BAC Sequence – LE_HBa0109A21

>C01HBa0109A21.1
TCAGACTGACTGCTTTTTGTGGACGTCAAGGTTCAAAATGACTTTGGACACTGATTTAACCATGGGTTTCCTCCTGTGAGAGGAAATAGTTATGTGATGA
ATCTGATGCCGTAGTTGTTTGTGTTTCTGTTAGTCTTTTATCCTCTTGGTACTTTTCAAAAGTAGTTTCTGTTTCTTTTGTGTTGAAATTTATCTCTTTG
GACCTTTAAAGTACAATTTTCTGGGCATTTGGGTTGATTTTTAAACTCCGGTTTTCGCTTTGCTGTTTATCTTTTTAGGAGAAAGACAATACTTCATTTT
TATTTGTCATTTTGTGTGTTTTGAAACATAAATTAGATCACGTTAATTTGATATTTTAAATAAAAAAATTTAGATATTAAAAAATTATATATTTTGTTTC
AAGTCAAACTAGGTCATTCTTTTTTAAACGGTTTGGAAGTTAAAGATGCGTCAGAGTTGATTTGCTTCTCATAATAGTTTTTATATCATTGCATTATTTA
TATTTGTAAAATCACGACTTCCATGGTTCTTTCTAACCTTGTTTTTTTTTTAAAAAAAAAAAAAGATTGTTAATGTATTTTTGTTATTCATAATTTTTTA
TATTATTATTTTTAAAATAAAGTTTTATAGGACTTGTATTTCGTGCGTCGAGACTTATCACTTATGCCTAGTCTCCCGCCAAGTAAACCTTTTTGCCTCA
TGCCTTAACATTTTAGAACACTCGGTATTTTGTTGCTTAAAGCGTGTACGGAATAAGTCTTTTTTTTATTATTATTTTTTTATTTTCATTTAATAAATGA
CATATCTCGATATTTCGATCTACTCACCACAAACATCACAGGCCTCCACACAGTGCATGTGTGAGGGTTGGAACAAATTCAATTGAGTCATACGTTGATG
CCTACACTAATTCTCTTGTAGTTTAACGTAAATATAAACTTGTATAATTTTATTTACGATTTAAAATTTTATTTAAAACTCTACCATTTTTATTCAAATC
ATGTATAGTATTTAAAGTTTAATATATATTTGGTCGTGAATCAAATTCTTGGTGGCTCTCAATAAATGAAAACGTGTTTTCTCTTTCTTTACCATTATAT
ATTCATTTATCATCACAATAAATTAGTTAGTTAAAGATTTCAACTGCATACTCATTTATACTGCTAAAGCCAGTGGCGGAGCCACATGCCAATTAGGGCT
TTCATCTCTACCTCTTTCGGCGAAAAATTTATCAATTTTATATAATTAAAATAAATTTTTAAGTATATATAGTAGATATCGAACCCCCTTCGACTATTTT
GAGTGTCTATCTCTTCAATTTTTGAACCCCTTATTGATAAATCTGGCTCAACTACGGCCTATAATTACTTTTTCCTACTTTTCTTAAACATTATTGATAT
AACATATCTTTTTTTTTTATCTGCTTAAAATAGAATAATATATTTTTTATTTGATAAATATTTAATATAATATTATAGACATCCAAAAAAAAAAAGATTA
TAATATGTTTTCCGTATATTATTGCTATTTGCAAGTTGAAATACTAATCAATTGTGTCCAGATTTTAAAGCTAAATGCCGTGCAATAATGGGTACGTTAT
TTGATTGAAAATGATTGTTGCTATGTTAAAAGTAAAACCAATATTAATGTGAAAATAAATAAATACCCAAACTTTTCAATTTCTAAACACTTTTTTCTTT
ATTTGTTATAAATTTATTTCTTAGTTACTTGTAAAACGCGAATTTGATATAATTGTCAAAAGATAGTAATATCAAGAAGTGATATGACAAGAAAAAAAGG
ATGAAGATTTAGGGTGTGTTTCATATTTTTTAATCTTTTCATAATTTATTGGTCAATTTTTATTTAGAAAATAATTCTTGAAATAAGAGAACTCATTAAA
AGCACCTGACACTCTACACGGCGGAGTTAGGATTTTAATTAAAAATATCTATATATAAAAAAAAAGTAAAATTAATTGAAGTTAAAGAGCGTCAACATGT
GATAAAAAGAATATCAATCGATATATAATTCTGCCACTGCACATCCCATAATATTTATCTAATTTATATATAAATATTTTCGAAACGATAACATTTTGCA
AAATGGATCATTCAAGATGAAGTAAATGTAAAGAGGGGACCAAATGGTACAAACCCATCAAGCATCTAGTACACCTACAGCCTACAACTATTCAATTCTA
GTTAATGTACATTAAGAACATCCTAAAATATTTCTATACAGATCAACCACCTCTCTGTTTTTCAACATACCCTTCATTAATATATATATATATACATATA
TATATATCCGAATCATCTATATATCGCAGCGGATTCAAAATTTTTATCATAAATTTTAAAATTAAAAATATATTTTTTGAAATTCAAACCCCCTCAACCA
CTATGCGGTTATATTCAAGAGGTTTAATATCTTTCTAATAATTTTATCGTTGCTATTGTCTAAATCCGACTCGTATAAAGTGTACCTTCGATATATACAC
CAAATAATTAAAGGCGTCTCAAAAATCTTGGCTGTTCCCATCTTCCTTTACACCTACCTACGCTAAAGTCAATAAATTGACATAAACGGTGCAAGTCCGT
TTCCGTTGTTAGGCGAATTCAGGATCGGGTCAAATATATTAATGACCTAAAACTAAATTGTATAGAGGCATTATTGTTATATTTAAGGGCAACTTTCACA
TATAGCAAACAAAAAATTTATATTTGTATGCTATAGCAAACTTTGCATAATTGCGTTCCATAACAAACATAAAACTATATAATTTGCTCTACATATACAA
TTGTATAATTCGCTGGCCTAAATTGTATAATTCGCTGGCCTATTTCACTGCAATTGTATAAGTTGTTTTGCATACAATTGAATCGAATTAAAATGTATGT
ATATTGCATAATTATAAGTGTATTGCAAGAAGATATATGTTTTTCTTGTTTTATACAAAAACAGAAACACAATATATACACTTCTGTTGTATAAAGCTAG
AGAAAATTGTATTTCACTGCAATTGTATAATTCGCAATTGTATAATTCGTTGGCCTTTTTCTCTGCAATATTTGAAGTAAAATGTTTGTAAATTGTATAA
TTAAGTGTATAACACGAAGATATACATTTTTGCATGTTTATATACAATTTTCTCTCGCTTTATACAAAACAGAAACAGAATTATACACTTCTGTGTATGA
AGCGAGAGAGGCGAGCGAGAATGGAGAGTGGCGAGCGAGATTTTTGGGAGAGAGACGCTGGCAAATTTTAGCTAATGTTTTATATGGAGCACAATTAAAT
CAAACCCTAACTATTCCATTTAATTTAGGTTATTAGTTTGCTATTATATATAATTTTCCCTTTATTTAATGCTAATTACCATTAATAGTTTATCCAAAGG
ATGTAGATATGACAATTTTGCTACAAGTTCAATATTTTTATATACAAGAGTATATATTGTTACATAAAAAGAAATTACTAAAATTTCAACAAATAATAAT
ATTTTAAATATGATATTCAATCATATATAAATATAAAATTTTAAATTCGACTCTGTTCGGATTCGTTGATCTTTCTATTGTTCAAACACAAGCTTAGACT
AGGGAAAATAAAAAGAGAGTTGCAACCTTTTTGGTGCGTTTATTATGACTCTGTTGTTATTCATGTGATCTTTAAATTCTCATTTTCACATCCTTCTTTT
AATTAGCTGCCTCCCCTGCACCCAAACAACCTACAACCCCACAGATTTTTAATTTTTTTCACTTCTCGTTCGATATACTTCTTAATAAAGACGACTCTAT
ATTTTAAATTTGAAAAAAATACCATTATCTTACGTTCATCTAGTATGATTTTTTTTGGCTCCTATAACATAATATTCTCTCTGTCTCAATTTAGATCGAT
CTAAAAAAAAAATTAAGTTGAGATGGAATTAGAATTCAACTTCACTTTTTATCCTCCTGTTTAACTAAACCATGTAGCTTAGCTTGTGGTTTAGGTCATG
TTTGGATTGATTTTTGGTTTATGACTTATAAGCCAATAGCCACAAGTTAGGATTTTTAACTTATAACTTTTGATTTGTTTTTGTTATTTTGACTTTAAAA
TAAGTGATTATAAGTACTTTTTACTTTATCCAAACACTTCAAAACTGTTTAAAAAATTATTTTGGCTCCAAAACACTTAAAATAAGCCAATTTAGATACT
GTTTGGATGGGCTTAAAAGCTGGTTAATCTGACTTAAAAGTCAATTTTTGACTTATTAGAATATTTGACAATTATCAAAGTGACTTATTTTAAGCTAAAA
GCTAAGTGATTGGTGTGTTTTTTTCAACTTAAAAGTCATTTTATGTTGACCAAGTATATTACCTTTTTGCCCTTAATTCTTTTATTATTGTTATTGTTAT
TGTTGTTATTATTATTATTATATTTATATTATTAAATAATAATAATTTGAGATGATAAATAAATATGTGAATGATAGGAAATATAATTACTTATGAATGT
AAAATATACATTAATTTTGTTTTAATTTTTTAAAATATAAAAACCTCAAAATTAATCAACTTTTTGTCATGTTAACAATTTTAAGGATATTTCAGACAGT
TTGATTTAAAAAAAATGTTTATTAGCACTTATTTGTCAAACACATCGATAACTTTTTTTTTTCCTATTGCAGCACTTTTATCCAAATACTAACTACTTTT
TAAAATACATTTCAACACTGTCAAAAATATATATTTTTTTAAGTCAATCCAAATGGGCTCGGGTAGTCATTGAGTTTTAATATTGATGTGACTAATTACT
CTGTTTCTTGTACCAAACTTGGTAGTTGAAACATTAACTAGATTCGTTACTTCTCTCTCTCATGCAAGGTCTATTTTGTGCCATTTCTTCATCGCTGGAA
GTGAAAGTGGCTACACTATAAGCCCTGTTTGGACCATCTCAGGTGCTGTTTGCTATAAAATTTTGAGTTTTGAGTAAGAGAAAGAATTGTTGAAAATGAG
CATGAACAAATTTGGTTTGAAGGTTGAGGAAGGAAAAGAAGGAAAAAATGGAGAGCCATCTATTGGTCCTGTTTATAGAAATCCAATAGCTAAAAATGGT
TTTCCATCAGCTGATCCTGATTTGTCTACAGCTTGGCAACTCTTTAGGTAACTTTTCTTCAACCTTCACTAACAAACTGTTGAATTGTCTCAAACATTTC
GTCTAATTGAGCCAAGGACGTGAAAATTCTTTTTTTTTTGCCGAGTTAATGGTAAAAAAAACACATGATTCATCATTTTTTCGCGAGTTTTTACTTTTTA
ACTATCAGTTGTTTCCTTTTTCTTACTTGAACTATCATCGATTGCATTTTAACTAAGAATTGTTCCTTCTTACTGCTTTATCTACGGAGATAGGAAGAAG
GAACAGTTCATGGTTTGAGTGTTTTAGATATATAAACGGTAATAGTTCAGGTAGGAAAAGAGAATAATTGATAGTTTGAATGTGATATTCACGAAAAATG
TGATAAGCTAACAATTATTTTCTTCTTTTTTTCCATTTCATAATGAATGGTGGTGAAACTTAAATTCAAACACCTCTAAAGATTAAGCCATTAGTCGAGT
TAGTCATGGCTTTTATTTACTTAATTATGTCTTCGATTAACGAAAACAAAAGAAATGGACAAAAAACAAGTCCATTAAGATTCTCTTGTTTGCTTTCTTC
ATTTTTTCTGTATCAAATGTCAGTAAAGCATAGATCTTTATTCTTTTACTTTTAGATTAGTTACATGAATCAGCTCGCAAGGAAAATCTTGATTGAAAGT
TCATATCTTTCTAGTTTCATCTATATCCAGATAGAAAAAGAATGTATGCATCAAACTTTGATGTAATTTAATCTTTTTGATCAACAGATCAGCTGTTGAA
AAATATCCAGGAAACAGAATGCTGGGATGGCGTGATTTTAAGGATGGAAAGGTAAAGTGTGAAGTTATCTACTTATCTGGTTATCTGTCATCCTTAGTGT
TATTGGAGTAAAAAATATTTCAATGTCTTTACTCACCATTTTCCTGTTTGTTTGTTTTTAAATAGTGGGGTCCTTATAATTGGAAAACCTACAAAGAAGC
TTATGAAGAGACTTTGCAGACTGGTTCTGCATTACGGGCTCACGGAATTGAACCTGTAAGCAATAGGCTAACTTAATATTTGTATCAGTTTTAGAGTCTT
AAGAATGTCATGTATGATATTCGAATGTGCTATAGGGTGCTCGAATTGGAATTTATGGAGCCAATTGTCCTCAGTGGATAGTAGCAATGGAGGTTAGTCT
ATGGTTTTGACCGCGTGTGATCATAATGTGTTTACTTTTATCTACAATGAGTTATACATTCGTATCATTTGATAGACGGTTTAATTTTTTTTTAGGCTTG
CAGTGCTCACAGTTTGATATGTGTTCCTCTCTATGATACCCTCGGTAAATAATGGTTCTGCAGTCTACCACTTATATTATGTTATTTGAATGAAAGCAGC
AATAATGCTGGTTTTGTTTTCATAATTTAAGGTTATTACAATTCACTTTATAAAGCAACTAAATTACAGTTAATGTTAAATACCTGAGATTTTTTTTGCT
TTCTGTTGATGTAGGATCCGGCGCTGTAGATTTTATTATTGAACATGCTGAGATTGATATCGTTTTTGTTCAAGATAAGAAAGTGAAAGAAGTGAGGATC
ATCTAAACTGTTTCTTGTGTTTCATTGCTATTGACCTTTACTTAATTTGGATATCTGAGTTATATGATGGTCATCTTTGGTCGATGTTCACTTTGCAGCT
TCTAAATGCAGAGTGCACACATGCTAAACGCCTGAAATGTAAGTCTGCCTCTCTATTGGTTGCAGCTACCAGATTGACAATGTTTTTTACCGAGTTTCTT
TGTGAATGCAGTGATCGTGTGTTTCACTTTGCTACAGCAGGAAGAAAAGGATAAGGCAGTTTCAATGAATATCAAGCCATACTCTTGGAATGAATTTCTC
AACATGGTATATACTCTTTGTTTGATTAGTACCATTGAAATGCTCCACTAGCACTACCGCACCGATGGCCTAAGGTGATCTTTTGCTTTTAGGGGCTGTT
TATTTTGAAGAATATTTAACAACTTTTGTCTTTCCAGGGTAAAGAGAATCCATCAGAGCCTTCACCACCACAGCCATTAGACATATGTACAATCATGTAT
ACTAGTGGAACTAGCGGCGAACCTAAAGGTGTAATATTGACTCATGAAAATATGACAGCATCTGTAACAGGAGTTGATCATTTTATGGAAGAATTCGAAG
ACAAGGTAAGTGGAAATCCTTTTCCTAGAATTTCAGGTCATCTCATCGCTAGTAATATAAATCAGTAACGAATTGAATTTCATCGCTACTTTATAGATGC
TTTGACAACCTTTTGGGCCTTATGAATCTTGTATATTTTCATTTCGCCAAATCCTCAGAAGTGCCAAATTTTAATTGTTTCGACTAATGTTTGATCTCTT
GATAGATGACAGTGGATGATGTGTACATATCTTTCCTACCACTTGCTCATATACTTGATCGGATGATTGAAGAATTCTTCTTTCATAGGGGTGCTTCTGT
TGGCTACTTCCATGGGGTAAGGTGTTGGAACTAAACGTGTCAAACTAATTTTATGCTCTTGCACTGCATTCACTTGTCACAGCAAAATTCCTGTCCAATT
TCAAGAGACTGAATGTCGGAGTGTAGCTTAGAGCTTGCAATTCTGTTTTCGGGTATAAATTTAGTTTTTTAACTTAATGAATACTAAGATTTCGATACTT
CTTGTTATTTTTGTGTTCAAGAATATTAATGAGATACAAGAAGACATGATGGAGTTGAAGCCAACCTTTTTAGCTGGAGTACCTCGAGTTTATGAAAAAG
TGCATGAAGGTATGATAATCTTAGCTTTTTCTTGCGTTATACAAATGCTACAGATAAACAATTCGAATGATTGTAATCAAGTCTTAACTTATGCTTATCA
GGTGTACTAAAAGCACTTGAAGAACTCAATCCTTTCAGGAGGCACATGTTCCATGTGCTATATAACTTGTAATATTCTATTTATTTGTTCTATTCAAATT
TTCTTATTCTATGGTTCGGAATTTTCTGATTTTATCTCGAAAATCAGCAAGCTTAAATGGATGAATCTTGGGTACAAACAGAAGTATGCTTCGCGACTGG
CTGATCTACTAGCTTTTAGAAAGGTTGTACTTTTTCCTAATTATGTTCTCGCTTTCTTGTAACTTTTCCTGAACTTGAAGAAATTTCGCTTTTATGTTGC
TGCTAGCCTTCTACCATCTTTGAGGGATTATATTCAGTTATGGACAAGGAAAAGAGAGTTTATATGTCTTCTGACTCATTTATTCGTCTCATTGTTTAGG
TTAAGAATAGGCTAGGTGGCAGGATTCGTCTCATAGTTTCCGGTGGTGCTCCTTTAAGCACTGAGGTGGAAGAGTTCTTGCGGGTTACCTCTTGTGGATT
TGTCCTACAAGGCTATGGTAAATCTATATATTTCCAGTATGACTCGTAAATATTACTTTATAGTGAATACACCTATAGTCTAGCTATGACTGACTGTCTA
GTTATAGTCGATATGAGCAATTTGATGCAGAGGAATGAGCCAGTTCTATGTGACAAAGCATCGATGCACAAATAAAACATGTCTTAGTATACTAGCAAGT
CTACTGTAATAAGTTCGATGTTATTCACTTATCGTTATATAACATATTCCTTTCTCTACCAACTGATACACTATACGTGGATTTGATTCATTAACTTATC
GGAGTTTCCATTTTCACTTTGATTTTTACACTCTGTGTATAATCCGAAGCATCTTCTGTAGGTTTGACAGAGACTTGTGGTTTGGCCACCATTGGGCATC
CAGATGAAATGTGCATGCTTGGAACTGTTGGTCCACCATTTGTCTTCACAGAAGTTCGTCTCGAGGAAGTTCCTGAAATGGGATATGATCCGCTAGCAGA
CCCTTCCCGGGGAGAGATATGCGTGAGAGGGAGGACCACTTTCACTGGATACTACAAAAATCCAGAGTTGACAAGAGAAGCTATCAAAGATGGATGGTTT
CATACAGGTTAAGTTTATACTTACTCTATGCTAAGAATGTCGTTTCACTATATATGAAATACGTCTTTTACATTATCTACCTTTGAGCATATCCAGGTGA
CATCGGAGAAATGATGCCTAATGGAGTTGTAAAAGTCATTGATAGAAAGAAAAATGTTATAAAGCTATCACAAGGAGAATATGTTGCATTGGAATATCTG
GAAAAGGTTTATGCTATTGCGCCCATCGTTGAAGATGTAAGCTGATTCATTCGAAATATTATATGTTTTCGAGTGAATTTCATGTCTATCTAATATATGT
TTACTTACAGATATGGGTATATGGGGACAGCTTCAAGTCCATGTTGATAGCAGTCGTGGCGCCACATGAAGGGAATACGAAGAAATGGGCTGATAAAAAT
GGCCACAAAGGTTCAATTACTGAACTTTGTTCCCTACAAGACCTAAACCAATATGTTCTCCTTGAGCTGAAATCTGCTGCAGAAAGGAACAAGGTCAGCA
AAATACAAAATTTTCTCTGTTTTTAGGTACTTGTATGGAATATTATTGGAATAATATTGTGATTTATTCTACGTAAACACAGCTAAGAGGTTTCGAGAAC
ATCAAAGGAGTGATTCTGGAACCTCAACCTTTTGAGTTTGACAAGGAGTTGGTAACTGCAACAATGAAAAAGAGAAGGGAGAGACTGCTTAAGCGTTACA
AGGTAATCGATGAGTTCCTAGCTCACTCTTTTTGATGAGTTGGACCATAACCAAATTTGATACTCATTGTTGTTTTTTGCAGTTGGAGATTGATGACCTT
TACAAAAGGCTTAATGCAGCAGCTAAACGCTGATAAGTTTTTGAATACTGCGCAATGCATCTCTTCATCAATCCACTGCATGATCGTCTGGCGTTGTAAC
GTTTGAACTATACAAATTATATTGTTTTAATGTCTGATATGGTAGTGATTTGTACGAATAATCATCAGTATTATTGTCTTACATTTCTAATTTAAGCACC
CTTCTAGAGAGATTAGTAGTATTGGTTTTATGAATGGGCTAATAATTCTAAGCACTCAATATTATGTAGACTTAAATGGTAATATTATACTATTAAGTAT
TGTTCACAATGAGATCCACAACTACTAATAGGACCAACACTCTATAACTAATGCAGTTTTGATTTTTATTAAAAATAGTTTTTCTACTTTGCTAAATCAA
GAAAATATATATTAAACGTTTTTATATTATCCTTTTAATTAATTCTTTTCGAAAGTGTTTATATTTGATTGTAAAATTTTGATAAAACAATTAATAGGTG
AATTAGTAAATTATCTTCTTATTTAACTAAATCACCAACTTAGGAATGATGAAATTGATTCAAACTTGATGTTGATAAGGTGTTTTAAAATAAAACTCAA
TATAGAAGACGAAAATAACAGACTATAGTAGATCTTTCTTCTTTCCCTTCTTTCAAAGTGCACAATATCCCTCTATTCAAAGTGTTGCATAGCATTTAGC
CAAGAAGGTTAGAGGAGTAAATGCTAATCAACAAAACAATTGTGGAAATATCTAGGGATGGACGTTCTGTTTCTCGATTCGACTTTATCAAACTTCGATT
CGATTGATCGATTTTTGGTTTTAGAAAAGTATGCATCGTATTTCAAATCAAACTAATTCAGTTCGGTTCCATTTTTTTACTTCAGTTCAATATTTTAATG
TTTTTAAATTAATTTTTCGGTGCGAATGAAAAATAAAATGAGGACAAAATCAAAAGTATAAGATACTTAAAAATTTTGTTAAAGATTGATGTGTCTCTCC
ACTGAACACTTATTGTACCAATTAAAAGACTATATTTGTCTTTGTCAAGAACATTGCGCTTTCAACTACTTTTCGAGAAAAACAAGGATGAAGGCAGACT
CCTTTACATAATGTACATTGATAAAAATATGTTTAGGTTCCTCTTAGCGATTAATATTTGAAGTTAACGATTGAATTGTAAATTTGTTGCTACTTAGATT
TGTTCATGAATGATTTAATTGTTAGTTGAGTTTTTATTTTGATAAAAATGACAAATATCCACAAATTATCATAAATGGTATGCAGATAGCCTCTGTCATA
CTTTTGAGACATTAGTGCCCTTACTGTCCAAAAACTAAAGCATATATGTCCTTTACACTAAGAAACATATGTCATAATTTTATCCACCAACGCGACATTT
ATTAAATATTGAATTGAACCAAATAATATTGTGTCATTTGTCTTGTTTAGTCCTCCGTTAGAGTGAATGACATATATACTCTAATTTTTAGACGGCATAG
GCACCAATGTTTCAAAAGTATGACGGAAAATATCTGCATACCATTTGCGATATTTATCCATTTTACCTTTTATTTTTAGTTGAGAGAATATGCCCATATA
TGAATAATTTTTAATTTTTTTAATAAAAATTCGATTTTTCAGTGCACCAAAGTTCTGAGACAATTACACAAAATACCAAACGAAAGAACCAAACTTTTGA
AATATAACACCAAATCACAAAATCGAAGAAACGATTAGCTCGGTATGAAATTTTTTTGATTTTCTGATATTTATGAGTCACTTGTATGGTTCTAAATTAT
GAGAACTCCACAATAGTAACCTAATTTACAACAGCATCCAGTTTTACTTCCATGAGAACAAAATTACATATCTTTTCAGACTACCCCCTGAACAGATGTA
TCCAGAATCTGTTCTTAAAATACAGGACCACTCTAGAATTTTGCTTTCTACCCACAATGTGTTTCCTTCCCTAATGATTAGCCTATCAAATATGTAATAC
TCAGTGAACAAGTAACATGTAAATAACAAAGCAGAAAAAAGAAAACAGATACTCATGCAAGCTAGGGCTGAAAATTAAAAAAATTATTTTAAAGTAGAAC
AAACTGTACAAGAAGATGTTGTGCAGCTGCATCCCATATTGCTCATTAATCTAAATCAAGTTTCTATATAGCAGAAAGGCTGCATATATTTTCTTCAGCA
CATGAAAAAACTTACAATGATGGTTCGATAATTCACAACATTGAACGCGAGGAACAGATAAAAAATAGATCACTCCAGCAACAAGAAACAGGGTATTAAA
TAGTTCAGATGGGATTCATAGAAACTATTACAGTACATAATAGATGGTACATCAATCTTTAACCTATCGGCCAAATTCTGACCCCAGAGTTCCCATGGAG
TGTTCGTGCTTGGAGGAACTAAAAGTATGACGAATGGATTCATTTTTTGCTCTTGCTTTCATCTTTTTCTCGCTCCCGCTTCTTGTATAACCGCTCAAGC
ACTCGTTTCGCCTCGCATTGTGGAAAGTTTGCAAGGTCATAGTAGTGTGGTGCAATATCAACCAACCTGAGAAAAATTACAAAAAAGAAGAAAGAAGATA
ATAGCAAGGAAACATTAGCCATTTGTACGCACGCTATTATCGAATTTAGTTTTTAGAAAGATACATTTGTCCCCTTGAACAGGAGGTCTATTTGAAAGAA
GTTCAAGATAAAGAGTCCTGGTTTCAGCCAATTAACATTACTCCTTACTGATTATACCAGGACTACTTAGAGAACAGATCCGATGAATGAACCTCTGCAG
GAATCTTGAAAATTGGGACTCAATAAAGGGTTAAGGGTATAAATGCTGATTTTGCTTAGGTAGTAAGTAGCAGCACAATTTGGAACAGGAAAAAGTGCCC
TTTTCCTTTACAGGTGAGAAGATAGATCCTCTCAGTCGTACTAAAGAAAAAAGAGTAATAATTAACAAGGCATATAGAAAGGTAAAAATAACGAAATTTA
CCATTCACCACGGATATCAGTCACAGTGCGGATGAAATTCCTGCTTGTTAAGACATATTCATTATATATAACCCATTCTGGCTTGTGATCCAGGCAATTT
GAAGGATGCAAGTGTACCACCTAAAACAACAAAAAGATGGAAAAAAACATAATAGTGAGAAATAAACGGCATTGCTGGACCCACAAAGGCTCTTAGTATG
AGTTTATTTCCCTAATTAGTAGGGATGCTTACTTGATTGTCTTTAACGGTTAGATAATGCCCAGTACGCTCTAGGTGTGCAACCTGCATGAAATATCCGG
CTAACATAGCCTTCCTTATGTTCACATAGTACTCGCGACTGTTGAAGTCTGTGCTGCATAACTTGAGGTTGAACCTGGCCATTATGCGAGAAAGCTGTTG
CCTCACATTGTCAGCTGATTTGAGAGCCCTCTGATTGATGAAATTCTCATAACACCATTGAGGATCCTCCTCTGAGATAATATTACCATAAAAAGACATT
ATCAGGGTTAGAAGGGTATATGAAATCTGAACTTGATTGTTAAGGAGGGACTGAAGACAGATACTTACGGTTTTGCTTGTAGGCATGATACACATTCAGC
AACGTCAAATGATCCCCATCTATGTGACCGAACCGATTCTTTGCTTCATCCGCAGCTTTTTGAGCCTCCCTAGGCCGGACAAAGCAATTGGGTACTAGAG
AAAAAATTGGTTATCACAGCGGAGGCCCACTGTAGGTCAGCAGATGCATACAGGCGAGACGACACCATTTGCTTCATGAGAGAATACTGAGAAACTGCAA
CTATCTCCATCAGCACTTACTTAGAAATCTACGGCACATGCCAACCGGGGGCATAGAACCCAGACAAGACAGTTGCTGATGACATCCTAAGAAGACACGT
GCAACTAACCCCACACATATGCACATGTTGTGCAGCTTAGCACGTGATATCATATGCATAGACAAATGTCTATGCACGTGAACAAGAAGGCATGGTGAAG
CGGACTAGCATTCCCAAGCCTGACAAACTCTCGACATAGAACAAAGACAAGACAAGACACGACAACCAACAAAATGGAAGTAAATTGGCAGGAAATCGTA
CCTGATAACATGGCAGATATTGAGAGGATTTCGTTGGAGCAGTTGAATTCGGGGCTGACAACAAGCATTTTCCCCATCTGAGGGTCGAGAGGAAATTCAC
TCATTATCTCACCCAGCCGGGTCATGTTTCCATCATCATCCAATGCTCCCAAGTAATTTAAAACCTCTAGTGCTCTCATCAACGTCTCGGGGGCAGGAGG
ATCCATAAAATCAAAATGAACTAGGTCATCAATACCTAGCTTCTTCAAAGTTAGAACTGTATTAGCCAAATTTGACCGAAGTATTTCTGGATACGTCTGA
GGTTGAAGGTCATTATGGAAACTTTTCTCCGTGTAAAGTCTAAAGCATTTTCCTGGCTGAGTTCTTCCAGCACGTCCTGATCTCTGGTGTGCACTGGCCT
TTGAAATAGGAGACACCAACAAAGATTCCACACGCACCCTTGGATTATAAACCTTTTGCTTAGCAAATCCTGGATCTATGACATAAACAATGCCATCTAT
TGTCAAAGATGTTTCTGCAATGTTGGTTGACACAACAATCTTCCTGCCAGGAGGACCACCCTCCACAACTGGTGGTGGGGCCGGTTCAAAAATCTTTTGC
TGCATAGCGGGGGGAAGTGTAGAATAAAGAGGCACCGCTTTAACAGGGCCTACTTGATCACCCATATTACCAATTTCCTTTGTGATTTTGCGACATGCAT
CTTCAATCTCCTCTTCTCCGGTGAGGAAAACAAGGATGTCACCAGGAGGTTCACATGTGTGAATCTGCACCACAGTCCGAATGGCAGCCTCAAGATAGTC
TCTCTCAGGATCCTGCGTGTAGAAAATTTCCACTGGATGGAGCCTTCCAGGAACTTTCATGAGAGGTGCACCAAAGAAGTAACCCTGAAACTTCTCTGCT
TCAAGTGTGGCACTCATAACAACTAGCTTTAGGTCTGGTCTATTTTTCAACACCTCTTTCAAAAGCCCAAACAGGACATCTGTTGCCAAAGTTCTTTCAT
GAGCTTCATCAAGAATAATTACTTTGTAGCGTTCCAATAGAGGATCCGCCATTGCTTCTCTTAAAAGCATACCATCTGTTAAGTATCTGTCATGCACAGA
GACAGACCAAATACTAATCCATCAGCAACTAGAGCAGTAGAGAATTTTTCTAATAATGTAAGCAAAATATGCAAAGGAAGAAACATTTCCAAGCTACGTT
GTAAGAGAATATAAGTGGGAGTTAGGACAAAAATGTAAAAATTGGAGAGAGAAAAGTAGCGTCATGAAAAAAGTAGGAAAAAGGTACTCCCTCCATTTGT
CATGGGAGTTCAAGAAAGTAAAGATTTTTGCATCCTGTGGTCTTCAATTAAAGATATGTAGAATGTACCATACTAACCCTTTCATTGTGGTCTTCAACAT
GCCACGTGGAAAGTTAGAATCGAGTTGCAAAAATAAAAAGAAGCATTCATTTTTAAATGGACCAAAAAGGAAAGAAAGACAAACAAAATGAAACAAAGGA
AGTATTTAGAAATTGGGGTTGTGCTTGAAAATGAATACAACTTTGAAAAATGTAGGATCTTTGTGAACGATTGGAGTCTTCCGTATTTGGGAGGGAATTC
AACTTCTGGGAAATTGTAACAATTATATGTCCAAACATGATGATTCCGGAATATAATACCGGAAAAATGTGAAAATTATCCATGGCAAACCAGCCCTAAA
ATATTTTATCATGTAAGAATCTACTTACTTTAAAACAGTTCTAGCACTAGTGCAGTCCTCAAAACGAATGCTATATCCAACTTCTTCCCCAATTACAACA
TCCATCTCTTCAGCAACACGACGAGAGACAGACATTGCAGCCACCCTCCGAGGTTGAGTGCAACCAATCATATATTTCCTGCGCTTATCAGCTGTCTCTA
CTTCAACAGCATCCAAAACAAACTGTGGAATCTGTATAACACGAACATATCCCTTTAAGCAGTAGCTCAATAAAAACCTCCACTCCAGTCGGAGAGAGTG
TGTATCATCATGAGTGATAAAGTATCAGGCAGCATACACATGAACAAGTAATTGACGCAGCGGAGAAGAATATAGACGCATCTTGCTTCAATTGATGAAA
CCAAGGGACAAATTTTTAACAAACACACAGTATAATGAGCATCTTGCTTCAAGGAGAAAAAAAGTAAAAAGAAAAGAACTTCAAAACAGATCAATTTAAA
TTCCCAGTAATCATTAATTTAAAGAATTATCAAAAAGATGATTTTTGTATTTTAACAGTTAGGGAATAAAATCTTCAGTTTTGAAGTTTGAAGATAATGG
ATTTCTCATTATATAAGAAAACCCTACTAATACTCATAGAAAATATTATTCTACATCTCTAACAAAAGAACCTCAAATGGTATCCACCTTCTTTTCTTCT
TTTATGTCAAAGTGAACCTTGTTATTTGAGGAACTGGGGATGGAAAGGAATAGCCAGGTTTATGTCTGGGTAAAAGAAGTTTCAAGCATCATAAATCCTA
TAAAGGTTCAATTCACTATACAAATAGATAATGGCAGAACCAACAATATAACATTACATCTGTTAGCAGATCCAACCATCTTAGGGATGTAGAATCATAA
ATTCTTTTCATATCACATAGTTAGATCAACTCCTGTTTCCACTCTATTTTAATTAAGAGGATGTATCAATCCGTTACTCAAACAATATCACTCCAAAAGT
TATGGAAATTCTCAAAAAGCGCTAGTAACTAATTTTGAAGGGGATTCGGTTTATTAATAGGAATTATAGATTTTTTACTGGATAAGGGGAGTTGCGAATT
TAGGGATTTATTTGAATATTCAATATCTTGGTTTACAATAATAAGATCATCTTTTTGTTACTTTATTTGGAAGTTCGTTATTAGTGGTAGTTCTTACAAA
GGATTGGACTGATGACATATATTGACTTGAGTTCTCAATGTAGATGCTACATAGTTGGTTCTCATCGAGACCTAATACCACCTTTTGCCCAAACCTACAG
CATAGTAAGCTTCTTCTTGCATCAGGAATGTCCAGCAATCACTCAATAGATCAATCCACCACACAACCCTGAGCTAGTTCAGGGTTAGCTATGTAAATGT
TCTATACATAATACTAGAACTAATCTCAATCCTATAAAAAACTTATGAGGAGCCAGCCAGCCAGGGAAGAAAATACTCATTAATATCCCTATAATATATT
ATACAAATAGTATCAAACTACCAGTAACATAGTACTAGAAAATGAATTGTCACATCTAATTTTAGTTGACGCAGCCAAACTCTCGTTTCTTGTCAAAAGT
TTGTGTTTTAAATCAAATTAATTGTTCTAAGAAACTGTAGACATCTGAAACACCCAACCATAACAA