATTCCTAAACACTTGTGTGC
TTCTAAGCAACTCAGAATCTTGATTTTACTCAAGAATTTCCTCTTTGGTTCAATACCAGAAGATTTAGGCACATGTTTGAGTCTTGTTAGGCTGAGATTG
GGACAAAACTACTTGAATGGTAGTATCCCAAATGGATTCATTTACATGCCTGAGCTAAACTTAGTTGAGCTGCATAACAACTATTTGTCTGGTAACTTAT
CAGAAAATAGTATCACTTCTTCAAAGCCAGCAAAGTTAGGTCAGTTGAATTTATCAAACAATCAACTTTCAGGTTCTTTACCATTTTCACTTTCTAACTT
CTCTTCCCTTCAAATCCTTTCACTTGGAGGGAACCAATTCTCTGGTCCTATTCCTACTTCTATAGGTCAACTCACACAAGCTTTAAAAATTGACCTCAGT
CATAACTTTCTTTCTGGTGAAATCCCCCCTGAAATAGGCAACTGTGTCCACTTGACTTATCTAGACTTGAGCCAGAACAACTTCTCTGGCTCAATTCCAC
CTCGAGTATCCGAAATCCGAATCTTGAACTACTTGAACTTGTCAAGAAACCACTTGAATGAGACCATACCAAAGTCAATTGGTACCATGAGGAGTCTCAC
TACTGCTGATTTCTCATTCAATGATTTGTCAGGCAAGCTCCCAGAATCAGGCCAGTTTGCTTACTTCAATGCTACTTCTTTCGCGGGCAATCCTCAACTC
TGTGGTTCTTTATTGAACAACCCTTGCAATTTCACGCTAATCACTGATCCACCTGGAAAGTCACATGGAGATTTCAAGCTGATCTTCGCCCTCGGGTTGT
TAATCTGTTCACTAGTTTTTGCAGCTGCAGCTATCATAAAGGCCAAGTCTTTCAAGAAAACAGGCGCGGATTCTTGGAAAATGACAGCATTTCAGAAGGT
TGAATTCAGTGTTGCTAATGTTCTTGAATGTGTAAAAGATGGCAATGTGATAGGCAGAGGAGGAGCGGGGATTGTTTACCATGGAAAAATGCCAAATGGA
GTTGAAATTGCAGTGAAAAAACTGCTTGGCTTTGGAAACAACAGCCATGATCATGGTTTCAGGGCGGAGATACGGACACTAGGCAACATTCGACACAGAA
ACATTGTAAGACTAGTTGCATTTTGTTCCAACAAGGAAACGAATCTCCTTGTGTATGAGTACATGAGAAATGGTAGTTTAGGAGAGGCGTTACATGGGAA
AAAAGGCGGATTCCTTAGCTGGAATTTGAGGTACAAAATCGCGATAGAAGCTGCTAAAGGATTGTGCTATCTTCACCACGACTGCTCGCCATTAATTGTT
CATAGAGACGTCAAATCCAACAACATTTTGCTGAATTCAAACTTCGAAGCTCATGTTGCAGATTTTGGACTAGCAAAATTCTTGGTAGATGGTGGTGCCT
CGGAATGCATGTCTGCTGTTGCTGGCTCCTACGGTTACATTGCCCCTGGTACGTTACTTATTTAACTTCTACTCACACATTATCGTTCATAATAAGCGAA
ATTAATAATCTCGAAAAATAAAATATACACTGCGTACTGCGTAGAGGGGACAATTATTGTGTAACAATCATAGATGTATGTACGTTAGTTAGTTAATTTA
GTTAGGTATATAGACATTACTACTCTGACAAAGTGATTTTTTCCTGGTCGTACATACAACAACAATTAGTCTTATCAATCGGTTATAAAATCCAACTTTT
TTTTTCTTTTTAGTTTGAAATTTTGGGCTAAAATGAAGAGGCCCGTGATTGAAGGGGGCATATAGAGTTTAGGGCTTTGTTGGAATTTTATGGGTAATCG
TAAATCGTATCATGGGCCCGTTTTACGAGAGAGCACTTAATTTCTGTGCCACTAGAAAGAGTTCTTAGTGGGGGCCCAATAGAAGATCACACTGCTAAAG
TGGGTCAAAAAACTGACACACAGATAATTGGGCCCCTCGATTATCGTGCTTGCCAACTCAACATGCACTTTAAAAAAATAATCAACTTGTAGGCATCAAC
TAAATAGAGTAGAGTATTATAATATATAGTCGCAATTTTATATATTTTATTGTATAAAAACTCTTTAAAGTAGTAAACTTTTTCAATTAAAGAAAGAAGA
AAAAGCAGCAGTGTGAATATTTTTTGTTTCAAATTGTTGCAGAATATGCATATACATTGAGAGTAGATGAAAAGAGCGATGTATATAGTTTTGGTGTGGT
TCTATTGGAGCTGATCACCGGGCGTCGTCCGGTGGGAGAGTTTGGAGACGGAGTGGACATAGTACAATGGAGCAAGAAAGTGACAAATTGTAAAAGGGAA
CAAGTAACACACATTGTGGATCCAAGGTTAACTAGTGTGCCTCAAGATGAAGCAATGCATTTGTTCTTTATTTCTATGCTATGTATTCAAGAAAATAGCG
TAGAACGTCCAACAATGAGGGAAGTCATTCAAATGTTGTCCGAATTTCCAAGGCAATCACCAGAATATCATCGACCTTCGTCTTCAAAAGTTGTTTTACA
AAAGCTAAAAAGTCTTGAGAATGACCAAATTACTTGTCCGAAGATTCGAAAAGAAAATTTGGTCTAACCAATTTTCATTTTTTATATAATATGGTCCTCT
TGGCAAGTTGTTTTAATGTTAACTTTGTATTATTCTTTATGCTTATTTAAGGATAGGGGTTTTATGACAAAGAGAAGTAGGAATATAATTAGTATTATGT
ATTATTAGTGGTTAATTAGTTGCTTTTAATTAGTTGTTAGGGTTGGGGGTGTTTAAGTTCTTGGCAAAGGCAGGCCAGGCCCAATTAAGTTGGTTCTGAA
TGCTTTTTGTATCATATGGTTATATACAGGTATATATTCTTCCCTTTACCGGTGAATTGATTCTCGATTCAATAATGTTTAATTGTTTATTGTTGGTTAT
GTTGTTACGGGTGAATTGGTTCTCGATTCAATATGATATTTCAAGTGAAATGAATAAATTATCAAAGTTCAAATAAATTTCTCAAATTTTGGACATTTTA
ACTCTAGACATGATTTTTTTCATCTTCAAACTTTTTATGTCTGAAATTGATTCAGATTTTCGTTTAAAATGAAAGATTCCGAACGACATAACTGATTTGG
GTATACATTTATTGGGCCTCGCATTCCAATACTGTGTAGTTCAATATTGAGGCCCAGTCTCCAACGCTTGAACACTTGAACGAGGCCCAAATCATAAATT
ATTGTATAATTAAATGAAGATAACAAATATTAATTGAAACATTAAAAATATTATTTATATTATTATACTCCTATACAAACTTCAAGTGAATGAGTTTTCA
TGCAATGTTACCTCTATCCAACTATCCTGGAGTTTTCTTAGTTATATATATGAGTATCATTATATTCTTTTAATCCCATAATTATTGAAGATTCCACACA
TGAATTTAAAATATGATTGATTGTTCATATGTATTCCTTGGAATATTTGAGGTCTTTTTTTTTTCTCTTCATATTTTCACTTTTTTTATCTTCTTATTTA
TAATAATTTTTTCAAATTTGTCAAATATAAATAAGAAAAATTTCTTGAACATTTTTCTGTTATTGATATCTGACTAATTCAAATTCATACCAAGTAGATC
GCTTAGAATGAAATATTTTTTATTGAGACTCAAAATCAAAATCCCCATTAAATTTAAAGTAACTCCATTTACTACACCGTATATTTTTATTTTATAATTC
AATAAACTTGATCTTTTATTTTATATTATATAAACAAACACTACTTTCTATATATAGATATTTATCAAAAAATGGCATTGCACAATGAAGAATATTTTAA
ATTAAATGTCATGTGTTTCATTCTAATGCACATACTTTCCCTTTCTCATTAAATCCAATTTTTTATTTTAGGGGAAAAAACAAAGATGTCAATATACCAC
TAACAATCAAACCTAATATTTACAACGACTTCTATATTTTTTTCTATCTAATTCTTTAATTCAAACAATTTAAAATTATCCCAAAATCCAATTTAATTTT
CTAAAATATCTCCTTCAATAATACAAATAAAAATCCATAGATATTTTTTATTTCATAATAATAATATTAAAAAAAAAGTAAACAACTGGACTCTTCCAAA
TAGTGCTCGTCCACAATTCAAATGAATTTAAAAAAAAAAAAACACAAAAGAATCTTGAGTACCAGTCATTGACTATAAAATTAACGGTCCAGATGAGTTG
ATACCAAATCAAGAAACGAATATAAGCCGTTAGATTAAAATTAAGGGTTTAGTCACAGTTCCTTTTCACTCCACGCCTCCTATTATACACTCACGCAGTC
CTCTTTACATTCTTCCTCTTTCGTTTCCCTCAAAAACCTTCGCTACAGGGAAACCGCTTCTCTGTTTCATAGCGGTTTTCCGGTTATCTGGATCGGTGGT
TTTGTTTATTTGCTTATATAAGGTGAGTTTTTCTTTGTTTTCTTGATTTTTTTCTTGTTTGATATAAAGATCTATAACGTTTGTTTATTTGTTGAAAGAT
TTATCTGGGGTGTTTAGTTTCATGTGATTTTGAGCGGGAAAAGGGTGTTTTTGGATTTTTTTTTACGCGACATACATAAAAACATGATAAAGAAAGATCT
GAACTTTTTTTCCTGGAAAGATTTTTCTGGGTTTCACTGCAAAAGGTTTTTTTTTTTATCTTTATTGGGGTTTTGTTAGTTTTGCTTTTTAGGTGAAATT
TGAGATGGGTTTCTATTTTTATTGAGATTTTGGTAATTTTCTTTATGTATAAGTATGAAAAAGTTTGTGGTGTCTTTTCCTATGTGCACGAATGATGAAG
TGAAGCTTTTGGGTTGTGTTCAGTTTTTCATTTACGACAAAGGATACCTGTAAAACCCACAGTAGAGTTGTTTTCAGTTTATTTTTTTTAGGTGATTAAT
TTTCAACCCTAGTTTAGTCTATTTTATTGCTTTGATGTTTTTCCAGGAAATAACCATTATATGTGGTGTGATTTTATTGGGAATCTATTGTCCTTTATTT
GTTTGCTGCTATTCTGCGTTGTTGTGAAGCAGAAACACAAGTATAGATTGAGGGGCTATATTCTCTTTTTCCTTGTTTTATGGGATAATCATTTGAAACT
AGGTCCACCCTTTTTTGTTGGTCAATTATTAGGATAATAAAGTGAGGGAAACCAGTTTTTTCTCTCTACATTACAGGCTATCTTTTACTTCCTTGTATCT
AGGCATGAATTCTTGTTTTTGAATTTTTTTTTGGTATGTTCTGTTATCTACAAGTCAATGGCTTGGAATGTTTTTCTTGTCTGTCTTTGTCTACATATGA
TTGTAAGGCATGTGTTTAATTCAAAGCTCCTGGAAGGGTATTCATGTCTGTGTGGTTGTTCGGGTTGTTTTCTTCTTTTCTAGTAGATTTTCCCCCTTAA
TGTCATGATTTTGGAGCTCTCAATTATGTTTTTAAATCATTAAGAATTTGCTTATGATTATTTGTTCTCAAAAGTTTCTGTTTCCTTTTTACCTTATGCA
TTCCGTCAACTGTTTGCAGGTCAGGAATTGGCTTTTGAAGCTTGATAATGGCTGGTGAGAAGATTATAGAAAAACGTATCCTGTTAATATTTGACTGCAA
TTTTCGTGGGTCCTTTGGTAGATTCTCTAGATGCTTTATTACATGTTTGAAATTTTTGGAACATGGTTTTTAAAATGCGAATGATGTCTCAATCTTTTAT
TTGGCATTGATGACTGGATTGCTCCACAGTATGATTTTCTTGCTGATGAGCATATTTCAGAATGTTAGGGGGGTGATTGGGTATAATATATGAATTTTCG
AATTCTCAAAGAAGTGTTTCCATACATGAATCTATGAAATCCAAACTCTACCAAATGTCTTTACAGGAAACAGCTTTTATCCCTGATTAAGATAAAAGGA
TGTTTCAGTAAACAGCTTTGATATCTTATCCCCTGCCTCTCCTCAAGCCCTCATGTGGAGATGGAAATTGCAAAGGAACATGCTAAATCTTTATAGCACC
ATTGCAAACATTTATCGCCCTAGTCTATGTGCTTATGCTAGCTTCTGATGTGCGATGAGCCAATGAATACTGTGTATAAGATTATGCCACTTGATTATAA
GAAGACTATTAATGCTTGAATTAGCCCACCCTGTGTATAATCTGGATTTTTATTTCGAAAAAGTCTTCTGTTTGATGGTACTAGTTGTTTTATCAAGTCT
TGAGCTCGGTCTTATTATACTTATTGCTCTATCAAATCTTGAACTCGGTCTTATTATACTTATTGCAATTTCGTCATGACTTAACTTTTTTCAAGCTGAA
GCTGTTGCTCCGGGACTGAAATCTGATCCCTCTAACAAACTGATTGAGAAGGATTTGGTATGCTACTATTCATTTCTCTCTTATTGTACATGATATATTT
GTGTTGGGAGTGTTAAATTTATAAATATGTTACTATACCGGAAAATAAAATAATGCTTGCTTTTTGTGACTAATTTTTGCGAAAATAGCACGTAGGTTCC
CCATATGTCTAAGGAGAGGGGAGGTAGGCGGGAAAGAGTTGGATAGAGGTGATTATACAAGGACCACATCTTCAACTCACCCGCAAGTACTTGACCCTAG
ATATTGAAGTATGAACTATCCAGGTCGAGGATAGAGAACATGGTTAATAGTTAATCAAGTGCTTCTCTTATTTTTAGATGAAGTAATGAGAGTAGTATCG
TATATCTCGAGCTAATTCTCTTTTCCCACTAATCTTTTCTGTCATAAGCATTTGTTTGGTTAGAAGAATACTGTTTAGTCTTTGTCTTGAGCTACGAATG
TTCTCTGTGCTTCTGCATTTGTTTGGTTCATATAAATCATGCTCATCACTTCGTTTTATGTACTTCAGACATTTTTATATTTTTTTTCGTATCTGTTTTT
TTGTAAACTCAATATGTATAGGTTTCAAAAAAAGATGGAAAAGCTGCTGACTCGGTGGCTTCTTTGGGAGCTGTGACCAGCATCAAGTGTGAAAATGATC
AACCACCTGCTGCAGAGCAAGGTGCTTATTATCCACCTACTAGCTATTGCGATTACTACTATCCAGGTTAGATACTGACTTGGGTTTGTCATAGTTCCTT
TAATTTTCGGACCTGCTCCTATTTAATGGTCACAGACCAGTTATGACCACTTCATGATTCTATTCCCTATATAAATGCATTGGAAAATCTTGGTTGGAAC
TTGTTAACTTTATGAGTAGTGTGTTTTTGTGTATCATATACACAGAGTTATCAAAGATGCAGAAGAACACATATCAACCAAGTTTTTATATTCTACTAGG
GCTGACTTATGATAAGCTACATCTTAAGTACATATTTTATTAATACTCCTAGGTGGAGATTGCTGCATCCTTTGATGCTTGTTTATGAATTGTGGCACAT
TTTATTATTTCAAGTTATGTTTCTTCTATTCATTGTAAATATAAGGTGCAAAAAAGAAGAGAAATGTAGCAATTTTTATGGAAATGAAAATCGAACTGAC
ACACTGGAATAGAAAAAGCTTATGGAAGTAGAAATATGAAGCAAGTAATTGAACCCTGCTTTGGTGGTTTTTTTTTGGGGCTCTTTTTACTGGGTAGTGA
ATTAGGTAGTTCTCAATGCTGCTAGGAGGGTTCGGCAGAAGTATATGGAACCATTACTGGTAGAGGTTTGATATAGTTTTGATGCTTAACTATTTTATTA
TATCTTCAGGTCTTTACTCCTCTCCATTGAAGTTTGATCTGTGGACTTGTATGTGTTTGCCTTTTGCAATTAAATATAATAACCCGTTGGATGATAGTGT
AATTTGAATTTGCTTTTTGCAGGATATAATGGGACTTATAATCAGTTAGATGAGCAGGCTTACTTTAATGCGGTAGGTTTTACTTCAATAAGGGTTGTGT
CATCTTAATTTGTTTTGTTGTCTTATATAAGCTTAAACACAATCTGGTGATTGTCAGGGTGTTCAATCAGACAATGGTTCCCTTCTCTACTATATGCCTG
GCTATAATCCTTACAGTGCTGGATTTGTGGGAGGCGATGGGAAGCAGCCCTATCCTTCGTCCGGATATCTCCAGCAACCTGTCTCATATGGTTCAGATTC
CATGCCATGTTATACATGGGGCTCGCCATACTGTGCTGATATCACCAATAGTGCTGCTCCAAAATCCGGGAACGTTAAATCAACTTTTGGACGAAATGGT
TCAGTCAAGTCGAATGGTTTTAATTCCACAAAAACAAATAGTTCTTTCTCAAGCAAAAACTCGACCGTACTCTTTAACCCAAAGAGTCGACCAGCTACTG
CCATGTCAAATCCTCCAAAGTCTTTCCATCAAGCTCAGCCTTTTAATCCAGTGAACAAGGTCTGTTTAAATTTCCTCTGATTAACTAACTATATGATGGC
TTTCTTTGCTAATGTTGAATGGGAAAATCTATGCTGAAATGTCTCTTTCATTCCTTTCAGAGGGAAAATGTCTCTTTAAGTTTTTATTTTCTATGTTTTT
CCTTGTGTTTGAAAGTGTATATCTTCCTCTTGTTTTCTTTTGACGAGTTTTATACCCCTGTCTTTGCAGTTTCAGTCCGATGTCCAGTCTGGAGGCCTGA
TGAAGGGGTTTCATCTGGTTGGGGACTACCCATCATACACGAGTCAGAATCAAGGTTTTTTCATGCCTTATGATCCCATCAACTGTCAAACAAACAGTAG
AATGTGGAATGGAAACTACAGAGCTAAACCACGGGGAAATTTCACCAGAAATGGTGTGTTTGAGGCAACTAATGAGTTACCTCGTGGTCCCCGTGCCAAC
GGTAGAAGTGTCCCTTCAAAACCATCTGCTGAGGAGGATCAGCTTGTGCCAGCTGTTCAGAGGGAGAAGTATAACAAGGAGGATTTTAAGACTCAGTATG
ACAATGCAAAATTTTACATTATCAAGTCATACAGTGAAGATGATATCCACAAGTGTGTCAAATATGATGTGTGGTCAAGTACTCCAAATGGAAACAAGAA
ATTGGACACTGCCTTTGTTGAATCTGAGGCTAAAGCAAGTGGAACTGGTTCAAGCTGTCCAGTGTTCCTCTTCTTTTCTGTAAGTTATCATGTTTCTGTT
TTTTATTCTTCGATTACATCTGAACGTTTTTTTTCATTTGTGTGCATGGACGTGTCTTTGAAAGGATGGTCATAAAAATCTAAGTTTTTTTCTCTTGAAT
TTTTAGGTAAATGGAAGTGGACAGTTTTTAGGTGTAGCTGAGATGGTTGGGCAGGTTGACTTCAACAGAAACATGGACTTTTGGCAGCTTGATAAGTGGA
GTGGGTTCTTCCCACTGAAGTGGCACATAGTTAAAGATGTACCAAATACACAGTTCAGGCACATCATCCTTGAAAACAATGATAATAGACCTGTAACCTA
TAGCAGAGATACACAGGAGGTGTATCTCAGTTTTTGCTTCTCCATTTTTGGCTATTTTTGTCGAAGATGTTTAATTTTTAGTTCAGTCTGCCTGTGTCAA
TTCTTAATTTTAAAATTAGAGATCTAACAAGTATGCTGTCATTCCAGATTGGATTGAAGGAAGGTTTGGAAATGCTTAACATACTTAAGAATTACTCAGA
GAAGACATCTATATTGGATGATTTCAATTTCTATGAGAAGCGTGAGAAAGTGCTCAAGGCTAAAAGGAGTTCAAAACCAGTTATTCAAGCTGATGCATAC
GAGAAAGCTGATTCTCTTGTGAGTTTCTACTCCTTGTGCATTTCTATAAATATTCAACAAGTAGTGCCACTCTGCATTTTAGCTATAAGATACCTCATGT
TTCTCTTTAAACTGTGGACACTTTGTACCAGACACATTGTATGAAATTCGTATGTTTCCTGTGTTGCAGAAGCAATTCAAAGGAGGAGACAAGGTACTCG
AGGAGGAGCTGAAGACCAACTCTACTGATCCAACTGCACCTTTGGTTTCTCTCACCAAAAACCTATCGATTAATTCAAGGCCATTCAAAAGTAGTGTCTG
AATCATAGGTTGCCTCCAAGAGGCATTTTATGACTAGGTAGACCTGA