Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

BAC Sequence – LE_HBa0131O24

>C01HBa0131O24.1
TTCTAAATGTCTTTTTGTTTTTAAAATATGTCACTTTGGTATGGATGGATAGAACCAACAACCTTTCTAAATGTCTTTTTTAAGGTAGAGATAAAAAGAA
ACTCGTCTTTTAATGATATTATTGTTGTTTTTTGTTAAAGAATGACAAAAGTCTCAGGTTAATGAGATGGCTGGACTCGTTATAAGGCTTGGACAATCCT
CCTCCATTTGAGCTAGCTTTTGGGGTTTCAATTAGGCTTAAAATCAAATTGCACATGGTATCAGAGTAGGGTCCGTCTCACTCAATATTGGACCCCCAAA
ATTAAAATTGCTTACGCTCCAGATGCTAAACACTGGTGTGAGGTGGGATGTTAAAGAATGATTAAAATCTCACATTGGTGATTAATTGACTCCTTATAAG
ACTTGGACAACCCTCCTTCTTTTGAGTTAACTTTTAAGATATAAGTTAAGCGTAAGACCTAAATTTCACATTGCTATAGATTTGACATTGACAATGATAA
AAGGTGGTTAGTTGTCCTATTGATTAAAAAGAAAATATCTATGCACCGCACTTTCATTGGTGGAAGAATTGCCCAAGAAATGTGAAATTTAATTGGAAAT
CCTATTGGAATCTTTTGAGGATTTACCTGATACGTGTATGCTTTTAAAATGATGAAATATCAATTCAAAAAATTCATTTTATTGGACAAATTTATAATTT
ACTTCTGTATTAATTTGTTGTGAGAGGTGAAAAATATGATATTTAATGAGAAATTTTGTTAAGGACGTGTAAAAATAGTGATATGTGATTATCAAAATAA
AATAAAAGAATATTATATTATTTAACTCAAAACTTGTTTACTTAAATAGATATTTTTTATCGATCATATGCTAAAGACATAATTTAATTTGTAAAATATG
TCCAATTTTAAATATGTAAATGAAATTAAATATATATATATATTTATATAATTTTTTAACGAAACGTGTATGACACCTTAGGTAACCCCTTGCACATGCT
TATCTTTCATTGATAGCCTTTGAACCTCACACACTAGATTCCATACGAATAGAATTCCTTCCTTATAAACAAATGAAGAAATATTTTGTATGTAAATGAT
CCTGTTGAGATGCTAAGCTATATTTTTCTCTATCGTGATCACGTTAAACTTAATTTTTAATTTGTTTATCTATGCTCTCCTAGCTTTGTAATTTTCAATT
AATTTTTTTGTTAATATAAAAATCATGCCATTATCAGCGGCAGACTCAATATTTTCTTTTAGGAGGTTCGAAAAATAAAAATATAAACGTATAAATAAGT
CTTTCGAAATGGACACTTTGAATTTTTGGGGTTTAAAAGCACAGTTTTGGCACATTTTTAAAACAAAAATAAACTGATACTATAAAGGAAAATAAATAAA
TATTATTATAGGAATTTGAACCTAGGGCATGCAACATAATATTCAAGAGTATTATCATTGAGTCATTTGTTTTTATTTGTTATTGAGAGGTTCAAAATAT
ATGTATCTACCGCAATAAAATTTACCTTATATATATTGTATATTTTTTTTTACTGAAAATGTTCGAGTGAACATCCTGAATCCAACGTGGATCCGGCCCT
GGCCACCATACGACAATAATTTCTGTTCTTAAAAAAATAAGTTTATCAACTTGACACTAAATTTTAATAGTTAACACACTTTACTTAAATTGCCATGTCA
ATATGTTTGTGGTGTATATTAATTGCTTCACTCGTGTTCTTATCTTTATATAAGTAATTACCTTTTTATAACTTTCGTCCTTTAATTAGCTCTGTCCCCT
AATTATAGTAGGGAAATCCTTTTGAAAAAGTCATATTTCTAAACAAAAATTTAATTTTTAATTAAAGGAAAAAATGGACGTGAGTGATTTGAAATGAGTA
CATATATAGCTAGGTCCATCAGGAGGAGTTTAATTTTCATAATTTTATGCTTTTTTCCATCAAGCAAACATAAGTTGTATGAAATTACTTTATGATATAT
GGTCTACTATTAAAGACAGGTCAAATTCTCCTTTTTGAGTTTTTTTTATTAAAGTTGTTTATCATCGAGCATTATCTTGTGTCTTCCTCCCCCTATTATT
ATATTATATTTTTCAATTTTATTACCTGTTATTTTTTCCTTCTTGTTTATTATTGCTACTCATAGATTTATTTAGTGTCAACAATAACGTAACGTACTCG
TGGATGCATGATTTTTCTATCAAATTAGGTATTTATTATATATATTTGATCGAATCGATTTAATATAAATCTATTTTTTTAAAAAAAAGTATAATAATAG
TGAAATTGGTTGTCCACTCATTAAATCCTAAATATGTATTGCTGCATTTGTTTTCTTCTCTATTTTTAGGATGATTTCTTTACTTTCATATTTTATTTTC
ATATTTGAATTTGATCTATTTTGCTTAAGCCTTTGACATATATAAAACATTAATTCTACCTTCAAGGCAAAAAATATAATAACTTTGCATACGCACCACG
CTTCCAAAACTCCATCAATAAAATCACACTTGAATTTTTTATTGTTGTTGTGTACGTACGTTATCTTGTCACTTCCATGTGAAGTGGAGTATTATGTTCC
TGCTCTCTTAGCCAAAGTATCAATATGACATTACATACGAGGAGGAAAAACTGAAAAACATACTTATTAATTTTTGGAAAAATTACATATTCAGAGACAT
ACTTCACTATCATATATCGTTATAAAAATATTATTATCTGAACATATATGAACGACCAAAAATCTTGTAAAATACTATTGTAAACTAGAATGTATATAAG
TAATTAGCTCCTGAAATAATAAGATTTATATAAATTCCTGTTATTTTTAAATAATAAGAGCTGAATGGTGCCTTTGAATTATAGGTTCAATTAAGCCTAA
GATTTTTATAATGATAAATATTTATTTGTATATAGACATATCATCAAATATTAAATTTTGTATTCGTAATATTTTAAAAGTAAATGAAGTTCGTTCAAGT
AAATCTATGAAGTTTAAGTTAAATGAAATATTGAATTCATTTTATAAGTGATGAAAGGAACATAAATTATATATTCATTTTAAAACCTTTGGCCCCTCGA
CCAAAATAACCACAACTACTTGACAAATATACAAAATATATATTACTTATGTGTATAATATGTATATTATATATCATATTTAAAATACTATTTTATTTTA
GTATAAATTATAGGAGCCATATATTATAAATACTAAATGATATCTTCTCCATTCTAGTTTCGTATTTATCAAAAATTCTTTAAAATTTTGTTTGCGAGAT
ATATGTTGAGAAGTACGAGATATTTAAGTGTTAATAAATTTCAATTGATAACTGTTGCGTTTAATAAGAACATAATAACGTAAATTTATTTTTGATAACT
ATAAATCACATAATTTACGCTCGACAACTTGAGTAATTGATTGACAATTTCAAATTTCAAATTTAGAGTACCTTCATCAAACAAAATTAGTCCTGATAAA
GTTGATCTGTAGTCTAAGAAGTTGAAAAAGATAGCTTAAAAGATGAATATCTCAATTTTATCACGGCATTCTGATATTTGGTTAAACGATGTTAATTACG
AAGGTTACAAGGTTGATGGAATTGTCGTTGGATAATCCATTTCATTTGTAAATCTGAAATCATTTTTGTAACAGAGCTGGAGATCGACAGTGTTACAAAA
AATATTGAAATCCGATACATTATAGAGGGAACTCATGTCCATTGAAAATCAAGAATGACATGGGTGTGAAACTTTATTTGGAAGTAAAAAGAAATTCGTC
TGGAATTGGTATGTATCCGCTTTGTATTGATAAAACTGATAAAAATTGTTGGGGAGATAAATAATTTTTATTGTTCATTTGTGGAAATCGTATGCGTGGA
AGGTACCGAAAGAGATACTGAAACTATTGGTTTGGTCGGATCGAGAATATGTGACTTTGATTATATGCCAGAATTAAATGCTAGAAATTAAATAACTGAT
TCCAATAGTGATGTGAAGACGGAGCAGTTGTATAAAGATAAAGAAACACTCATTGCTGTAATGACTAAATATAAAATAAAGAACAACTTCAATATTTGAG
TGAGAAGATCCGATAAAAAAGGTATTGAAATGTTTTCTCTCTAATTTGATTGTTTTTCTTTAGATTTTGCATATATTTAGTACAATTCTTGTTGCTATTG
TGTTTAATACATAAGTCTAATTAGTATATGTTTCGTTGTGATAAGTTTGTCAGTGTTTGATGAAATTATTATGATCAATAATATTGACAACTGATTTACA
TGTGTATTGATAAATCTTATTATGTGATACATAAAACATTTGTAAAAAAATGGTTATATTCTTTATTATGGCGGACACATTAGTTATGAACAACTTTAAC
ATTCAACGTATCATTCACTCTCCATTACAACAAATGTTTGAGATTAGACAATTACAATTTTATATTTTATTTTTTCTATAAACAGGGCATGAATTATGTC
ATAAAAAAATACCAGCACATCCATTGAGGTTTGGAGTAACGTTCAATTTTGATTTTGGGAGTGAAATTAAAAAGTCCATAAAGGATGAAGACGTGGAAAT
GTTCAAGAATACAATTTTTGAATCATATCTGAACATTCCAAAATGTAATTTTCAGAGTCAGATTACTAAGTGTTTGTTGTTGTTGGAGGTGCAACAGGAA
AACAAAGATGTATTGCATGTTCGTCATGCTAATGGAAATGTAATGCAATTTAGTAGGAATTCGTCATTATAAATGGCCATAAATGCAAAGGAAATGTTAA
GGATTTTTCATTTGAATTCCACTCCAAGCCGGTTATTACAAAAATATTTCCCTGATTGTCCTGCAGGTATAACCAATAGTCGCTTGATTATCGGAGTGAA
AGAATATGAAAAATCCTTAACATTTCCTTTGCATTTAAGGCAAGTTACAATAGTGAATTCCTTTATACTAAACTGCAATATATTTTCATTAGCATGACAA
ACATGCAATACATCTTTGTTTTCCTGTTGTACCTTCAACAACAAATACTTAGTAATCTGACCCTGGAAATTACATTTTGGAATGTTCAAATATGGTCCAA
AAATTATATTCTTGAAAATCTCAACGCCTTCATCCTTTATGAACTTTTTGATTTCATTCACAAATCATAATTGAACGTTGCTCCAAGCCTTAATGGATAT
GCTGATATTTTTTTGATAACATAATTCATGCCCTGTTTATACAAAAAAAAATTGTACTTGTATAATCTCAAACATATGTTGTAATGAAGAGTGAATGAAA
CATTGAATATAATTTGTAAATTCAGCAAATACATCATGATTTTATAATGATATCATATCAAACACGTTGTGAAATGCATAAGATACATGAATAACTAATA
AATATATTGTACATGAATTTCATTCACATATACCAATTACATATATGTATAAGACACTTGAATTATAATGTATATGATACATCGTATACATTCATTCACA
AATACTAATTACTATATGTATAAGACACTTGAGTTATATGATGTATATGATACATCATATGCACTGACAAACAAAAACTGTAAAAAAAAACACGTAACAT
CAACAAATGATACATTAATTGAGCAATTTATGCATATGATGCACCTTAAAAACTGTACATACATGATGCTTTTATTGAATTTGAAATTAGTGAATTTGTC
TTCATTGTTAAATGACTTTTAATTCGATTTCACAAACACATGCAACAATGTAAAATGAGGGGTTTAATATATCAAGAAAACACAAAATCAACCATTTTAA
ATCGATATTGTTCTAAACATACTATGAAAACATTGAATTGATAAGTAATGTATCTTCACTATTGATGTATTCAACCTTTCTGTCCAAACACAACCGACAC
CATAACAAAAACATAAAAAAAATAAAAGTTTGTTTAAATACATACCTTAGGAAGTGTGGGTTGGGAAACAATATATGTCACTTTTCTTCGCCCCTTTTTT
GGGATTTCTCCAATATTTTTCTTTGGCTTGACAACAATCTTGTTCTTCATCGTTAATGAGTCATGCAATCGCTTGGATCTGTTCTCGGCCCACATTTCAT
CATCAGAATCATATATACGATTAAAATTAGTATTAGAAAAATCAATACTATGAGATGGACCCTGTTCCATATGAATCAGTAAAAAGCACGAAGAAAACAA
CAATGGAGAATAAAATTCTTACCTATTTAAAACTTAGAAATTGAAATACTTGAGAGAGACTCCTACTGAAAATCAAATTGATTTGAAATTTGAAACTGCT
AAAGATGGGAAGAGATTTTAGGAATAAAATTAAAGAGTGTAATTGGTAATGGAAAACCTGAGTGTTGGCAGAAAAATAGGATTGGATATTGACTGTACAA
AAGGTAAAAGATATTTATGTATCTTACAGATTTTATTAATTGAGGAAAGTAAAAAAAATTAATTTTTTTATAATAAGTAGGAATAAACGAATATTAAGAT
AAATAAAGAAATTTAGTTAAGTAATTTTTCGGAACCCACCTTGTAATGTCAAACATCACGAGAAGCTTATAACAGGAAAATCTCGGGTCTGTCCAAATTA
TCCCATTTTGAAAAATTATTGGGCTCGAAGCTAACATATCCAGCTGATCGTAAGCCCAAAAACGTGTGACCTAAAGCCCAATACATCACCGAGCAAAACT
CCATTATACATATCTGTCAACTGCAGTACCTCAATGCATTTTTCGAATAACCGCTATATATATATATATATATATGAGATCGAGTGATATTTCATTCCTA
ATCATAACACATCGTCTGGTTTTTAGTGTCAAGTAAGTATTGGTACTTTTTTGAGTACTCTGAATATTACTATACCTGAATTCACGTATAAGAATGTGCA
GATAGATAATTTTTCGTGAGTTATAATATAAAGCAGAATGCTTAAAAGGCCCTTATTATTTCTCTGCTTGTTAAACCTCTTTCGCAACAAATGTTAATTA
TTTTGTCCCTTTTTGTGACGTGACGTTAGGGAGTCAAATTCCACTTAAACAATTGATCAATTATTTCATCTACTACTATCTTTCAATGGTCTTTTATTCA
ATAATTGGAAAAACTAGACATTATGATGTAGGATTTGGAAGCTTGATTTTAACTTTTTTATTCAAATAAATGGTTGCATATGGAAACTGCACATATTTTA
ATTTAACTTTAAATTATGTTCTAAAAAGTATAAATTGAAAATTCATATTGTGATTTCACTTTTCTTCACTTTATAATAATATATTTAAAAAATTCAATTT
TTTTTTATATTTTACGAAAAATCTCATGATCGACTGGAAAAGTTTGTACAAGGTCTGTACTTTATACCATGTCGGCGATTTTGTCAAAGAATTGTGAGTT
ACTACTGAAGTTGGTTTACTGAATTAGTACTGTAAAATTATGTGTATTTAAGTATTTATATGTAATAACAAGTAATCACACAAAAAAATAAAAGTATAAG
AAAAATATATAAAAATTGTTGAAGAAGAAAGAAACTAACATGGAACAGGTCCAGAGCAGTTGACTGACCTATCTTCAACATGTTTCAATCTTCAGCTTTC
TTCTTCATCAACACTTATTGCAGATAGATTAATCAAGTGCGTTGATCTGATACTTTTGACATGTTTTAATCTTCAGTTTTTTTCTTCTTCAACAAAAATA
TGTGATCCATTTATTTATTCAGCGCATTAGGATATTCTAATGTCTATGAACTGTGATTTACTCATTGGGAGTTTTAGTAATTTGCAGAAATGAAGGAGTT
TACTCTGTAAAAAACAACAGCGATTTACTCCACCGTAAAAAATAAAATCGCTGCCTACGTAGCGATTTTTATTTAAAAGAAAAAATTAAAGAAAATCATT
GCCTAGGAAGCGATTTTCAAGTTTTTTTTTAAATCGTTGCGACTTTCAATTTTTAAAAAATAAAATAAAAAACTTGAAAATTGCTGCAATTTTTTTTTTA
AAAAAATGATTTTCTAAAAAAAAATTAAAAAAATGAAAATCGCTGCTATTTGAAAATCGTTGTCAAGGTAGCGATTTGAATTTTTTTTTAGAAAAAAAAA
TCACATTTTGCAAAATCACTGCAGAGTAAATCGCTGTTGTTCTAGCGATTTTATCATTTTGATTAATATAAAATTTTATATACCATTTTAAAATTTTTGT
TAATATTTTATACCTTTAGGTTTCGAACTCTCTTAAGTAACTTAAACGGGTCATGAACTAATTTGATTTCTATGAATGCATCCATTTAACACCTCTATAT
TAACTAATATATGTTTATTTTTTATATTGTTAATAAATAAAAATTTACTGAGGGAGTAATATCATGTGGTTTAATTCCTAAAAGAGAAAATCATGAGTGA
ATAATTTCACTTGCAATCAGTTGGGGAACCCCACAAATTCTTTAGTGCGCCTACTCAACGTCCATTTGTTTCTTTGTAGGTGACCAAATTTATAAGATCT
AAAAAGCATCGGCCTAAAAGCTATGCTTTGGTAAAACAATTATTTTACCAAAAAAACATTCAACAAAAAAACAAACTTTCTTCAAGCAAATATAATTTCT
CTCTTTTTAAGAAATATAACTCTCATCAATTTCTCTTTATGCAATAGCTGTTGGAATTTAATCTAACTTAGCTCGGATAATTAACCTTTACGAGCCTAGG
TCTAAAACAGACCAAGCACTTGCACTAGGGGTGTACAAATTAAATTGAAAATCGTGTCAAATAGAAAAAAAAGTTTAATTAGTAATTTGATTTGACTTTG
TTTGATATTGAATTTTTTTTAATATATTTGAATTGGTTTGATTTCAATTCAAAAGAAACAATTTGAGATCAAACAAACTCGATATTGTATATATAATATT
ATAATTTTAAAATTTTATTTTATACGTAAAAATATTTACTTGAATATAATTTTTAAATATTTATCATACTTTTTCATAGTTTTTATCTTTTAATATATTT
CATGTTTGAAAGTTACGATTCTTAAATCTTAATGGTCCAATAAATATTATAATCCATATATAATGGTAGTTATAATAAAGCTTGAATCGAAATCCTGTTA
ATACTAATGGAAAAAGAAAAATAATAATAATAATATTAAATATTTGTTCTTAGTTTTATATAGGTTTAGACAATTAAAATATATAATTTACTTTTAATTT
CCATTAATATTTAGTCATGTAACTAACACTTATTGAACTTATTTTAGCATGATTTAGTACTCTTAAATTATGATCATTTTCACAATGACTTATTAATTTG
CAATATTTGTTTTACGAGATTTCATTATTATTTTTTTGTTTGATATTTTATTGTCATTAATCATATCATATTTTGTGTTATTTTCTTAAGATAAACCTTA
GATAGTTGTATTTTGATAAGTATATTTTTGAAAAATCCAAAAAATCCGAAATTGAAAAACTCAAATTTATTAGTTTGATTTGATTTATATAATTCAAATA
TCTGACACAAATAATTTAATTTAATATTTAAAAAATATGAGCTAACCTGATCATGTACACTCTTAATTTATACTATGTAAATTAGGAGAGCGATAATTTT
TTTATGGATGAAAATTAAATCATCATCGATCTTGCAAAGACTTTCACGCAAAATCATCAAAAGCAAACCTACCGGAGATTAAAAAAAATAATTCATCTTG
GTCTTTCTATTGGTATGAATTTCAAAGAACTTTATCTTTATCTCTCAAGAGTCACGATAAGAAATCAGACAAAAAAAAAGCATACTTATCATGATTTGGA
AACCATAACTCCACTAAAAACACATAAATTTCTCTATGTTTAGCATGGTCCACATAAATTAAAAATTAAACATTAATTTAGACATAAAAGTCCCTTTTTG
TGGGATAATTTTAAACACTTTGAAATTTTTATCAAACTTTTTATGATGGCAAATGTATATATCCAACATTTACGTCTCCTTTTATAATCCATCAAAATCC
ATCTTCCTCATGGTTGCAATATTTTTTCTACTATATATATAGCAATTGGTCACTCTATATATAGTTCCAATATGCGCTAATATTATCAAATACAAATTAC
CATTTCACTTCACCTATTTATATATCCCCATTTTAACCAATTTACGCGCGCGCTAATATAAAAAAAAAGATAATGGGGAACGAATTGATGGTTTTTATGA
TAATGGTGATTGTACAAGTTGCATATGCCGGAATGATAATAATATCGAAATTAGTGATGGATGGTGGCATGAATGCTTTCGTTCAATCAGCTTATAGGCC
TATTTTTGCCACTATCTCCATTGCTCCATTTGCTTTCTTCTTAGAGAGGTATGTATTCTTCTTCCCACTTACCAACTTCTAAAAGATAAGAGTATTCAGT
ATTATAGTATCACTAATATATGTAAGCCACAGGTCAATATGTGTGCTTTTGTGATCTAAATTTACTATTGAGGGTATTTTGGTCATTTGAAAGAGTTTAA
GCAATTCAATTGACTTGAGAAAGTAATGTACGGTAGCTACTTCATCAATGTCTATGTATGCTTTTGACAATCATACCCTTTTCAGGGGACATTTTTTCCG
CATCCAAGTTATTGCGATCGCGTGACTGTTTATTAAAAAAAAATTGTTTTAGAGCAAATAGTACTCTTTTAATTAAATCAAGATATTTTTCGAAGGATAA
TTGATTAACAAAATAATATTTTTTTCCAATACAGAGTAAGATATAAGTAGCAGTGACTCTAATTACTAGATGACCTTAGTTTATACTAATATAAGAGGGG
TTAATTACTTAATTAGAAATTTCAAGTGCGAACTTTGAAATTATAATAATTCTGGCATAAAATGTTTGTTTCAATTATCATTATCTCTCGATTCAGTTTT
TTCTTTTCTTAAATCGTTTTATTTCGTCACATTGACAGGAAAACTAGACCCAAGATGACATGTTCTGTACTTTTTCAGATATTTTTGTGTTCTATTTTCG
GGTAAGTATTTTCTTTTCCGTTCAAAAACATGTATAGTGTAACACTCTTTTTTCCCCTAGCTATTTACAATCACTGATCCAAAATAAGGACACCAATCAC
GAAATTTTGAAAAAGAAACATTAACTTTTTTTCTTCTTATTTACTATTGCTGATCATATCTAAAATCCTTAATATTAGCTTAAAAAAATAAATTTAATTT
TAATTGATGGTGTTTTTAGACCGAAATGTGGAAGGAGAAGTAGTTTGAATCAAAAGCAAAGGTGGAAGGTATTTCTAGACCAAAAGATGAATGAAAGATA
TTTTAAAACATTTTCTAATAGATTAGGGTTATTCTTGATCCTTTATTATGAACTTCAATGTCTAGAGACAAAAATGTGGGAAATAGTGACTTAAAATCAG
TTAATATTTGAGTGAGTGAGTTATAGAAATCATTGATGTAAATTTCGGGTTAAAATATAACAAGAAAAATCAGCTATAAAGAGAACTTGATTGTTATAAA
AAATGATATTCTATTACAAATAGTAATTTTTATAAATATCGAATTTATTTTAGATAGTATCACCAATTCTAACCTTTTGTTTTCTTATGGTAATATATAC
AGGATAACAGCGAACCAAAACATATATTTCATCGGGCTAAAGAATTCAACTCCAACAATTGTTTCCGCTATTGATAATCTAATCCCAGCTTTCACCTTTA
TCATAGCTGTACCCTTGGGGTAATTAATTATTTTCTCTACGAATATTCAAAAGTAAAAATATCAAATTGAAACATGATAATTAATGGCTGTAAATAATTT
TAATTTTTTGTGGGTGCAGGATTGAAAAATTGGGATTAAGAAGTATAGCAGGACAAACTAAGTTTTGGGGTACAATAATATGTGTTGGAGGTGCAATGTT
ATTGTCATTATATCATGGAAAAGTTGTTATTGGTCAATTAGGATTTCACTGGAAATATGCAGAAAATACAAGCAAAGATGTCAATTCTGCTAATTCTAAT
TTCTTTTTAGGACCTTTTCTACTTATAGTCTCCAGTCTCACTTATGCCATTTGGTTAATTATTCAGGTAATTTCGCTGTTTACTCTCTGTTACTATAATA
TCGATCTTGCATTTATTGATTTAGCGTAAATAACTCTTTACACGATTTTTTTTTTTGGGGATTAATTAGGCAAGGGTAAACGAGAAGTATGCAGCACCAT
ATACAAGCACAACGTTGATGTGCCTAATGGCAAGTGTGGAGTGTGTTATCATCGGCTTTTGTGTCGTTCCAAAACTTTCTGAATGGAAATTAAATCCTAT
TAGAGCTGTTTCAGTTGTCTATAATGTACGATTTTTTAAATGCTTTTTAAATATTTATTAAAAAGTATGTATATATATATATATATACACGATTATTAAT
TTGCTCATGATGATGTTTTATGTTGATTACAGGGAGCTATGGCTACGTCATTTACATATTTCCTGAGCTCGTGGTGTATTGAGAAAAAAGGGCCCTTATA
CGTCTCGATGTTCAATCCTTTGTTCTTAGTTATTTCTGCATTTCTTAGTTGGATTTTGCTTCGTGAGAAATTATACCTTGGCGTGTAAGTATATATATAG
CCTAACACTTTTTTTTTCCTTAATGTGAAATTAATTATAATTTCTAAGTAAAATATTAACTTTTTTCTTTTTTTCGAAAAATATCAGAGTTTTAGGGTCG
ATTATCGTCGTGGCTGGGATGTACGGCTTTTTGTGGGGCAAAAAGATGGAGACAAGTGCAGAGGATATTGATGTACTAGAATTAACAAAAGAGAAGAAGC
AATTATCCACTAAATTACAAGTTGATTTGGAATTGCAATTAACTCAGAATCCCAAGGATAATAACAATAATAATATGAAGCAGATCACAAAATCCAAAAC
TGAACTATGATTGATTGTGCAGTCAAAAAAAAATTGGGATACCACTTGGAATAAATATGAAACTAATCAATTCCTAATAAATGGATAAGGTTATTTAGTC
ATTTTTTTTCCATTGAGGCTTTTGTTTTTAATAAAATAAATTGTAGAATTAATATATGAAAGTATCTCTCTCTTCTTTATTAAATATATATATAATCGTA
TATTTGCTACTTATGTTGCAAATCTTTCTTTCATAACCCTAGAAGAAATTGTTCTAGGGTTCAATCGTAATTTTATTTTGATTAATGTTCGATCATATCG
ACTATTTGATTTTGTTTAGTAAATTATAAACCACTATTTATATAATATATATGTCGGATAATTAATTACTATCATATAAAGTGAAACTTATGTCTAATAT
AAAGTCCAATGCATTATTAACACTATATAAAGTGAAACTTAATGACTAATATAAAGTCCAATGCATTATTATCACTTTATGTTATCTAATTTTTTTTCTC
ACATATTACAAACGAAATTTACTAATTCAATTACGAGACGTATCAACTAATCATGCAATTTAATTAGTGGAACAAAAATAATGTTAGGATTTAAGGTATA
TTACTTTAAGTAGTGTGTTACCATTTTCTCGTGAACTACCAACTTTTAAAACTTAAAAACATTTTATTTCCCAAGAATTTAGAATAATAATACACACTTT
TTGCCTGCCACTCCTTTTTTTCATTTTTTTTCGTACATCTTGCATTTGCTCTTTTGGTTGTAACTGGTACTATAATGCATTGTATTATTGCTTACTCCAC
CTTCTTTTTATCACTTCAACTGCAATCGTTTTCTTTTTCTTTTTTCTTTTTCTGGTACAGACACTTCATATATATATATGGAGTATTTAATTGCTTCACT
CATGTTCTTGCCTTTAAGTGGTTTCCTTTTTATAACTTTAATCAAACACTTGAATAGCCTTTAATTTTAACTTTTAGTTCTTGCGACCAATATAATTATA
GTAGGGAATCCTTTTGAAAAAAACCATATTTTGAGACTAAGATTTTCATTTAATCAAAGGAAATAATAGACGTGCAAGATTTTAAATGAGTATTTGTATT
ATGCTTTATGTGACATACTTTTTTTTTAGCTCATCTTAAAAAGAATACGATTACATAACTTTAATTTTTTTTATCGTTGATAAAATGATTAGTATTATTG
AAAACAAACTTTAGATCCCTAAGAAAGTTTAAATTACGTAGCTTTAGCGTTTTCTCCATTATGCAAACATAAGACATTATTTTTAGGATATATGGTCCAT
TATTAAACACTGGTCGAATTCTCCTTTTTACATTTTTTAAAATTGTTTATTATCAAGCATTATCTTGACTGGGTTTTTTGTCAAAGCGTTATACCTTGAC
TCCACTTATATGATTAGTGGTAAAATTAAAAGATATGTCCTTCAATATATTTTTATTATTGGCTGGTGTTATCAGGTGAATGAGTGTTTTAAAAAAAGAA
AAAACAGTCAACGTGCACTTCTTTTATGAATCATCAAACATTAGAATCCCCCTTGGGCGTAGCACTAAGCAAGCATCATGCACCTTATCCGCTGATTAAG
AAAGAGAATTTCACACCATACGAATATGAATATAAAAATATTAAAATTAATTGTTATTTTAATATTTAAATATATAACATCTTTCTTAAATTTAAAATTT
ATAAATATATATAATTTATTAAAATATTAAATTAATCTATTATATTATATTAAAAAATTATATGATAATTGAGAATGATGATAATTAGCGATGATGATTA
TGTTTGTTGATTGGAGATTATGATAAACCGTGATGATAAGTGATGACTGACAATACTAACTAACAATAGTGATTGATGGCGATAGTTAGTTGAAAAATAA
TAATTGATACGAATGATGGCTATAATTGATATGAATGTTCCATTGTAATAGATCTGTGGCAAACAGCCCATCACTAGATCCCAATCCTCATGTCTAGAGT
TAATGGATTCATGATCAGAAACTATCATTTGGTCCAAATATTTGTTTCTCCATAAAAAATTTAAAAAAAAAGAATTATATATATAGAACAGAGTAAAGTT
TTCCTTTTGGAAAATCTGAAAAGCTTTCAAAATAATTTTACACAAACTTTTAAACAAAGAATTGAATTTTTTTTTTTTTATAGATTTAAAGAGGAAGGGT
TTTTTTTGAAGATTTGGGAATTTTCTGGTAGTGATTTTCTTCGCCTTGCCTTTCTTTTCTTGATAATGCCTGCTTTTATAGAGATCCTCGGACTTCAAAT
TTCGGATTTCAAATGTAAAAGGAATCTTATCATCTTGGCCGGGTACACTTCTGGGCCCCATCGTCACGTGAAATGATGTTCCTTTTCTTGCATTAGTGTC
CTTGTAATCTGGTATCCGTTTTATCTTTTTAAGTGTGTCCCAACAGTTTTTCCACAGATGTGTGGTAGTGACTAATATAATAAAACCAGCATAATATCAC
ATGTCCAAATGGTGATTTCATTTCATGATATCATATGATAAGGTATTACGTGGTTAAGCGCCTACTTAGTGGGTATGAATTTTAGGATTTGATTGACAAG
ATAATTGCAGCTCCAATTCGCACTTTGTTCCTAATTACGGCTGCTTCAATTGATCTGTTTTTATCTCAAACCTTCGACTTCTCTTTCTCCTTTCCCCAAA
GAACACCGTAGAATCCTACAACACTGAAATTCACGAAAATAAATCAACGAATACCATGAAGGCAATTTAATAGAAAATTAAAGCAATAATAATAACGAAA
AGTGAAACTAAGACTTACGTGCCAATATATATACTTTTTCACGAAGCAAAGCCCAACTAAGAAGGGCGGTGAATGGTGATGATTAGCCAATTGAAATAGA
AAAAATAAGTTCATAAGTAATTGTTACATTGTAAAGGATGGCAATAGTTCTCTTTCTCTTACGGTCAAGAGACCAAGCAGCTTTGCCATGAACGACACAA
ACCCCAATTATAACACATTGAAAACTTGTCATTAATTAACACATCAACATTATAAGGAGCTCCATATTAAACCCCAATTAATCTCTAGTTTTCCTGGAGT
AACCGACAAATTTAGCAATTAATTAGTTTTCAAGTTGGATAGGACATATGAGGAAATATCATTTGATTAAGCCTGAGACAAAATTTATATTGCTTTTAAT
ATTGATGAGAAGATACATTTCAATTTAGTTACCACTCGAAGAAGTAAGCAAAAGGAAATAGTGCCAATTATTTGGCGATAGGAAATGTGGATTGCATTCT
ATAGCTATTTTTCCTACTTTATTAGAGTAATAATAGATTGTGTAGTGAGGTTTAAAAAAAAAAACAGACAGCATATTCACGTTATACATGACTAGCTACA
ATTTACAAGTCAGAGCATTGTGCATCATTTCTTTTCCGTAGAGTTAAAGGAATACTATTATTGTATAATAATTTTTGAATTTTCAATTATCGTGAGATTA
TATAAAGTGAGAACTAACGAACAAAAATAAAATAAAATCAGACTTGTGTTTATTTACATAAGCTAAGAAAAAGAAAAGATTCGGCTGATAGGCCCAATAC
ACATATACAAATGGGCTGGTAACCCTAAAGCTGCTGTTTGTTGAGCCATGAAGAGAAAGTCAGCACAAAGGAAGTTGGAATGTGCAAATTCAATTAACTT
TTATTCCATAATTTGTTTTCTCTAATTTATAATGCACTTTCTTTTTGCTTCTCTTTAAATTGTTGCTCATAATTCGTAAATTTGGATGGTACATTATGAT
GTAAACATAGACTAAACCTTCAGGTGACTAATATAAGAATCTATCACCATATAAACGAAAACAATGGATGGAAAACGAATCCAACTTGCCATGCCGACTG
CTGTGTGTCGTGTCATGTGTGTGGGTCTAACCACATATAGCCAAACATAAAAACTGCTAAAGCTGATGGAGTAAAGATGAAAAGGCAAAGATAACTTCCT
TTCTAAAAAGTTGATACAAAGCTATCGAAAATAAATTATACAATTATATTTCATTACAAGTTAGAATAAGTATTTTAAATTAAACATTGGGAAAAGAACA
AAACGGGGACAACCTACTACGATGTCAGTGGAACCCACACATTGTTCTGAATGGCCCCTATTATTTTCAGCAACTGCCAACGTTCTAATTCTAAAAGAAG
AAGTGAGTAGTGACTAACAACACTTCACTAAGTAAAATTGATGAGAGCAAAATAACATGGGTTGCCTCTCATGTTTGCCGCACATATTACAAGCTTCAGC
TTACATTATACTTTTCATTTTTTTCATTCTCTCCTCTTTCTCAAACCCAGTTCAATCTCAGTGTAAAAATAGACCAGTCATTTTCAATTTTGGTGATTCT
AATTCGGATACGGGTGGACTCGTTGCCGGACTCGGGTACCCCATTAACCTTCCAAATGGTCGAAATTTTTTCCGCCGTTCAACTGGCCGTCTCTCTGATG
GCCGCCTTATTCTCGATTTTCTATGTAAGTCCTTTTTCTCATTTTAATTAATTGTACATTGAGAAGTAAATAACATGAATGTGTAAGATTCACTGCATGT
ATTGATTGGTAGGTAGAGAGTCATATCTGTGAAATATTGTGAATTGTGATGAATAATTGATTGGGTCCTACATGGATTTTTTTTAAGCATTTTGGATTAC
ATAAGTGAATGCAGCTTTAACTGTTCGTGCGATCAAATTGAGGTAGTAATTAATAGATTTACTTTCCAAAATTTATGATCCTTGAGAGTGAAAATTTTGA
TTAGGTAAACTATGATCTCTGTTGTACGTATTATACACTATTTTCTTGTTAATCTTTAGAGAAGACCTGAAGTAGATACCCTAACTTCCACAGCTCGCAC
GTGTGACCGATAGTTCAATTATTGTTCCAAGGCTCCCCTTCACTATGTACAACAAGCAAATTTGAAAGTAAAATCTGCGGCGTTTCATTTACCTGAACTC
TGTTTTACAATGTGATACTCTTGTAAATATCAAAATACTCAAAATTGATAACTCATTGATGGTTGAATATGTCAATGTCCAGAATGAACTAATGATCTTC
AGAGAATGGTTTACTTAGACTTTAGTGTCATTGGAAATACTAGGCGATTCAGTCATATAAGGAAAGACTGTAACACTACAGTGGAGCTTAGGGATTTGGA
GTTATGTTTTATGGAACGTTGAAGTGGAAGGTGATTAGGACCTCAATTGTCAATTGAATCTATCAGTTTAGTTGGGGATCAACCAAGTGCCTGGTCTTCT
TTTTAGTTATTATTTTGCAGAAGTAGCATGTGATGTGACCTTCTTTCTGCAATCACAGTGTAGGTTATTGTATATATACATGCTAGTTTGTTATGTAAGC
ATGATTTTACTCTTTACAAGTATCACGAGATACCAATGTATATGAGCTGAGATTGCAGTATTGTCAGCACAGGTCAAAGTGTTAATACAAGGTTCCTGTG
CCCATACCTAGACTCTGTCGGATCTAGTTTCTTGAATGGAGCAAATTTTGCTATAGCGGGATCCCGGTTACTACCCAAGTATGAACCATTCGCCTTAAAT
ATTCAAGTCTTGCAGTTCCTTCATTTCAAGGATCGCTCAATTGAACTTGTTAGTGCTGGTAATTCTTACACTTCCCTTTGATACTCTGTCTGACACTCTA
CTGATAAAATATGCAAATAAAAACAAAAGAAACGTGTGCTCAGAAATGTGAATATAATTTGACTTGTCTCATGTTGTTGCATTCAGGGTCTGGAAATTTA
GTTGGTGATGAAGGATTTCGAAATGCTCTTTTCATGATAGATATTGGACAGAATGACCTAGCCGATTCATTTGCTAAGAACCTGTCTTACACAGAAGTAG
TCAAGATGATCCCCTCCTTTGTTACAGAGATCAGGAATGCAATTCAGGTAATTTCTTTAATCACTAATTGCTCACTTTTCCTTGCTTCCCTGCCGAAAAG
AAAAGAGTAAATTAGGTGCAAGAATAGCAGTAGCTCGCTATGTTAAAAAACATGGGAAGGATAAAGTTAGTTAAGAAAGGTGGCATCACAAGGTTTTTTT
AAACATCATCACAAGGGCAAAGATTTGCTGAAAGTTAGCTTACTTAATTTTAGGTAGTTCTACAGTCTGTTCATTCCATTAAACTTTCCAAATGTAGGTC
ATATATTCTCAAGGAGGAAGAAAATTTTGGGTCCACAACACCGGACCATTAGGATGCCTGCCTCAAAAACTTACTCTGGTTCAGAAAGTTTCTTCTGATC
TCGATCCGCATGGCTGTCTGGCAAATTACAACTCCGCTGCTAAACTGTTTAATGAAGGGCTTCGACATTTGTTGCAAGAGTTGAGATCTGAAATGAAGGA
TGCTACTATGGTGTATGTAGACATATATGCTATCAAATATGATCTTATAGCCAACTCCAGCAGTTATGGTAAGCATAAAATCTGTTCTCGTTTGCTTAAT
TCCTAGTTCTTGGGTTGTCGATACTCAAAATGAATCTACTAAAGTTGGTACTGAAAGGCTGATATTATTAGTGGAAAAATGGAGGAGATAACATTCCTTG
CTCTTGTAAATTTAAATTAAAAAACAAGAAAATGAAGAATTTGACGTCTCGTGACTGAATTCTAAAGGTCTTAGAACTTCATGTTGCAAGGATGATGGCA
AGTAGATATAGAATATTCACTTATCTTATACACTAGTGACATTTACTAAGATATCCACTTCTGTGGAAACTTCCGAAGTACTATATTTCTTCTTTTCATA
CCATCATGTAGAGAGATTCAACGTAGTATATACTCTAGAGCTTCAGCCTGTTTGAAGATAATTGGCAGCTTACTCATACTACTGTTCATATATGATGATT
CTACATTTGCAGGCTTCTCAAATCCGTTAATGGCTTGCTGTGGCTATGGAGGTCCTCCGTACAACTACCGTAAAGGAGTGACATGCGGTCAGCATGATTA
TCAGGTTTGCAGTGAAGGGTCTGAGTTCATAAGTTGGGATGGAGTTCATTATACCGAGGCAGCTAATAGAGTTATAGCTTCTAAGATACTGTCAATGGAC
TACTCCACTCCACGAATTGGCTTCGATTTCTTTTGCCATTGATTGTCATTTGCTAGAATAAAGTGCAAGCATGAATTGATATATGTTGCTTCAGAGTATT
ATGAAAAATATTTAATTTGGAAAAATAGAAAAAATGATTGGTTATAAGAAAGAGGCCAGGTAAACTTTTTGCTCTTAGTTTTGAAGTCACGATCCCCTTT
TCAGTCCAGTTTTCCCTGTTATTTTAGGCATCTATAATGTATTAATTAATGTTGTAAGCAAGTCTTATGATATTAATTATTAAACCCATTAAGTCTTTGT
TTATTTTTTCTTTTGCAAGTAATTCACATCATGATGTGTCTTCTAGTTGACATAATCCAAAATATAATATTTCTTGCTTATGTCATCCATGAAAACCACA
TGCATCTGAACCCACAGTTCAAAGTCCTCCTCAGATTAACCAATCTTTAAAGCAGGGTTGAGAACAACCCGATGATCTATTCGAAACAACATTTCTATTT
CTATATCTCACGAGATAGATTTAAGTCGTACATTACCTAGATTATAATTGTGAGACCCAATATGTTGTTGGTTGAGAATAACGAATTAATATCAATAGTT
GTGGATTTGATCCCTATTCTTATATATACAACTAAAGCATTTTATTTTTATCCATAACTATGTCAAATAATGGGGCTTTTCACAAATTATGTACTCAATT
GGCTTTAAGCATGCATTCGTTGGTCTCAATGAACCCAAGTGCATCTTGAAAAAATGATCCTTATTTTTAGAAGAAAAAAAACCTAAAGATGATTGATTTT
ATTTTTTAAAAAATGCAAAGTTTCGTGTATTATGCACAGGAAAAGAATCTCAACTCCTTTATCATTTTGTATGACATAAAATATTTGGGGAATCAAATGT
TCTTTATTTAACATCCTCTCAATCATACAAAAAATATCTTGTATAGCCTACATTTCATATACGTAAATCAAGTTAAATTGTGGGGTCTGTAAGTGTATTA
GCCACATGACTATAGTTGCAATATTTGTAGGGGTCAGAAAAACAGAGAACCAAAGTCAAAATTCATCTATTTACGTATGAGTCCATTGAATCAACAAAAA
ATAAGTCAAATGTACACACATAACATTGCATTGCGTGCTGTAGCAGAAATCTAACTATGTGACCCCATATTTTGTCCTTGATCAGTTAAGAGAAGAAGAA
GCTGCACTAACCATAGATAACTTAAAAAAAGAAAATCATATGCTAGATTTATCATAAGTATTCCGATTTGAGTGCGAAAATAAATTAATCGAACCAGTAA
ACTAAAAAAAAAAAGAACTAGCTTACAGTGAAAGATTGAGGTCCAAGTCTAACATATTACATTTTTTTTCTTCATTTTTTGTTCCTTCCCTTTGTCCTCC
TGTTTCATCTTCTTCTACTTCTTTGCTTTGTTTGTTGGAGTTAGAATTGGAAGGACCTGCAATTGCAGAAGCCTCAATTACCATGAAATCTCGTGATTCA
TGAACTGATGGATTCCAAATTCCAACTGCAGAATTGTTATGAACTGAATCTCTGTTTTCTTCCAAAATTTTGGATCTCTCTGTTACTTGATTTCTTGCTA
ACAAACGGTCACGTAAATCTTTAGTGCTTCTTATAAGAGCAAAAAACTTGTCAATTTTCTCATCTTCATCTTCATCTTCCTCTTCCTTTTCTAATCTCTC
ATTCTCCAAATTCTTCCTCTTCCTTCTCTCTCTATCCATAATCTCTTGATGTGAAACAAAAATTAAGGCAATGCAACAAAATATGAAAGATAAGGTTGTG
TCTTTATTATTAATAAAAGAAACTACTCAATCCCCAACTGCCCTTCCCACAACCCCTACCCCTCCCTGCCCTTCCTAATTTCGAAATTTGACGAAGGATG
TCATTTTTGTTGCTTAAAAAATGAGAAAATTGAGTGAGTGTGTACTTTTTTGCCATATATATATAAATACATAAGCAGAATATATAATTATTTAATCAAT
ATACATATACAATTCACATTTCTTTTACTATTTTCCCCTCTCTTCTTTTTTCTCTCTCTCAGTTTTGCTCGCCTCTCTCCTCCAAATAACATGTAGCTAC
AATTTGTAATTATCAAACTATAGCTATAGAGAGTAATTAATTATTTTTAAGTGACTATATGTGAAAGTTTTCTAAATAATAATGATTGGTATAGTGAGTT
CGATCATTTTATTTCTATTAATTGATAGAGTGTTGAACATAATTACTCATGATGTTTTTCAAAGACGTTCACTCAATGTTAATAACGGAAGGTATAATAA
AAAGAAAAAAATATTCTTTTTTGATTTATTAAAAATGACGTGTACAAATGGAAATCAAATTAGGAAATATTTGATAAGTAAATAGAAATGAAGGAGTATT
AATTTGATATGTTCAAAAATTACACGAAAAGTATTACAAATTATATTTTCTTTACATATCAATAAAATAAAAAGTATATCGTAAAATATTAATCAAAATT
TTTATAATAATTTAACTATAAAAAGGGAAAATTTTGATAATTAAAAATAAACAAAGGTAGTATATTAATTAGCCTCTTGAATACATAAATTCTTGGGTCT
TCAAAGCTTGTTTAACCTTAGAAGGTCATAAAAATTCTAAGACTAAAATGAGAAAAAAACTAATTATTTTTACTTTTATTTAATAAGTGATCAAGTAATA
TAAAGTAAATATTTTAATAAAATAAATATTTTAAGTAAAATGAGAAGGCATCACTGTATTCCGCACTACTTTTTGTAGTTACTAATCGAATAACTTTTCC
ATATTTTATTTTAAAGGTATCATATATAGTGGTCTTCGAAAGGGGAGTTATGTGGCTCATTGTAGATGTTCTTTTCTTTCTTGGAAAAATTAAGTGAAAT
GATAAATATTTAAAATATATAATGTAATATAGTTATAGTTTTAATATTTTTAATTTATAATTATAGTTTTGTTAAATTTTGTTATTCAATTTTCTGATTA
TATAGATCTAAAACTTTTATATGCTTATCATAATTATTTGTTTATGATTTATGAATAATTCATAATAATTTATAGTATTTCTATAATGACGGATGAGATA
TACAAACGGAATTCTTAATTTATATACACATTCATATTTATATATTTACAAGCGAAATATTTAAAAGAACAATCAAAATATATAAATTGTAATCTTCGTA
ACAAATAAAATTATATATATAAAGTGTAATTACTAACATTATAATTATAGAACTTTACTATATTTATTATTTTTGCTATTTTTGAAATTTTCTCTTTTCC
CTTCTTTAACAAATGGCGTAATAGGAGCCCATTCCTCCAAAAAAACAAAACAAAAAAAAAGTCAGAATGGAGAGAAGAGAAATACTATAAAATGAAGCAT
AAAATTATATGCTCATAAAAAAAAAGAGCAATAATTTACAAGTTAGTCTCACAAATACTACTTACTTACTACTGAGATTATATTTATCGTTGAAAATTTA
ACATTTTCTTTAAGATAATAAATATAGCCCTCTTCCCAGGGATTAAAAAAAAAGAAGCAAAAAATAGATAAATAATTTACAGTGAAAATTATTGGTTGAA
CACTTTTTGGAGATGAAATCATCTTTAATTCATCTCTATTTTACTTTTCATTATTTATATTTATAGATAAAACCATTTTCAATCCACTTCTATTTTACTT
TATTTATATTAAAATAAAATTAATTATTTTAATCTCATTTTATCATTTATATTAAATGTTAAAAATAACATTATCTTAATCTTATTTTTAAATATCATGC
AATGTTTTGGTGAGAAATAAAAATAAAATAGTAAATAACAAATATCTTTTACTATTTTAAGGAAGATACGAAAAAGCTACTGTGGCAATTATGGTATCGA
AGGAGAGTATAATATGGTAAGTATGCTGCTCTATTTATTTTTACTCGTAAAATAAATTTTTATTTTTATCTATTATTTTACATATATTAAAAAGAATTAC
ATATTTATTTTTCGAGATCAAATAAATATTAACGGAGAAAGTAACTAAATCTGTCTACAATAACCTTTACTAGTTACTGATTTATCTCACATCCTGATAA
CCATAATTAGATATGCAATTTGCAATGTGATATTGAGAGAAAAAATAATTAATGATAATGTAGAGAGAGGAGTGCATCATTCTCTACGACAGCCATTATG
TCAATGACCGACCAGAATATATGCTATGCCCATACTGTGACATGTGATATATGACAGCCAATTCTAATTTTATTTTTATTCTTGGCCCTCTTTTACTGAT
GTTGATGAATACGGTAAAAATATCAGTTCTGTTGGAAATCATATTCAAAGAAAATAAAAATATGTCAATACAACTTTTAACTTTCTGCATAGTCACCAGG
ACTAGTTAAATTTCCTGTTTTTTTTTTTCTTTTTCGATTTGCTATTTTACTCGAAACTCGTAAGTTAAAATTCTTTTTTTCATTTATCAATAAGGACAGG
TCGGTCAGTTTTTTGAACCGTAATCAAGAAGTGTGTGCTATTGCGTGAAGCGGACATAACTCAAAATGTGTTACAAACACTTTCCTGAAGCAATTTGTTC
GACACAAGTCAAAAGTATGTGTTCAGTAATAAATCATGTTATGTAATAACAAGGGGGTGTCAGGCAGAAGGGAAATATTTTTAATGAAAGATAATTTTCT
AAAATATATTTTGTTGAAAATAAGTGAGTTATTTATTTATTTATTTATTAATGTTTGATAAGTAATCAAATAATTATTATCTCAAGAGCATTTTTATCGT
GAACATGGTAGGGAGTGGGAGTTTTTAGGGTGACGTGGTGGGGATCGGAACGTTGAGTGAGTAGAAAAGAGATAATGAAACTTGAATTGTCACTTGTTTT
AAATTGTTATACCTTATATTTCATTAGAGAAGTCATTTTTCTCATTTTTAAGAAACTTGATTTAATAAAGAAAAAAATTTAAAATATTTTAACCAATCAA
ATATGAGAAAATTAAAAAATATTTTTAAAAAAGTTATTTTTTTCTCTGTATCAAACACAGTCTAAAAGTGATGATTCCTGTTTAACACGTATATGGCCAC
GTTTATGCGTTTCCGAGTCAAAACACTAATTACTAACAAATAGATAATCAAAGAAACTCAAAAGCAAATCTAACGCAGATTTAGGAAAAGATTGATTGCA
TGTGACTGGATTTTGCTTTTGCTTTAAGATATATTCCAAGCAGTAGAATTTTATTCTGTTAAGGTCAGTGTGTTAACCTTTTTAGCAAGTTTAGTAAATA
CCCAAATTATACGTGCTCTTCCTGTTGCTGACTGAACTCGTCCTTTCTATTTAAAAAGTGGAAAAGAACTAGCAGCATATAGACCTTCAGTTAGGTTGAA
AACGGACTCACAGGAAATATTCATTGGATGTCTAAAACTTATACAGTAATTCAATTAGGGATGACCCAAGAATTGCTCTTCTATAACTTGGGATTCATCT
GAACCTTGGTTGGATTTTCAAGTATTGGATTTCCATCGGTATTCCATTTTGAGTTCAACTAACTCGAATTCACGCCAAAAAATCTCATCTAAGAAACTTC
AAATATAAGTAAAATAATTCAATATAAAACCATACAAACTTCTCACCATCTTTCAAATGTGTAGATCAAAGTTGGGAAATTGCCAAAAAAAGAGTCTAGT
TAAGCTCATCTTTCAACCTCTCCAAAATGCCTTGTCCTATTCTACCCCCCCAAACTACGAAATAGTGATCAATCCCTATAGTGACATGATTATTTGACTA
GAACCACCTAACTTATGTCACTATGCCAGCTTCACACATTTGGTTTAAACAACGAACAAATATCCACCGTCAAAGGACTGACAATGGGACGCAATCACCA
AAATAGTTTTTACTAATATGTCACTATGCCAGCTTGACATATTACCCTCATCAAGTAAACAGAATCCACAACAAACAAGCAAGTGGCGCCAACAATACCA
AGCCAACTTTCAAAAGCTAGTGCCATCAATCTCATTAATCTAAAGTCTTAACTTTTTCTGTAGTGTGTAACAGGTGTGCAAATTTTCTCACAATGATTCC
ATCTCAATCAATGATCACTAAGATAAGTATGGAGAGTGGATTTCTAATAATTCCTTCTTTAGGAATTTCAGTGTTTGTATGATGTATAACTGTGAAATTC
ACTAATCATCCAACCACTTGACTCCATGTTTAGCCCAGAGATTACCGGCTTTATCTGGACCCTTGCTACCAAACTCGTAATGCTCAATTGTCGCATTATT
ATTGTCTAACTCACTTAAAACTGGAGATAAAATGTTCCATGCAGCTTCAACCTCATCGCTTCTCATAAATAGATGGTTGTCTCCATCTATTACATCATGA
AGAAGTTGTTCATACGAATCAGTTACATCAACATTGTACCTAGTACATCAACAAGAGAAAACAATAAGAAAATATGGAAATGGAGATCCTAGCACAACAC
TAAATTCACAAAATTACTAACACAAGAAAATAGAAAACATTACTTGTCTTTATAAAGCAAGTTCAATTCCGAAGCCTCCAAGTTCATGCCTAATCCTGGA
ATTTTGTTATTGATTCTGATGAGTATGGCCTCATCAGGCACATCACGCAGAATCAGCTCATTAGTGACAAGATCTTGCTTATGCCCTCCTCCGTCTTTAT
GATAAATGTTTCCAGGAACACGCCGAAATTGTATACGAATTTCAACTCTGAAACACATCAGTAAGGATAAATTAGAAAGAAAAGACCTATTTTGATGATT
ATCAAAATCATGCATCAAATTCATTGGATTATGGAACAGATATGAATAGTTTAAATGGAACATGTGGAAAACTATCATAGCAACAATCTATCTACGCATT
AAAATTTCAAAAAAATGTAAAGGAACAACCTCCTTTGTGTTTAGGCAGTAGGATATGATATTTCAAATGGTTGAAGGTGAGATAGAGATACTTTAACTAG
AGAGCAGTGATCAGACCTGTTCTTTTTTAGCCCCCAGCCAGCCTTAATAAGAAAAGGCACACCGTCCCACCGTGCGTTATCGATGTGTAAAGCAGCACCA
AAATATGTGGGCATAAGGTTTTCCATATCCTTGAAGTTACTTCCGGAATCAGCTTCACTATGCCCAAGAATTACATCAGATGATTCCAACTTTCGAATTG
ATTTCAAAACCTTAACCTGAGTAGTAAATGATTTATATGACCAATTTCAACAAAAAATATTGAAAATATTTTGTAACATATAGGGAATAGAGGTTACATA
CTTTCTCATAACGAACATCTTCACCATCAAGGGTGACAGGCGGCTCCATAGCAAGCAAGGCCACTGTCTGGAAGATGTGGCTGTGTACAACATCTCCTAA
AATCCCATAGCCTTTAGGATATCTATTACGTGAAGGGGAAAAATGAAGAGGGCGAGGATTAGGATCAAATACTTGTAACCTACATAAGTGAACTGAAACC
TTGGCTACCTTGCTGAGGTCTGCATGCCTAACTCTTCAGAAAAAGTGACCTAAAAATAAATGTTCAATGATAAACTAAGACTTCTTGCATCATTCCCATG
GTGATTCGAGCATCGGTTATCCTAAGCAAATTACCTGTATGTTGTGTATGTAACTTCGATTCCATAATGGCATAAATACTAGATTCGAGAACCTTAGAAC
CGCAAGATTCTCAATTGTATTCCTTCCCAAAAGATGATCTATCCTGGAAGATAGGCAAGTAAAACAGTGATGAGCAAATAATTCAGAATTCAAAGTCTTC
TTATATCACACATGTTTTTGAACCTGTATAATTGCTTTTCCTCAAAGTTTGAGAGAAGGGAGGTAGTCAACTGATGAGAAGAAAACGAACCCAGACCAAA
GGGTTTTTCAGTTATTACACGATTCCAACCCCTCCGGGTTTGGGCTTTTTCAGCAAGAGAGGATGCTACGTCGATAAGTGCTTCTTGAGGCACAGAAAGG
TAAAATATTCTGTTTGCTCCAAACTTTCCCTAAGGTACACGAGCTGTAAACAACAGTAATAAAATAACAAAGATTTGGATACAATGAGCACTTACGAGCA
CAAAAAGTACAGAAACAACATACCCAGTGTAGTCCTAGTGTCCCACGCGGTGGGGTCTAGGGAGGGTAGAGGGTAGAGTGTATGTACACCTTACCCCTAC
CTCAAAGGTAGAGAGATTTTTTCCGATAGACCCCCGGCTCAAGCAAAAACAACAGATAGTAATGGAAGTACAAGAAACAACATATAGTAATAGAATAATA
CTACAACAAAATAATACGATAGTCAAGCACAAGAAACAACAGAATGCACACCATAGGTCGACAATCCTCAGCAGTATTTACCTCAACTTCTTCCATGAGA
GTATTGAGCTTCGACATGCCTTCTCGGTTGTCATACCCTCCATAAATATAGAATATCCTTTTGAGAAATGCATCCGTTTTTTCTTCACAGTTTTCTCTGC
ATAAAGAAACTTTATAAAGTTAAACTACATCATGTTTCACCAATGATTTTATTTAACATATGAAAATTGAGACGAGTTTTTGTTTTAAATAATTTTGGAT
AATGTCATAGACTTCTCAAATTTTTCTTTGTAGCACTAACTTCCCTTGTGATTTTACGATATTAGGCTTACCTCCTTTATTTTTATTTTTTGGTAACATT
TCTTTGAGTACATTTTTCATCAATGTAAAAACTTTATAATTTGACCTTATTAAGTATACTCTTTCATTTAATTATTTCTATGAACGTTTTTTAAAGATCT
GCAAATTCACACCACAATCTCTCCCTCTCTTCGGCATCCTTCTGCTCTGCACTTCATAAGCTCCCTTTCCCAATAAAATGAATTTTGGTTATAGGAATTT
GAAAGTTTGCACATTAATTGTCTGTTCTTCTTAGCCTTTGCCAGAACTACTTATTTTTGTTTGAATTTGGGGTATTATGTGGTGTGTTTCTTTCCTTGTT
CCACTGGAATCCTCTTCAATAATTTTTTTTCTATTTCTATTATTATTGTATACCTCCTTCTTTTCAGTATTATTTCTAAATTTTTAAACAAATATGTTCA
TCAAAATGTTCCAGCAAAACTCAAACCACATAATTTTACGGCACGGGGAAAAATTACACCATCTTTAAGGAGCTCCTTTAAGAAGATATTATAAGATAAA
TTCAACAAAATAGCATATTAGAAAGGACAAATTAGTCAAATTATGATTGTTTTCATCAAAGAAATATGAGTTAAGAAAATCGTGACAAAGATTTCAAAAT
AAGGGTGATAAGTGTAATATCGTAAACCACAAGGCAAATTAGTGTGATGAAACGAAACCTGGGGGAGGTCTCTGAGATTATCCCAAATAAATTTTATGTT
AATAGATCAACAACAAGAAAACGCCAATTTTCATGACACAATCCATTTGTTTCCCTGATCACTCATAACTCCCTCATTAGCCTTTCAGGTGCTCCAGCAA
ACGCATCTTAAATTTTGAAGGCAAAGTCTAAAGTTTTTAGTCAAAAACTCAAACTCTAGAAAAGAATCAGCTATACAAAATCCTTCAGTGACAAAATCCC
CTCCCCCCCGCCCCAACTCCTCTCTCTCTCTCTCTCTCACACACACACACACATGTGCATTCAAGCTCTCTCTGTGTGCATAAGCACATATTTCTAATGT
GTCCTATAATATAAGCAGATGGATAGACACAGTCAACATATAAAACAGAGGTACATATGTATATATATATGTGTGTGTGTGCGCGTGCGCACACGCATTT
GAGAGTTAAGGAACATACTGGTGATCAATACGGCAACTTAAAGTTGGTGCTATTATGGCTCTTAGATCTTCTTCAGTTAATTTTTTCCGTGAGTACCCAA
ATATACCAATTTTCTGCAGCCATCAGAAAGACAGTAAGCCTAGAAGGTTAACCTCATATGTATATAACTTTCCAGTATTATTCTTCCTATCATTAAAAAG
TAGCAAGCAGAAGAAACTAGCAACATAGTTCAAATATTCCGATTCAATTTTACATTGATCTTATTTGACTACCTTGTTAATATTTTTATCGAAAAAATTC
CAAGTTTTGAGCCCCTCAATTGTTCTTGCGTGAATCTACTTCAAATGATTCTAACAGAACAAGAAATTACCAACTATCACATACTTCAACTTAAAGTGCC
AAATTCATTTGTTTCATAACTTCATGAAGTGGTCATGTCTTCTTCAGTTGTGGAGCCCGGAACATTTCATAATTTTACACTCTATAACTACTTGCTGTGG
CACATGATCCCATTCTTCTAGCGTGATGCTTATTCTAGTCCAAAGTCTTAACAGTTGCAACTTACCATCAAATTACTTGCCCAGGTAACAAGTGCTATCA
CCACTAGCTCAAAAGTTTAAACGCACAATGTGGAAGAAAACTAATGCTCGTACCTCTTTCAGCTAGTTCAGTCCAACAAGCATGGCACCACCCCAACCCT
TCAAAAGGCTTTTTCAATGTTAATCAAGCTACTACATTTGATCTAAATAAAAAAATTATCAAGCTGAGCTCAAGTTATCAAAGATAATTTTAAATAGTTA
CTTTCTGAAATTTAAGCAGAGGGTCTATCGGAACAGCCTCTCTATGAGATAGGAGTGAGCACTCTACCCTTTCATACTCCACTTGTGAGATCACACTAGG
TATGTTGTTTTATTGTTATACCACCAATTAATATGACTTGTGATGTACAAAAATTAGAAAACAATTGAATTAGCGGTGTAGCTATGACAGACGGTAGCAA
AGAAAAATTAAGTTTTTCATTAGTAATTAATATATAATAAAAAGCTAAGATGAAATTGTGTTCCACCAGGATCAGAAATGAATATTATGGATGCTGAACA
TGATAAAAATTTCAACAGATGCGTAGAACTCAAAAAGGAGCACAATGGTAATTGATCAATGTACCTACCTCTGGAAGTTGACCACTGTAATACAAAGCAA
ATAATGCTGGGAAAATTTTCTTTCTGGCTAGTACACCAGTGGCCCCAATAACAGCAATGCTAAGAGAGGCTGAATCATCAGTTGATGCACCACTACTGGA
TGATTGAGTCTCACACAAAGGCAAAGGCAACTTTATGGAAGCATCCGTCCCAGAAGTGTCAATTATAACTTCTTCATCAAGTGAAGTAGTGCTTCCAGTT
CCTTCAACATTAAAAGAGGTCGACCTTATGGAAGATCGCGGTCTGTTGACATCATGAGGTTGAACATACGCCACATAGTTTATTTGTGTTCTGGATTTCT
TTATCGTATGGCTCTGTGTAAAGAATATATATCAGTCTCCAGAAAAATATTCATTGACACAAGGGCATGGGCCAGAATAAGTGCACATGTATTCCCAACT
AAACCACACGATTATAGAAAGCTGGAACAGTGAGATATCAAAAGGCAAACATGATTCACCAGCTTCTTCTGATCCGAAGATTGAAAGTTATGAAGAAGTA
TCAAACTGAAAATACAGACCAAGGTTTAGATTCATCTGGTCAACCAGTTCACATGACTAACCAAATTTAAGAATTCAGGGCATGCAGGAAGAAGTAATAC
TTCAATTTGGCGCTGTAGCATGTAGAACATGCATGCTAATACAGCTCAACATATGTGAGATGTGGATTTATACATCTTTCTAATTTTTGACCATTGCCTT
TTAGGTGAATTGTGAACATGTCTTGAAAGGATCACAGAGATGTTTTAGAAGCACGACAGCACTATAACATGGTTAACAAAAGTAGTTATACAATCATTTG
GAAACACAATTAGATAGAAATTTTAGCACTTCCAGTTATTAACCTTATGCCTGTAATTTGATAATTGCTTCTTCATTAGTATAAAAGAACTTCCAGTCAC
TGTATTGTGCAGAACATGAAAAATCATATATTTCGTGAAAAGGGTCACATTTTATTGGGGCATATAGAAATGTGTTGCACATTTTCAATTGACACATTTC
TATTTATGATATTATCCTGTTCAACTTTAAGAGTTCAAATTTGTTTGATTAGTTTAGCTATAATTCTAAAATGATATTTTAACAATCAAAGCAAACGTTT
CGGTTATGAATTTAACAGGTTTATCAAGACTTCACAGCTACCAGTACAAATGTATAATAGACAAGTCATTTTGACATTCTAAACTCCACCTGAAGTTAAA
CTGAGTTACATGATACTGGACGCTGTGACTATAGGATCAACCAAAGCCTCACCCAAGCAAGAGCTACATCTTATTCACCCAGAACCAAAAGTTGACTATT
TATGTTTTCCTAGGGTCAGTTTGACTGATTTCCAGTCCAAATCTGATATTGATATCCACTTTCTGAAAATAGCTAGTTAGTCATTATCAGATTTGGACTG
GAAATTCTTCAAATCATCAGAACACTAGCTATTCCAGAAATTATTATTATCAGAACATTAGCTATTCCAGGTTATTACTGAACATACACAAATCAAGGTT
GATGATGAGATTTCCAATACTTCCAAGTTACTCTTCTACAGAGTATCGAAAAGTCTACTTTGAAGGATTCACAAATTATCAGTGTGAATCTGTGTATAAA
CATACTCTCTGCATTATTCCCCTCTCGCTAACACCTAAATTCGAAAGTAATAAATGGTTAGTCACTTATTCTCTGCATCGTCTAAATTTAATGGGACTTA
ATAACTTATTGTATTCATATCACTGAAATTGCAACATCATACAGTAGATAAACATCAATTTTCTTCATAAATTCTGAAATAAGTTAATTTGTCAACTGGA
TTTCATACACGAACTGAAAATCATGGAAGAGAATACGATAGGTACAGCACCATATAGCTCAACTTGGATACCAGAAAAAAACATAAGAAAATGGATACAG
AGCTGACCGGAAAAGAATGGACAATAACGGTAGGTAATACATAAAATTTCCGATAGATTGACGGGACGATTGAGTTCTCCGATGAAGACGTTGATAGCGA
CACTGGTGAAAGCGACGCCATCACTTTGAATATCCCGATCAACGTTTTCTGTTGTATTTTCAACTAGTATACTCTATGTCGTTGTTTACTGTGTAAAAAA
ACGTTTATATCTGAGTTTTGGTAATACTTTGGGCTTGGGTTCTGGATTCTTGATGTTGGGCCCATGGCCCAATTTGGAGTAAGGTCCGAAAGAGAGAATT
GGGAAATTTTCTCATACCACATATATTATTAAAAATGTATATTGTAAATTCTTTCTCAGATAAAAGGAAAAAGTTCACTGATATTATGACATTACTAGAC
AACATACATATTATTATGGGGGAATTTGATTATTCGAATGATAATTTAGAGAAACTATCCTTTTATTCAAATTGAAATTCTTAAAAGAAATCTATGAGGT
TATACGAATGATTTGTCCCAATTTTTCATAGATTGTGCTAATATAAATAGTTGCGTAAATATCATATTTTATATTTGTCAAATATATATATAACACTTGT
TACATGTATTTATGCAAGCACAAAGTTATTAAGGCATGGTATCATCTTGTTATATTAAAAAAATTAAATTCACACGAATTTAATAGCTTTTGTTTAGATC
TTATATATTTAATTTTAAAATTTTTCTTATATATATGAATATATTTATATTAAATTCAATAACTATAAAACGAACAATAAATTCTTTTCAAAATTTACAA
CTCATAAACTTAACCAATTAGATCATATTGAAACGAAAAACTTGTTGGGTGCAATTGCACCTATTTACAATCGAAGAGGATTGAGTCCATCTGTCAATTT
AGTGCATGTCCCTGCTAACTAGACTAAAATACTAGAAATACTTGTCAATTAAGATAAGCCTCAATTATCTAAAGAGATTGGCTAATATTAGTAACCAAAA
ACGTCATCTCGTATGTATTATTAGGTTACTATTCTCACCATAGTGGTTGGCTAACAAGACTTTTCTCTTGGAGGTTTCAGATTTGTTTTAAATCGTATGG
TTATGAACACATAGAGTGTGTCTGGTATGAAAGGAAAACATTTTGTGGAAAATGTTTTTTAATTTTTTATGTTTAGTTGTGGTAAAAGTTTTGGAAAATC
TTTTCCAAATCAACTCATTTTTCTCAAAATTAAGGAAAATGACTTTCCTTAAAAAATTAAGGAAAGCATTTTTCAAAGCTCTCCTCCAATTTCAATTACA
TTTTTTTTTTGAAAAACATCAATTTTTTTAAAAATAAAAATATTTTCAATTTCAAAATTTTATTTTTTCACTCCTACCCCCTCCCATGCCTCCCCCACTA
TCCCCACCCCCACCACCCCACTCCAAAAAAATTGTTTTTAAAAAATATTTTCAATTTCATTAATTATTTTCTACTCTAGTAAAAATAAAAGATGTTCCTC
AAAAATATTTTTCATTCATAAATCAAATACTAAAAATCATTTCAGAAAAATATTATCTACTCACCAACCAAACATGAAAAAATAAGTCCAAAATCTACTT
GTTTTCCAGGAAAACATTTTCTAGAAACAATTCTTGAATGAGGCCAGGGATGAATCGAAAAAGAAATCTTTATTGGTTCTATCTCCTATTTTTTATAAAG
AGAATGAATCTTTTTCTCGAAGGATCAGAAAAAAATGGGTCAGGATCTCCTGCGGGAATGATTTGGAAGATCCAAAACATTTTCCTTCACACCAAACACA
CCCATAATGAATGAACGTAATCTTTTATTGTAATAAACTTATTTGATCGTAATTCTCAATGTGATAAACTTGTCCGAGACATATATCTCATCACTGTGAA
AATATGGAAAACGAATCAATCTAAGTACGTCTTGTAGAAGAGACGTTTTGACCTATATCATGTATGTATAAGGATTGAGAGAATCAAATTCTTTGACTGA
TTAAATTGATTAAAATTGAATTTTATTTGAATATGCTATTTGAATAAAAACTTGTACCTCTTCTCATAAATATATAACATTCACAATTTGTGAAAACTAT
ATATATAAATCAATTATTTAATCTTACCAAATAAATGTATCATAATTTTTAGGCAAAATAACATAATAAACAGTGCATTTACCAAAAAGAAAAGGAGAAA
AAAGATACAAGTCTATCAATAAATTTTACATCAAAAGCTTACCTATATGTCTATATAGTGGTGTACGCAAAATTTTTAGTAAACGGTGTGATATTTAAAA
TTTAATAAACAATAAATAATTAATATAATAACATTTTGTTAATAAAAACTGTTTTAAAACGTAAGTTAAGTAAACTATTAAATTTTTTCTCAAACGAGTT
CTCATATTTAGAACTGTATTGATAATAGCCTTGTTGGAGATAGTACTAAGTACTAAATACTTTAGTGCAATTGGTGTAATTTAGTTTAGTTTGATTATAA
ATATGAGGTTGAAGGTTAGAATAATGACTATTAAATTCGCGCTCCAAATCAAGGACCCAAGAAACTCAGTTGTTCAGAGTTTCATTAATGTTATTTATAA
GAATATTCCTATTTTTTTAAATTTTTAACATATATAACATTGAAATTTTTTAATAAAGCAATGTCGATTAACACTATATGATGGTTGTATATACTTTATC
TACTCTATAACTATACATATATATAATAGAAAGAAAATAGAACTTGTTCTTTTTTTCTTTTCTTTTTTAAAGGAGCATATGGTAATAGCGCATAGGGTTT
GTTTCACGACAAAATAATTAAGCAAAAATAAAGAATTTTATCTCCTTTCCATTCTTTATTTTTTTTGGTTAGGGAGGAAAGCGAACTAAAGAAAATTATA
GTAACTTGATTACATTTGATTATAGGTTTTCTTAATTAATAAAATTTAATTAATTATTCAGTGAAATTTAACTGTCACAATTAAAATTTTGAGTTATCTT
TTAAAAGTAAAAATACATATTTAAGAATAATTTTAAAAATTATCTTTCTAATAAATTTTAAAATTTAACTAAATTTATGATTAAACATTAATTTGAGGTT
TATATTTTTCGCATTTCCTTGCGCTTTCATCCAAAGCAAATCTCAAGTATCTTTATACTATAAATTATAACTTATATAGCCAACTATTTAAATAATTTAA
TATCAATCATTTCTTAACTATTAAGTACTAATTTGTTATAAAATTTTTAAAATAAAGAAAAGGGAAAAGGAGGTTAAAGTTAAGGCAATTATCTGAGAAG
TGAGATTATTGCAATTTGCAAGTCAAGAAGGCAAAACAAACAAACAACAAAGTCATGACAATAATTACGTAAAACATATTTTATAATAATAATATGATTT
CTTGTTTTATATTATAACAACCCACCACTACCACGTTCTTTATCCATATTTTTTTTAATTATTTTAATAATATTCCAAAATTTTACTCATCAATAATGAA
GAATCCCAATCAGTAGTCTTCTACCATTATAATCACCTTTTGATCAGATAAGACCACTTGCTTCAGTCCTTTATTCTTTTGGCTCTCTCTCTTTCAGCTT
TCAGGTAACAAAATTTATGTTTTCAATTCTAAGTTTTCTGCTTTTTATTAGTCTTGATGATTTATGGGGTTTCGTATTCTGATCCATGTGATCTCTGATT
ATTTTCAACTGGGGTGTAGTTTTTTTGGATGTTTATAATCATGACTTTGACTTATTAGTGATGAATTTGGGGTTTCTTGGTATGTGAAATCGTTCATGTT
TAGAGGAATTGGGAAGATTCTAACCTGGGTTTTTTGTTTGATTTTGGATCAAAGTTTTGAGCTTTAATTGTTATCAACATCGTTTCACAAAGGCCTATTT
TTTTTGTTCTTTTATCCTTTTTACATGTTATAGTTTGAAGTTTTGCTTTGTTATTCTTCATTGATTACTGTTGGTGCAAAATTTCTACTTTTAAATCACT
TTGAGACAGAAAGATTGTCATAATTGGACACTGATCCGTGGTGTCTGTGATGGGAATTTATGGTTTACAATCTTGCAATGAAATCTTTTAGATTTTTGGT
TTATAGTTTTGTTTGATGCAGGTGTTTAATTAGAAAGTGAATCTATTTTTTGATGCTTTGAATTTTGTTCAGTTTCGTCTGTCTAGGGGATACATGGGGT
CTGAAGGGCCTTCACCTGTGATCGTACATGTAACTGGTTTCAAGAAATTTCATGGAGTTGCTGAAAATCCAACAGAAACCATTGTAAGTAATCTTAAAGA
TTATATGAAGAAAAGGGGTATGCCCAAAGGGCTGATCCTTGGGAATTGCAGCATCCTTGATACTGCAGGCCAGGGAGCCCTAGTTCCCTTATATCAGACA
CTGCAAGCTGGTTTAAGCGGTGGTGACTCGGAGTCATCTAATTCCAAGAGAGTTATTTGGGTCAGTTGCTCACTTGGCTTCTTTTACCTTTCATGCTTAA
CTTTGTTCTGCTGTCCAAATGAGGAAATGATAGGTTCTTAATTTCATTTGGTTAGAAAATGATCACATAGCCATTTTAAAATTGTGTAGCTCTGTATTGT
TTTTGGTGTCAAGTGTAAGCCGTTAGTGATAGAACAAACAGAAGCTATTTATGCAGCTTATACAACGGTTGTAACTTAGAAAATAGGACCCTATGCAGTG
TTGTGAAAGGCGATCGCCTCGTCGCCAGTGGTGAGAGGTGAGGCGAACCTTCATCGCTTTTTAACTTTGTGGTGAGGCGATCTTCGACAGGTGAGGCCAT
GAAATCAAAGGCGAGAGGCGAGAAAGGCATTGCCTTTTGTATTTTTGTTAAAAAGGGCTACTAATTTAGGATTTTAAAAAGCTAAAAGGTACTTTTAGGG
TTTTCGACTACACTCCTCCAATGACCAGCCAGACTTCTCCAGCAACTCCAAAGTCCAATCAATACATATTTCTTCTTCTTCCTCAGTTTCTTTTCCTTCT
TCTTCCTCAGATTTCAAAGTCACTTCTACCTCTGTTTTGACTTGTGCTCTTTTTTTTCTCATTCAAGTTCTAGACTTTTAGCATGTACTATCTATTTTGA
GTTTTTGAATAGAAATATTTGCTAATATGTTATTGCTATTGAGTTTTTTGATTACTTATAAATACAATTAAATATTGAAATTTTTGGTACTAATTGGCGT
TGCACTTCAAAAAGGCAAGCGCCTCGCCGCTCGCCTCGTCTTGTGGCGAAGCAGACCCTTGTCGGCTTTTATCGCCTTCCGGCGTCCAAAATACTGTCCC
TATGTAACTACAACACTTCTGAAGCGGGGTTACATTTTCTGATGTAGTATACCTGTGATATATAATATAGACTAACTGTTACCTTTCTTTTTTTAAAAAA
AGGTCACGTGACTGGTAATTCCATTGGACCTTAATATGACATAAAGATGGAAATTTTTCTTTATGGAATCTAACAGGACCACATGACACAATTAGTGTTC
CTTTTCTCCTATTACGAAATATATGACCTTTAATTTGGATGTGGTTGGTTTTATCTTGGAAATATCATATTTCTACTTTTGTCATGTACGATATGGAAGT
TTTGGATCATAGTTCATACAAATTGATCATCTTTGAATGATGCAGGGTGCTACTGCTTTTGTATTTTGTGGAAGGATCGTTGCTGACAAAATGGTCATTA
AATTAATTTTTTAATCCTGAAAACCGCTATACTTCGTTTTTCAGAAATTTGACGCATGCTATGATGTGTAGGCGGCACCTTATATATACTCTAGGCTCTT
TGGAAAATCCTGTTCTGGACCCAATCCTGTGAAAGTGTACTTAAATATGCTGCTGGAAATGTTACCCTTATAAAAAATATGCTACTAGAGCCTAGAATGT
TCCACAAATTTACCTTAACAAAATGGGTTTGGTTCATAGTCTTGGGATAGTTAATGAATCATTTAAAATCAGAATTGTATTCAGGTGTTAAGAGAAGGTA
GATAAAAGGGAGGGATAAAGGTCGCAAATGGGGGATAAGGGGAGGGATAAAGCTAAACTAAGAGATTGTTGTTTATTTGTTTACAACCAAATGACCTAAT
TCTTTTGTCGTGCTTTATCTTTTATACTTGTGACTTGTGAGGAGAAATGTTGTCCATTTTTCGTTGAAATTGGTGAGTATCACATATTCTTGTATAGAGA
ATACCACTAAAGTTTTTAATTCCTCTAAGATATATTGATACAGGGCACATATGACATAACATAGTTGCTTGTAGTACCACTCTATAATGACACGAGGAGG
GAATGGTGTTTATGGTGTTCAAGTGGCTAGAGAGTATTATGGTTATGTTCTAGAGTCTTTGTTGCGAATTCTCTGTCACAGTCAAATTATCTATGGAGTA
TTTTGATGCCCAATATTTGTACTTCATATACCAAGATTAATCTAATTTTTGGTAATTTTTATCTAGGTACACTTTGGAGTTAATAGTGGTGCCACAATGT
TTGCCATAGAGAATCAGGCTGTCAATGAAGCTACTTTCCGTTGTCCAGATGAGATGGGATGGAAACCTCAGGTTAGTTAAAGGACCTTCCAGTTTTCATT
TGTCCTGTTAAAAGACCTTCCAGTTTCAGTTTGTACAGTTCATCAACTGAACTCAAGATTTTTATCCTGTTACTTGCAGAAAGTACCTATTGTTCCTGCA
GATGGGGCAATTTCGCGTAAACGAGAGGTATTATGATTTCTTGCATCCATCTCTCATGATTTCTGTAGAATGGTTATTAAAATTTAATGCTTATCTTGTT
TTCCAACTTTGAAGTCAACCAAATGTGGTTGGTACTTATATGAAACAGTTGTATGCATTGGTTCATACTTCATTGAAGTTTATATACCATCTTTTAAAAG
TTGAAGGGAGTTTGCTATACACTTCACTGTTAGACTCCATTTTTTGAGTTAACACTTTGTCTTGGTTTCCAAAAGGGAAGCAGGACGGCAAGACCAGAGA
AGTTGATTGTTTACTTCCTTTATATGAAGTATTGGTGATGATTATCCACTTGTTTGACAAGTAAAAGTAATGTATGACCCTACTAGGGAATGACCCTTGT
AAATAATGATCTAAAAAATTAGTTAGTTTGGAAGATAGAAGTGCTTAGGTATAACAGCTTTGAGCTGTCGAGTGACGATTGGCCGAATTGTAGAAATATA
AAAGACAATTCTGGGCGTCCTATGCTGGAAATAGACACAGAGCACTGAGCTGAGGAAGTAACTTGTAAACACAAAGTCATAAGCTTTTTGGAAGCTCAAG
ATTGTTGGTTCACTGTCCATGCTTATACATGCTAAACCTTGAGTTAAATGCTTAATATTCCAGCCTCAATGGTTCTCTTTCCTTTTCTGGTCATATTCTT
CATAATCCTTTAAATGCACCAGGACCGGATGGAAAGATATGGACCTATGTTGCGAGGGTTGATTCTTCATTTTATGATATACAGTTCGAATCCAATTTCT
TCTCTCAAGTATTCCGAGCTCATGAACTTTTTAAAGATTTTTATTCATTTATTTTTACTGAAAAATATTCTAGTTTCCAGGGATTATGACATTGTGAACT
GTTACCAAGACCAATAACCGTGGCTTCTAAATTATTTCACTTTTGCTTTGCTTCATACTATCTCAGTCACTTTTGTGACTTCCTTGAGGAGGGAGGAGCT
GATGAATAACGAAGTGGTGTAGTGCTTGTTGGAAATATATTTCCTATCTTGAATAGTTGGAGTTGCCATCCAAGCTAAACACTAATTTCTCCATCTTATA
TATACATGATTTTCCTTGATATGTTTTCATTTCCATACCTTTATTTGATTCAGGGATCCCTGCATAATCAGTTCTTTCAATTTTCCCTATCTACCTAAGA
ACGGACGGTCTGCGATACATGGATCTTGGATCGAGAAACCGTATCGAAGCTCCGGGTCTAGTCTGTGTACTTTGGACTTTTCGAACTTAGAAAAATGAAA
ATCTTAGTAACTAAAGGAAGGGAAATCAACTTACGTTTCTCCACTTCTTTTTTGTTTTCTTTTTGATAATTAAGGTTAAAGCTTAATCTTGGACCACATG
GTAGTATCCCTATTCAAAGATATCAGACGAACAGGTAGTTTTAAATGGGGAAAAAGAAGAGCCCACTGTGGAAATTTTTTCCAGTAGGAAGATCACACCG
ATTTCTCTGAACATCCAGTTTCTGGAGTGGGGAGTTTTTACTAGCATCTAATCTTTCTACAGATCGCACCGACTGGAAATAGCTGCTTCCTGTAACTTCT
AATCCAGGAACAATTTATTTTTGTTTGTCTTCGACACCTATAGGTGTCGTACCACTTCTCTTTATACTGTGTTCTCTCTTTGTGTAGACTTCTCTTCCGG
TGGAGGAAATGACCAAGGTATTGGCAAAGATGGGATATGAAGTAATGACCTCTGATGATGCAGGCCGGTTTGTATGCAATTATGTATACTACCATTCCTT
GCGTTTTGCAGAGCATAATGGTGTCCGATCACTATTTGTACACGTTCCCCTCTTCCTAACCATAGACGAGGAGACGCAAATGCAATTTGCTGCTTCTTTG
CTGGAGCTACTCGCCTCTTCATACTAGTCCTCGACTTCTGTGTCTGGAAGTGTATTTGCCTTGTTATTTATGCTGTGTATGCGGAAGAAGGTTGATCTGG
ATATAAATGTAATGCTTTAATAAACAGTGAACTTTTAGTGAATGGCAAATGCATATGGTGTGTACATGTATCTTCCTCAACATTCCTTGGGTGGTTTATC
TCGTTGATTTGGAGATGTTTCATGCCTATTTGCGAGCAAACTTACAGCTTTCTGTATCTCCTAATGGATATGATAGGAACTTGTCCTTCAATTTATGTTC
TTGCATTAGTGTCTTTCTGTTCTTTTGGCTGATCAAATATTGGGCAGAAAATTACACCCAATGACGTTGAAAAACTTATAAACTTGAAGTTTCGCCTGCG
GAGTTCAAAGTTCAGAATTACAACTTAAGCATACATAGAAGAATTCATGAAATCAAAAATAAAAAATCATTTGTAGTTACTAGGAAATAGAGTAGAAGAA
TTGATGACATAGGTGCACCGGCCCCCTACATCAAGTCAAAGTTAAAAGAATTGAGTACTACATTTTACTTGTGGGCTATATATATGGTGTTTGAGAAATT
GTAGGTGGTAGCCCCACACCACAGCCGCCTTACTCCATTTTCTATGTTGGGACCTCAACTTTTTCCATTTATAGACTATAGTGCTGTCATCTCTGCCACT
CCCACTACACATTAATTATGTCATGCTCTTAATTATTGGATCTTCTTTAATTTAATAATTTCATTCTAGCCCCTTCCATTCCTCCTCCTCTCTAATAATA
ACTTGAGTAGATGATGATGTTCGAGTAAGTATCATCGGAGGAATTTCTTTTATCTTAATAGAAATCGTCATTTCAAAGTTCAGAAATATTATAAACTTGC
ACATCTAGATTAGTTGGGATCGTCACCAATATTTGCTGCATGTTGCCTAAAGGAAAAAGCTGTTGTGCGTCTTTTACTCCACGGATTTTTCTATTTATAG
TTAACCTATGTGTACGATTAACCTACCTGCTACTGTAATTAGTACTAAATTTAGAAAATTCAAAAGGTAAAAGGGATTGCCAAACCTATTTTCGTGCAAC
CATTGCCCTTTTTGTAATTTATCACGATATATAGTAGGTAATCTGTGTTATTTTCAATATTACTTTTTACTATTTTACGAGCACGTGAAAGTAATATAGA
TTAGTCGTACGTACATTGAGACACTAGCTATGAGTTATTGATCACTTGCCTTTTTTGTTGAACTCGTCATCTTATTGGGCATCTGGTAATTGATATGTGT
GTGACTAAATTAAGCTACTTCTTAAATGGTTAAAATTAGTGAATAACCTTGATTCCTTTCTACTTAATTTCATAGACATCCAAACATGCTATGAACTTTG
GTCATTTACCTAAGTTCACAAGTTCGAGCTGTGTGGAAGCAACCACTAATGCTTAGGTTGTGACCCTTGTCCGTAACCTTGCTAACTTGGGATGCTTAGT
GTACTGGGCTTATAGTTATTTACGCTATCAGTGTAGGTAAAGCAGAAGATATTCTAAAACTGATTTAAAATATACTACTTTTATATCATTAACAAAATGG
ATACATGCTTACAGTTAAGTTTTAGTCCTCTCTGGAACAAGACTAGAAGAGCTAAAACTTTAATACATACTATTAAGTACTCCATCTTTTACAAGTTTGT
ATTTCTTAGCAAATCATGTATCAGCATTGATCAAGATCATTACTTGGTAATGACTGAGGTGTGCCTTCCAACAAGCAAAAAACTGGTGGAATTGTAAGAG
TAATTAGAGCACCATAAGCATTCCAACAAAATGGTTCCAAGATTTTTTGTCCTTGAGCAGGATATAACTCCACATCCAAAAAAGTCAAATTTGTGCAAGG
GACACTGTTACTACAAGCCAAATGCATTGGTGGACTTCTCACATCATAAGTACCCTTTATGTTTGAATAAATCACATCAGATATGTACACTGCTGAAGTC
TGATTTGCACAGCTCTTTGTGCTGCAGTAATATTGATCTAAAATTATCGGATTTCGAACACTTTCCATTCTAATGTTGTTGAAATTAATGTTGGATACTG
TCCCAAATCCTCCTTGCCATGTCTTGATCCTAACACCATTGTCTGAATACTTAATAGTTGAATCTTCCACTGTAATGTTGGATACACATGCCCGGGAATT
GCGAATGCCTAGACTGCCAATGCTGAAAATTATGCAAAGACGCAGTCTTTATATTCAAGATTTGGGAATAAAGACAGAGTAGACATCTTGTTATGGGCTT
AAAAGTGTTGTTCTTTTTTTTTTGTGTGTGTAGTGGTAGGGCATACCTCTTTCACTCTAGCAGTTTTGTTAGTTAATGTGCCATTTTTTTTAAGAATATG
TTTGTGGTGCAAAATTAATTGTTTACTTTTTTGACATAAAAAGATGGTGTGATATTGAATATATACCTTATTCCATGACTTGGACCACAGGTCATGTTCC
TTATATCAACATTGTAACAACCAGCTCCAATTGAAATACAGTCATCACCTACAACATAAATTGGTTGTGCTCAGAAAGAGAATACGCGAAGAATAATCCT
CTATCACTTAACTTTACAAGAATTTAAGGTTTTACCATTGGAGATTATTGAGTTTCTTATTGTGACATCATTGGTATTCTCTATGTGAATTCCATCAGTA
TTGGGGCTCTGACGTGGTGCTTTTATGTAAAGCGAGTCAACATGGACACCGCGGCAACTGTCAAATCTGAAATGGAACAGTGGGCTGTTCTTGATTTTAA
GCCCTTGCACTGTCAAATTTGAGCTCATGAAAAACTTTATAGCCTGTAAAATTGAACGTACTTTACATTTTATGGAGTCTTTTGGTCTAAGGGAACAAAA
CAATGTGTTTTTGAACTTACCACAGGGCTGTCACAAGGGCCAGGTAGTGTTGTTCCATTTATCCCCTGCTGCATTGAAGTGTTTTACATTATATACAAAA
CTCAAGATCCTAAATCAAATTTGTAAAATAAATAAAAAGGGCAGTCAGTCCGGTGCACTAAAGCTCTCGCTATGTGCGGGGTTCCAGATCACAAGGGTCT
ATTGTACACAACCTTACCCTGCATTTCTGCAAGAGGCTGTAGAACCCATGACCGACCTCGTGGCCACATGACAATAACTTTACGAGTGGATCATGAAAAT
TACTTTATGTGGTTTGCACGGAAGATTCCACCATTTTTCTCCTTTACCATCTATGAGTCCACCACCTTGCATTGACATCCCATCAATTCTGTAAAAGACT
AACCATTGTTTCTTACTGACACCTTTTGGCCATGAATCAGGTCCATCTGGTGGCATAATGGTTCCTTCAACCTACACGATCAATCCTAAAATTAGTCACT
TCACACAATTATCGAACAACGTTTTAAGTACATGAAATAGTTTGTCACATTACCTTAAAAATTAGTCCACTTTTGCAAGGACCAGTGAAGATTGTGGATT
GGATCATGAAAGAATAGTGTTTTGGAACTAGTAGAATAGCTGAATCAACTTGACAAGCAGTATCCCAAGCCATCTTAAACGCTTGTGTATCGTCTATCAC
ACCATCACCAACAGCCCCATAAGACAACACATTGAAAATGCCTGCTGCATAATCATTTGATGAATTCTTCACATTCTCAGTTTTTGGATCACCCTTAGGT
TCAGGAGCAGGGGCAGGGCCAGGGCCAGGGGCAGGGGCAGGGAAAGGTGGCATTGATATTTGTGACAATGCACGAAAACGCGACACTTTGGGGTAATCAT
AAAACCTACCATGAACTGAAAAAACATAGGAAATCAAGAAAACAGAAAAAACCAAGAAGCAAAATCTAGTGAATTCCATAATTTGTGTCCAGCTAGTATA
GCTTTTTTAAACTAAAACAGAGTACTTATAGAACTTAAGGGAAGTGAAGTAACACAATTTGGCTACTTGTTTTTACTAGACCCCTCACTAATCCTATATA
GAAAACTAAAATGTCAATTCTCACTAGACTAAAAAGATCATGCTTATTTTTGTCATTATCAGTAGGTTTTTTCAGAAGTTAGAAGGATATAAGGCAAGGC
ACCCACGTTCTTGGAAGTCAAAAAAACAACAAAAATGAAGTTGTTTATGTGACCACCAACTAAAAACCAGCACTTGTAAACAAGTTGGAAAGACTATGCA
AGTAGTTTCAATTATGTTTACTTACAAGTTCTCAAAGTGAAATATTCCATTTTATACTAAATGATTCTTAGTGGAAGAATGGTTCTTTTGCATGGTCGGC
ATTATTTTAATCATATCAAAACCGCCCTATTCCATTTACACAATGGTTTTTCTGGTTGAGGATAAATAGATAGGAGGGTGTCCCTTCAACGATAAGAATT
TAACTTCTATATGTTTATGTATACTATCGAGAGGGATTACAAACTTTAAAAATTAGACGAGGTACCTTATAATAGTTTTTTTTAATAAAGTTACTGTCAG
TATATAAAAATTAAATTTGATTAAAAAACGAGAGCTATTGGGGTGGGCGGGTATGAGATAATGATAATAGTGAAATTCAAAAGAACCCCACGTTTTCATC
CCATCACGTGCCACTTACTTTGGTCCCAAAACTAGTGAGACTGCCCAATAGGCAATTCTGATGGAACATGTTATTATGGTTACTATGTATGGTTATAAAT
CTTGTCTAATAGAATGCTTCTTTTACTGTTTTTATTAGGAATAATGCAGTACAAATTTAAATTTGTCTATTTGTAATGGCCATAATAAAAGGATTGCATT
TGCATTGATGGGTAGATTTCAATTTTGTCTGCTTGATTATACTAACAGAAAAATTAATCTATCAAAATTTTCATAGATACCTAATTGATAAACTCGAACT
TGCTCTACCATGAGTGAATCTTATTTTTATATGTACTAAGAGGCACATATTAGGGAGGTAGTTTTTGTATTTAGTTCACATAGAGTGAAAGTTTAAGGTG
TTATAGTAACTATTTGCAAAAGTAACCACTAACTCAAGCTATGGGATCTTTTCTTTTTAAGTGGAATACTGAGTGCACCTAAAATATAGGTGTTTTAGAT
TGTAGCTGAATAAATAGGATTTCTTAACTCTTGATTTTCGGTGAGTTTTGAATATTAAAAAGATCTTGTCAAGGGCATCTCCCTTTGAACGAATCTTACC
ATAACCATGATATTTTTTAGTTGTCGCGCTCACTTACTATCTAAGCAAGCATGCACCTCGGACTATGGAGTATTATTCGAAGTCGTTTTCAGTTGTTTAT
CCCCGTTCAACTTGCAGGTGTCAAGGACGAATAATGTGTAACACAAACAAATTATACATTGGATAGTTAACTACAATTTGTAAAAGAAAAATATTGGGTT
AATTATTGTTGGGACTTTGTTGATTAGCTATGTAGTGTAAAAATCCCAAAGAAAATCTTAGTTTTTGTTCATCTTTTAGGACAAGGAATTTCTGGCGTCT
AAGAAAATATAGTTCCACTAGGAGTAGATAGAAACCAAACCCCACATAGGACCACTCTTTTTTGCTTCATTTTTAATTCCCATTATGTAAAATTTTATCT
TTTATAAAGTCAAAAGAAAGCATAGTTGAATGCTTATAATGAAACAAATATATTACAGAGAGCATGCTTTGATACATATTGTTTTGGAATTTTGTGCTCA
CATTACCTTATGCTTATGCATGCTTTGAATTTTCGGTACTACAAAATGGGTAGCTTTACTTTGTTGGAGCGGCGGAGATAAGTACTTGTGATTTTTTTTA
AAATCATAATGGAAACAAAATGTTTTTTTATTGGATGATAAAAGTTTGGTAGAAACTAACACTTACAATAAACCTCAACTCGAGAACATTCTTAAATTAG
ACAAGTAAATGGCTTCTTAGGCTAAATGGCAATAGTTAGGTGATTATTCTTTAAAATAATTATCATTCATTGAGTTACGGTCCGAAAATTCAAGCTGACA
TAATTTCCTTAATCGTGGACCCATAGGGACTGGAAAAATGGTTTCCATCCTACAACTTTCATATGATCTTTCATAAATACTTTCAGGTTGCTCCAAAACA
TGTAACAGTACCATTTTATTAGAATATCAAATAAATTTATATCGTCAGTTCATATAACGTAAACATCAAATAAGATTTGGGAAATGACATGGGAATTGGG
TGGGAGGCATAGGAATCAGTTCAGCAGAAGTGTTACTAAATTACTTGGGCATTCGCTGTTCATATTCCCATGGTATATGACATACTTTAAAAAGAGGGTC
TTTTCACTAATGCTAGCTGCATTTTCTGGTTTCTACAATAACTTCATTTTGGGTGGTAATTGGGCAGATTGGGTCATAATGAGTTAAAGACAACAATCGG
GTTAACATCCAACCCCAATTAGCTTGGGTTAAAAGGGTTGGGTACCAATGTCCATGCTTGCAAGATAGCTCCTATGTGTGGGACATACTGGCAAAAGTGG
GAGCTTTGAGCCATGGAAGGATAAGTATCAACATACTTTTACCTTGTCTCCAATGTCTATATTTTTCTTCGCTCTCGCTTATCTCTTCATTGTCACACTG
AAGCACAAGTTAACATATCATGTGTAGAATAGTGATCTACTCATTGTCACACTGAAGCACAAGTTAACATATCATGAACACAGCTCTGAATGTGAAAAAG
CCATTATAAAATATTGGTTGCATATCTCACATAGAAGATTTAGAATTGATCCAGAAGTGTCTCAGACCAAGGTAGATCACCTCTTCAAATGATAGATACT
TCTATGTAATTGTATCAACAATATGCACGTATAACCAAGCTACCAACGACCCAATTTTATTAAATTAAAAAGACAAAAATATAAACATGAAAACATCTTA
GGCTTAATCACAATTCACAATTTTCACAAATTAAGGCAGTGTCTCTCCTGATATGTTCATAAAATTAACAATTTGTAATCCAAACCCACTTCTCAAACTC
ATCTAATTTGTAAGCTTCAAATGATAGCCACCAAGACCACAGTCAAGCAGTAAAACTGTGGAACTACTAATCCACATCCTGCACCAAAAGTAGTTACTTA
CAGGTCCAACCACTATAACCATCCAAAATCAACATTAATTGGAATTAATGGGATCATTGGGGGAAAAGAAGGGAAAATATGAAGGTATTCCTGCCACCAC
ACTAAAATTTTCCACTCTAAATAACAGGTAGGTGAAGTTCAAATGATAAAAGGATAACCAGGTTGTAATTAAATTGAAACCAACATTTTTAAATCTTTCA
TAACTTTTAATTTCCTGTTTCTAAGTGCAAATCACTCAACTGAACTTGTAGTCATCTATTTGTTTCATAGTCAATATAGTATTTATATTTAGGGCAATCT
ACATCTTCAGTCCACCCACTCTAAAGCATATCTGACAAGAGTAGTAAATGAGGTGGCAGACCTATCCCCACTCAACAAATGGGAGAGGTGGATAACCACC
CTCAGGCGGAGGCCTTAGAGAGGGAGGCAGATTGCTCAGTGATGCTCCGGCCTTTTCTCTGAACACATCACCTGCTACAACCACACATCACAACTAGATT
TAGAAGAAAAACTACCAAGAGCATCAGCAGATTAACTGGGGAATTGGAAAAACACAACACCTGACATTTTAAGTGAAAATAGGAAGAAAATACATGCAAA
AGCAATGCTTGCCTGGAAAAGAGGCTGAACCAAAAGGTTGACTACTTGAATGGAAACCCTCTCTACTATTTTCCCCTGAGAATTGGATAAACAAAAGGAA
ATCAAAAGTTTGCATGCACTGTGTTCCTCCACAGCTATTCAAATTCATAGTTTGCATTCACTGTGTTCTTCCACAGCTATTCAAATTCATAGGATATGAT
TGACAATCAAGTATACTCCCAATTCAAGTGTATATCCATTTCAAGAATTAATACTGTACAACTTAAAAAAACTAATCAGGTCACTCAAATCTTTTAGAAT
AACTACTAGGAATGAAAACTTAAAACTACAGGACAAAGAACTTCAAAAGAGTTGGTACATAAATTTCGAGATCTTGAATGAAGAACTTGTAGCATAACAA
GATAAGTTCGTTGGCAAAATGTACACAATACTATTAACAATGTTTTTTTTAAAAAAAATAGCACAGGATACCGCTTGCACAAGTTAATTCTGCACATTGC
CAAATCCAAGAAATTCAAAAGATTGATTCCCCAGTTCTTCTTAAAGCTCTGACTTCCCAAAAGTTAGATTACTTTCCTAAGATATACCTTTGAGATTTTA
ATAACATCTGACAAAAACCAGGAGATCTTTTGGATGAGTGACAAGGACAACCATTTCATGAAGCAGCAAACAACAGAAATTATCATGGTTGTTAATATAA
GAAACAAAAATACTTTTTGAGGGCAGTAAGTTTAAATAGTTATCGTGGTGGTTAATATAGTTCAAGATTTAAGACATTAGTTGGTTGACAGTAAAATCTT
GAATATGAATATACTCAAAACATGCGAGAAAGATACCTGGAGGGAGTCCCGTTTGGTTCACAGTTTGAGGGTTTTGCTTGGGATGATAATATTTGCAGGA
GTCCCCATACTGGCAATACCCCTTTGATACATGTAAAAGATATGATCAACAACATTATCCAATAAAGGGTGTAAAACACATAGTATTTATTTAGAGTTTA
GACTTCACCATCCCCAATCCACTGTTGTTGCTCCTTCAACATTTTGTTTGTCTTGGGCAATACTTCAGGTGGATGAAGTAAAGCAACATTCACTTATGTT
CATAACTTAGTGAATAGAAGTACTATCAGTAATGTTTATCACTTATCAGCATATTACTAAACTTTTTCAACCATAATGATGTGAATCTGCTAAAATAACA
AATTAAGCTAAGCTAGCAGATTATGAAATTCACCTACGACAATTCATACCATGCTCATCAAGTTGGAGACATACAACTTAGCCGTATTCTGAGAAGATTA
TAGCCTATAGGCCTTACAAAACCTTATAAATTAAAGTAAAAGGCCTAGAAACCTCAAATTCTACTTCAAAGTATCTTAGATTGCAACAGTCTCTCTTTTT
TTTTTTGAATGGTAATTATGAAATGCATCAATTGAACTCAAAAGATGATGAATCTTCTGAATAAAAGATACAGATGATTCATATAACCAACTCGAACCAG
TCTAATATTGATTGATGAAATGCGAAAATCTGACTCATCTATCACTTTTGTTTCTTCTTCCATCAGTTGCAATAAAATGGACAACCCAAAAATGTAATAC
AACTTCTGACTCCGTGTCTCAAAATATTGCATACTAAAATACGAAGATAAGAGCAGTACCGTTCGAACAAAGTGATTGCAGACTCCTTTACCGAACGAGT
CCGGATCGTTAAATAATTGGGGATCTGTTCTCCCAGAAAAATCGTTCATCAACACTTGGAAATTAATTTACTAAGAAGAAGAAAAAGGAGAAACTTACTG
CGCAAGGAGTCGTACCAAAGAGCCTTGGCTCTTTGATGTTGAACACCTTGAAGATGACGCCTCCGAGCAGCTGCGGTATCCTGGAATTCCTTATCGCAGT
AATCGCAGTAGTATTTACCCAACGGCATTTTTTACTAAAACTAAAATCCCAATGCCTAATGGCTTTTTATATGTTTGCCTGTACAAGTTTCCAGATCTCG
TTTAGGCTCCGGTTTACACTGTTTTTTTTTAATCTCAAACTAAATTGGTGAACATGTGACTAAATTAGAAAGTTTTAAAAGTAACATGTAGCATAATCTC
ATCACGTCAATTGGCCAGCTAAATCTGGTATATGGTTTTTTCTTTTCAAAATTCTACTCTTTATCAAAAGTTTGAGAAAGAGGGAATTAAGAAGTCTCGT
CAATTTATCATGTCCATTGCAAAAAATAATGTTGTAACAATGCTTGTATTCTTCCTTGTTGCTAGCAAAAAATATTTGGCCCCATTTTGCTTGACCTCAT
TATAATGAGATTATTCTTGGCGGTCCAATTCATACCTGAAAGAATTTATAGGGATGAACCAACTGTACGATTCTTGCACTGAAATGCACATTCTTCTCCA
CATCTGCTATTTTCCCTTTTTACTGCTACAACTAATAGGCACCACGCAGTTCATTCATCGGTTCACTCGCCATATACTAGTGTGGGACAATGATTTATGT
TTTCGTAGGATTCGGAAGCCATTTGTAAGGTAACCATAAAACCATGTATTCTACAAGTAACGGAAACACTAGCGATAACAACATACCATGTAAATGTATT
AAGATTAGATAGCCAGCTCGCTGTTCTGAAAATTCTCACTGGAGACAGCACAACCCAAAGGACAGCAGTAAATCGTTTAAATACCAAGAGTCTTAGGAGC
CATATCAACAGTCACCCTATCATTAATTTGCAATCCCATAATAATAACGTTCACTCAAATTGTTAATTCTCAACCACATAATGTTACAAGCATAGGATAT
ATCGGAACAGGGTAAAAAGGAACACAGGTTGAACATCGGGTATTTGTTAAAGATCAATTCCCTACATCTGCTTTTACAAAACAAGATATAATAATAATAA
TACAAAGGGACAACAGAGACATGGTAAGATAAGGGAAAGAAGGAACAAATTGATACAGAGAAGAAACACAGCTTCAAAGGGTACACTTAAATTATTTCTA
TCACAAGGCAGGAACTCATAACCCAAGGGAAGGGCACTGTTTTCTGGCGTGCTCTGGAACCAACTTCAGTAATATCTCTGCATGCACATTCTTCAACTCT
GGTGACAAGAAACCCAGATTCAATAGATTCACTTGCAACTTACGGAAAGAAGCTAATCTGAAACAAGTCTAGTCAACAACATACCATGAGCCTTGAAGTT
AAACAAGGGAGGAAGAAAGCGTCCATTAGGCAAGCGTGTATTGGGATCACGAAGCTCGTCAAAAAATGGGTGAACCAAGGCATCCAACTGCATTCAAAAT
TAGTACACCTCTCAACTTAGAACTAGACTGAAATAATCACACCATTGACAAATCAAACTACAGCTGCATTGCTCTTCAAGAAATTCGGCGAAGCCCAAGA
CAAGGAAAAGAAAGACTGGCATGCAATGTTGAGTCAAAATTTAGATACTCTTTTACAAAATAATGGGTTCGTGTTCAACTATAAAAAGAACATCAAAATA
TGTCAAACACTGAACAGAGATACAGAAATGTGATCCCTGTATATTCTGTGATATACATAGGCGAAAGAGATTAGCTCGAATAAACAAATTCGGCATACTT
ACAGCAGCACAGCGCAAGTTAGGAGAGTACTGAAGCAGTCTTGAGACCAGATCAACTGCTTCTGGAGGCATGCGCTTATGAAATATCTGAAAATCAACAT
TAGAAATGACTTGTTGCGTTGTGTATACTAGCCAGTTCTATGAAGGGGTTGGTTACAATAAGTTGCATTTCAAGTACCTTGTGCCATGGATGAGCTTTAA
TTTGAGGAAATTTGAACTCATTATAGTTGGGATTCATACATTTAATTTCTTCCCTTGTAGGAGTGCCTAAAACCTGCAAAATGTAGTAGGAGATATAGTT
TGGGCAAAAAAAAGTAGATGTGGGCCAAACTCAAAACAAATTAAGTAACATGGCCAATCAGCAAAAGGTTGAGAATCTTCTTAGCCATATTTATCTATGA
CAATAATTGAGATGTTAATAGTACAGAAAGCTGTCTTATTACTAAAACAATAATTTTACTTTTATTTCTTTATCAAAAAACAGTGAACTCGTCTTAGTTA
CAGAATCTTCGAATCTGAAACTGTTACACAAGCAGAAAAAGGAAACGTATTACGCCAGCGCAAATTCCTTAACATTCAAACAAAGCTCCTTCAATTAATT
ATAATCTAGAATCTAAACAGTAGGATAAACTGAACTTAGCACAGAATCAAGTACACCTAAATTTACGGAACCGACCAGAGTAGAGGACAAAATCATTGGG
CATTTACAGACTATCCAGGTCAGAATCACCTGTTACTAGAATCACATTATTCTGGTCAGAAGACCAGACTCCAAAGTTTTGGTGGGATGCCTCATGTAAA
ACTATAATTGGTCAGAAAAAGCCTATCTCACCATCTCTGAGTTCTATTTGATCAACAAATCATAAGCTTGGTTTATATGGAAGTTTGGAAGAGGTGGATC
TCAGTTAATATCAAAACTTGGTCACAACAGCAGCAAAGCAATACACAAACTGAAAGCCAAGTTAATTCCTCCAATTTCCTTTTAATTTTCCCTATTACAT
CATCTTGAAAAATCTCATTGCTAAAAAATGCATAACATGATTAAAATGATAGGAATGTGCTAATACAGACACTAAAAAGAGCTATTATCTCCCCATAAGA
TACATTTGCAGAAAAAAAAATCTGAGAAAGCAGAGATCACACAAGGGTTGACCCAGAACATTGCAAGTCAAGCAGTAAATAAATCCAAAATAGAAAGGCA
GGAAAGAAGGCCTATAAAAATTACAATTGGATGCAATAAATGAAAAGAAGGAAATAAACAAAAAACGACAATGATGAAAGAAAATCACGAACAGCAGAGG
AAGGGGACAAAGGTCGAAATAAAGTTGGCAAGGAACTGCAGACAAGAAAGTCAAATAGACAAGATTACCTTAATGATCTCAACAAGCTGATCAACTCCAC
TTTCACCTGGAAATAATGGCTGAAAATGGAAGAAAGCAATCAATGAGATATTGTCAATGTAATATGGAATACTGTCCACGAATACACTAATATTAAGAGA
AAGTAACAACCTACCTGACCAAGAAGTAGCTCAGCTAGGACACAGCCAGCAGACCAAACATCTATAGCAGTAGTGTACTCTGTTGCACCAAATATGAGCT
CAGGTGCTCGATAATACCTAGAACAGATGTAAGAAATATTTGGTTCTCCTTTAACCTGTCAAAAATTGGAGCAGATTATCCAATCAGAAAGAATGTTAAC
ACATATGTAAGGAAGGACAAGAGGCTAAAAATGTTAACACATATGTTAGGAAGGACAAGAGGCTAAGAAAAAATGTGAACACACCAGAACTTTGGCACTC
CCAAAATCGCATAATTTAACCTGGTGGGTATGTGGATTCACCTGCCAAAAAAGTACCATGCCATGGATTTTTAGTATCCAGAGAGAAATGAGAAATGCAA
ATGGAAAGAACAAGTAGTTCTTAATAGCACTTGCTAACATGTTCAACAGTCATAAGCCAGGAGAGTAGAGCAAAATAAATAGAACTGTTTCCTTCAAATT
GGGAAGAAATTTGCATCACTATGCACACTAAAATTGCAAATACATTGGTTCTCCTTTTATATTTTGGGTCGCATCAAGTACTTCTTCTTTCATCCTTTCT
AATATTCTTTAGGTTCCAGTCCCTTCAGGAGCCAATAAAGAGATAATATAAAGACAATTGCTAGCAAGTTAAAAAAATTGAAATATATCAATAAAGCAGA
ATAAATTGCCTGCTTAGGTTAAGGTCATAGCAAGTTCACCAACTATGTCAATATCAGTCTCTCATATAACTATCTTTGTACTAAAATCCATTACTCAATC
GGAAGAAATGATGTCAACCGAGCGTGATGAAAGCTCACATCAGCGCAGCAAAACATATTTTCACAACAGAGCGTCCACAGACAAAATAAGACACAGAAAA
GTGAGTTCATGGTGGATGCGAAGTTACATTCCCATCTCTCCTTACATGCAGTACATCAATCTAGTTACATCCTTCTATTTCTCTGAGGAGATCAGTAGCT
TAACGCATTTCCAAAATGCATGATTGATAACATTATAAGAAGAGTAATGAGCACATGAGGAAAGAATTTTTTCTCTCAATGAAGGAATCAACCATATTGC
ATTATTCTACTCCATACATCAAATCATTGACAAACTTAAAACATATCTTCGGTACATTTTTCCATACATTTGGAGCAGATGTTCACATCATATCTATTAT
AATGAAAATAAAGCAAAACAGTTACCGGCAAAGCGGCAACAACAAAAAGCTGAAAGGAAATAAACAGCAAAGCAGTGGAGTAGATAACTATACCAAAAGA
TTCTGAGGTTTAATGTCCCTGTGGCACACTCCAATAGTGCGGTGTATGTAAGACAATGCCCTGAAAATCTGCCAGACAGAAACAGCATATTGTACTTTAG
GCATGTTACACAATAGAACAACCTCAAGAAAATCATTAGCTATCGAAGTGCATTAAAAACAAGGTAATTGAAGTGAAACTAGTTTCTCATAATAAAAACC
AGTCTGGCGGACTTTCCAAGGTTGGCCCATCGTAAGAACAAACAAAAGAACTAGAAAAATACTGGAACAATTTTAGCAACAATCTCTTGTCCAACATCTC
ACATATATGAAATATAGGAAAACAATCACTTGTACAACAGGATTTGCAGAGGTCTCACACATTGGGAGTTCTTAACAAAGAGGAACTATATAAATGACAA
CTCACTTTAAAAAAGTGTATTCTACCTGATATGTATAAAGCTTCACAAGTATCAACGGCATCCTTTGATTCAGCTTATTGTAGTGTTTGATAACACGGTG
AACGGTTTCAGGTACATACTCAAGAACCAAGTTAAGATACAGTTCATCCTTGTCAGTTGTGGAAAAGAAGCAGTGTTTGAGAGACACAACATTAGGGTGG
TCAAGAAGGCGCATTGTCTGCAATTCTCGGTTCTTATATCTTTTATCTTGAAGAACCTTTTTAATAGCAACAGTTTCACCAGTCTCTAAGCATTTTGCCT
GCGGAACCAAATAAGAAAATCATAAAATTATGCACATATAACTTCCTATGGGTGTATGAAGGGTATATTGATAAGCATAAATAGACAATGGCACCTGTAA
TGAACAAAATAAAATAATATACCTGAAACACCACCCCAAAGGATCCTTGTCCAACAACACGTTCAGCCATGTAACTAATAGTCTGCAATAAAAACCAAGT
GAAATTGTGCAACAATTTGGCCAATAATAAGAACATATGTCTATTATATAATCATTTTACTTGTCTACCCTTAATCAACTGATGAAGAGAAAACTCTGGA
ACCATATCAAGAAACCAACAGAACAAAAAAGGAATTAAAATGGAAGAGAGTGACAGAGCACATTACCTGCTTTGGCTGGCCATTTCTACCACCAATAGTT
GTCACTATTATGTGGCCTGTCTCAGTCCCATTACCGTCAACAATTGCTGCTTCCATTTCCTACAAATGAACAGTTTAAATCTGATGAACAAACTTGAAAA
GGACAACGAAATCACCACAAAAAAGGAGGATCCAATAAAATAAGGACAAATAGCAAAAAGGCTATGCTCTTCAATATTCAGACCTTATCATCCCTGATTC
TCATGTCATTCATCTCCTCAGGCAACCTATCTACCCCAGCATTATGGCCACTGGATTCTCTCAAACCCGATGTAGGTGCTAAGCCCACGGAAGCCATTTC
CAAGAAAAGTCTGCTTACTAGTTATCACCACAAAAGGTCATTCACCTGACCAACATAAAAAAAAATGGGAACATCAGCATGATCACACACATCATATCAT
ATCATAGTACTTACAGAAATAATTATGGGAAAAACATCCAATAAAAAGTTGGATTGAATGACATCCATATATCTCTAGTCATGACTGTACATTGAAACAA
CTCTAGACAAATGAAATTATGCACTCAAACACAAGATAACCCTGCTAACTTAATGTGTTTCCAATTGATTGTCCAGGAAAGTTCTTTAAAAAGTTTAGCT
GATTGTCCAGATTGGAAATCTTCCGAATCTAGCTTTTTAGTTAAGCTAATTGCAATTTATCTCGCCTCATTCCCCATCGTTCCATCGTAAAGTAGGGAAT
TTAAAATTCAAGATCAAGAACAAGCTTGCCTACTTTTCTCATACACGCAGCAGCTCGTCGCGCAACAGAAAAGAATGTTGAAATATCAGCACAAGATTAA
ATCAAATCTCATGAGACGAAAAAAAGTAGTTTCAACCAAAGAAACATTTATTTTACAGCACAAACAGTTGATACATATGCGACCTCAGCTCATACAATTG
TCCCAACACAATAAAAAATACAACCGCAGAGATAACTCCGATTTGAAAATAAGGCACCACACCAAAATCCAACAATTATTTCTCCAAAAACAACAAAGAA
AATCCTAAGCATCCACATAAAAATAAACACAGATTTGAGAATTAATTAAGTCAAAATTATCTTCCCGTTCATGAAAAAAAATCGAAAAAGCAAGGGCAGC
TGTGCAAATATTATCAGGTATTCAACAAATAAATAAATACAGAAAATAAAGAACAAGAAAATCACAGAATTTATAAAAATACCAATTCCAAAAAACGGCT
TCAAAATAGGTAAATAAATAACACAACCAGTTTTAACAATTAATTTATAAAATCACAAAAACGAATTACCAAAATCTACAAGAAGATCTAAACGGATCCA
TAAGTAACCCGATCCATATGAATTTAAACGAAAAAGTAGAACACGGATCTACAACGCAGAATATCAGAGCTAAACTTTGCAAGAACAACAAGGATATACA
TATATATATATATATATATAAATGAAGAAAAATATGGATACCGAAAGAATCAAAATGTTGAGGAGACGGAGAAAAACACCGATCACCGGCGGTCCTCCGA
TAAAAATTGTGGCGGAGATGATACCATCACCATGAGAGAGAAAAAGAGATACAAAGAGAGAAAGAAGAACCTGATATTGATTGAGAGAGAGAAAGAGAGA
GGGATGTACTTATATTTTGCTTTTTCTCTATTTATTTTGTCAATTCTATTAATTCTTTTACATTTTTGTTCACAAGTTTTTTGGGTTGGTAAATGCGCGA
GTGTGATAGTCAAAGCACAACCAATTTTAAATACATTTTCATCGTCTAATCCCCTCACGAATTTTATTAGCCACAAGGTTAATTAAAAAAATAACATATT
TTATTTAAAATAAAGACAAATAAATAAGTTCAAACAATTAATTTTACTTCATTGCGAAAAGTTTGACCTGATAAAGAATTATATTATCAGCATATATATA
TATATATATATAACATATACCTTTGGGAATATCGACAAAATTTAAAGAAAAAAGATATTTGAAAATTTACTACTTATTTATTAAATTTCAAACAAAAATA
AATTTTAGTGTGTCATAATTTAAAAACTTTAATAAAAATAGGGATAAATATATTAGTGACTTCAAAACAATATGGCACGTCCCACAAAAATTGTCACATG
ATTTGAACAGAGAGAGAAACTATTATTTTAAAATTAAAGTAGCTGTTTTTATTTTATAAAAAATGTCATTTTACTTGTATTTTGACTAGGATATTAAAGT
TGGTATGATATACGAATTTCTAGACATTTCAGTTTGTATTTTTTTGTGGTCAATTTCTTTAAAATGTTACATCAAATATCATACGTAACGCATGATTTTT
CTCCGATTTTGAATTATTCCGTATGGTAGAGAATGATTAAAAAAATTAATCTTTGAGGAGTAAAAGAATATTTGAATAAATACTAGTAATTTAATCAAAT
ATTTTTATATTTTAATTTTTAGAAGAGTATTAGAGCAATTTATAAGTAAAGCCTTATAGTATAAAATATTAACTTTGACTCAATAAAGATAAAAAAATAT
TTTTAACAGACCTTGACAAAATAAATCACAAAAATAGATAGCAATAAAAGAAATATAAATAATAATAGCAAGAAAAAAATAACAACATAAAATCAGAACA
AATTAAAATAGAAAATTTTAAGATAAAGACAAAGAAGAAAAATATTAGTACATTAAGAATGGGAAATAACATGTATAAACAACTCCAACCTTCCTATCAA
GCATCATGACTTTAATGACGAAAAATTATATTTATCTTACAAAATTCTTTCATTTTAATATTTCTTCGCGCTATTTATATCTTACCACCCCCACCCTAAG
GCCCTAATTGTCAAGCTTTCACACTTCATAACTGTAGTATTTCTACATCTCATATTTTACTTGTCTGAAACATCTTAATTCCACATGTTATTATCTAAGG
CGGCACTTTATAACTCCATTTTTAATCTCTTATTTCCTTGACATCCACACATTCACCTCAAACACGTTTATCCTTATCATTTTCAACTTTTGAATATGAA
AATTTTTGAATGGCCAACATTTCGCTCACAAAGCAAGATCACTCTATAAAAATTATTCTCAAAATAGATTGCTTGCATTTATCATATATAATTTTAGATT
ATTGAAATTTTTACTTCATCTATCCTGCTTCAATACAATGAGTGACGTCTCTATTAATTTTCATAATATTTTTAATACATACCCTAATTATTATTTTTTT
CGATTTGAATATTAAGGATATTGCAAATTATGCATACCCCTAATTATGACCGTTCGAAGCCATTTTTAGAAGAAAAGGGAATTCATTGAGTGTTCATTTA
TTTTTAATTTAAAGAAAAGAAAGGCGCAATGATTTGAGCGACAGTGTCCTTAGCAGCTTTGGACAACACCTTAGTTGTTATGGAAGCGCACCTCATGCTT
AAGGGAAAAGGCCAACACGAAGGAGACATCTCTTGTATGCACTATGAACTAGTATTTAATTACTAATTTTATGGAGATGACTATCGATATAGATATAATT
TATATTTTATTTGTATTTATATTTTTTAATTTTAAATATTTATAAATAGATATTTAGTATGTAAAAAATTGAACAACCAGACACACACATTCTATAGTGG
TATTTACATGGCAATTTACGTCTTATATGGTATTCAATGTGCATTATGCTATGTTCGGAGCTATGTGTCTACTTATTCAATTTTGTACAAATTTAAGTGT
CTATTACTACATACTCAAAGTCAAAATGTATAAATATGAAATGAGGTCAAATTAAATAATATATTTATGTATTATATTGCATTAATTAGGAGGCATATCG
AGAATATTATTAGTAAAAATATATTCTCTTTAACATTTTAAACTTTTAGATAAAGTGATACATATTTCATTAATTTTAAAATCAAACCTAATATTTTTTA
TTTATTATTAAGATCTCATTTAAGAGAAGCACTTCGATTAAAAAATATATGATATCTATGGGGTTAACTACATACTTCCATCATGAAATTAGTTTGTCTT
TTTTTTTTTCAATTAAGCTAAACTTAACTCTTATTTGATCTTTTTATTTTTAATGGTCTAAAACTACTTCTTTTCTTTTTGCAATATGATTTACATGATA
TCATGTTCGAAAATTAATAATAGGGATTTAAGTGATTGGAACGAAAATATTTTGTTAACATGTGTCATATCATTAATAATATTTAGGACTCGTTGATTTC
ATAAAAGAAATATTTTCTCTAAAAAAATTATTTAAAAATTAGTGTTTGAAAAATATCAATTCAACTAAAAAATCACAAAATTTTCACAGGGATCCAATGA
TTTTATATATTTTAATTATCACACTACTTAGTTATCATAATTGAATTTATTTTCATTATATTTGGTTATGGATATGTTTGTTATTTTTCTTTCTACTTCA
ATATGTTAACTATTTTTTCTAAATCAAGTCTTTCGAAATTATCTTTATACCTCTTTATGTACAAATAAAACATTTTCTCTATCCGCTTTTATTTGTCATG
CTTTTCGAAAGTCAATTTGACGAAAAAAAATTAAATGTTCAAAAACTATAGTAAAATATTATAAAACTGTAAATTTTTGCATATCAATAGAAATAAAAAT
ATAATCGTAAAATATTAATCAAAATTCTTATAATTTGACTCTAAAAGAAGAAAACTATGACAATTAATTATAAACGGAGGAACCAATATATATGTACCCT
CCTACTATCCTCCTACTCCACTAATGATTTTCACTCTTATGTTATTGTTAGTTCCAACGATTTTATACGGAATTATAGTTTGATTAACTTAATTATATCA
CTATCATTAACTTAGCATTCTCATTTATTGTGATGTGTTCATTGGATTAAGTAAAACTTTGGGGAAAGTCGCCACTTTTAATCACTTTGTTGACCTTTTA
GTAATTGGTGAGAAAATAGGCTTCATTCATTTCCCAAGATCATCTATCTCTAAACTAAAATTAATTTTATTAATAATATTTTATTTTAGGAAAAATTAAA
TATCGAAGGATAGTGTATTTTCTTTTAAGTAAAACAGAATGTACTACTATTAAATTCCTTAATTTTTAAGGTATTAATTTGGTCGTACACACTAAATTTG
AGAAGACTACCTAACTACTCACTTAAATAACAACTTCATTTATGAACAATAAATGAACGCGTATTAGTCTTTTTCTTTTTCTTCTGCACCAAAGACAAAA
GATAGTGTTCAGTTGAATAATATTTTTCGAAAAATTTAATCAACTAAATATAAATATAAAAAATATTTTTATCTGATCGAACACATTTCCAACCAGTCAG
CAGTCACCAAAGTATATATTTTTATTTCTTTTTCATTCCCTTGTTTTTTTAAAAATAATAATAACAATAATGTGCAAAATCGTTTAATTTAAAAGGTAGA
CGAAATTCACACGTAATTTATACAATAAATACCTATATGCAAACGTTGCTTAAATATCTTATCTCATCAAAACTATATAAATGTAAATAGTTTGAATAAT
GACATCGCCTTGTGTGTCTAATGGCGTTAAGTGTTTTTTCATGATGTTAATTTTACCAAGATTTTCACTGAATAAGAATTAACGGAAAAGGGTTTAAAAA
AAGCATCAAATCACAGAAAATGAATAAAATATTATTTATTTATAATCTGATTCAAAAATATTTTTGTCATCAATATTTTAGTTCAATAATGTCTTTACCG
TCAATATTTTGATCCAGAAATACCATACGATTAATAAATGGGTCAAAAATGCTTTTTTCCCTGAATAAATATATTTCTTTTTTTTAAAGACAACTTCTTC
CAAATTAAAATATTATTAAACAATCATATTCTTGTTTTCTTTTTTTAAAATTCACTTTAATATATAAAAATGTAGACATCTCACTTTATCGATTTAAAAT
AAAATAACCTCATGTACCCTTTCAACGGATAACATACCTCATATCATATATAAGATCATAGTAAATCCATCATCAACTAATTTTACGTAACGATAAAAAA
TAATTATAATAAAATAAAATTCTTTTTATTTTTATATGAATTGAAATAGGATAAACGTTTCTAAGTTTATAAATAATCCTTAGAAAAAATGTGTTAAAAA
ATAAATAACAAATTTATTGGAAAGATGGGATTCTTTACTCATTAAATAACAATAAAGATATTTTTGATCAAAGTATTGACAACAAAGATTTTTTTATTCA
TATTTTTTATCCTTTTCCGAAGAATTAATGAGGTTCACATTTTATTGAGAAGTTTTGTCTCTTTAATCGTTTGTATCATAATTTGATTTTGTTAAAATTC
ACACAAATTAGGCAGAAACTACCACTCCCTTCGTCCGCAATTATTTGACAGATATGCTAAAAATAGATATTTAAGACTAATTGTCAATTTAAATAATCAA
AAAATAATTAGTCATGTTTTTCCAAATTTGCTCTTAATTATAGTGTAATTCAATTCAAAAGTTAGATACACCAGTTAGATACAATTTTGATATTCTTGAT
ATATTAGAGTTATATTAATCAAATTATACTTTGCTTGAAGTAACACTATTTACTATCAAAGCAAATATATTTGACCAATCCTAAAAAGATAAAACTTTGC
GAAACCCTTTTGTTAAATTCCGCACTAAATCAAATTACAACAAAAAGAGTAAATAAATACTGACTAGTGAATAATGATAAAGGGTCGATTTATGATTATA
CACAGAAACAGTAAGAATGTGACAGATGTATCATATGTGGACTTAAGAATAGTAAGTAACAAATTGTTCTCCAATCTCCATGTATTAAAAACAGCACTTG
TCTAAATAATTTCACGAATTTTAATATACTAAATGTATATTTATATTCTAATCAAAACAGTGCTTAGCTGTCTTGTCTGAATTATCCACGTTCAAAAAAT
GATTACACAGTCAAAATCTGTATATTATTATAATGAATCAACAATTATAGATATGTCAACTGGTCCACTTTGTCATGCCATTAACCAATTCAGCCTACTT
TGGTTCATGATATAAGATGATCACATATCTTATAAATTATAATTAAATTTACAATCTATTTGATTGAAAATACTGCCAAACTCTAAAGTGAACAACTGCA
AACAAATATTTCTGTTAATCAAAATGTGTTCGATATGCAGGGAAAACATTTCCCCCCAATTTATGTCTATTCATCAATTGATCACATGTTTTGAAAAAAA
AAAGAAGTTAAATTTCTTCTAAAAATTAAAGAATATAAGCAAGAACAAGTTCCAACACACCTCATCTTCACTCCCACACCTCCTCCCTTATATATTTTTT
GCTTATCTGCGGAACACAAGATAGACTCAAACAGGGCACAAATTGAGGTGAACAGACTTATTTTCCTTTCATACCGAACAAACCCTATATCTCCTATCAG
TAAAACCTTTCCCTTTACTTTCACTCTCTCCTTCCTAACATTGTGCTTATTTAAAGGATTCAGCATGTATGTTAGATTAACTTAAAAGCAGATCAAATCA
ACTTAAAATACTCAAGGCATCAATGGGAAGAGATTCCAAGTACCCTTATAGACATCAAACGGAAAAAATATCAGTCTCACTCGACTCTTATAGAAGGTTT
AGAAAGAAAATCAATCACCTTAGATGAGCACTATAAGAGTTGTCATTCTAAAAAGCTCCAATCCCTTCAACAAAATAGCATGGATACTTTGTCTAATTCA
CCATAGCCATAGAAATACCTCATGTTTGGTAATGTAGCTAAGCAGTGTTTGCAATGCGGCTCCACTACTAACAGAAGACAAGTAAGAGTTGAGAAGGAGA
CCAGAGACAGGTATATTCACAAAGCATGTGTGGACTCAAAAATGCTAACATGCAGACTACTGATATTGGGGACAGATGGGAGCAACATTTACAGTGGTCG
ATCAAGAGTGCAAAAGGAAAAACTCAGGTGGCACAAACTTACAGAATGGCACAGTTCATGCCTCAACGCTTCAAAGAGATCAGAGAATATTTGGAGACAA
ACAGTTCTTGGATTTAAAACACAGAAAAATAATAGTTCTATTTTAAAGTTATATTCACACCTCACAGAACACATCTGAGGATTTTTACATGACTGCACAA
GTAGGTAAAAATGATTGACCAAATCTTCACACACTAAAGAAGTGGAATCACAGTTTCCATATCACTAGTCTCCAAGATAGAGGGATCACAGCAGTAAACA
TGATATCAAACCTTGCCAAACTAAACAATGTTTCAACAAGAGGATATAATGACAGGACGAAGATATGTTGCTGGTGGAAAGGTGGCAAAATCAACTCCTA
TCAGGATTAGAGGACTTGCTGTAAATTGTATTAAACAACAGCTCTGTGCAGTTCCTGTTACACAGAAGAACTCATTAAAGCTTGTAAATTTTGCAGCTAA
TAATTGAACTAGTCATGCAATAAGCAGAGGGGTTGTATTCTGATCAATTATTTTCACGACAATACAATGAAATGACAACAAAACTAGTAACCTCCACACT
TCCAATCAAAGCAAAACATATTTGCTACTATATCCTAAACCAATGACCTAATTCTATGATGACTACTTAAGCATTTAGAATTTTCCAATACAAATTCAGA
CATCAATTTCTTAAGTTAGAGTAATAAATCTTGTGCATATAAAGACTTCATAGGATACTACAAATCACAAGTTAAAAAGTAAACTGCCATGGTTAAAAAA
ACTAATTTACTCCACATAGACGATAGCTGTCATAATTTTTTTAAAAAAGCCAGAGGGAAATGGAGTAAATACTTACTTTACATTTTTCACTTATCATCAA
TCATCAGTGTCTTGACAACATAGCAAATTCTATAACATAAGCAGATATGAAGAGAAGTTGCAACAAACATATATAATTTTGCGGTATGTGCACACTTTCA
AGTCTACTTTCACAACCTCTTTCTACCATGAAGGTTTATAGGAGAGGGTCCACAACAGCTATTTCATGTCAAACTAGCCTCCACTTTGCATTGAGAACTG
AGGCACTCGACCTAGTGGAATGATCAGATCTTTCATGATCTCATATTCCGCTGCGCTTATCTGAGCACCATCAAGCACCTGTTTAGCCAAAGTCAACAAA
AGGAGATCTCAGTCCACCTGGCTTCTTTGAGTCAAAAAACTATTAATGTCTTATGCAGGAAAACTAGGGGAAAATGGAAAGAAGATACGTTAGTGCATTA
ATGTACTAGAAAAACCCCATTATAGATGAATTTTAGGTTACGTCCCGATATGATAAATAGTCATATCTTCTATCTTAACAACGTCCCGATATGATAAATA
GTCATATCTTCTATCTTAACAACGTAGGCAAACACTCCATCCACTACTATATAAAAATATATCCAGCAGTATCAAAGGGAATATTTTGAAATACTCACTA
ATCTTCTCTTACTTTACTTCAATGAATCTAAACACATTATACTGTTAATTCACTCGATTTTCACATAAAGACATTTGTCAACCATGTATGCTCGAGTACA
ACTATTATCCTGCATACTAGTTATTCTGTGGAAGGGTAGCAAATGAAATCAGGTTCTCTTGATTTTCAACAAAAACATTTCGAACTATGTTAGCTCACAT
ATAATTACTAGTACTGCATGCATGCTTGTTAGCAAATCTGTGAAAGGTTGGTAAAGTGATATTCAAGTGGAGTTAAAAAAATTGGACAGCTTGCTCGTTA
AGCTTATAGCATTCAACCGAGCCTCGAGAGCTGCCATATACCTCATGAAAATTCCGCAAAACCAAGTTCAACTATAAGCGGAACATTGGAGGTTATTACC
GCACCTCCCTAATAATCTGTCAGTTTTCAGCTTGATGAACAAGAACAGCTAAGCTAGAACAACTATAACACACTGAACTTCTCAGTAAAAGCCAGCCACA
AGACAACTTCACAACTTTCTATTTTACCGTTGACAACAATACAACTTCAATGCGGACTCATCAAACAACTTTGTTCGCTACCCGAAGGAAGGAATACACT
TCTGTTTGCCAGCTATACTGTTATTAGCGTAGTCTTGGTAATGTTTTCTGGCAAGCAGGAGGGTACAAAACAGCATGTGTACCATGTAATTAGATCTTCT
TTTCCCTACCTACAGGTGGCCATTTTGAAACTGCTGTTATTATATGCCTTCCACTAAAAATACATAACCATTTCATTTTCTTCCAGTATAAGTAATCGGT
TATATTTGACTATAAACACATGTAATGGAATTTAAAAGTTCATCCTACCCAAGCTCTACATTTTTGCATCAAATCTCCTGCATCTTCTTGGAATTTCAAT
AGTACATCCCATCTCCCATAATGGTTTCATTTAAGAGGAGGAGTAAATTGCATACCAAAGAACAAGAAAGAAGGTGGTCAAGGTGAGTCTCCCTGTTGCC
TAGCAAACTTGAGAGTAATAAGTAAAACAAGGAAAAAACAATTTATCAAAAAAAGAGGACTTCATCAAAATAAGTTCAACAGCACATGGTCTGAAACTTG
GCGGAAACTGAGCCTGCCCATATAATCTTCTCCACTTAAATATCGAACTACAAGGTTGAAACTCACACATCTCGCGTTGTACTCTTATCACTAGACCGAG
CCCCGAGGCTTAAAAACAAAGATGATCGCCTCCCAGAAGAAGCAACAGGGGAAATGATTGGAATATGTTTTGGAACTGTAGTTTTCCAGAAGATGGGACA
AACAAAAACTCCAAAGAACAGTTAGGACACAATCACACTCTAAGGAACATGTTTCAATTCTTTTTTTTGGAAACAATATAGTCAACATCTAAAAAACAGT
TGATCCTTTCTAAGTAACATGAAGCAAGAACTGAAAAAGTAATGTCTATCACATATATAGGTCTAGTGCCCTAATAAATTGCATTTACCAAATATTCAAG
CTCGAGTTAGTGAAAAATGCTGCCATCAAAATATAGGCATCTATGTCCAATATAATTCTGGAAGGTGGCAAATCTTAGTGAAGATTTAAAAGGACTAACT
AGACCTGGGGAGGGGATGGAAGGGATTCCTGAGAACAAATGTTAAAGAGTGAGATAGAGGAAAGAAAATTGCATGAGAACATAGAAGTTTATGATCACAA
AATTCTACCTTTGGAAACGAAGTCCTTCGCCCCGTCATATATGGAGTCAGTGTGGGTATCCTACATACAGAAAGAGCATCAAGAAACAGAAGTACAATAA
GTTGCCATTGCTTCATTCGGAATGCAGGGAGTGGATCCACAAAAGACATTGTATTTAAGAGGAGAACCTGCACATGTCAAACAAAGAAGAGTCATCCTCA
CAGATGATTATTACTGATTAGTCATGACATGCAATGATATCCTTAAACCAAAAACACCCTCGTCTACCTAACTACACCATCACAAGCCAACACACCCATG
GAAAAGTCTCAGTGGATGGTTCTAAGCACATCAAAGAACCTCCTCTAGATTTTGGAAATGCACACAAACCTCACTTAAAAGTATAATGGAGCCAATGAGG
ATAATATATCATACAAACTCATTTCTTCTCTTAACTTAAGAATAAGTAAAAACAATGAAAAATGACATATGGTAGAAAACCGTGAGCAACTTCCAGAGTC
ATAGAAAACAAAATGTCATCCCATCACCTCCCCCAGCCAACTATACAGCACTTGGCAGAATCATTCCATCAAAATTATAGGTGGTGTACTTGTATTGATT
TCCTCCCCAACCCCCATGACAAAATGTCGATTGTTTGAGGCTGAGTGAAAAGAGAGAACCCTAAATTTGGACTTTCGGGTAGTTTAGACAATCCTTTACA
AGCCTCTTGTATTTTGCAACTTCATGCAATGCACAGTACTGGCAACATTTAATAGCATATTTAAAGTTATCTCCTACTGGGAAATGAAATCCTAAACCAA
AACAAAACCATGAGACTAAAATTGCTTCCAAATACAACATAAAAACAAAAGAAATTAAAATTGATTCTAGCTGCACAAAAAAAGGCAACCACTTAATGTC
TCCTGACAGCATTCAGAAGTCATTGACTTGACAACTTCCACTGTTATCCTAAAAGAGCTTTGACAAGGGGAAGGTAATATCTTAAAATGTAATCATACCA
TTCCTTGCTCTAAAGTTGATATCGGTACAGGCAGCCTAAGGTCAGCAACCAATCCCGGCAATGCTCGAGCAAGACAGCCAGCTAGAGTCTGCTTAATCTC
AGTTGACCGGCCATCAGATAACACAATTTTGCGAGGATATTCTCTTCCATTGATAGACAAATACTCCTCGTTATTGCTTTCATCATGCCCATATATAAAT
GCCAAGGACGATGATGATATCCATGTGAAGAGGGAATTAAACATTGTTCCGAAAGGTGACAGCTGAAGAAAATTACACACACAACCAAAAAAAAGGTTAA
GAAAGGAAAAAAGGATGGGTGGGTGGGGGTGGGGGTGGGGGGATATGAAGAGAGAACAAGAATATTAATCAGTGGTAGCAAGTTCCAAGAGTGTAAAAGG
TTTGAGGAGCAACTTACAGTCATATTGAACCCCTCAGGTGGACTATCATACCAAGAGTCCTCTGATTCAAAGACATCATAATTTGGCATCCCTGGTTTTC
TTGGCCATTTTAAAGGAGCTGTTTCTAAATCAAGCATCTCATCAGTCTCCTGAAGTATTGCTTCATCCACTTCTTGTGAAGGTGGCAATATTACAATCCC
GGCTTTGGACACTAAATATCACATGCAACAGAACTCAAAAGCAATTAGATGCAAAGAGAGTATGACTTGCAAATCTCCTAATAAGGAGGATCAATGAAAA
TGTCATACCAGCATCAGGAACATCAGAACCTGAGGCAACAGCCTCTGCTGCTTGGCTTAGTGCTGCTGCACAGGCTTCTGCAGATTCAAACCGATATGAA
TCATCATTCTCTTCCATATCAGTAGAGGCTGATCCCCCATAAGCTTGACTCTCATATTCTGATATTTTGGATGAGCTCTCTGTTTTCTTGCCAATGCCAC
CATCGATACTTTCATCAGCCCAAGTGACTGACCGAGACATTTTTTTGGAATTTGAAGATTTTAAAGAAGATTTGAGCTTATCATGTTCACCATGTGATGC
ATATTTCCTTCCGTCATCAGACATAATTAGGACACTTTTGTTCTTGACATCATGTTGGGAAGGACCAGAAGACACTTCTCCAGAATTAAATTTGTCCACC
TTCAAAAATCTAGTGTTCTTATCCGATTTTTCTGTTTCTTCTCCAGAACGCAACTGCAAGGCATCAACTTGCTTCCCCAGTATATAAACATCATCATCCC
TAACTTTGTACCTCGTCTTCGCTTGGGTTTCTTTGAACTTTACATTCGAGTCAGCATTTACAGGAGCTGGGAACTTTGAAACGCTATATTCATCTTGAGT
TATTATAGTGCTCGAAAAATCAAACTCATTAAGTATCATGTTTTTCTCATCTTGGAGTCTGGCATGCTTATTCTTGGATCCTGCAAAATTACCAGTATTT
GTCATTATCAACAAGTGCATAAATTTAGATTAGCTAGAATAAGAAGTCCACTATATTCTAAAGTTTCAAATGAAGCGACTCCACCAAGCATAAGCTCGAA
AAGCATTCTCCTATCAACTACAGATACCTGTTTAGATCATTGAAATCCTCGTACCTTTGTTAATGTTTTTCAACAGTGCTGGATTCACACTTCGATCTCT
CTGTGGAACATAGCCTTCAATTGCATTAGATGGACCCATCCACTCTTCTAATGAAACTTCACCACCCTTTAAATCCACTTTTTCCTGGATCTTCAACTTA
GAAGATCCTCGATCTCCATTTTCCTTCACATCATCTAAGGAATGCAAATGCAACCCCTTAAATAGATTCAGGACTTGATTAAGCTTTGCTGGATTCAGTG
TAGAGCTTCTCTCATCCTGCAAGCTACCAGCAAATGCTCCGCTATTGACTACACAATTTGTTGAACAGTACATGTATGTTTCATGAAGATCATAAACTTT
ATGCTCCTTCAATGATATTCTGTAATGTCCTTTCCGAGACCTTTCAGAAGGCAGAGAATTGCTGCAAAGAGGATAACCACACATGTTGGCAATTGATCGT
TCGGTCACTACATCCTGATAATCACTCCGAGACAACAGAGATCCAGCAGCAATGAGTTGGCTTTCATCTTTGATGCCTTCAAGAAGACAGAGTTGTAATT
TGTGGACAGCATCTTTAACAGCGACGGCTTCTCCTTTTGCCATTAGAGAACTCGTCCGAAGTACTGATGACAAATAGAATTTATTACAATAAGTTAATAA
AGTACATGATATGAGATAGGTATTAGATATCAAAAATAAATCTCACTCATTCTGCATGTTATTCACCATGGATATCATAAGCATACAAAAGAACATCTAA
TATACCATATGAGATCTTACACCAATAAATGTTACTCCCTCGTACCAATTTATGTGGCAGATCCAGTAAGAATGTTATACGCAAGCACATTCCGATTACA
GTGCCTTACACAAAGTCTCTTGATATTAAGTTTTGCTAGGACTAGAACACTTATGTTTGCTCTGTTCATGATCATCGCAACAAAATCAAGACGTGATGGT
AAAGGGAGAAGTGAAGTGTAATGATGTAAAGGTTAATATTTCACAAAACAGGGAGTACAAATTAATGCGATCACAAATAACAAATGACGGAACCAAGCAA
TTCCAAGCGGCATACGATCAAACATGCTACCTGCAGACATCAGCATAACTACCTAATACTAAAAAGTATAGTCCATATATAGTTATGTGAAGTTCCATTG
CCCTAATCGTGGAACTTCACGTGTGCAATTGAAGGGGAAGAATGAGTTGACTAAAGGAAAATTCATCTTAACAATGATTAATAAAATTACTTAAACCCCA
CTCTAGCCTTAGGGCCAATTCATCAGCTATCAGAAAAAGGGTTATTTGTCCTTCTAATGTCGATAATAAATTATTTTTGTTCTCCATTATGCTTTTTCAA
CAAATATATCCTTATAATCATATTTTAAAATTATATTTAGCCCCACCCATAAAGCTGAGTTATATTCAATCATCACCCATTTCAAGTTTCAAAAGTCACT
GTACCATACTATTATTGGACGAAAAAACCAACTTCATTGACTAAAAACCCCAACTCTGGAAGGAAAAAAGGAATGACAGGTCATAAAAGTAATTAGCAAT
TTAATCCAATCAATTCAAGAAGTGACGACAATGAAACTAGAACGAAGAGGTTGGACCTGCAATCTATTCTGGCTTGTGTGCGGCGCGCTAAGCAGCATGA
AAGGTTTTTTTTGTCTATGTGAGTATATAGTGGAGGCTAGATCACTCCGCAACCCTACGTCTTTATCAAGGTTCTGAATAACAGCGAAAAGAAAAGGAAA
AAGGAAACTTGGTCTGGGTTCTTTTCAATCAAAATTTTAAGGCTATCAATCATTCGTCGATATTAAGTTTTGCTGGGAGTAGAACACCGATGTTTGTTCA
TCATCATTGCAACAAATTCAAGAATGTGAATATAAAGGGAAAAGTGAAGAGTACTCAAAATAGGAATACCAATAAATACAAACACAAATAACAAATGAAT
GAACGAAGAATTTGCAAGCGGCATATTATCAAACATGTTACGTGCATGACTACCTAATACTAAAAAGTGAAGTCCATGTATTTTTATGTGAAGTTCCATT
GCCTTCACTCCGCAACCCTTCTTCTTTAATCATTCGTTGATGTTAAGTTCTGGTAGGAGTAAAACACTTATGTTTGCTTTGTTCATTATCATTGCAACAA
AATCAAGAATGTGATGACAAAGGGAAAAACTAAGAATAATGACGTAATGGCTCTGATTTCCACAAAAAAAAACAAATAACAAATGACTAAGCCAAGAATC
TGCAACTGGCATATCATCAAGCATGTAACCTGCAGAAATCAGCATGACTACCTAATAATACTAAAAAGTTAAGTCCATATATAGTTATGTGAAGTTCCAT
TGCCTTTACTCCACAATCTTACTTCTTTATCAAGATTATGAATAACAGTGATAAGGAAAAGAAAAACCTACTTCCTTATCAAGATTCTGAATAACAGTGA
AAAGGAAAGGAAAAACCTAACTTCTTTATCAAGATTCTGAAAAGGAAAGGAAAAACCTTACTTCTTTTATCAAGAATCTGAACAACAGAGAAAAGGAAAA
ACCTTACTTCTTTATCAAGATTCTAAATTACAGTGAAAAGGAAAGGAAAAAAGAAAATTGGACAGGGTTCCTTTGAATCAAGATTTTAAGGCGATCAATC
ATGGGCTGATATTAAGTTTTGCTAGGAGAAATACTTACGTTTGCTTTGTTCATTATCATTGCAACAAAATTAAGAATGTGATGATAAAGGGAAAAGCCAA
GAATCTCCACAAAAACAAATAACAAATGACTGAACCAAGAATCTGCAAGCGGCATATTATCAAACACGTTACGTGCAGAAATCAGCATAACTGCCTAGTA
CTAAAAAGTAAGGTCATATATAGTTATGTTAAGTTCCATTGCCTTCACACTCCGCAACCCAACTTCTATATCACGATTCTCAATTACAGCGAAAAGAAAC
TTGAACAGGGTTCTTACCAATCAAGATTTTAAAAAGGTTAACAATCATTAGTTACAAGTGATTCTCGTACCTTAAAAGAAAAAAGGTACTGGTAATTCCA
CCCTAAATCATCAACTTAATTGAATCTCTCTACAGCGCCCCCAAGAACAACGAAGGAATCAGGTCTCTGTAAGCTCTACAAATGGCGGCTGTAGGCTTTG
AAATTGTTCGCAAATGGCAATGCAACTCTTATTAATAGTAGTAGTGTTGACAAAATTCCCAAAAACGAAGGCGGTTGGATAACGGGTCAAATACGGGTCA
GCCCATATAACCCACAGTAAAAATGGGTAAACCTGAGAGTTTTGTGGGGTGGCATAAACGCCGGAAAATCGAAATATCGAACCAAACTAAATTTTTTCAG
AATTTTAATTTCGGTATTTCGATTTTCGGTTCGATATTCGATTTACTTTTTTGTATTTTTTGGTATTTCAATTTGATTTTTGGTACGTAATATTTTGATT
TTTTGATATTTCGATTTAAATCAAAATATTATACTATAATTTATATTATATTAATTAATAATTATTAATATTAAATAATCTTTTAAAAAAAGAAAAAAAG
TATGTGAAACCCTATGTAATGCCCTTATTCCTCTTCATCTCATAGGCAGCACCTTTTCCTCTTCTAGTCTTCTTCCTCTTCCTCTTCTTCTTTCGGGCAG
CAGTTGTAGCAGCCGCCAGATGTTACTTTTGATGTATTATCTATTTTTACTTTTTAGCCCATTAAGTTGAAAAATCAAACAAAAAAATTGTTAAGTTTAA
AATTTTAAAAAGCCTACTAAGCATGCCCATTAAAAAACCAAAATAAAAAAATAAATTGAATTTATAAAAATCGAATCAAAATAATAAAAATCGAATCGAA
CTGAAATATTTTAATTCGGTATTTGGTACACATTTTACAAGAAACAAAAACCAAAAAAAAATGAAATCGAATCGAAATACCGAATGTCCACCTCTAAAGT
TTTATTCGTGATTTTACTAATTAAAGCTTAATTTTAATAATTAACATGAAATATTTACTAAATTAACAAAAAAAATCTTGACGTTTGTCATCATCAAATA
AGTATTATTTTCCACAACTTGAACAAAGCAAAATAAAAGTATTTCTACACTTTTTTTCAAAGGAAAAAATTACTCCATCATATTTGAGGTTCTATGACAA
AACATGAACTAATTGGTATTGGTCAAGCTTTTTCGACCAATACTACTTTAAAAGTTTCATTAACTACACCAACATGGACTAATTATTATTGGTTAGAACT
TTTTCGAGCACTTGTCCATACTTTAATAATGTCATTAACTTTTTCGAGCACTTCTCTATACTGGTAAGATGAGATCGTTTCGCGGGATATATAAAAATAA
TACTATTAATTAGAATATACAATAATAATTGTATTGGTTATGTTAGTATTAATTGATTATTATATACAAGGATTGTTTTTTTTATTATTATTTGGATTGA
TAGATTAAAAATAACATATATTGTATAATTTATTTATGAAGATACCTTTCATAAATATGATGAGAAAGAGGTGTAAAAAAGAATTTGATGGATAATTGGG
TTTTAATCATGCTAATGCATATTTCTTTTGTCCATAAATGTTTGGCAAGTATATTAAAAATAGATGTTTAAAATTAATTGTCAATTTAAACAATAACTTA
GTTTTTTAATATTCTTACTATAATAGGATTATATTTGTCAGATTAAACTTTATATTAAATTTTTCTTGAGAAGAGTGCACAACCTTACCCTAACTAATAA
TTGCGAAATATTAAATTTCCTGACATTACTAATACCATAAATTTTCATGTATTGTAATGCACCCTTCAATAGAGAGGATACCAAACTATGTACTATAGTA
TACAAAATTCATGTTTTAGTAAATACACAGTAAGTTCAACATTAACATTATTTCTTCACCCCAAAGGCTAACAATGTCATCAATTTTTTTAGAGATTTTT
TTTATATATCCCTTAATTTTATCATTTGGCGATGATATATTTTCGTAACAAAAATGATTTACTTATATCACTTTTAAAATGAATAATTAAATAAGAACAG
AAATAGTAATAATTATAATAACGCACATTAATTGAAACGTACTGATATATGTATTTAATTAAACATAGAATTAATTATTGAATGACAATGCGACAATAAG
GAGGAGTACTCAATATTTTGCAAGATACTTTTTAAAACTGGGAAACAAATTTCAGTGCAAAAAAAATAATAATTTAAAAATCTAAATTCTTCAACAAGTG
TTGAACTATCAACTCTACCGTACAGTCTTCTTTAATTTTAGGTGAGAAAATACAAGTTTAGAACTTAAAGATATCAACTGACTCACTTAAGGTAATTAAT
TTACTTCATAATAAAAAACATTCTCACGTATATTATAATGAACGCATAAAATTAATTGCTTTGATAAAACCTTAATTTAATATAAAATTTGAAAGAAAAA
CAACATGATAGACTTGCTAGTCAGAAATAATCGAACACTGAATTAGGTTCTGCTTTACTCTGTTTATTTGAAAAATATTGAAACCATATAAAAAATAAAT
AATACTCCAAACTCCTCCTTTTTTTTAAAAAAAATAACAAATAAATATATGTATCAATTTTTTTTTATAGTTATACTGGAGATATGTACACAGGTGTGTA
TTACGGATCCTTGGGCGTAATATCTTCCAACTCGAAGGATAAGCGAAGTCATTATGCAGGGTATATAAGCGCAACGAACCCTGAAGCCCCATCTTCAAAC
ACTCTCTGACATATATCTTCTTCTTTAAATTCCTCCATTGATAAAAATGATCGTCTTCGTCGATCCTGTTTAATATAAGAGATCGTAATTGCATCAGATC
TGTATCGGCGTCACAAAGCTCGGTTCATGTAAGATATTTGTTCACATATTGTTTTGTTTTTTAATGTAATTGTTGATTTTTTCGTTTTGTTATTCAAAAC
GTAGAATTTGGAGAATTTTTTTATTGTTTTTGAAATTTTGAGCTGTTGTAGGATCAGGATATTAGAGGATCGGAGAAAGGTTTGTTCCTGAAAAGCAGAG
TCAATTGCAAAGTGAGTTTCTGCTTTTCTGGTGCTAATTTTCCATTTTTCTCATTGAGCTTGAGATTCGGATGATTACTGTATATGAGTTGATTTTTGGT
GTAATGAATAATTTTAGCTATTGTGGAATTTTTTGGAAGTTGAAATTGGAGATTCGTGTTAGTTAGTTGAATGGTTTCAACTAGGAGATTGTTTTGTTTA
TATTTTGTATTAGAGTAGAAAGAAATCATAGCCGTGAAAATCAAAGTGTTGGCTTGCGAGAAAAATGAACTCTAGTGTAATTTTGTAAAAGTTTTTTTTT
TTTGGATCTTAATTGTTAGGCCTTATTTCAGGTGTTGGTGTAAAATTGGCATTTCTCAACTTCTATATCAGAATATCTTTTTCTATGTGAATTGAACCAT
AGCTACAGGAAAACAAGAACGAGAAGGATGAGATCTACTCTTTATTTTATGATTGAGAAAATGGTAGAAAGATTTGGGTGGAATGGGGATTTTCAAATGC
AGTAGTTTCCTTCTTGCTTTCCCAAATACATACTGGTTTGAGTTGTTAATTTGATTAGAGGACATATGTGAAGCAAGTGATTTCCCTTTCCTGGCCGGTA
AATCCACAAACTGGTTGTGCTCAGTTTCTTCTTGTATTTTTGGTCTGCTAATTTTTTAACTTCCTTTACAATTGTTTATTTTAAATTCTTCACATTCTTT
GGTGGAATACCATCAATGTAGGAATTGGGTAGCTGGGTAAACTTGCTATGTGGGAGGAGAGGAAGGAAATCATAACTTCCTGTTGTTTTTTCACAGGTTA
TCATCACGCTTGGCTCTGCACTTTATTGAGGGTTTAAGGGCTTGTATTCGTCCTACTCGATGGCTGATACCCGGAATAGTAATGTCAAGGCTTCTAATGA
CAAAGCATCCGGAACAGCCAATCCTTATGCCATCAATCTGGAGAACTTCGGTAAAAGACTAAAAACATTATACTCCCACTGGACTGAACACAATGATGAA
CTTTGGGGAGCTTCTGAAGCTCTTGCCATAGGAACTCCTCCTCCATCTGAGGATTTGCGGTATCTGAAGTCGTCAGCTTTAAATATGTGGTTAGTTGGGT
ATGAATTTCCTGATACTATCATGGTTTTCATGAAGAAGCAGATCCATTTTCTCTGTAGCCAGAAGAAGGCCTCCTTACTTGAAGCTGTCAAGAAAACCTC
CAAGGATGTTGTGGGAGTGGATGTTGTAATGCACGTGAGGTCTAAAAAAGATGACGGGACTGGTGCAATGGATGCAATTTTTCGAGCAATGCAAGATCAG
TCAGAGTCAAATGTGCCCGTTGTTGGACACATCGCGAGAGAAGCTCCTGAAGGGAATCTTTTAGAGACATGGACTGAGAAGCTAAAGAATACACAATTTC
AGCTCAGTGATGTAACTAATGGATTCTCTGACCTGTTTGCTGTCAAGGATACCGCTGAAATTATGAATGTGAAGAAAGCTGGCTATCTGACTTCATCAGT
GATGAAGCACTTTGTAGTCCCAAAGCTAGAAAGGGTTATCGATGAGGAGAAGAAGGTGTCACATTCTTCACTAATGGATGATACTGAAAAGGTCATACTG
GAACCTGCAAAGATTAAGGTGAAGTTGAAGGCAGAGAATGTCGACATCTGTTACCCTCCAATTTTTCAGAGTGGAGGAGAGTTTGATCTGAGACCAAGTG
CATCAAGCAATGATCAGAATCTTTACTATGATTCAACAAGTGTGATTATCTGTGCAATTGGTTCTCGATATAATAGTTACTGCTCAAATGTTGCTCGGAC
CTTTCTAATTGATGCCAATCCAATGCAAAGCAAGGCGTATGAAGTCCTTTTGAAGGCTCATGAGGCTGCAATTGGAGCTCTGAGACCAGGAAATAAGGCT
GGAGATGTCTACCAAGCAGCCCTCAATGTGGTTGAAAAGGAGGCACCTGAATTGGTTGCAAATTTGACGAGATCTGCAGGAACTGGAATTGGGCTTGAGT
TCCGTGAATCAGGGTTAAACCTCAACGGCAAGAATGATAGAATGCTGAAATCTGGCATGGTTTTTAATGTGTCTCTTGGGTTTCAGAATTTGCAAACAGA
GTCTAAAAACCCCAAAACTGAAAAAATTTGTGTTTTGGTTGCTGATACAGTTGTTATTGGTCAAAATGCTCCAGAAGTGGTGACTTCTATGAGTTCTAAA
GCCGTAAAAGATGTGGCTTACTCATTCAACGAGGATGAAGAAGAAGAGGAGGAGCAGCCGAAGGTCAAAGCTAAGCCTGTTGCTGCCAATGGACTCTCAT
CCAAGGCTACACTTAGATCAGTTAACCACGAGACATCAAGGGAGGAACTAAGACGGCAACACCAGGCAGAATTGGCCCGCCAAAAGAACGAAGAAACTGC
ACGAAGGCTCACAGGAGGAAGTTCTGGGGGTGCAGATAGCCGTGGTTCTGCGAAAGCCACTGGAGATTTGCTTGCATATAAGAACATTAATGATCTGCCA
CCTCCAAGAGAATTGATGATTCAGGTTGACCAGCGGAGTGAGGCTATTCTTTTACCTATTCATGGTACCATGATTCCATTCCATATTGCCACCGTGAAAA
GTGTATCTAGTCAACAAGATACTAACCGTACCTGCTATATCCGAATAATGTTCAATGTTCCTGGCACTCCATTCACTCCTCATGACACAAATACTCTAAA
GTTCCAGGGATCAATATATGTTAAAGAAGTTTCATTTCGTTCCAAGGACCCAAGGCACATCACTGAAGTGGTTCAACAAATAAGAACCCTCCGCAGGCAG
GTTGTCTCTAGAGAATCAGAGAGAGCTGAGAGAGCAACTTTAGTAACACAAGAGAAACTTCAAGTTGCTGGAGCCAAATTTAAACCAATCAAGTTGTCAG
ATCTGTGGATTCGTCCAGTATTTGGTGGTCGCGGGAGAAAGCTTCCTGGTACTCTAGAGGCTCACACAAATGGATTCCGGTATGGAACTTCAAGGCCAGA
TGAGAGAGTGGATGTTATGTATGGTAACATCAAACACGCATTCTTCCAGCCAGCAGAAAAGGAGATGATTACAGTCCTCCACTTTCACCTGCACAATCAC
ATAATGGTGGGGAACAAGAAAACCAAGGACGTGCAGTTCTATGTTGAAGTGATGGACGTTGTGCAGACAATTGGGGGTGGAAAAAGATCTGCTTATGATC
CTGATGAGATTGAGGAGGAACAGCGTGAAAGGGATAGGAAAAACAAGATTAACATGGAATTTCAAACATTTGTGAATAAGGTAAATGACCTCTGGACCCA
GCCTCAGTTTAAAGGGCTTGATTTGGAGTTTGATCAGCCGTTGAGAGAACTTGGATTCCACGGGGTACCCCACAAGTCAACAGCTTTTATAGTCCCAACA
TCTAGCTGCCTTGTTGAGCTCGTAGAGACACCATTTGTTGTGATCACTCTCTGTGAGATTGAGATAGTCAACTTGGAGAGGGTTGGTCTCGGGCAGAAGA
ATTTTGACATGACAATTATATTCAAGGACTTCAAAAGAGATGTTATGCGAATTGATTCTATCCCTTCAACTTCTCTTGATGGCATCAAGGAGTGGCTCGA
TACAACTGACCTTAAGTACTATGAGAGCAGGCTGAATCTGAACTGGCGTCAGATACTGAAAACAATTACTGATGATCCGGAAGAGTTCATAGAGAATGGT
GGATGGGAATTTTTGAATTTAGAAGGTACTGATTCGGAATCTGAGAACTCACAGGAGTCTGATCAAGGATATGAACCTTCAGATGTAGAGCCCGTCTCAT
CAGACGAGGAAGATGATGAAAGCGCATCACTAGTTGAGTCAGATGATGATGAAGGGGAGGACTCTGAGGAATATTCAGAAGAAGAAGGGAAAACATGGGA
AGAGCTGGAAAGAGAAGCAAGCAATGCCGACAGAGAGAAAGGGGCTGAATCAGACAGTGACAATGATAGGAAGAGGAGGAATATGAAGCCTTTTGGGAAA
GGTCGTCCTCCAGAGAGAAGAAATCTCTCTAGCAACATTTCCAAGAGACCCAGGTTTAGGTAAAGAGTGCAGTAGCACGTGCTTAACTGTCCTAGGATAT
TAGTATATGCTGCATAAGTTATAAGCAGCTGTAAAGTATTTACTCAGACAACGGAGTTTAGACTTGGATCTTAGAATAGTTTTTCTCTTTTTTCTGTGTT
TGCCAAGTAGTGAATTCGTGTAAAATCAGATTGTGCAACTTAAGTTGGGTTTAAGTTCCATTTAAATTTTTGACCTTGGTACTTTTGTTTTTCAAAATTT
ACTCAGTTACTTGTCAGCTACATTTCTAGGACAATTGCTCGCCTATTACAGTGCAAAAGGTCTTGTTCCTAGCTATTTCTTAGTGTTATGGGGGCACGTA
AAGCAGTATATTTTCATATACTCTCAGCTTGTACATATTTTGGATACTGATATTATTAATACCTGGGCACTCTGCAACTGCTGCTTGAAGTGAGAATGAC
GCTGCTTTGGGAGATGATCTGAAACTAGCACCAGTTGATGAATGTAGGTGGCCGAAAAGTTTCACAGTTGTCTTCCAGAAATTGAACAGTCTTCCGCAAA
TCACCACCAGGCTACTATGTTTTGCAATATCTTACCACTTCATTTAAGTAGACAAGATAAGAACAATGTTGTTACTCGAGTGCTTTCTGGTTCCTATAGT
TCTACTTTCAGTTAAGCTACTTCCACAACTAGGAGCAACAAATACAAATGAGAAGATGTATTCAAAATCATTAACGTTTTTTTTTAGTTTTTTTCCTTCT
CGTAGTTGGATGACACCCCACTGAGAAGCCTCAAACATCTGTCAAAGAATGACAAACTAAAAAAAATTAAAGGTTTATATAGCTAGCAATGCATTTCCTA
TATGATATGCTTCTCAAGAAAATTTGCCAAATATATGCTACTCACTGAAAACAATATGGCAGGTTTTCTCACTGGCATAACAGATAAAAACACTAGAAAT
ATGTTTCCATATATCTGAGGCTAGTAATTTACAATAAGATCAAAACTACCACCTAATTAGAACAAAAACCAGCAAAAAGAGAAACAGAAACATAATAGGT
CTTTGCATCCATAAAGGAACATTAAAGAAACGCCCTTCTAACTAACCCATCTACCTGAACTTCATTCGTTTTCTGGCAGCAGAAGTAGGAGCAGCTCGTG
ACTTGCCAAAGTTCTTCTTCTTCCTCTTCTCATCCTCGCTATCTGATTCATTAATTTCCCTGTCTGCATAGCTTGCTTCTTTCTCCAGCTCTTCCCATGT
TTTACCTTTTTCTTCCTCTGAATCTTCATCATCATCCTCTTCTTCATCATCTTCAGAGTCCACCAGAGATTCACTATCAGACTCATCATCATCAGAGTCT
GACTCAGGTTCAGCATCTGAAGGTTCATAACCTTGGTCTGACTCTGAATCTCCAGATGATGAATCAGTACCTTCCAAGTTTAAGAATTCCCAACCACCAT
CATCAATAAACTTCTGTGGTTCATCTGTTATGGTCTTCAGTACTTGACGCCAATTCAGATTCACCTTGCTCTCATAATACTTGATGTCAGTTGTGTCAAG
CCATTCCTTGATGCCATCAAGGGATGAAATAGGGATTGAATCAATCCGCATGACGTCACGCTTGAAGTCCTTGAAAACAATTGCCATATCACAGTTCTTC
TGCCCAAATCCAACTCTCTCCAAGTTAACAATCTCAATCTCACTTAGGGTTATCACAAGGAATGGAGTCTCTACCAGCTCAACCAAACAGCTGGAGGTTG
GTACAATGAAAGCTGATGATTTATAAGGAACACCGTGGAACCCAAGTTCTCTCAGAGGTTGATCAAACTCCAGGTCGAATCCCTTAAACTGAGGCTGGCT
CCAAATATCATTCACCCGGTTCACAAAACTCTGGAAGTCCATGTTGATTTTGTTCTTTCGATCTCTTTCCCTCTGTTCTTCCTCAATCTCATCTGGATCA
TATGCAGACCTCTTTCCACCTCCAAGCGTTTGGACCACATCCATTACCTCAACATAGAACTGCACATCCTTGGTCTTTTTTTTCCCCACCATTATGTGGT
TGTGCAGATGAAAGTGAAGGAGGGTAACCATCTCCTTCTCTGCTGGTTGGAAGAACACATGCTTGATATTACCATACAAGATGTCAACACGTTCATCTTG
TCTTGTGGTTGAATACCTGAAACCATTAGCATGAGCTTCCAGTGTACCAGCAAGCTTTCGTGCACGACCACCAAATGTGGGACGGATCCATAAGTCAGGT
AGCCTAACTGGCTTGAATTTATTCCCTGCAAGGACAAGTTTTTCCTGAGTCACTAAAGTTGCTCTTTCAGCTCTCTCAGACTCCCTTGACATATAATTAC
GTCTAAGTGTTTTAATCATCTGGACCATTTCACTTATGTGCCTATGATCCTTCGAGCGAAATGAAACTTCTTTTAGGTAGATGGCACCTTGATTCTTCAC
ATCAATAGGTGAGAAAGGGGCACCAGGAACATTAAATATGATTCGGATGTAGTCCTGTTGGCTTGAAACAGTCTTAACAGTAGCCACATGGAAAGGAACC
ATATTACCATATATTGGTAAAAGGATGGCCTCATTCTTTTGGTCAACCTGAATAATCATCTCTCTGGGTGGTGGTAGGTCATTGACATTCTTATAGGCAA
CAACGTCAGTCGAAGTCTTAGCACTCCTGTTATTCCCAGTTAATGTTTCTTCACCAGCAAGACGTCGAGCAGTCTCTTCATTCTTCTGACGGGCAAGTTC
TTCCTGGTGCAACTTTCGTTTCTCTTCTCTTGAAATCTCATGATTGTCAGACCTAAGTGTTGCCTTGGAATACAGGGTATCCCTACCATTGGACTCTGGT
TTCATTTGTGGCTCCTCTTCTTCATCATCTTCATTGAAGGAATAGGCCACATCCTTCAAAGCTTTGGAGCTCAAATGGGTGATCACATCACGACCATCCT
TTGTGACTATCACGGTATCTGCTAGCAAGAGTGAAAAATTCCGGCTCTTTACTTTGTTGGTCTCGTTCTGCAGATTGTGGAAACCAAGTGACACATTGAA
AACCATTCCCGATCTCAACAGTTTATCATTCTTAGCATTAAGGATCAACCCTGACTCTCGAAACTCAAGACCAATCCCTGTCCCAGCAGATTTTGTCAGG
TTGTTCACCAATTCAGGAGCATCCCTATCAACCACAGCAAGAGCTGCTTGATAAACATCACTAACCTTGTTACCAGGCTTCAGTGCATCTATTGCCACCT
CCTGGGCCTTAAGAAGCACTTCATAAGCCTTGGTCTGCATCTGAGTGGAATCAATTAGAAACGTTCTGGCAAGATTTGAACAGTAGCTGCTGTATCGTGA
ACCAATTGCACATATGATGGCACTGGCAGATTCATAATATAAGCCATCATCGTTGCTTGTAGCACTAGGTCTAAGATCAAAAACACCACCACTCTGGAAG
ATTGGAGGGTAACATATATCAACATTCTCAGCTTTCAGCTTCACCTTGACTTTAGCAGGCTCTAAAATAGCCTTTTCTGTGTCATCCATCAATGAGGAAT
GTGTTACTTTCTTCTCCTCATCAATTACTTTCTCAAGCTTTGGAACAACAAAGTTCTTCATAGCAGAAGCAGTCAGATGTGCAGCTTTCTTCACATTAAC
AAGCTCATTTTGGTCCTTCACAGCAAAAAGGTCAGAAAGTCCACTTGTTATATCATTAAGCTTAAGGCCAGAATCTTTTATCTTCTTAGTCCATGCCTCC
AAGAGCTTTCCTTCAGGGCCTTCTCGTGCAATATATCCAATAACAGGAGTATCATAAGCATCTGATATTGACTGCACATGAATAGCATGGAGCACCTTGT
CCATTTTAGAAGTCCCGTCCTCACCTTTGGTCTTCACATGTGTGACTACTTCCACTCCCACAGCCTCTTTAGCAGTCAATTTCACAACATCCAGCAATGA
AGCTTTCTTTTGGCTACACAGAAAATGTATCTGCTTGTTCCCAAAGACCATTATAGTCTCAGGGAACTCATAGCCAAGTAACCATACATTTACAGCCGAG
GATTTCAAGTATCTTAAATCCTCTGAAGGTGGTGGAGTAGCTATAGCAAGGACATCAGAAGAACCCCAAAACTCATCTTTATGTTCACGCCAGTGTGAAT
ACAAGTCCTTCAGTCGCTTACTAAAAGTAGGCAAGTCAATTGTGTAAGCATTTCTGCCTGTTGCATTCCCATTTGCAGGAGGGCCATTTCCTGTTCTTTG
TTCTGGTGGCATCATACAGCTACTTGTTGATGATCTGGACAAGAAAACACAAAAATTACACAAATCAAAATTTTTAAAAAATGGGAGAAGGGGGGGAAAT
GCAATCTTAAGAGACCCTCCATACAAATTCCAATAATCTATAAAATGAGTAAGCATTGTTTGAAGTATCATTCCTTTGGAATTTCATAAAGCTTGAAATT
CATAGCAATCTCAAGGTATTTTCATAGTTATATATTTGAGATCTTATCATTCACCAGAACCCAAGATCTCCCAAATTTTTGGCAAGCACTGAATCAGTAA
TCAGTTGGGCACTACAAAAAGAATTTAAACATGTATTTGCAGATAAAAGAGAACACGTAAAGAATACTGCCCCATTGTGCAAAAGAATCCACAAAATATG
TACTACTCTACATTGTTATGGATGCGACAAAAGAAGTCAATTGATGAACTGTCATGCACAGCCCTTCACATTATGATAAACTAAAATAACAAGATATGAA
GAGACTCGTTAAAATATACAATAACTTTGATATGGACAAAAATATATGGAAAGAAGAATGTTAAATTACTATGATAGCCACCATAATCCATGATTTTCTG
AAAATTTTAATTTCCAAGAAAGCACATATTAACTGCTTGATGCACATCTTCCTGATAAAAACAACATTAGACCCACCACACAATCATCAACAACTCATAA
GACTAATTGATACACAATTTGCATGTTTCATTTTTTTCACTTGTTGTGAAGTTGATACACACGGCATACATAATCCTTCACCTGATTTAGAAAAAAGGTT
GAACACAGTATACTTGTTTCTTGATTATATTTTCCCAAAATTTGAGAAACACCACCAAATTCCAACTTCAACCAATATTTAATGGTCTGGACAAGAATAA
GGGCTATATCTCACACAGAGACATATCAAACAATTAAATGTCAAAAACTTGATACAGATTATGGTATCACCTGAATATCCCAAATCCTAATGAACTTGGC
CCTTACAAAAACCAAGTAGTAAAACAATGCAGAACTCAGAAAACATTCTTATCCCCTACACACCAAGTGCTTCACCAAAGCTACTGCATAAGCATAATAT
AATAAGCTTTCAGAAACAAAGATAACAAAAATATAACGAACAACAACTAAACCTCAGTCCAAAAACAAGATGGGGTCGGAACAGAAATCTAACCCCACCA
AAAACACAACCTCCAGTGGCAGCCCCAATTTAGGGTTTAACACATGCTTCAAGACAAAGTCGAAAACTTCCCACAGAAATCACCACCAACCACAATGTTA
GACTCCAACATCAAAAAATATGAGTTAGCAATTAATCAAAAGTAACAAATGCTTACAGACGAACGAACATGAAAAGGTAACAGATCTCCTCAATACATTC
CATTTGACAAAGCCCCATAAAAAACCCTACCCAGTAAAAAACCTCATTCCAACCCGAAATAAGTGTTTCGGAAGTCACATGCAAAAACTAAACATGCTCA
AATTAAAAAAGCAAACAAAAAAGGAAAAAAAACTCACATCCTTATCAATGCCCCTATTAGGGTTTCGAAACTCAACTGGGAGTAGTGCGCCGCGCAATGA
GTCGGGTCAAGGGTTTCGAATACTATATTTCATAAACATGAAAATTGTTCAAGTGAACACTGAAAAACAGATCAAACATTGAACTAAAAAGTTGAAAATC
GAAGTAAAAGGAAAGGAGATCTCGAAAAATCTATGAACAATAAAGAGAAAACTCGAATTTCTAAGGAAGAAATTGAGAGAAAACGGAGCGAGGAAAAGAG
GAATTTTTTCAAGAGAATGGGAGCGAATGACTGATTTGAAAATGGACGAGACTGAGAATTTGGTATTTATATCCCTGGAGTGATATGAAAAGGGTCTTGT
ATTTACGATAAATTACACCAATTGCCCATTTATAGTGTATGTGTAATGACAAACCTCTCCCTGATCATACCTATTACTTGTAGGGATTCAAAGTTGGGAT
TATGTATTGCGAAGGGTAAATTAGTACTTTGATTTGAGGCAGCGAGAGGAGTGAGCTGTCAATTGAAGTGCTGCGTTACGTGGCACATAATAAACGACGC
CGTTTATCTCATTCTTTTTAACAAAAATGGCGGGAACGTAAATGCTCGTTTCCCACCAAAATCAACACCAGCAATCTCACTATCCAAATCAGAGGCAGAG
TCATAAATTAAATTAAAAATAATAATAATTAGGTTAAGAGTGTGGAAAATTAAATTTATATTTAATAATTAATTAATGAATTTTTATACATATTATTAGG
GGTGTGCATTTGGTTTTTTCAGTTTGGTTTTGTATTATTCAGTTTAGATTTTTAGATTTGAAGAAGTGTAACTTGATTTGAACCAAAATAAATTTAGTTT
GGATTTTTTCACTTCGATTAATCGGTTATATTAATAATTAGAAGCATAACAAAGTTATGTTTGCAATTTAAATTTCTTAAATATACTTTTAATATAAATC
ACAAGTAAAAATGTAAAATACAATACTTACAAATAATATTAATTATAGATGTCAAAACATAAAAAATAAACTAATTCATAACTAAAAAGGGACAAAATGT
TTAACTCCAACTTAATTCTAAACACACATATATATAATTTATTTTTTGATTTTTCAATTTTCAATTTTGTAAATTCTAAATCAAAGCAAACAAAATAAAT
TATAAATTCAAAATTAAACCAGAAATCCAAAACATCAGTCAAAATTAAAATTCAACTTGATTTGATTTTTCAATTTAATTACCCCTACTTATAAAATATA
TCTAATATAGATAATTTTTAAATCACAAAGAACATTATATTAGTCGTAAATGTGTTATACATGATATACATAGGATTTTTGCTAAATTTCTATGGAATTT
TAAGGAAAAAGCAAGGGCTAAACGCTTAATTGTTTGGAATGTAAAGTAAAAGACAAGATTTTGATTTTAGATCTCTATCTGATGTTTCGAAAACATTCAT
TACTGAATTATGATGGGATCTTAGATCAACCTAACACATTGTGGTCTAACTTTATGCGGAACAAGTACCGCAAAAGACATAGGCCGCAAGTGGTAGAATG
AGAGAGGGCTCTCACGTATGGAAACTTATGCTACAAGTTAGAGATTTCATGAATCAGGAGATTTGGTTGGAACCCCAAAATGATAAGTGTAGTGTTTAGT
TCGATAATTGAACACAATTGAGGGTACTGCACTATTACTTGCCCATTAACCATGATTATTGTCAATTAGAGAAGGTACAACACTTTATAATTATAATTGT
GAAGTGATAAAATAACTATTTGCTACGTGTGAACTTACCGAAAGAAGTGAGTAATCACATAACTTTAAATCTAGGCCGAAAATAAAGATTTGATGAAAGA
GAAAAGCCGTAGTGAATGCCTATTGCTACATGTAAATTCTGTATTGGTAACACTTGGGAATTAATGAGTTGGAAAAATCACAAGACTGATAAAATCATGT
ATTTGAGGGAGAAAGGTTTGCCTTTTAAATTATTATTATTTTTATTTTTTGGTAATGAAGGTGGTTCACATATGTAAGGAAAATAGATTGACCTATTACT
TAGCTACTACAATGTTCATTTTAAAGGTACCAACTAGCAAGGAAAATCTTAGTAACAGAACAAGGAAAAATCCCAAATATACAAATTAAGAAGATACAAA
ACAAAAGATTCAATACATAAACAAGGAATTAAGGATCAAAAGTGATAAGTCGACGTGAATTGAAAGCAAATGCAACCATAAGAGATAAGTAATAACTAAT
CGGATTCACACATATACTTCTCATAACACCTAAGAGACAGCTGTGTCGGAAATACCTCTTGAAAATGAATCTCTTTATAGTGATATCATTTTTCGGGACT
CATTCTGCGTAGAGGATGATTTTTGATGAAGATTGTCGTATCGTAGCTTCAAGCTCCTAGGTATGTTGTTTGAATCCATTTTGACCTGAAGAAGTCTTTA
AGGAGGTTGATTCCATGGCATTCATTGAAAGGTTAAATGTAGAGGTGTAATTCGCTCAAGCTCAACAACATACGAATTTGGGGTTAGTTTGGAGGAACGA
CAATGAGAAAACTGGACGGAGGAGTGTTCCTCGACATCAATTTTAGACTACTTTCCTTTTTTTTCAAGATTTTTTGTTGTTTGTATATAAATCCGGATCA
CTTTTGGACATGAATCAAAATAGTTTTTAGTAATATTAATAAATTCAAATCTTAGCGATAGTCATTACCAAAAAAGCTTCAATATTGATAAAAAAGAGGT
GATATTCTTTCCATTTTAATTTATTTATTTCATTTTCTAGATACGTTTTAAATTTATTTTTTAATAATTTTTTTCACATGATATATTAAAAAATATATAA
TTAAATAATATTTTAATATTTACTATATATCTTTAGTTTCCAAAAACTTGTTACTTTCTATGATAAAGTGAAAATCAGACGAACAAATAAAAACATAAAC
GGATATAATTTTAGGATAATGATATGATTTTTAATTAATATAAGGCGCATGAACAGATAAACAAAGTTTAGGGGCGCTAATAACATTATCAAGGAAAAAT
AGTTGGATTATGAAAATCAGGCAGCATCATTATTCTTCCCAATACAGTATCTTCCCTTGTTAAAAACGCCCAACTACCTACTCCCCTGTCCCCACCCCCA
CCTCAGCTCATTCATCTCACTCACCAGTTGTTGCCTGGTTGGTGAATACCCACAATTCTTCTACCTTAAGATAATTCCATAAATTTCATAGTTCTAGATC
TTCGTTTTTTGTAATCAATTGCATACCCACCAACTGTTTGTATAATTGTTTAAGAGAGAGAGAGTTGTCGTTCGTTTGGATTGTAAGAAAAACAGAGTAA
TATGGCGAGGAAGAAGATCAGAGAGTATGATTCAAAGAGGCTTCTAAGGGAGCATTTGAAACGCCTTGCTGGCATTGATCTTCAGATCTGCTCTGCTCAA
GTGAATTCCTTTTTTTTGTTTTAAAGAACTTAAGTTATTGAACTGTTGCTGTCGAATTGTAATGGAATTTCGGTTATGAGGTGTACTTTTGATGATCTTT
TGCTAGTGGTTTTAGATCTATGCGTCTTTTTCTTATCTGGGTGTTTGTTGTTTGATCAGTTCAGTTCGAATCCTACTTCCCTTTGTTCCTCACTACTTCC
TTATTCCCTATTTTTGTTATTCCAAATGTTAGAGTTGAATGATTGCTTCGTTGTTATGATGAAGTTCTGTAGAGGTCATGATGTATTTTCCAATTGCAAA
GAATGATTCTTTTGTTTGTGGAAAGCTCTTGTTGAGTGGACAATCGTGTGTTGTAAGATTAGTTATCTACCTATTGTAGATTTACTTGGAAAGCACCTTT
TTAAGCTACTATAGAGTCCTTTAATAAAAATGAGATGTACGTTACAAACTGAAAGAAGCTTGGCGTGCATCCGCGTTTGGTAAGATGGAAAATACTCTAC
ATAAAATACTGATATTTGGTTACGTAAATTATTATCAAGGTGATCATTTGGACTATCTGACATTATTTGTCGTCATTTCCATTTATTTTTTCTCGCCAGA
GTTCTCATGTTTATTTGGTTTTTGGTAGGTGACAGAATCTACAGATTTTACTGAGTTAACAAACAAAGAACCATGGCTTTCATCGACAAAGCTGGTTGTA
AAACCAGACATGCTGTTTGGAAAGCGTGGAAAGAGTGGCTTGGTAGCTTTGAATCTGGATCTAGCAGGAGTTGCTGAGTTTGTAAAAACACGACTTGGTG
TGGAGGTGAGCAGAGGGCCAAGTATTTTGAATCTTTTACTGCTTCTTATGTGTTATAGTCATCTTACATGTGAATTTGTTTCTAGGTTGAAATGGGTGGC
TGCAAGGCACCTATAACAACATTTATTGTTGAACCATTTGTTCCCCATGACCAAGAATATTACCTTTCCATAGTCTCTGAAAGGTTGGGCTGCACAATTA
GCTTTTCAGAATGTGGAGGCATTGAGATTGAAGAGAACTGGGACAAGGTTAGTTGGTTCAAAAAGTTTTAACTGTTGTTTCCTCCTCTAACAACTATTTG
TTTAGACAAAACTGGTTAACTCTAGTTATTCTGGTAAATTCTAGAAAGTCAAGTTATAATTTTTTCCCCTGTAATAACAAGATTTTATTTGTTTATGTAA
CATAAAGGTCAAGACAATATTCCTTCCAACGGAGAAACCTATGACCCTAGAGGCGTGTGCTCCACTGATTGCTACTCTGCCCTTGGAGGTGATCTGAAAT
TTTTGTTTTTGTTTTATGCTTCTACTTTCCTTTTAGTCATCAGTCTCGATCAAGCCAGCATGATCTGTCAGTCATAATAGTTGGAATGGTTTTCTAAGAG
CAAGGTCTTGGATAACAGACACTTAAAAAAAGTGTGTTATCATATTGTGTATTGCTGGCAATTCTTAAGGATTATTGTTTTATGTTGTATTATTGTGTAG
CTATTTTCGATATTTGATCTAGTTTATATATATTGGTCTACTTATTGCTGGACTTTCACCTTTGTGTTGATAAATATTCTGACTTCGAAGATTAAGGCAC
TTGACTACTAACATCTCAACAACCATCATGATACTTAACCTAAGTTTCTGGTTGACTCAGGTACGGGGAAAGATTGGCAATTTCCTTATGGGTGTTTTTG
ATGTGTTTCAAGGTATGCCATGCTTTACGGTGATACATCTTTCTAGCATGCATTTATGTTATTTTTCTCTTTTTCTTTTATCTTTTGGTGCTATCTTTTA
GATAATTGCCAGTGACTATACGTGGAAAACATAATTAAGTTTATTGTTATATAAGCAGATGAAGATGAAAATAAACTTTCTGTTGGTTTATGTTAAACAT
TGACCTGTTCTTAGAAGCTAGTTTTTTCATATTTTCACATCATTATTCTCAAATATTATTTCATTGATTATGCAACTCTGTCGCTTTGTCTTTGATCCCA
GATCTCGATTTTAGTTTCATAGAGATGAACCCATTTACGCTTGTAAATGGAGAGCCTTACCCATTGGATATGAGAGGAGAGTTGGATGACACAGCAGCCT
TCAAAAATTTTAAGAAGTATGTGATTCTCACTTCTTTTCCGCATGTTGAAGTGCCTATTCTTGCTTCTTTTTTTCTCTCTCTTGGGAGAGTCTGAAAACA
GTGTGTGTATTTCCAGATTTATTAAACAGTTTGCTATTGTATCATCCTCTGTGACTTGTCAGGTGGGGAAGCATCGAGTTTCCTCTGCCTTTTGGAAGAG
TTTTGAGCCCTACCGAAAGCTTCATTCACTCTTTGGATGAGAAAGTAAGTTCAGTTATTTGTCTTTATCTAAGGGCGTTTTTGTTGCCTGAGTTATCAGA
TTTACTTGTTTATTCTTGTAGAAACTATTTTGTTAGAGAAGAAATTTTATCTTGGATTTTCAGTCATGAACTGTTATGGATACTGAACTACTGGAGGAAC
TTTATGCATTGCTTTAGAGATCCATTATATCCAAGAAAATCGTGCCTTTAAACAGCATTGAATGGTTTTTTAGTGATAATTTACATTGTTCACCATTTAT
TCTGTGCTGAAGCCGTGGTGCCATACAGACTTGAGGGCTTGGGGGTGGTTAGGGTTTGGGAAATCATCTTTTTTGAAATGCTGTTTGAAATTTTTTTAAG
TCTTGAATGCTTCTGAAGGTTAAAAAGATTTATCCTTGAGCTATGGTGGCTGGCTATCATTCCTGCCAAACTTTCTGGTGATACTTGCTCTACTGGAATT
GGAGTATAATATCTGCAGCTTTTCTGTTAATTCTGTCTTGTCTTGACATCTTGCAGACTAGTGCCTCTTTAAAATTTACAGTTTTGAACCCAAAAGGTCG
TATCTGGACAATGGTGGCTGGAGGTGGTGCAAGCGTTATATATGCTGATACAGTAAGTATATTCAGAACTTGTGATGCAACAACTTGATGCAAGGAGATA
TTTTCTATCTTGTCATTATTCCTCCTGCATGAAATGTCAACACTAATAGCTTACTGCTTATATTCTCTGTTTTTGATGTCTTAACCAGGTAGGGGATTTA
GGTTATGCCTCTGAGCTTGGTAACTATGCCGAGTATAGTGGAGCTCCAAATGAAGAGGAGGTTCTGCAATATGCTCGAGTAGTTCTAGATGTATGAACTT
GACTGTTCTCTCTCCTGGTCAATATGCTCATGTAGTGTTTGTCCTATTTTAACTTAACCAGCGTTTGATTTGATGTTTTTAAAGTGTGCTACTGCAAATC
CTGATGGGCGTAAGAGAGCTCTGATTGTTGGAGGTGGTATTGCCAACTTCACTGATGTAGCTGCTACTTTCAATGGGATTATTCGGGCTCTCAGGGAGAA
GGTTGGCTGTGTGCTATTTTTTACACAAAGTTTTTTACTTTTTCTATAGATAAGAGGCAGTAAATAATGTTTTTCCTTTGAATCCGAACAGGAAGCCAAG
CTAAAAGCGGCTAGAATGCATATCTATGTACGAAGAGGTGGTCCAAATTATCAGACTGGTCTAGCAAAAATGCGCGCCCTAGGAGAGGAACTTGGAGTTC
CCCTTGAGGTATGAAATATCACTTGGCGAAATTCTTATTCCTAAGTGATACAGTGACTACAGTCCCTGAATTTCAATTATAGTACGTAATCCTTTGACAT
TTTTGGAGGTAACATAGATACTAACCACACATGCCACAGATGAAGGGATGTTGTAGATCAGAATTTGCTTTTACTTGATCCTAGGCATTCTGTTTTTTTA
GTTACATCTTCCCAACTAAATCAATTAGCCCGACCATGGTGATGTTACTCGTAATTACATTCATAAGTAGCTTGGTCCATCTTCATAGATGTCTGAGGAT
CGTTTGAGGTCAGACATCAAGACTACAACAGGTTCCAGTTAGAATATAGGAACATGGACTTCCAAAGATGCTGTTACCAGTATTGTTATTAATACACCCT
ACTTCCTAAGTTTTCATATTCAACGAAAGTAAGAGATAAGGTATAAAATTTGTGTCGATTCTGCTATTGCAGGTTTATGGACCAGAGGCTACAATGACGG
GAATTTGTAAAGGGGCAATTGATTGCATTATGTCTGAAGCATAAGTGCCAAATGAGAAAGAAGACTTGTGTTACATTCTTGCAATTAAGAAGAAACTTTG
TTGGATATTTAATTTGCCTTCTGATATTGTTTTGTTACAAATGGGACCTTTAAAGAATAATTTGAGATCCTTTTGTTTTACCTGGAAACTAACTGTACGA
GAACAGATGCGTGTGTTCCATCCAGCAAAACACATTCCTGAAATTAGCAAAAAAAATTTGTGTGTAATAGAGTAATACGTATTTAGAAGTATTCCAAAAA
AAATAAAATATATATATCAAAAAGGCGTAAAAGTAGAAATAAATAACGAAACCTAAGTTGTATAGGATTTAGTTAGAATTTATTTGTCCAATTCGTATTG
GAATAGAATTTCTAGCACTAACCAACCAAATTTGATTGTGTTAGTATTATTATAAATAGGGTCCTGTGTTTCATAAATCTTGTGGCTTTATAAATTTAAA
AATGACTACGTACGTCTGGACGGTAAATTTGGATTTTTCGTCTTCGCCATGGAAGTTCACGAGAGTAATAATTGCATTTAATAGGGTTCCAAATTCGACG
GCAGTGTCAGGGCCTTTGCATGTGTTTGTCGAGCAACTGCAAGTGGAACCGCCACAACCACCTAACCAAGAAACCACCAATCCCACCTCTGCCTAATATA
ATCACCGTGTTACTTCGTACGATTCATTTATTTAATTCATGTCTAGTTATCACATTTATTTGTTACTTTTTTACAAGTTTAATTTGGTCTTCTAAGTTTT
ATAAATAATGATGCTCCGTTGCATATTTTCTTTTCCTATATAGTTTTTATTGAGTGCATATATTATTCTTTTTCAAAGTTAAATGTCCAAGTATCAATAA
GGTGATTTGGATTTTCTTGGGATTTATTTGAATAGATTTTCTTGAAGTATTTGATTTGCAATAAGATTAGAAGAGTTGGAGTTATGAATATTTCGATATT
TATGAAATGTTCTATGTATTTATTTGAGAAAGACAATATTAAATATATTCATAATGACTTTACGAATATTCAAAATTTCTTTGTGAATTCCATAAAATTT
TGATATCTAACAAAATATTCTTTATCATAAGACTCCAAAATCAGAACACCTATATTGTGATCTCCGACGTGACCATTTGATTCAAACTAAAATATTAAAT
ACAAATATTGCAACGAACAACAAATTAGTAATCATTGACTATCTTGAATTTTTTTACAAATATTACAAAATCAAAACACTTATAAACAGTTTCAAATAAA
TAAATAAATAAATAGGAGTAATTGGAATTGCTCACGTCACCGTTTGGTTTTTAGTACGATTAAAATTTTAGCCATTCTGCAGGTCAATTTCTTGATCGAA
CAGCCTGTTGGCTAATACTAAATCATGCATGTTTCCTGTTATTTTATATACCAAACTCACGGTCAGAAATATAAAAATTACAATAATACTAATTGACTTT
CTTGATTATTTTTTTAAAATTGTTATTGGTTTTTATAGGTGTTCCGGCGTAGTCAAAATAATTCAACAATATTAAGAGAAAACTATAGTTTATTATTTAG
AGCCAAATGATAAATACATCCTTAATTTTTACTATATAATAAAGTACAATTTTATCGATCTACTTTGGAATCTACTGCGTATGACATTAGTGATAAATAC
CATGAATATGTTTATATATAGTGTAGATATAGATCTTAATCACAAAATATTATTACAAAATCAATATTTGAATATAATTATTATAGAAAGGTAATTTCAT
AAATCACTCCCGATATAATAAACGTCACCCTTGTTATATGTATATATAAAATATTATTATATAAAGGTGAAACATAGCAATAAAAATAGATTCTTAAGAA
AGTTAGATTGTTTTGGTGAAAATGAATAGTCGTTGTACCAAAGTTTTAACTTTTTAAATTAAAAAAAGGCCTGTTGAGAGTTTGAGACACAACATAATTA
ACGAGTAAATTTGGTCACATTATTTGATAAAAATTTAAATTTCAAACTTAGATTCAAAGATCAAAAGATTATAAATAATGTGCTGAAATAGAGACCACTT
CCCAAATTCGCAGTAATTAATTAATTAAGAATACTTCAAAACATTAAAACTATTTGAAAGCTTAAGCCATCTGCTAAGAAGCAGTCGCTGTTGAAATTAC
GTACGCGTTAGCAATCTATCTATCTATCTTACCAAGTAAAATCAATGAATTTAGACATAACTGATAAATGTATCAGTTCATATTTGTTATCCGTATATAT
GTGTATATATTTGAAAAATACATTGTTCGAGCTTGCTCCAAATACATCAATATTCGATACAAAATATATTAGATATTTGATACCAGATATAGTACTGGAA
TAAGTTGAAATCAAATTTTCCGTATGAAACTGCTTCTGGATACACATAAAGATACATGATATTTATATTTAATATACAAATATATGAAATTGTGAAACTC
AGATACACTTTCAAACAGATATAATGAGGAGTGGAATAAGAGAGGAAGAGAGGCGAACGAGTTGGAATATTCTAAATACATGTTAATTACGTTTTGAATA
CAGTGTCTGAAATAGAACACACCTAATCTAACTCATGATACATGTATCAGAGATTTTCAATAAGTGGATTCAAAATTCGTAGAAATAGACATACGGAGTA
GCCGGAGGGGGTCCAACATCTACTATATATACATAAAATATTATCTTAACCATGTATAAATAGTATAATTTTCCATCGAAGGAGGTTCTACCGAAGCCCC
TTGTACCAAGGTGGCTCCGCCCCTGATCAGAGTGGTCAAATAATCAATAATAATATGTTTTTTCTTGTTTCCTCTTTTCTCCCTATTGTTGTGATGCTAA
CTATTAGGCGTGTCAAAAGAATATAAAGAATTATATGCACTGAACTTAATCAGATCAATTTATATAATTTTTTAAAATAAAATAGTAAATTTATATTTAA
GTGTATAACCATTTCGAACAAATGAAATTGTCCTTTTAATTTATAATTAAAAAAATATGAAACCGAACCAAATAACTACCTTATATATAAATATATTTTC
AATATAAACAATATGTTTAAAAAATTAATCTATAAATTATTATATGATATTTTTGTAAATATAAATATAATTTAGGTTCTAGACCTCTAGACAGTGACTT
GACCACTTTGAGTTTACTCTTTAATTATCCTTTAATTAATTGGATTTAAAATTAAAAGATAATATAATACTCCCTCCTTCGAAATTGTTTGTCAGGGTAA
GATTATATACTTTCCTTGAGAAAATCTAATACAAGGTGTAATTTGACTAATACAACCTTACTATAACAAGAATATCAAAAGTCTACGTAATTTTTTAATC
GAACGAAATAGAGTAATTATATTAAGGGTAGAATTGGAAAAAGACGACTAATTATTTCATGATTGTTTAAATTGACAATTAGTCTGGACATCTATTTTTA
ATATACCTGCCAAACAATTGTGTACGGAGAGAGTATATAGATACTTCATCAAACAATACGGTGAAATCTATGCAAACATTTTTATTAAATATATAAGATC
AAACAATATGACAACAAAATATTACACTCTTGACTTTATTATGAAGAATCATAGTGCTTCTTCAAGAACATACTTGCGAAAGAAATATTTTAATAATAAT
ATATTTTAAGGTGATACTACAAAGTAAAAGAAAAAATATGGAAATTAACTGAACCATACCGACATTGAAGAAAACATGATATGATTGAGATGATTTTAAA
ATTTTAATTTTGGTTATATATTATAAAATACCCGAAAAATGGAGATGACATGATTTTATAAAAATAACCGACTGAATTGTCTCATGAACACTCCTAGTTC
CGTCTACTTTAGTTGTCATAGTTTTCTTTTTTATAGTCAAATTATAAGAATTTTGACTGACATTTTATGATGTGTTTTTTCATCATATTGATATACAAAA
AAATTTACAAATTTAAGTACTTTTATATAATTTTTGAATATATAATTTTTCTTTTTTAAAATATTAAATTAATTTAATTTAATTTAACTTAAAAAATAGT
CAAATTGATTTTTTTTTTTAAGTGTAACATGACCATTAGAAAATAGCGAAAGGAGTATACAAGATATAAGCTCTGGCTTTCATATTTCAGGTCAATGGAG
TAGATTCACCTAATTTGTCTTAAAAAATTAAATTGTTTCTCAGCCACCTCTTAATTTAAACTAAAATGTTAATATTACCCACTAGTGTAAAGCTGCAGGT
TGATTGAACAGACACGGTCAAATATACAAATACGCCCAGCATTAATATTTTTTTAATTTGATATAATTTTGAAGTTTTTTAAAAAATTACTAGAGTATTA
TATGTATATGTGGCTGGCGTCATGGTAGTCGAAACAATTCAATAATATTAACAAAAAAATGTAGTGTTGTATTAGAGCCAAAATGTATTTAAAGTATTGG
CTGGGTATATGTGAAAAATTACTAAAATTTCAATAAAAGGTATAAATATGTTTTGAATTCACAATTTTATAGGCATAATTGGTTCATTAGGTTGCTTTCA
TCAAACTCTATTGAGTTGTAATATTTCCTTTTCTTATTGAACGTCTGTGTTACCTATGTAATTATATTATTTTCAAAGTTAAATATCCAAAATATATCCA
TAAAAAGACTGTAATTAGTCCTTGAATGTGTGAAGATTAAACAAATACTCTATCTATGTGATTGCAGAATGAAGAATCTATGTTAACACACATTATTATT
ATCAAGAAAAAATAACCGGAATACGATCTAAGTAAACAAAAATATAACTAAATACTTTGATATTACTATGCGACTCCAAAATCAAAACACCTAAACTGTT
TCAAAATAAAGAGTTGTACTCCTTCTGCCTAAAAATAGATATCAGCAATATTTGCCCACTTTATATAATTAATGGATAATTTATTTTAATTTCTAATTTA
TCCTCATCATTAATTATAGTAATTTTTTTATTATATTTCTAAAGACATTATATTTATTATATTCAAAAAATGATATAGTTAAAATTATCCTTCTGTTTGT
AGTTTTTTTTTTCTACGTATTATTGGACAGTACGTCACCGTTTAATCCAAGTAGTATTAAAATGTGCCCACTAGTCACCAGGTCAGTTTCTTGATTGAAC
AGCGGCCTGTTGGCTATACTGTTGCATTTTTGTTTTTGTTGTATTTGAAGAGAAAAGAGATTAAAAATAATGTGGCTCAAAGTTAAATAGAGACCATTGT
CCAGTTCCCACTAATTAATTCAAAATATTAAAATTATTTTGGAGGCTTGAAACTATCTCCTGATTAATTAGAAGCAGTCGTCGCTAACTCATTGAAATAA
CGCGTTACTTACCTATCCAACTTACCAGGTAAAAATCAAAGACTTCCCTTCCTATATATACTCTATCCTTCTCTATTCCCTTTCATCAGTAGTAATTAAG
TTTTAAATTTGTCATAAATAGTATATAAATTACTCCACTTTTCAAATCCCTATAACTAAAACACATAACGATGAAATTGTCAACTTTGTTCATCTTATAT
TTTTTCACTGTTTCTACACTTGCAAATGCATCTCTTAAGATTGGTTACTACCATTCAAGTTGCCCAAATGCAGAATCCATTGTCAGAAAAGCAGTCAACA
AAGCCGTCTCTCGTAACCCTGGCCTTGGCGCTGGCATTATCAGGATGCATTTCCATGATTGTTTTGTTAGGGTACGTCTCATTTTTTTAGAGAGTCAAAC
AATTTTTTCTTTTGATTTTGATTTTGTGCGATGAAATTAGTAAAATGTTAGTTCAACTGACAATATCTAACTTCATATAAATGATTCAGGGATGTGATGC
CTCAATCCTTTTGGATCCAACTCCAGGGAATCCAACAGAAAAAGAACATCCAGCAAATAATCCA