BAC Sequence – LE_HBa0111P03

>C04HBa0111P03.1
AAGCTTTCTTAGCCTCCTCAGTTTCCCCAGCCCCCAATAAAGCCACAGCCTTATTGAGCTGTGCTCTCCAGTGATTCGGCCAAACACTTAGTACCCTAGT
GTACATCTCTGAAGCACGCTGATACCTACCCATATCCATGTAAAGTCCACCTAAATTGTACAAGGCATCAACATGACCAGGTTTCAAATCAATAGCTCTC
TGAAACTCCTTAATAGCATTATCATCATCACCCATTGCGTGCAATGCAGAAGCAAGATCACAATGTGCATCAGCATAGTCACTCTTCATATAAATGGCCT
CTTCTAATGCCTTAACAGCTGCCTTATACTCACCCACGCCAAAAAGTGCACTACCCAAAAGTTTCAAAGCTCTAAAATGAGTTGGACACAAAATAGCAGC
CTCTCTATAATGTTCACAGGCACTTATAACCATACCTTCGCCTTCAAGAGCAATTCCCAAATTCACATGAATCTGAGGAAGCAAATAAGCCCACTGACTG
CCACCAGCTTCAGCAGCCTCCAATGCCAGCAAGAACTCCTCTTTCGACTCACTATGTCTCCCGAGCACATACAAACAATTGCCAGCCCTGAAATGTGGCC
TAACATCAGCAGGCTGCAACTCACAAGCTCTCTTAAAGCTCACCAGTGCTTCCTTAAACAAATGTTGATCATACAAAACCCTGCCAATTGCCATGTGACC
ATCAAAAGCTTCTTCCCTTGACCTCGATCCATCAGCCCTCGACCTCAACACACCCAATTCCTTCACAAACACAGCATAGTCATGTCCAGTCTCCTCCCAG
TTAACACGTTTATCCGTAATCTCCGTCGAAGGCCCTAATTCCCTAGACCAACCTTCCGAATAAACATCAAAATTATCATTCTTCAGCTTCCCATCTTTCG
ATTGTTTCGATTTAAGCCTCTTGATCAATATCTCAAGGTCATCTACAAGCTTCCAAGTATCATCAAACACAATGCCATGATTCGGAGAAGCTGCCCAAGC
TGCAGTCCGCTGTTTCTTATGAGGCTCCATCACTCTCTCATCCGCAATCGACGACGAAGAAGCCTCCTCCGCAGCAATTGAAGTTCCAGCATTATCCTCC
GGCTTAAGCTCAAGCCCAAGAGCGTCAAAATCACGATCAACATCACCAGCACCATCATCATACGTACGCAAAAGTCCCTCATAAGTAAGCCCCTTTTCAC
CATCAATAAACTCGCTGTACGTACGGAAAACCTCATCGAGAATAGCATTAATTTGCTCTTCGCTAAACTTAACCCTAGGGTTTACAGCAACCACCAAAGC
TGCCATTTCCTCTCGATTAAGACCTCCATCATGATTACCATCAAATTGCTGAAAAATCCTCTTCACCTTCTCCGATCTGCTTCCCCTCGTAGCCATTTCC
CAAAAATTAACACCAATTCAAGTACAAATTCTAACCTTTCACGTTATTGGGTGTCGAAAGCTTCAATCAAGATTCAAACTTGGCGGATAAAAGGTAGAGA
ACCTGTAAAAATTAGGGTTTTATACTGAAAGCAAAAAAAGATGGGATTTTTAGGGTTAGGGTTTCAAAAAGAAGATAAATTAAGGAAAATTGGAGAAATA
GAAAAATGGGTATTGAAAAAAGATTAAATTTTTGCTATAATTTGGATCTGGAGAAAGAGAAAAAGGGCAAAGAGGAAGAAGAAGAAGAAGAAGACAACTG
TTTTCTGTTTACATTTTTTTTTCTTTTTTCTTTTTGTTCTTCTTCTGGTTGTGATGATGGGGAGTGGTGGTGGGGCAGAGTGACTGGAAAATTTCAAAGA
TCATAGAATTTTTTTAATTTATTTTTATTGTTGCTTTTTTTAATTTGTTTGGCTAAAATAAGAAAAAGTTTCCAACTGTCAAAGGAAAAAAGAGGTACTT
AGTTAAAAAGAAAGAAAAAAGTGATTTTTGAGATTTTACATTTTAATTGGTAGATGAGAACATGTGAGTTAATGATGATTAGTAATAGACACAACACAAG
TCAATGTCATGCATTATTTATTTTGGGTTAGGTTAAAGTTTATCTACCTAGGGTATTTTTAAATTAGGAGGTTAATACTGTGTATTGTTTAGTTAATTTA
TGATTAAGCATCAATTAATATGAATATTGTGATAAAATATTTACATCAATTCTTATTTTTGGAGAGTTTGTAAAATTCAAAATAGACAAATAAAACTAAA
TGAATAAGAAAAAACAATACATTTAGTTTGAAGGTTGCAAAGAAAATATGATTTAATGATAATCATGTTTGGGAAGACATATGTTTATGCATTTTATTTA
GTTGTGAATAATTCTTTACTATATTGGTGTGTTTATTTAGTCATATGTTTTGTGAATCATATTTAACTTCAACTCATTTTATTATATTTGTAATTGTTTT
CATGTTTTATTACATGTATTTTGATCTTTTATTACATGTATCTTGATCACACTTATGAAGAGGTACACATAAATAGCATTAATCTAATACGAATGAAATT
TTATAATAGTGATTAGATATATAATTTATATGTTTTAGATCGTTATAATAACAAAACCTAATAATACAATTATTATATCACTTCAAATTTTATATTTTAT
TTTATGACTATTATTTTAAATTTTCATAGAAAATTCTCTTTCGGTGAGTTAATTCTTCATAAATTTTACCTTTTAAATTGACAATGAAACAAGAAAATTT
TGGATTACCCTTGTATCGAATTGATTTTGCTGTTTAATTTGGAAAAAGAAAGTCATTTAAAAGTGACATATAGAGATAAATATTATATATTTTGCTTGAA
AGTTACACATTGCATTGTCATAACCTTGTTCTTGTAGTTAACTTATTCTTGAAAATTATTATTAATTAGTATTAATTCAGTGATATTGATTGATGAGTTG
AAGAATTAATGAACAAAATCCAAATCTATGATCTTTAATTCCAATTTTACTCACATTATGAAGTTTTCTTCTAACTTCATGGCTGCCACTCATCCTATTT
CTATCTTCAAATAATTTTTAGTCAATGTTGATCATTATTTATTCATAACTTAAAAACTATATTTCCACAACTTAATTTAAATGGAACCAAAATCATATCT
AGACTATTAACATTCATAATTAAACATGTACATTACTTATTTCAAGTAGTTAGTTAGTTAGTTACTTTCCATTTTATAGTTGGTGATGTCATAGTTAGTT
ATGTAACTAATTAGTTTGTTAGATTGTTAGGTTGTTGGGTTAGTTACTCTTTTCTTTCTCCACTAGATTGATTCATACAAATCACATGTATATATACACC
TCTTGGGTGATCAATGCAATCAATCAATCACATTCTACAATACAATCTCAAGAGTATACTTTGGTATTTTGCTTATGGAACTTCACAGCCTCATCAATGG
CTGCTCAAGTTCACCTTGAAGGTTTTAATATGGTATCAAAGCACAGTGAATTGCTCTCTTCTCTTTGGTTTAGTTACGTGTCTTAGCAATCGATAGTAGA
TCCTGAAGTTACTCTGTTGATTACTTTTGTTTTCCAGAAACTTTCCATCTCTATTCATCTTCGTTTTGCATCTCTGTTTCTCTTCTTCTTTTGCTCATCG
AATAGCTTAGTTGTGATGGCTGTTGAAGCTGTGGCATCCACATCTGAAGGGTCTGTCACATCTAGAAACGATACAAATGGTGTTGTGTATGTACATCCCT
CGGATAATCCAGGGATGATGCTTGTTCCTGTCCAATTTGATGGAACAGGATATAGGTCTTGGAGAAGAGGTGTAATGAGGGCCTTGTCAGTGAAAAATAA
ATTGGGTTTCATTGATGGAAGTTGTGAGAAACCAAACAACAATCCATCTCAATTACGTCAATGGCAAAGATGTGATGATATGGTGACATCTTGGATACTA
AACTCTTTAATCAAAGAAGTTTCAGATAGTGTGGAATACGTTAACAATTCTGCTGAGTTATGGAAGAAGTTGGAAGATAGGTATGATCAAACTAATGGAG
CAAAATTGTATCAAATCCAAAAGGAGATCAATGATCTCACACAAGGAGTTTTGGACATCACTGTCTATTACACAAGAATGAAGAAGTTGTGGGAAGACTT
AAACACTTTGAATGTGAAAAACCATTGTAGCTGTGTGTGTGTATGTGGTGCGAAAGATGGTATATACAAGGCTGAGCAAGATAGGCGGTTAATTCATTTT
CTTATGGGATTAAATGAAGTGTACACAGTGATAAGAGGAAACATTCTCATGATGAATCCTCTTCCATCCATGGGGCAGGCTTTCTCATTACTAATCCAAG
AGGAAAAGCAAAGAGAGCTCAAGCCTGTTGGTAGAACAGATTCTGTTTCCCTGAATGTTAAAGCTGTTGATAACAAAGGCCATGGAGGAAGACCTTTTAG
AACAAATTTTCAAGGGAATAACTATGCAAATGGCTATGGAAATCATAGTGATACTAACAGTAACTCAGGAGGGAGTTTTTATCCAAACAACAGGAATGTC
ATAATATGTGACTACTGTAAGAGGACTGGGCACATCAAAGATAAATGTTACAAGCTGCATGGGTATCCCCAAAGCAACAATAATCAAAATAATAGATCAG
GAAATTACAGTGGTGGTCAGAGTTCTAGACAACAAGGCTCAAATTACAAAGGAAGAAGAGTGGTAGCAAATGTACATGGTACTATAGGTGATGTGGTGTC
TGGTAATGGAGAGGAACAATCACAATCTCAAGGTGACAACTCAAAGAATGTTAACTTCACAAGAGAACAATATGGACAGATCATGAATTTATTGCAACAT
TTCCAAAATGGGAATATGGGAGAAGAGACTGGGGCTAACAATGCTTCTGGTGTGGCTACTGGATCAATGAATTTTGCAGGTACTGTGTTTTGTTCTTCCT
CTACTGTTGTTGACAATCCATCTTGCAAATGTTTCGAATCAAGTGCTAATTTGTGGATCATTGATTCAAGAACCTTTAGTAGAAACTCTCTAAGGAACAT
TAAAACCTTACCTTTTCCTATACTTGTTTCTCTTCCAAATGGATACAAAGTCAAAGTAACAGAATTTGGGGAAGTACCAGTCACACCTAGCATTATTTTA
CATCAAGTTTTATATGTGCCTTCTTTTAAGTATAATCTAGTTTCAGTTCAATCCCTAACTGCTACAATGAAGTGCATAGTCATGTTCACTAATGCATTGT
GTCTATTGCAGGCCCCTTTAGTGAAGAGGCCTCAGGTTCTTGGTAATTGTAGAGATGGGCTTTACTTCTTGTGCACAAAGTGTTTGAAGGCTTCTAATAA
GGTCAATACATGTCAGATATGCTGTTGTTTTTCCAATAATAGAACTTTGTCTAGTTCCATTAAAGATGATACATGTAATTCTTTTTCTGCTAGTCCTTGT
TTTTCAGATCAGTTCAAAGTGTTGGTTTCTAATTCTGTTCCTCTTAAGTGTAAATTTTCTCCTAATAATATGAATGTTCTGGATGATCACAACTCTTGTA
GTGTTACAGGAGATAATGTAGATTTGTTATGGCACAATAGACTTGGCCATGTACCTTTTGCTAAGATGAAAAGTATTACTGACTTACCAGTTGTTTTCTC
TCCCAAACAACCTTTTTCCTGCAACATTTGTCCAATGTCAAGACAACAAAGGCTACCTTTTAACCATAGTAACAGCCAAACCAAATCCATTTTTGAACTA
CTACACATTGACTTATGGGGACCTTATCATGCATCTACATATGACAACTACAGATACTTCATTACATTGGTGGATGATTATAGTAGATCAACTTGGACAC
AACTTTTAAGTACCAAGAGTAATGCATTACAAGTTTTAAAGAATTTTACAGTCATGGTGGAGAATCAGTTTAATACCACAGTGAAAAGCATTAGAACAGA
TAATGGACTAGAGTTTGTTAATAATGAAACACACCAATTTCTTCTATCCAAAGGGATTACCCACCAGAAAACTTGCCCTTACACATCTCAACAAAACAGT
ATAGTGGAAAGAAAACATAAATACTTGTTGGAAACAGCTAGAGCACTTCTATTTCAATCTAAACTACCTATAAGATACCGGGGAGAGTGTGTGTTAACAG
CTACACATCTTATTAACAGACTTCCATCAAGTTATTTGGAAAATAAGTGTCCATATGAAGTGTTATACAATAAGAAACCAAACTATAGTCAACTTAGATC
CTTTGGTTGTCTTTGTTACCCCACTATTCCAAAGGTACTTAGAGACAAGTTTGAACCAAAAACCACACCACACATTTTTTTAGGATATATTTTTGGAACC
AAAGGTTATAAGGTGATGAGTCTGACTACAAAGAAGATACATATCTCCAGAGATGTGATTTTCCATGAACATGTTTTTCCTTTTGCTTTGTCAACTGAAA
GTCCTTCTTTTCCTTCTGTTTTAAAGTCTTTTTCATCTTCTGATTATGCTGATTTAGATTCATATAAAGGTTATGTAAATGATTGTGACAATGTGACTGA
TACAACTCCTCCTCATATATCTTCTCACATTACTCAAAATCCCAGTATATCTTCCAGTGCTCCTATTACCTCTTCAACATCATCCCAACACAATACTCCC
ACAATAGTACAGAGAAGATCTCATTGGGAAAATAAAATACCATCACATTTGAAAGATTATGTTATCAATATCCCAAAACTAAAATCAGTCAACTCCAACA
CACAAACACAGAGATCAACAATAATTTATCCCTTACTGCATTATTTACCAAACACCACCATATATCTCCTGAAGTCATTGCATTTACTAGTCAGTCACTT
GTTGAGAACATTTGTCATGATAGTGAGCCATCATCATATGAGGAAGCATCATTGAATCCTGCATGGCAAAAGGCCATGATACAAGAGTTTGAAGCACTGT
ATGTTAATGACACTTGGGATCTTGTTACTTTACCACCAAACAAACAAGCAGTTGGATGTAGGTGGGTATACAAAGTAAAACACAAAGCAGATGGAAGCAT
AGAAAGGTTCAAGGCACGATTGGTTGTGAAGGGGTATACACAACAGGCTGAAATTGATTACACTGAAACTTATTCACCTGTAGTCAAGATGACCACAGTG
AGAACTTTGATAGCATGTGCAATAAAGAAGGGTTGGAGTATGCTTCAACTTGATGTAAATAATGCATTCCTTCATGGAGATCTTCATGAAGAGGTTTACA
TGAAATTACCTCCAGGACTTGAAGTACCTAATTTAGAGCTAGTTTGTAAGCTGAAAAAGTCTCTTTATGGCCTCAAACAAGCAAGTAGGCAGTGGTATTC
TAAGCTAACTGAGGCATTATCATCTAGAGGCTACTCACATTCACAATTTGATCATTCTTTGTTTTACAGAAAGGAAGGTTCTTTGGCTGTATTTGTTGCA
GTATATGTAGATGATGTTATTTTAACAGAGACAGACACAACTGAGATTGCACATCTCAAAGTATATCTAGACAACACCTTTAAGATCAAAGATCTTGGAA
GGCTTCACTATTTTCTGGGCCTGGAGATTCTTGATACAACAGATGGAGTACTGATTTCTCAGAGGAAGTTTACTCTAGACTTACTCAAAGAATATGATTG
TTTCAACTATACACCTCTATCATCTCCTTTGGATCCCACTGTGAAGTTGAAAGCCAAGGAAGGAGTTCCTTTGCCTGATCCTACTTTCTACAGAAAATTG
ATAGGAAAGTTGAATTTCTTAACTAATACTAGATTGGACATAGCTTTTAGTGTTCAACACTTAAGCCAATTCATGCAAGATCCACGAGCTCCACATTTAC
AAGCAGCTTATCATCTACTTAGATACCTCAAACAAGATACTACTTTAGGAGTTCGGTTATCCAAGAATCCTGATTGTACAGTCCAAGCATTTTGTGATTC
AGATTGGGCATCATGTCCAGATTCAAGGAAGTCAGTCAGTGGGTACTTGGTGTTGCTTGGTAACAGTCCTATTAGCTGGAAATCTAAGAAACAAGAGACA
GTTTCACTATCTTCAGCAGAAGCAGAGTATAGGTCACTCAGAAAGGTTGTAGGAGAATTAACTTGGCTTCACAGATTGATCACTGAGCTAACTGTCTCTA
TTTCCTCTCCTATTAGTGTCTACTGTGACAGTCAATCTGCAATCCATATTGCTCGATATCCTGTGTTTCATGAGAGAACTAAACACATTGAAGTGGATTG
TCATTTCGTACGTAATAAGCTTCAAGAGGGGTTGATTTCTTTGCATCATGTGTCTACCTCTAATCAACTTGCTGACATTCTTACTAAGGCCCTCACTAGC
ATCAAGCATTCGGCCATTTTGCGCAAGTTGGCTGTGAAATCATCACCTCCAACTTGAGGAGGGGTATTAACATTCATAATTAAACATGTACATTACTTAT
TTCAAGTAGTTAGTTAGTTAGTTACTTTCCATTTTATAGTTGGTGATGTCATAGTTAGTTATGTAACTAATTAGTTTGTTAGATTGTTAGGTTGTTGGGT
TAGTTACTCTTTTCTTTCTCCACTAGATTGATTCATACAAATCACATGTATATATACACCTCTTGGGTGATCAATGCAATCAATCAATCACTTTCTACAA
TACAATCTCAAGAGTATACTTTGCTATTTTGCTTATGGAACTTCACAGCCTCATCAATGGCTGCTCAAGTTCACCTTGAAGGTTTTAATATAGACGAAAA
GTTAATTCGAGTAGTTCAAATCCCCTTTTTAACTACATGAATCATGATCATACAACATGTTGAAGTTTTTATTTTACTCGAACAATACAATTTTACAAGT
CTTACAAATAGAATCTAAAAAGGGTCGTGTACGCAAACCTTATCCCCATCTATAATACTACATATAATAATACTATATCCGATCAAGTCAAGTAAAACAA
AAAACACAACATTTACCAAGTTACAAGCAGCAAACTCCATTTCACTTGAGCAATTTGCATAAATAACCTTTTTAAGGTTACTATTTTAGATTATGTCCCA
ATTAATCCAATGTGCTAAATTTATTCCACAAATGAACTAACAAGTACAACATGGATACAATGTAAAGAGTGTACTTGAAAAGATGTTACAAAGATCGTGA
TAAAAGTAATAAATATTTTTTTATTATTAATCAAAAATTTTAAAAGAAAATACTTTATTGTAATACGAGACTTTTTAATGTAAATTCAAATTCTAACGTG
AAAAATAAAATTTTCTCATTTTTATCGGTGCTTATTTAATTCCTTGCAAATTCCAGTTGAGTCGTTATAGTTTGAGCGGTAGCTGTTTATTTCAAAGTTC
CGTACAAATCGCTTAAAAATGGAAACACAGAAAACAGTGAGCGTTCCAGAAAAATTCTCAGCTCAAATTTGTTACATTTTTTCGACCATAAATCTCAAAT
TCCGAGTTTTTAGCGTGTTTTCAGCTCACCCCATTATCTTTACAACAGCAAATATCATCATCTTCATCCTCTCCTCCCAAAAAAGAAAAAATCATAACAG
TTTCTTCTTTTTCTTGCATAAACCACAAAACTTTAATTGCTGTACTTTGGTTTGCCAAAGATAATTTTCAAATACCACTACCAGCACAAAAGGTGAGCAA
GGTGATGACTATTCTTGGCAATAATTTGAAAAATATGGAGCTTTTTGTAAATGATTATGGTTCAGTTTGTGGGGTTGAGGTGTTTGATGAAATGCGTCTA
AGAACATGTTATGAGCTAAAGAACCAATTTTTAGGTGTTTTTTTGTTACTTTTTTTTTCCCTTAGTTTGTGGGGTTGAGTTGTTTGACAGAATGCATTCA
AGAGTTTCAATTTTATGAGCTAAAGAGCCCATTTTTAGGTGTTTTTTTTAATTACTGATCTTTTTGAGTTTGTGGGGTTGAGTTGTTTGACAGAATGCAT
CCAAGAATTGCATGTTTATGAAATAAAGAACCCATTTTTAGGTGCTTTGATTTCCGTAACTATTTTTCTTAGTTTGTGGGGTTGAGTTGTTTGACAGAAT
GCATCCAAGAATTGCATGTTTATGAGCTAAAGAACGTATTTTTAGGTGCTTTGGTTTCCATTACTATTTTTCTCAGTTTGTGGGGTTGAGTTTTTGACAG
AACGCATCCAAGAACTACATGTTTATGAGTTATAGAAAACATTTTTAGGTGTTTTTTGCTCTTTTTCCCCCCCTGATGTTCTGTTGTCTGAATTTTGGCA
GATAAGAAGATCATATACGAGGTTTTTAATCAAATTAGGCATATACAGAGGGTAGGGAGGTGGTTATAAGGCAGTTCCTCTCTTTTAATACAAAGAGAGG
GACCATATGAAGATTTGTAATTCATTGATATAATCTATTTGCTGGTCCTCTTCAAGTGCATTGATTCTGGGGAAAGAAGAGGGTGCTAAAAATGAGCTCA
GTTTATGGGGAGGAGGCATCTCAATATGGTGATGATCACGGATCAGTTGCACATGAAGAGAAAGAGAAGATTTTTGTTGCAGTTAGATTGAGACCTTTGA
ATGAGAGGGAGATTACATGTAACGATGTCTCGGATTGGGAATGCATCAATAACACCACAATTTTTTATAAAAATTCTATGTCAGAGCGTTCATTGTTTCC
AACTGCTTGTGCATATGGTAAGCTTCTTCACATATTCATTTTCCTTTGCGTTGTGTTTTTATTTTTTGAATTGAAAAGATTCCTCCTTAAAATTGGTGTA
TGAAATTGAACAGACCGAGTATTTGGGTATGATTGCTCCACAAGGCAGGTGTATGAGGAAGCCGCCAAAGGAGTTGCTCTTTCAGTTCTTAGTGGTATTA
ATTGTAAGTACTAGCCCTTGTTCACGGTCCATTTTCTGCACCTACATAATGATGTTACAGTAATAACGTATGAAATGTCTTTGCAGCAAGTATCTTCGCA
TATGGACAGACAAGTAGTGGGAAAACGTATACTATGTCTGGAATCACCGAATACACATTAGCAGATATATATGATCATATATGCAGGGTGGGTAAACCTT
TCCTATTCTTCAATGCAATTAATTTATGCTGTACAAAATTCAGAGTGTCTGATGCTTTTAAGGTGCCTTTTTATTTTCAAAAACTTTTAGAACGTAGACC
GAGAATTTACACTAAAATTCTCTGCCATGGAGATATACAATGAAGTTGTTAGAGACCTTCTAACCCCAGAGGACACTCCACTTAGACTCCTCGATGATCC
AGAGGTGAATATATGTTTTAAGCATGATCAAGTTTTGTTTTATTCACAGACAATATTATGCAAGTAAGTAACCTCTTTCATTTACAGAGAGGAACTGTAG
TTGAAAAACTTACAGAGATAACACTGAAGGACTGGAACCATCTAAAAGAACTGCTGTCAGTATGTGAAGGTAAAAGGCTGAGACTGCTGTGTAGTGTTTC
CAGCAAGTTAATATGATATACTTCAATTGTTACCATTCTTGCAGCTCAAAGGAAAATAGGAGAAACTGCTCTCAACGAAGTGAGCTCAAGATCTCACCAG
ATTCTGCGTTTGGTTAGTGCATTGGTTACAAGATGGTTTATGAATAATAATATATAAAGGAAATACATCATTTCTTGACTTGGACAAATGATCTTTTTGC
AGACAGTTGAAAGTACCGCTAAGAAATTTGTTGGCTTAAACTCAAGCACTCTGACAGCTGCAGTGGTGAGGAAAATTACCTCTGCACGGACATCACTTAG
AAAGATTATTGGAGTCCTTAGTTCCTATGAAAATGATTGATAGACAATATTTTGTTCTTCTTCCTGCAGAATTTTGTTGATCTTGCTGGAAGTGAGCGTG
CTTCTCAAACCATGTCAGCAAATGTAAGACTGAAAGAAGGCAGCCACATCAATCGCAGTTTGCTGACTCTTGGAACTGTCATTCGCAAATTAAGGTTGCC
ACATAACTACAGTTTGCTGAGCTTCAAATTTGTTTTTGTTTTGGCTTCTTCCTTAGATCGCTAAAAGGCTATTTCTAAGTCTTGTTCATCAATATAATTT
TGTACTTTTATCAGCAAAAAAGGAAATGGACATATTCCTTTCAGAGACTCGAAGCTGACACGCATACTACAGAATTCATTGGGAGGCAATGCCAGAACTG
CCATCATTTGCACCATGAGTCCTGCACATAGCCATGTTGAGCAATCCAGGAACACTTTGTTGTTTGCAACTTGTGCCAAGAATGTTATTACTAACGCAAA
AGTTAACGTGGTAATGTCAGAGAAGGCACTGGTGAAACAATTACGAAAAGAACTAGCTAGATTGGAAGCTGAGCTAAGGAGTTTATCGGCACTTGCTGCC
TCAGGTGGATCGTCAGAGGCTCTGAAAGAAAAGGAGGATCTGATTGAAAAGGTACCAATGGTTAACCTTTGCAATATCTAGTATTCTGGGGAACTCCTAC
AATATCTTTTCATACATTGTTCTTCAACCTAATTTTGATCTCTTAGGACTTCTCCATCATGCCTATAAGACATGGCAAGACAAGAATTGTTCCAAAACTA
AATGTCTCAATGATGATTTATCTTTTGGTTTGCTATGGATCTCAAAAACTTACTGTTTTAGCATCAAACATGTGAGTCGATTAATATATATGTCTGCCTT
TTGGTGCAGTTTGGGCGCAGGACGTTAGTATTTGTCATAGATGACAGTTCAGATTCAGTGTTTCTCAATGATTAAATATTTATCTAACTTCAATTGCTTG
AACTTTGATCTAAGTATAGTGGCTTTCATTCAAGACAAGATATCCATAACCTATTCCCTTTTTGTATCACGATGCAGATGAGCAGAGAAATAAGGGAGCT
AACCCAGCAGCGTGATCTTGCTCAATCTCGTTTTCACAATTTTCCAAGTTCAGGGTCATGGGTACGTGTAGTTAGTCTTGAATGAGCTCATAAACTTTTC
AATTCATAATATACATCGGGGAGCTTAATCTGTTCTCTCTCTCTTGTAGACTGAACTGAGTAGTGTGTCATCTCCTGATAAGGCCCAATGGCTGGATGAC
TGTGCAGCATCAGAAGTATCAGAATGTGTATATCCTTTTCGTCCTGATGGTGTATCCGCTGTATCTCAATATGGCAGATACGGAGGCCTTAATTCTAACA
AGCTAGGTGAGCAGATTCCTGAACCTCCAGAAGATCAGTATCTCTGTGATGACACCTCCCCAAGGCTGTTTATTGAGAAATATTTTGGACCTGATCCATG
TAAGGGATGGGAAAATAGTGCTCAAAGAACTGTTCAAAATTTGGAAGATAACTGCAAGGAAGTACAATGTGTTGAAGTGGATTCGAACACGAAGAGTATA
AGCTCTGATAAACATTCATCACCTCGAAAGGGAGATCAGGAGTCAAGTTTCATTGACAGAGATCATAACGATAAGGAACCAAAGCAAACTAGCAATCTAG
TCGTGGAACACTCTTCTTCTTCTTCTTCCGACACAGATTCTGACTCAAATAATTTACCAAGGAGCAGAAGCAGTGAAGCAATTATCATTAACGTGCCAGT
ATCAGAAGGATCTGAAGTAATTAAGGAAAATGTGGACATATCAAGTAAATCTGAGGAAGAGTTATCTATTAAAAAGATTGATATTGAGGAGAAACCTTCT
CAGCCGGAGCTTTCTGCTGATAATGTTAAGTTGTTATCAAAAGAACACAACCGCAGTTTTACGATTGAAGTAAAGCTCAAAATGTCAGGTGAAGACTGTG
AGAAGATTTGTGCTGAGGAACCAAAAATGTCCGGTGAAGATAGCATAAAAATTTGTGCAGAGGGTGAGGTTGCCAAATCTGTGCCTGAGAAGCAATCAGG
GGATAATTTGGTAAGTAACTTTCTGCTTGAGATTAATAGCTAGAACTGCACATCTCTTCAACACAAAAAAATTCTTAAATGTGCTTCTAATGTATATCGA
TATACATACTTTGATAAGTTCGTATAGAGATCATAAGAAATTAACTTTATCTTGTTAGGTCCAGGATGATGAGCACACCTCCAAGGACTTGGGAAACTTT
GCCGCTGATTCCTTAAATTCAGAGAATGAATCAGAATTATCTCCTTCCAGACAGTGGATGGAATTTGAGAAACAAAGGCAAGAGATAATAGAACTATGGA
ATGCATGCAATGTGCCCCTTGTTCACAGAACATACTTTTTCCTACTCTTCAAAGGGGATCCAACTGACTCAGTTTACATGGAGGTGGAGCTTAGAAGACT
GTCCTATCTTAAGAACGCATTCTCTTTAGGAGCTAAAGTTGTGAAAGACGGTCAAATTTTCTCACAGGCTGCAAGGTACTCATTTATATCTTTTTCTTTT
CTGTAGTTTTTGGAGATTTCTTGCATGGGCTGCTATGTCTCAAGTTCTGTCTAACTTTCACAAGCAATGAGACAAGACAAATTTCATATCGGGAAAATGG
TCAAAAATACCCCTCTAGTATCCGAAATATCTTAATTTTACTCTCCATTACACTTTAGATCATTCATACCCTTAGCAATTCGTCTCATATATGTCCATGA
TGATAACGAAGTTCTAACATGAAGTATAACAAAGGGTAATTTTTAACCAAAAGTAGAGTCTAACACCTTTTCCCTAGAATTATTTTCACATGTGGAGTCC
ACATTAGAGCTCTGCTAAAGTCAAGGGCAAATATGAGACAATGTGCTAACAGCAAGTCCAAAAATATAGTGGGGAGTAAGATTAAGATGTTTCGTACAGT
AGAAGAAGGGTAGATTTCGAAGTTTTTTCCTTTAATATATTTCAAGCATGCAAAATTAATCTATCTGAAAGTATGATAAAAATTGATCCTGAAGTACTCT
AATCCTTTCGAACAGTTTAAATGCTCTGAATCGCGAGAGGGAAATGCTGAGCAAGTTGCTTCTTAAGAAGTTTTCTTCAAAGGAGAGAGACAGCTTATAC
GAGAAACGGGGCATTGGTCTTAAAACTAAAAAAAGAAGACTTCAACTGTGCCATCAGTTATGGAAAGATACCAAAGACATGGATCACATTAAGGAAAGTG
CAGCACTCATCTCAAAATTAGTTGGATTCGAAGCACAAAACGAAGTCCCAAAAGAGATGTTTGAACTCAACTTCTCACCAGGGCCAAAAAATCTCAGGTC
TTTCAGCTGGAAACCAAGAAAAGCCTAATGTGATCTTCTAATGCAAAAGATTTAAGGATTATTTGAAGCATTGTAGTGGCTTCAAAATGAATTAACCCCC
CCTAATTCATGTAAAGTTTAGAAGTTAAACCACCCCCATAGTATCTAAATATACACAAAAGATGTCCCATACTTGTACTTAATACACCTTCTCCCTACTC
ATCGACCGAGCCTTATTAATGTACATTATGTATATTCAATCCACAACCTCGAGATCTCAAGTTCAGAGAGTCATCCCTGTATGTAGATATAAGTGGAAGA
TATATTGCAGCTTATATGTATGTAAAACAAGACTCAAAATCATTGGGACAGCATAGGATAATTGTCTTCAAAAGGCATCATATTTTGCAGTTTTTTTGTT
CTGGTTGGAATGTAAACCCACAAAACCTTCTTTTCCTTCTCCTTCTCTGTTTGGTTTTTTTCCTGGGATACTTGTCAATACAATTAGGCCAACTAGTTCA
CAAAATATGTACAAAAAAGACCAAAATATAAGTATATAAAACCTATACATTGCATACTCAGCACAAATTCGGCAACGATAACCTTTGTTCATTATAGCAT
TTAACTCGAGATGAATCCTGATCATTTTTTTCGACTACACTCAACAATTCTTTGATCCAAACAAGGTACATTATAATTAGCCGAAACTAACCATTTACCT
GACTTTGAAAGTAAAGCAAAATAATCAAAAAGATGCACTTTACATGAAACTTTGTCAACATATACATCCATTATCGCGATTTAAGAACGGCTCCTTCCAC
AATTTTCCAACCGGAGTTTGCCCAGGACATGTCGTACCTAGTTGTATAGGTAGTACTGTATGAGTCATTGTGCTCTGGATGGGCTACATCAGTTAAACTT
GCTGATTCCTCTAGAGTAGCTTCCACAGTAGCACGTCGGCCATCAGCTGAGACAGTTACACTGTCAATGGCAAGGTTTAAAAGCTTGTACTCCCAAAACC
AACCATGCTGCGCAATTTCTCTTGCACGGTCTGTCCAAATCTTCAGCATCTGACCATCCAAAACCTGTCATTTTGAACAATGTCGTCAGGCAAAATACAA
ATGTGACACCAGAAATAGCAAGGAGGTGTATTAAGCTGCATTTGGACAATAGCAAACAACAAAAAAGATGCTGGGTAGTTCATCACGAAGCAACTCGTGT
TGAGCAGCTGAATTCTACAAGAAATCATTTGGCTCTAACAAAAAGTTGGTGTGTATGACATTTTGCTGTAAAGATATTATCATAACATTGTATAGAAATT
GAAATAGAGCAGCTAACACACAATCCTACCTCTTGCTTTGGCAGGAAGTAAAATCCATTAAGAATTATCTCAAGGCTTTCAGGTTCTATTGCATTTCACG
TCATACTATAGTGAAACATAATCAACACTATAAAAAGTAAGGCATTACATATTCATACCTCTGACAATCTGTTGAGACAGTGATCGGTTCCAAGAGACTG
GGATTTGATATTCTGCCACTTCCGAACTATACTTTCTGCAAGTCTTGCATCCATTCTAGGAACCTCAAGAGGATTTTCAACTGGTGAGGCAGAGGTATCT
GCAGTAGCAGATAAAATTTCTGATATTCAGAAGAAAGGGAAGGTTGGAAAAAGAAAACATAACTGAAACCCTCAGACAAGAATTTAAAAGAACCCCAGAC
TTGAGAAAATATAATAACAATAATAGAAGAAGATAATTTTTATTAGATAGCTGTACAACTACCACTTGTAACAATAAGATTTTTTCTCTCAAATCCAGGT
CGTTCAATGAAGCAGCAGAGAAAAGCAAAAGAGAATGGATCCATAAGGTCATATTTGGTCAACCCCGAGAGTTATTTAGAAACTAAAATGGTCAGTGAGT
CATACCCACATTGATGACATCCGAGGCAATGGCTGAACCAGTAGCACTAGCACAATGTTGAACTGAAGACCCATGTCTAAAGGAAGAAAGCTTCAATCCA
ACCAAAGTAAAGAAACCAACCGCTACTCCAGCACACATAATCTTCAGACTTGCATCTTTTATTCTGTCAGTTATCACATCTTGCTCTTGATAGTTAGAAC
TCTTTCTCTCAGGATCCCCAACAGTCGTAATAAAGTTATTTTGATCACGGAGTTCTTCAAGATCCTCAAATGGCTTAGCAATATCAAATTCGTTCATCTC
ATTGTCACCATATCGTCTTACACTGCCTTCCCCGTCCCCAGCAGGAAAAACTTTCTGCAGTGCCTGAATTGCACTAGCCTTAACACTATCAAGCACAGCT
GTAGCTTCAGCTCCAATCCTTGCAATAGCTGCAGCAGCAGCTAAAGGTGAAGCACCACCACCTTCCAGCCTTTCCAAATATCTTAAAACAGTAGGGTCAT
CATAATAGTCACCAAGCTTAAAAGTGACATCTTCTGTCTCTCTAAATCTGGGAAAGACCACTTCCATCAACCAGGTCTCCAAAAGCTTACATAGTCCAGG
GAGCAGATCATTTTCGTTGTCGTCCTTTGAGTGTTCTGCAACAAAAGTCACTATAGATGGATCTCTATAAGGGGAGTCCTCACTGTCTAGGCCCAACCAA
GAGCGACATCCATCGACTTCTCCAACAAGCAGTGAACAAAGGCCCCTCTCCAAAGCGAAGTCTATTTCACGGTTTTCTCTAACAGTGTATACAGACACAG
AACTGCCGTAAGCTGTAACTTTGGTCTGCTGAAGCTGCTGAAAAAGGTTATCAGCATCTTGAATGAGATGAGGTTTTTTTCCCACAAAAGCTTGAGCAAC
AAGTGCAAGCGCCACCCCGTAAACTTCAAAGCTTTCTGCAGGAATGTTACTTGGCGTTGCGACGAAGAGGTCCACCTTTTAAAAAAGAAGAGGAAAATGA
AGAGAAGGAGTGAAAAGAACAGTTACAAAAGAAACCAAAATAAATGAATGAAGTTAAGCCAACCTGCTCAGCAGCTGTCATCCGTAGGAAGGCCTCATTC
ATGAAATCTTCTCGTGTGAACCCCCCTGAAATTGCAGCTGCTCCTCCTCCTCCAACAGCCCACAAAATGTTGCGCACACCTTGAAGAGCCTCTACTCTTT
TCATTCGGTATTCATCACCAAGAGGAAAAGCTAGAAGTTCAAGTACGTAGCGTGGATTTATCTCTTCTAATGTCTCATCTATCTGGGATTGCAGATCAAG
GGCAAGATTACTTGCACCTTCTTCCTGGAAAAGGAAGGAAGAAAGTTCCTCATTATTTGCTCTTCACTGTAAGCTTACAATTCGACCCAAAAAAGGCATG
CATCAGCATTAAAGCAGGCGAGAGGTAAAGAAAAAGTGCACAGTCACATATACCCCACACACATACATTACCAAAAACAAACAAACAGAGATGTCTTAAG
TGAATCATGGATGACCAAGAAGAGCACTATACTCATTAATAGGTAAATCAAAATGAAGTTAGCAATCAGTACAATGATACAAACCCTCTTCCATTAATAA
AGTCATTTGTCAACAGACATTTGCAGCTGGCAAAAGCTGTGTCATAGTGCATAAACTATAGAAAACAGTTATTTCCATGTGTGTTCCCTTTATAGAATTT
CAAATATACCATCACATTCACTCTAACATACTCATATCATCAGAAGTAACTATACCTGCAACAGCTTAAGTGCTCTTTCAAGCAGTTCACAACCTTGAAC
AAAATCAGGAGGCGAAAGTGCCATCGCATCTCGCGAATGGTCAACATATGCGAGTGCCATAGCTAAGACCACATCTTGCTTGAATGACTTTGGCAACCGC
TCTTTCAGCAAGCTTTCCCCAATCTGAAGAACTACTCCAGTCTCACCAGCTTCTTGCAAAACACACAATGCTCCCGGAACCTGTAAAAGCCATGACATTC
TTTTAAATTCTTTGCATCCCACAACAACTTTTAGAATATTTAAGTTTTATAACCAACCCGGGTATAAATTTTACTACACTATCAGTTAGTTATGTATTGA
GAACTAATTACAAGTAATTCTTAGTAGTAAGTGTAGGATGGTAATCTGGAAAATAGGTAGGTGACATGCTACAACGGGTTAAATTACACTGGTCATGTAC
AAAACCTTTTCTTTAATTTGCATAACTTAAACAATTACCTTTATCAATAGTAAGCGTGGTCTGGTAATCTAGAAAATAAGGTAAGCAACAAGCAACAACT
CAATGAACTACATTGATCATGTTGTTCTCACTATATAAAATCTTATCTTATAACCGCGGAATAGTTTTGGCCCAATCCTTAGGAACAACCGCAGCCTTCA
AAACTCAGGAAAAAGGGCCCGTCCTTCTATCCTTCTCCGCTTAAATACTAGGCTTAGTTTGCATAGCTAGAACCTATGACCCAAATTACAAGTCCTTCAA
CCTTGGCGACTTGAACTAAGCCTAGATGCACTTAAAACTACAAACTTCTACAATTTATTCACTGCTACTTGCAATTGGTAATTTGTAAAATATGATAAGC
AACATGCTACAATTATTAGCTAGATTATACAGATAGTATATAATTGAAAAAAGGCATCTAAGATCAACCTGACTTACTTGGGGAGCATAAGTTAATACAG
ATAAACTTAATTCCAAGTTTCAAACTCCCTATAGCACTTTTCAATTAGCTAAAAAATTATTCAATTAAGAATGTGGGCAGTAAATAAAAAAGTGGAGTAA
TTGAAATGGTACTTTATCCCAGGGGACCGGAGTTAGAATAGTATCGAACTCATGCTGAGCGAGGCCTTGATTGTATTCTCTACGAGAGGTAGAGTCAGCA
AGGGTTTCACAAGCAGCTTGAAGAATCTGTCGTCGGCCAATCAATGCCTCTTGACTGTACCCGTACTGCGGCGGCTTAGTAATTCTAGCATCGTAGCATC
TCCTGATACCATCACCGAGGAAGTGAGCTTCAGCACCAAGCACTCTATAAAAGTCTATAGGCATTGAAATGTGGCGGTCTGAAGGAGCAACGGGAGGAGG
AATAGTCGTAACAGAGGTTGTAGAAGTTGAATTCTGGAAATCCGATGAGTCGGAGGTGGTGGTGGTGGAAGGAAGGAATTGGAAATCGGCGAGAAGACGA
TCCGCCCATTTACTGGCGGAGAAGTTCGTCGGTACACTACTTGTTCCACCGGTAACACTACTAGCTCCTCCGGTAACAGCATTGAGTCTCGGCGGCTTCT
TACCGACGCCGCCGGCTAGTTGATATGGTGGTGAAAGGCGTGCAGTACAAATGCCAAAGCTTAGGTGTGTTAATGCCTCCATTGTTAAGGAAGCTTCAAA
ATGTGCTCATAACTCATTGTTTTTAACTCTTTCAGATATTTTTTGTTCACTCGTAAAGGAATTGGGCCGACTCTTTTCATATGGGCTAAAATTTCTTGTT
GGGCTTCGAAACTGAATCTTATGGATGGATAAGTGGATAGGCCCGTTTCATTTGAATGATTAGATGGATCCAATTGCACGGTTTGCTATTTGAATGAACT
CATCGTAGTCATCGGATATTATGATGCAAAAACAATATAAGTAAAAATAACTTAAATACACAACTATAATTTTTATATTCTTCAATTTTTCCTACTTTTT
TTAAATATTACATAATTCTCTATTTTTTTTATTTTAATGTAAGTTTTTAGATACATTACACTCTCTCTTCTATAATACACATTTACCAATTTTAATGCCT
ATTTTTTCTCCATTAAAACACTCAACCTCTTAAATCAGTTTTTGAATTTTAAATTTATCCATTTAAACACTCAACCTTTTAATCAGCTTTTTGATTTTGA
ATTATTAAATTTAAATAAAAGAACAAATTTTGAAATTTTGAATTTCAAAATTCAAAAAATTAGGAAGCACGGTAACTTCCCATGCATTCTACCGTTTTGT
TCTTACCAAAGTCAACTTTCACTTATTTTTTTTCCTTAATCGTCTTCATTCGACTATTTCTTCATAATTTTGAATCTGCTCAACCCAGCATATTTTTTTA
TTTTCTTCTTTTTATTCTTAATCCATATTCGACTATTTCTTCCTAATCTTGAATCGTAAGAACCCAGACCTTTTTTATAGTTAATCCATCATCAATTCGT
ATATTCTTCTCTTTTTTGTTTTTGTTAATTACATCATAGTAATGGATCCGTCAATTAATAGAAGGATATATGATATTAGTAAAAATTTTAAGAAATTAAA
ATTGTCTCGGGTTAGTATTTTGGTACTTAAAACTGTTGTTAAAATTAGTAAAAATTTTAAGGAATCAAGTGTGCTTGCTGATACATTTGAATAAGTGTGT
ATAGTGTTTTAGATGGTGAATTGATACATGAATTTGTTGTGTATCATAATATTTTATATGTATCATGAAGTTTTGAAAATTGTTATAATGTATCATTCAA
TAAGTTTAGTAAATGCGTCATCAACTGTGCTTGATGATACATATAGAATCAGTGTGTACAGTGTTTAGTCAATGCACTGATACATGTAGTAGATATGTAT
CACATGTTTTGCGTGTAGTATGAATTTCTGAAAACTGATATCATGTATCAGTAAGGTATTAGTTGTTTAGTTGATGTACTGATACATGTTTTGAAAATTG
TTATAATGTATCATTCACTAAGTTTAATAAATGCGTCATCCATTGTACTTGATGATACATATAGAATCAGTGTGTATATTATAGTCGATGTTTCTGATAC
ATGTATTAGATATGAATCACATGTTATAATGTTTTAGTTGATTCACTGATACATGTACGTTGTCGTTTGTCAATGTATTTGCAGGATGAAGTAAAGACCA
AATGAGTAGCGCCAAGTGGGGAGATGACAATGATTTTTGTTTCCAAGATTCTTTTATTTTATGTTGTTAGGACTTAGGAATAGGAGAGATCCAATGACAA
GAGGAGCATGAGTGAAAAATAATTATATTTTTTTTGAGTTTTGTTACTTTTTGTTTTTAATTGCACTAGCAGTTTCCCAGATTATGAAAAAAGTAATACA
ATACAACAAGAGCAGAAACTAACGAGTAAATATGCATTTATATATATTGTCCTCTTCTTATTGCTCTTTCAATTAGTTCAAACCTTTTCCTCAACTTATG
GCTTACTATGACAAATACTTGTATTCTGGGTAGACCAATACACATAAGAAAACAAAAATTGATGGGCGCCACCTACAAAGCAAAAAATTTACAGTAACAG
GAGGCTGCCTGCCTGCTGCTGGGTTGTCTAGGGTCGTACCTTAAAGAAAAAAAAATTGAGATTTCGTAGAGCAAAATTAAATTTCGAATAATGTTTCACT
GTCGAGTTGTACAACTGATTTTTTTTGGGACTAACCTTGCTTAAGAAGCTTGCAATTGAGGACCCACATCTGTGTTTCCACTGACGACTAAATTTCTTTC
CGCCATGATTGTTCATAAAAAATGTTTTCAAAATAGATGATATAATTTTGATTTTCAAAATTTGAAATCAATATCCAATTACGTGCTGATTTTATGGTGA
TTAATGATCTGTTACCTTAAAATTAAGCTGTTTTAGTAACAACATTAATTGTACCATTTTTTCCCCATTTTTTTCTCAATAGTTTAAACTTACCATGTAT
CACTAGAGTTTAAAGTATCACGGAACTACAAATTTAAGGGATTTTTTGTAAATACTAAATTTGTCGGGACAGAATGTAATTATTGAATTACACTATGGGA
TTCCTTAAATTTTTACAAAATATAAATGTAGATTCCGTAAAAAAGTTACTTTCTCCGTTTCATTTCATGTGCCACTTTTCGCATTTCGAGATTCAAACAA
GTCTATCGTTGACCATAAGTTTTTCATAGATTTTTAACATTTTGAATTATTAATTATTATGATTTATAGTACTCTTTATGTAGTTTATAGATATATAAAT
TTCATTTTTGAAAATTTTGAAAATTCCATACGCAAATATCCGGTCAAAGTTAAATTGTTTTATTTTTGAAAAATGAAAAATATCACATAAAATGGGACGG
ATTGAGTATTTATTTTGAGGGCTAAGAATTAAAGACCACAAAATAAGGACAAAACTGCAAAAGACATATTTTATATCAACCTCTAAATTAAAGGAGTTTT
TTATTAGTGAAATTGGACGGAATCATGGTTCAAATGTAAAGGAAAATATTTTATGAAAAATCAGTTTCGTGGTGAAAAATATTTGTGACGCATATAACAA
CTATATTATATGAAAATAAAACACGGTGATAGTGTTTTGATGATCGTAAAATTGTTGTATTTGTAAAGAAAAAAAACAAACAAGTAGAGCTTTAGAAGTT
ACTTGCAATGTTTAAGCTGACCATTTCTAGAGTATTTGACAAACACAAAAAACCAGATTGACATGGAACATATCGCCATTGACAAAACATGAAGACAACT
TCAATCTCACATTCTGCAAGTACAACAATAAAAACGACAACCTTAAATTCATTACATTAAGGGATCGAAATCAAAATCTCTCCGTACTTTTTATCATTAT
CATATTATATCGAACCAAATTAAATCATATATCGAATCCGAATAAGTTCGAATATTGCAACAAATTCATTGCTAATCCGTCCTAATAATTAGTGGGTGGT
CCCATTAACACCACTAAGTATTAATTTTCTCATAGTTGACATTTATAGTCATTTGATTGACTCAAAGAATGCAACTTTATAATTAACAACATCTTAATCA
TGGTCTCTAATCTTATTTACAATGTGTCTTATCTTTCTTTGTTTTTTTTTTCTTGAATACATCATTAAAATAGAGACTATTATTTCACCATTCCACCTAA
TTGTATAAGTAATACCATCTAAATATAATCATTTGGTTACACGAGGAGTAATAGATTATTACTTTTAATTAGTATTAATAGCGAAATCAGAAATTTTAAT
AAGAAGATTCAAAAGTTAACAGTTTTACAAATAAGTTATTGATTCAAGGAGTATTACAGATTTAGTTAGTCTTCTTTTTTCATGTATTAGTAATACGTGA
ATTATAATTTCACGTCTCATTTTTTATGAGATAGCATGCGACCTTCATATATAACTGATACGAGCGTATATTTTATACCTATCTTTTGTGATAGGGATCA
TTTTTGGTAGTGTGGCAAACCAAGAGACCCCATATAGACTAGAGATAACGAGAAATGTTACTATTATTAGGATGTTTAGTTTGTTAGAAATGGTTAACTA
TTTTTGGAGTGACATATATAATATCATTGTATATCTTTTGTAGTAGCAACTGCATCTATGTATACTACTTAATTCACCCCCCTATCTACCTAAAACCAAC
TCAACATATACCATATTTCAACCATAAGAGTTTGAGTAGTGGGTGACAATGAATAGTGGTCCAAAGAATATTGTTCATTGCATTCAACTTCCTCACATCT
TAAAAGTGATATATGGAGTTGAAAGAGGCAATGGCAATAGAACAAGTGGACACACTACCATTAACTATCGTGATGAAATGAAAAGAATTTCTCTCGTTCT
TAACAAAAAGTCTTGGATTCAAACTTTTCAGGCTACGATATTTTTTTAAAAATCTAGTAGTGAGGAGCAAATTACACGGATACTTGATTTTGACGTTGTT
GTTTGACATTTGCTCATTTTTTAAAAATGTATACACACTTTGAAACAATTTCAAATATAGTCAGTTTGACAAAAATCTTAACTTCAAACACAATTTTTAT
AATTTTATATGACTGAAGTTTAAACACATACGACATTGTTAAAATAGACTTTCCCGTGAATTTTTTACGGTTGGAAGCTACTATTTCTCTTATTGTGTTT
GAAGTTTCATATAATTGAAGTCCAAACACACATTTACGACGTCTTATTTGACTTTCTCGTAATATTTTTTTTTATCGTATAGTACTGATGTTTGTCCTAA
TAATTTAATACGACATGAGTCGATATTAAACGAGACAGTAACTTAGATATGATTAAAAAAAATAAATTTAAAAAGTGCAATTGGACACGAAATTAAGAGG
CCCCCACATTGATTGCAAAAAAATGAAAAGAAAAATGGCTTTATTTATTAATCAATCTAAACTTTAAAGAACATATATAATGAAGATATCAGGCTAAAGG
AGTGAACATCGGCTTTTAATGTTATGTACATTATATTATACATATTTGATACTTACATGACCCTCTCAACTAGAAAACACAAAGAATCAAGTCGCATTTA
ATCATTGCCAAATGCACTTTTACCTTCATTTATATTAATGTCAATTAATCATAGAATTATTTTGTCAAAAGCCGCAGAAAGGTAGTAAACCCTTATTTTC
AGCCCCTTTTAAAGACCACTTTTTCATAATTTAAAAAGTAAAAAAAATGTTAAAAATGGCCCATAAGATTTAATGTAACCAACCATAAAATAAAACATTT
CATTTTATCGAAGTAATCTCTCTACTTTGAGATAGGAATAAAATTTAGATATACTTTATCTAGTTAGACTATATTTCGTCGGATCATACTGAATATATTA
TTATAAATATTTATCGTTATAAAAGGCGTAAATATATTATGTTGATAAGAATATGATAATAATAAAGACAAATTCGATTCATAAAGTTGAATTATTTTTC
ATTGTAGTGGATTATCTCCCCTTACATTAGATTAAATTTTTTGTTGTATAAATAAATCACTTCCATCATATTTATACTGTTACGAATAAAGACAATTTTA
TGGGAAGAGGTAAAAGGGGAAACAGACCAACAGAAAGGTAAAAATAAATATAAAAAGTGAAACTCATAGGCACCTATACAAAGGGTAAAAGTTATCCACA
TATAGTTGCATCAAATTAACATATAGATGTCATCATATATATGGGACTATAAAGTTTTTTCAATTTAATCATAATATAATATAATTTTAACATATATTTT
TGTTTCCTTAAATTACTTAATTATAATTAACTATAGCAATTATGAAAAACAATCTCTCCGTATCATAAAAATAAAATTAGGTCCAAATAAATTTTTATCC
GGTCCACACTTCACTTATATTATTTATCAATATTTTTAATTTACTGGTATAAGAAGAAGAATAATTTATGATTTTGAAATAAAATTTTCAAATATCTAAA
ATTTTAATATTAAATTAACTAGGTACATATAAGTTCTTATTATGTATATAAAATAAAATGAATTAAATTGATCATCGAAAATAAAATATATACTTACTAA
TACATAAATTAATGTCATTGATGTAGCAACAAGTGTATTATAGCATACTTGTGCGAGTGATGTTTTTAATAGGTCGTTATAATAATTTAATTTGACGTAA
ATATCGAATGAAATAAATGTTTAGTACCAAAAGCCACAGTGCATAGCACAACACATGGCGTTAGTCTTTGTCAGTGCTGCTGCTGCTGCTTCTTCTTCTC
AAACTGAAACTTTTTTTTTTTTCAGCTCATACGCTCCTCTCTTCCCCATTTCCATTAACACCCACCATTCTTGATTTTTCCTCCATTTGATCTTCTTCTT
CTTTTTCTTCCTTACCCTTACCCACCACCACTCTTTCTCATGTCAACGGCTACTTTTCTTCTCTCTCCGCCATTGGTGGTGGTGGCACTTACGTGGCTAC
TTATCAGTGTTTTTTCCATGGCTGAAAACGTTACAGAGACGGAAATGGAAGCGTTAATGTCATTCAAAAGGAATTTGGAAGACCCACTTGGGGTATTAGA
CGGTTGGGATTTATCTACCTCATTAGCTCCGTGTGATTGGCGTGGGGTTCTGTGTGGTGCCGGCAGAGTTCGTGAACTCCGCCTACCTGGGTTACAGCTG
AGTGGAAGGTTAACTGACCAGGTTGGTAATTTACGCCAGCTACGGAGGTTAAGCCTACATTCTAACAACTTTAATGGCTCTGTACCACGCTCTTTAGCTC
AATGTGCTTTGCTACGCGCTGTTTACTTCCATTACAACTCTTTTTCCGGCGAACTCCCGCCGGCTATCTCGAACCTTACCAATCTTCAAGTTTTAAACCT
TGCTCACAACTTCCTCTCCGGTCATGTCTCTGGTAATGTTCCAGCAAGTCTTAGGTTTCTCGACCTTTCTTCTAATATCCTCTCCGGTGGCATTCCGGGT
AACTTTTCAGCTGATTCTCAGCTCGAACTGTTAAACTTGTCGTTTAACCGGTTCTCCGGTGAGATTCCGGCGAGTATCGGAGCTTTACAGAAGTTAGAGT
ATCTCTGGCTTGATTCTAACCAACTTTACGGCACTATACCTTCAGCAATCTCTAACATTTCCACATTAATACACTTGAGCAGTAGTGATAATCATTTGCA
GGGATTAATCCCGGCAACAATCGGTTCACTTTCCAGTTTACAGGTAATCACATTGTCGCAAAATCAACTATCGGGTGTGGTCCCTGCATCGTTTTTCTGT
AATGGGTCAGTAAATGCTCATGCTATTAGGATCATTGAGCTGAGCTTCAATGCAATCACGGGTTTAACTAAACCTGAAAATGCAGCATGTTTGAGTGCTT
TAGAGGTCTTGACCCTTCACGGGAATCACATTAATGGTGTTTTTCCTGAATGGTTGACGAGTTTTTCGTCTTTGAAGGTTCTTGATATCTCCGGGAATGC
AATTTCTGGAACTCTGCCAAATGATATAGGGAATTTAAGGTTTCTTGAGGAGCTTAGACTGGGTAACAATACATTAACTGGTGATATTCCTTCTAATATT
GTGAACTTTGGTTCATTGGGGGTACTTGATTTAGGTGGAAATCGGTTTTCTGGATTGATTCCACAGTTCTTGGGTAAATTGACAGGGTTGAGAATGCTGT
CTCTTAGTGGAAATCGCTTTTCTGGTTCAATTCCGGATAGTTTGGGGAGTCTTTATCAGCTGGAGTTTTTGGATTTGAGCATGAATGATTTGAATGGGAG
TTTGCCTCAAAACCTTATGTTGCTTAGCAATTTGACTAGTTTGAACTTGTCCAGCAACTTGTTTTATGGTGAAATTCCAAGAGGAATTGGAAACTTGCAT
GGGTTAGAGGTTTTAAATGTTAGCAATTGTGGGTTCTCAGGGAACATTCCGACTAGTATCGGAAGTTTGTTGAGGCTGACAACTCTTGATGTGAGCAAGC
AAAACCTATCTGGTGAATTACCCTTTGACATTTTCGGGTTGCCAAGTCTACGGGTTGTGGCTTTACAAGAGAACATGTTAACTGGGGATGGTCTTGAAGG
TTTTAGCAGTTTATCTGGTCTGGAATATTTGAATCTGTCATCTAATGCCTTTTATGGACAAGTTCCGAAGACATATGGTTTCCTGACATCCTTGAAAGTT
CTTTCTATGTCTAACAGTGGTATTAATGGCTCAATTCCAGCAGAGTTGGGTAACTGTTCAGGCCTTCAAGTGCTTGAGCTTCGAGGAAATAAGTTAACAG
GTCAAATTCCGAAGGATTTCTCACGTTTATCTCATCTAAGGAAGCTTGATTTGGGACACAATGGATTAACCGGGGAAATCCCTGAAAACATCTCTAATTG
TTTGTCTTTGGCTACTCTCTTGTTGGATTCTAACCATATTTCAGGTCACATACCAGAGTCGTTGTCGAAATTATCAAACTTGGAAATGCTGGATCTCTCT
TCAAATAATTTGAATGGATCAATTCCTTCAAGTCTGTCTCTGATTTCCAGCCTGAGGTACTTGAATATTTCCCATAATCATCTCGAGGGTGAGATTCCAG
AGGCGTTGGGTTCTCGGTTCAAGGACCCTTCTTTGTTTGCTGCGAATAATGATTTGTGTGGAAAGCCATTGAAGGAGTGCAATGACGTTAGAAGGAAAAG
AAAGAAGTTGATCTTGTTCATTGTTTTGGCTGCTGTAGGGGCCTTTTTCGTGGCAGTGTTTTGTTGTGGGTACATCTACGGCCTTATACTTTGGCACAAA
AAGTTAAAAGGTTCAGCTGAAGGGAAGAAGCGAAGCCCAGGCCGTACGAGTTCAGGAGGAGAAGGGGGCCGTGGAAGTGGAGAGAATGGAGGTCCAAAGC
TTGTTATGTTTAACAACAAGATCACTTATGCAGAGACTTTAGAAGCGACAAGACAATTTGATGAGGAAAATGTGTTAAGCCGTGGAAAGTATGGCCTAGT
ATTCAAAGCCACTTTTGCAGATGGAATGGTCTTGGCTATCCGTCGCCTTCCTGATACATCAATCGAAGTGAACACATTCCGCAAGGAAGCTGAATCCCTC
GGCAAGGTGAAACATCGCAATCTGACTGTTGTTCGTGGATACTATGCAGGACCGCCACCTGATGTTCGATTTGTTGTGTACGACTACATGCCTAATGGAA
ATCTTGCCACACTTTTACAAGAGGCATCTCATCAGGATGGCCATGTGCTCAATTGGCCAATGCGCCACCTGATTGCTCTTGGCATTGCTCGTGGCTTAGC
TTACCTTCATTCCGTTTCATTGATTCACGGGGATGTAAAGCCACAAAATGTATTGTTTGATGCAGATTTTGAAGCTCATCTTTCGGATTTTGGTTTAGAT
AAACTAAGCCTAGTAGCAACCCCAGCAGAGACTTCAACATCTTCCACCCCAGTTGGAACTCTAGGCTACATTGCACCTGAAGTGGCATTAACTGGACAAC
CCACAAAAGAAGCTGATGTATACAGTTTTGGGATTGTATTGTTAGAGATACTAACAGGAAGAAAGCCAGTAATGTTCAACGGGGACGAGGACATTGTCAA
GTGGGTGAAGAGACAACTACAAAGAGGCCAAATTTCAGAATTGCTCGAGCCGGGGTTGCTGGAACTGGATCCTGAATCATCAGAATGGGAAGAGTTTTTG
TTGGGAATCAAAGTTGGTTTGCTTTGCACCATGCCTGATCCTCTAGAAAGACCATCGATGACCGATATTGTATTCATGCTCGAAGGCTGCAGAGTTGGTC
CTGACATTCCCTCTTCGGCTGATCCTACAACTCTTCCTTCACCAATGTGATATGAAAATTCTATTCTTTGCAAGAAAATTTCCTTCAATTTTCTCAGTCC
AATGTTGTTCATGCATTTCTTCAATGTATTGTTATTACTCCATTCATTATCATTTTGTTTGTACATTGTGTTCATTCAAGAGTTTGTTTGTTTTGTGCAA
GTATTATATTTCAAGTCTATTTTCTCAATGGCTTTAGAAACCCTTTGATTATTGGTTATCAGTTTGTAGAAATACTGAATCATTATAAAATCATTAAAAT
ATTAACTTATTGGTTATTGATTTATCAAGTTTTGATCGTTATTGATTTAACTTTGACACAAAAAAATATATTGAAAATCACTTAGAAACAAAGTGGTATA
TATATATATATAATTTTTTATCCGTGATATATAGTCATATGGAATATCTGTAACTTATTTTTTATCACAAATTCTTTTGTTGATTAAATTTCGTTTCTTT
TTGGGACGGAGAATACAATATAATAAAGTGGTAATCAATTATAATTGAGAAATCAGGGAATCAACTGGGAACAAAAAAAAATGAATTCCCGCCAAAATAG
TAATAAAAAATAGATAGAATATGTACAAGTGGAAAATACGAGTATATATTTATTTATAAAAATATAAGAAAGTAGCCGTTAATGTGACAGTGAAAACTGA
AGCCAAAAAGCTTTTTTTATGGGAAATGGAAATTGTAGGGTCCCAGACGTTAGCATCTGTCCAAATAATTTCGTTTAATATCCGATGTTCGATACATATT
AAAATCTAATTAAATTTATATTAAAAGTAAATTATTTTTAATAAAAGTGATTTCATACTTTGAATTGTTAAAAATAAATAAATAATTTAGCATTAAGTAA
GACTCAAATTCAAAATTTATCAATCAAATAAAAAAATACTTATCATTTCATCGTAATATAATTCATTGGAAAAGGAAATGAGGACCAATATTTTATGTGT
AAATTTAGGTGACAAGTGCTTTTACTGCTATTTGGGAATTGGTTGGTCCAAATAACAAAACCACGTCGGATTTTACGGAAAATAAGCTATACTTTGACCA
TCTATGTGGTCCTCTGTTGTGTCTTATTGTGATAATTTGTCGTAAATATATTTGAAAAAATATATTATAGTTAGAACTATATTTTAAAATTCAATGAACA
TATTCGGATACGTACGCTATTACGATACTAGAAGCTTATATTCAAATTTAGTGATCAAATCTCAATGTAATACGAGTTTTAAAATCATGAATATTTAAAT
TAATTTTACGAGATATATGTTATTTTTTATCCGCGCACATCGAAAGGGTGGAAAGAAAGTGAATTTCTGACTCAATGTAAATTATGAGTTTTCAAAAACA
GTGTCTATATAACATCAGTAAGTACTTGACTGAAATGAGGGGTCAGTGTCAGATATAAAATTTATATATGGCTGTAATTTTAACCTATGGTGAAATATCA
TTATTTATTGCATAGTATTTATATTCTGATTCACCACTCTCATGAAAAGTCATCACTTTTTTGTCATTTAGAGGCAGGTTCTTTATCCAAGTACAAAAGA
TAATTTAAATTGTTTTATATACATACACTACAATAAATAAGTATATAGTAGCACTATTATTTTACGGTATTTATAGTTATATACAATTTAATATTCATGA
TAATTCCAAGAATGAAGTAGCTTAACGGTCGAAAATAATGGCATACTGGTGGTATATTATGGATTGCTTTTCTGGTGATGTTAAATAGAATATAATCCAT
GTAGCTTGTGGTACATATAGTATCATTATGAAATATGATAAACGGATAAGGGCTTAAAATATCGTTAAAGTATTGAAAATGGTATAAAATTATTATTTAT
CCACTTATTGGCTCTAAAATGTCATTTTCATCCACTTATTGGCTTCAAAATATCCTAGTCATCCACCTTTGGGTTCAAAATTGTCTACTTTTTTAATTGT
TTTAAAATTGAACTTTTTGAATATTTTTTAAAATACTTGGCGTTCAACTATTGATTATAATTTTAATTTATTAATATAATTTATAAACCAACCCACTACC
CACTCATTACTAACTAAACCTTACCCAATTAATAATCCGATTATGATATCAAAATCGTCATAAAACTACTAAAACAAGATGAAATTATAGATTCCTGAAA
ATGACATTCAAAATTATTTGAGTCCGAATCAAAGCCCCAATAAAATTTGTTGAGTCGCTTATTTAGGAGGACACTTTCTTTCAAAATTAAATTAAAAATT
TATGATTAAAGGTAGAGAAGTAGTACATCCCGAATTAATTCATGCACTTTTTTTGAATATAATTTTATAAATATTTATGATTTGTTTTAAAACCTTTAAT
ATATTATTTTGAAAAAAAGTTACCTATGAAGTAACATTATATAATTGAGACGTAAGAATAATTAAGATGAACATAGTCAGACTTTTATGTTTATCGATGA
TTTTTATTTAGCCACTTGAATGTATGATAATTTACTTTTATATATATTTTTTTTAAAACACTCGATTGGTAGTAGTTTGCATTAATAATGTGAAAGGTTC
ATTAATTTAGAGGGATTTAATTAGTAATCGGTGGGTAGTGAATTGATTTATAAATTATATTAATAAGTTAACAAGTATTTTAATAAATATTTAAATAGTT
ACATATAAAACCGTTAAATAAATGGTCAATTTTAAACCAAAAGGTGGATGACAAGAGTATTTTGAACCCAATAGGTGGGTGAGAAGGGTATTTTGGAGCC
AATAGATGGATGAATGATAATTTTGTACCATTTTTAATATTTTAAAGGTATTTTAGGCCCTTTTCCGTATGATAAATTCATTATAGACTTCTATCTCGTT
TATTTGATAAAAGCGAATTGAGAACTTATTTTATTCTAACCATTTTCAATATACTTTATGAGAGTCGTTCTGCAATTATGTCCATGATACGTATTGTAAA
ATAGTTACTATTTATATTAGTTGTTCATCATGTTGTCTCCTTAACTTTAACTATTTTAGTTTTTCAATGAGACGATAACACAATTCTTAAAAAGTATGTT
CATAATTGGACCTTAAGGCTTCAAACATGATTACTTCTGAAAAAAATATGTGAATTCATAATCTCCTTATAAAACTAAAGTATATTATGAATATATTTTC
TGAAGTAGGTATTAGTAGATTAACTAATTATTTACCTGAGGGACTAACGAATCAATCCTCAGTTAAAATATTTTTCCATACTTTTTTTTTTTTTTTTGAA
AAAACTCTTGTCACACCCATGTTTTTAGTAATGCATTTATATTTTTAAAAGTGAAAAAGCTTAAATATGTTATCGAACTTTTAGAAAAAGCTTATTTATG
TTATTCGTTAAAAGTTTGGCTCATCTATATCATAACCGTTTAAGAAAAGACTCATTCATGCCTTTGTTTTTTAATAGTGATTTTGCAAAACTATTTTTGC
CACATGACCAATTATAATCTGGTCACGTCATTAATTTTTTTTTAAAAGAAAAAATCAAAATTCTAAATAAAAATTAAATTAAAATAACCCACCAAAGTAA
AGACCCACTCAGATTTTAAAATAGATATCCCTAATTTATTATGGTGAGTTATTTTAATTCAATTTTTGTTTAGAAATTTGATTTCTTTCATTAAAAAAAT
TATAATTGATCATATATCAAAAATAATTTTGCGAAATCACTATTAAAAATAATAACATGAATGAGCCTTTTCTTAAAAGGGATAGATGAGCCAAACTTTC
CCTTTTTAAAATTCTAGATTAGCCTTCGTAGACAGATGAAATTAGTTTATGTTGATGATCACTGATGTCATTATCTCTAACAATAAAGGGAGTACACGTG
TCTTCATAAAGGCCAACGAAAACCAAAAAATAATAGTAAAAAAAAATACCATATCCTCTAGATATTGATCTTGCGACTAAAATTAAACTCTCTCCCAATT
TAAATACCATTAGGAATATAAGCAATATTTCATGTTTTTAAAAAGGCAAAACATGTGTAGGAAACTATGGTCAATCACAACTTCATATCAAGTCAAAACT
AGACAAACAGATTGAAAACGAAAGAAGCAGTTCTTTTGAAATCAGAAAGCAGGTAAAAAGTTTATTGTCCATCTTTTTAATATAATCAACAGAAGATGTA
AAAAGTATACCATTCAAAGCTGATACCAAGGTCTAAGTAGCAGAAATCAGTAGATGTAAAATGGAAAAGATATACAGAAACAAATGAAAGCTTAAAGTAA
AGTTAATACAAGGAACATTTTACAGCAATTCAATTATTTGTCTTTCAAAAATATCCGAAAAGTTTGATATCTTTATTGAGGGAATCTTCTTTGCCAAGCA
ATCAAATACATAATCACGAAGGCCAAAACTAAACAAAATGTAATTTAACAGCCAAACTAGCTCATCAAACGAGGAAGAACACAAAGATACTTCACAATTA
CGGAACAGGTGGCACTCTTTCTCTACTCTGCTCTAGATTGACCAGCGCGAGAAGAAAGGATGATACCGACAATAAGGCCGTAAAGAGCCAAGGCTTCAGC
AAAAATAAGGATCAGAATCATTCCAACAAAAAGCTTTGGCTGCTGTGCATTAGCTCTGGAAACAACAGAAACAAAGAAATGCAGCATTAATTGGTATGTC
CTCTCATCTCAAGTGAGGAAACCTCCTTCTGAGTAAAGGATAAATGAAGTTAGCAGAACTATATGAATGTCGAATGCTATATACGAAAACAGAAGTTGTG
ACTATCAACCCCTACATTAGTTAACCAACAAAGCCTACAACATAAGACTGCAACTGTATATATACTCAGTTAAGCCACCAAGGTGTAAAAGTCTAATAGC
TAAAGCATACGATTTTAAACTTGATGGATAAAGGACCTACATCTATAACCCTCTCCACTTAAATATAAATCTAGTGGCAGGATTTGAACCCATGTCATGC
GCCTAACACATACATCATGTGTTACACCAAAGCTGCCCTGGAAGTTCTCTTGAGACTAACAAAGGAAAAAGAATCCTTGAAGGTGAATTTAATCTCTAAT
TTCCCGTTCAAACCCCAACATGCAGAATTGCTGTATCCCAAAGTTCAGTCCAACCCCACCATGCAGAATTGATAATCCGAACGTTATAATCACCACTCTC
CAGTCCCCCCTTCCCCCTCTTTTGCACCTTCCCCTATCTACACCAATCAGTCATGAAGAACAATTTATAGTCCTTAAACAGAATCCAGGATCTATTTATT
CACTAAAGGCCATCTATTATTTTTATCACAGTCAACCACATGCAAGTAAAGATCAAGTTGCAATGAACTCAAGTTTAAAGGAAAAAGAAACAACTCAAAT
ATTTGGTAGCCTAATATCTCTCCACCAAATACACAATTCACCATTACTCATTTCAGACAAATCATGAAAATCCTAAAAAAGGGTGATCTTTTTTAATGAA
GGACACCAATAAAAGAGTGATCTTTTAATAAAGGACAACCAATAAAAGAGTGATCTTTTAAATAAAGGACAACCAATAGAAGCTTGGCTAGTAAGTAAAT
TCAGACAGATCATACATAGAAATGCCAAAAGGTAACAAAAAATCTGCCATAACTGATTAAAGATCCAAACCCACATGCTCTTCACATCTATCCCAATACC
AGCATATAATTAACCAGAATGCAATATCAAAATATTATATCTTTATGAATCTCTATGTCATTTCTGCAATAGCACAATGATTAAACACAATACAGAAAAT
TAGCAAAAATAATAAAATACCTAACACCAGCATCACCAACGATTCCGATAGCCATACCAGCAGAAAGACCAGCAAGTCCACAAGCAAGACCAGATGAGAG
GTGAGCATATCCATCAAATAGATAATACGACTTAGTTTTCGGGTTAATCCCAGTACTAATAATCACAGCAATAATTAACCCATAAATACCCAAAACTCCA
GCCATAACAACTGGAACAATTGACTTCATTACCAATTCCGGCCTCATTACACCCATCGACGCTACTCCTACCCCACTCTTCGCTGTACCATAAGCTGCAC
CCATACCTAAATTCACAAAAAAAAATATTAGATTTGGATTCAAAATACATAAAATTGAAAAACTCATAGCTTAGATCTAATGGAAAAAGAATTACAGGAG
AAGACTAAGGCAGCTGCAGCGCCGAGGAAGCCAAAAAACGGTGCCGTTTCATCGCCGCTAAACGTAGAAGCCATTTTTATCTTCTTCGAATTGGGAAATT
GAAGTGATTTGCGATCTGAGTGTTTATTGGAATCGATTGATTGATTGATCTAAAATGCTTCTGTTAAATAATACATTTGAGATCGTCAACCTGATCCATC
ACTTGAGCTCTAAATGGGCCTTAACCCGACTCTGACTAATCAAGTATCTGTGGGCCTAAAGCCCATCTTTGGAACATGAATTTGCAAGTTTAGCCATTTC
AGACATAAGGTGTCTAAAGTTCTATATTTAAAATCCACGACATTAATAACATATCCAGTATAATCTCACAAATACGGTGTGAAAAGAGTAGTGTACACGC
GAATACCTTATCCCTATCTCATCGAGACAGATAGGTTGTTTCCATCTCACAAATACGGTGTGAAGAAAGTAGTGTGTGCGCGAATACCTTATCCCTATCT
CATTGAGAGAAATAGGTTGTTTCCAGTAGACCTTTAGCTTAACCCGCACCCCCCCAAAAAAAATGAAAAGGGAAACAAATAGAAAAAGAGAATATGAAAA
TGAAAGCAATAACAATAGTGGAGTTTCAAAAAAGGTAAAGTATACATACCATACCTGCACTACAGAGTTGAGGAGATTGTTTCCGAAGAACCCTCAACTC
AAGTATATAACATATTAAGAATACGAAAAGAGTAACGAAATAACACAAGCGTCAAATATTTGCGTAAAACCATCCCAAACTTTTGTTGAGGAGATTGTCT
CATTTCATTTTGTTCATAGTAGTACCTCCATCCATTTCATCCATGACCTCAATTTAGTTTTATTCATTTTCACTCCCGCGATTACATTATTTAGCCATCA
TGGTACGTCATACATTTCATGCTAAATAAAATTACAATTTAAATAACAAAAAATAGTGAAAGAATTGTTAACCAACATCGAGCAAATGTATCAAAGAAAT
AAAAAGGAATAGAAGCGAAGGAACGATTGTCCTTAAACATGCATACGCGATTGTACTGCGTATTTGCGCACGAAATCTAAAATCTAAAAGATTAAATGGT
ATATAGGTCGTACCATAGAAATTTTACACCATAATCCAACAAAAAGTTTCAAACATAAGGCCACCGGGCAGACTACTTAACAAGAAGCACTGGCATTTCA
GCTTCAGCGACCATGTTTAAGCCTCATAGGAACGGTTTCTTCAATCTTCCACATAGATGACCATAATCATATGATTAGTGTACGCTGTCAAAATCAGAAA
GAGGCACTATTAAACATTTAGGCAAAACATTAAACAAAGATAATAGGGGCAAATATCAGGGGAGGAAGGGAGATAATACCGTGAAATCGGTAGAGGCAAC
TGAAATGATGAATCAACAGCTGCAAATCATCAATTATCTTGTAACAGAGATCTTACAGGCAAGCAAGTGCTTGTGCTCCGTGACAGCAAACAGGAACTAA
ATGCACATAGAAGATTCAGTAGGTCGAGGCAGACAACAGATGTAGGAAGTGACGTTATGAACTGCAGTGCTCACTAGGGCACAAATAAGCACAGAAATCA
CAATCATGCATCAAGAAGTTACTACATGCCAAGGGAATTATGTAAAAGCTGTTGTGTATATGACTTCCATACTAGCATATTGAAATCTGACATTGAACTA
AATGACGGAAGTGGAAATAGTTACTTCTGCAAAGAGAATCAGCACATACATACTTGGCTAATTAAAAGACTATGAAGTCCACTACAATTGGCCAGTGAAC
AATGATTACTGGCCTAAAGAATTTCAGGCTTCCTCTTTGTATGCCTGCCTGACCTGAACATCAGAAGACTTATATTTCCATCTTTATCTACTGCATTGAA
CATGAGGAAAACGAGAGATTTTGATTGGACGTTAGCAATCCAATCAAGAACTTCTTCCCCAATTCAACATCATTCTGCACTGAACAACATAGCTGATATT
TTCATCTTTATCTACTGCCAGTAGTACACATACTGCCGGTACCGGTACTCATTCCAAGATGTTCAATATGAGAAGTTATATGTTTCTGCAGAACTGTATA
CCATCAAATTTCACCAACCTCAAACCGAGGGTATACTACTAGCCTGATGGATAGACCCATCTCATTGAAATCTTAAGAGAAACAGAGGGTGAGACAATAG
GAGGAAAAATGACCACAATTTTTAATTGGTAAGACCAAAATAAAAGCAGGCCCTCAAAAGTAAATAGGAAGGCCGAGTGAAATCACAACCTGTAAGGACT
GGAATTAGCAAGTCATCCAAAGAGAAGGCTCTCCTCCTGCTGCCAAGTAGTCTCTCAGCTCTCCGCTATATGCTTAACCTGACAATAAAGGAAATATATA
AGACCAGATAATGTACTGTGAGAAATCAAGGGATTACTAGTGTTATGCACATGCATCTTTTCATCAATTGCAAACTTCAAATGCAGAATTAAAATGTCTT
TGACTAACTTATCCCTTGAAAGAACTGAGTACACAGGGCAACAATCACCTCAGCTTCAACAAAAAAATGGAAGGCGATATAGAAAACTCACTTATGTAAT
CCCTGTTCTTTTGGTCTTCTTCACTGGATAGTGCATAGGGATTAAGAAACCTCATGAACAAATATCAAGCCACTTGGACACAATCACCAAAAGCACACAT
CTCAACAATGTTCTCTTTGATTGAGTGGAGCAATCCAAGATCATAGAAAGACATTCAATATAGCATATCTAAGAGATTTCATCTACACTATAAGAAAAAA
AATCTTTACGAGGGGAGATAGAAGGAGGATTTTGTTTTTACTTATTCTGAGAAATCAATATTTCAAAATGAAGGAAGCATATGACGCCCTCAAAATGTTC
TGTATATTTGTTCCAATGATAACAATCCTGAGCTGTACACATACCAAAACTAAAGAAAAGTCAGAAGTGATTGTTCATCAAAGGGGAACCCTGAACTGAA
AGAAACAAAGGGCTACTTTTCTTCTATATAATACAACTTCAAATCTGACTACCAATTCTAAACCTAATCTTGCTATCTCTTAAGGAATTCACGTCAGTCA
GCAGGAGTAGTAGTAGTATAACATTCACATGACAGACATGTTTTCACCGACTTTATCACCTTGAGATTGTTTCTTGCAGACACCGCAACAGAAATGTCAA
AAGTCTCAAATTTGCAGGACAATTAATCAGTCTCTTACAATAAACAGTCCATGATACATTCAACAAAAGAGTCTCTGAAGACGATAACTAGCTTGGCAAG
GATAATTGTTCAATGAAGCCTGCATTCCTCACTCGTCCATGATTGTTGCACCCACTCGTGAAAAAGTTGATGAGACTAATCACCCTGCCGTAAAGCATCA
ATAAGAGTGACTGCTCATCCTTTGTCCATTATGATTTTGCACCCGGATTCATCTGAATATGCCTTTCAACCAACTTGTCCACGAAATCTCTAATCTGCAG
ATTTACCAATACAAAAAATCAAAGGCAGAAATGCAATGAAAATGAAAATAAATACCAAGCATATTGAGTGAATGCTATAAAAAAAAATACAAGTGTTTTT
AGTTGGAGTATATCTCCAAATAGATCCACATAATTTTTATTTTTTAGGCTTATTTTATTTTTATCATAATAATCCAACCTATCCAAAAGTCTGTATGGAG
GACGATATAAATCAGCATAGCTTCTTACAGGCTGTCCTGTCCAGTCTAGAATTTGAATAAATAGGCTTTTCCCCTCCCCTTACTCTCAAACCAAACAAGA
GAAAACAGTTCCCTTTCACTATCTCCTCCACTTGCCCAATCCCTTTTCTCTTTTCTTTCTTCTTCTTATTTTCTGTATATAATTGAGGTCCTTTCCATTC
TCTTTTTTTTATGAAGGAAAATCCATAGCCGCTACCCCTTTGGGTGAGCGCAGGGTAAAGCCCCCATTCCTATGCAAACCACACCGAAGCGGTAACCCGC
ACTAACCAAGCTTGGTGCGACGAGCGCGATCCAGAAGGCAAATCCCTTGCTTTCGCTGGCAAGGGATTTCGAACTTTGAGACCTCCAACATGGAAGTCCC
AAGTCTAAATCACTGCCTAACTTACCCCCAAAACAAAATTTCCACTTTCAGCTACAAGATATATGTAAAGGCACTTTATCTGATAACAGTGAATGGTGGG
AAAGTTTGTTCAACAATCTCACATTCAACCAATCAATTATGCCTCAATCTCACTCAATTGATTGGTTCTCTATATCTCATACACATCCCTATGGACTAAA
CCAGGTAAACATCATACCTAATGCAAGTAAGAAAATACGAGTCATTTGCATGAGAAAAAGCAGACTTTTTTTCCTTTTCCAAGTTTTAAGATACACAAAT
GAATGTTTGCCAAATTTCCAACAACTAGGCCAAGAGTGGCTCTTCTGTATACAGGATCCCATAATACCTAGGATAAATCACAATTCACACCTAAAGATCC
AATCAATAGTTTAACCTCTAAACCTTCTCTATCCACAAAAGAGAGGCCCTTCTCTGAGAAAGCAAAAAAGGGGCAGGTCTTCCACACTCTTTTTAACACT
TGGCATTTGGTGAACTGCCATATGAATTTAAAGGAACTGACGTGAAAGGTCTTTGGCCAGACTAAATTATGCAATAGTAGAATTTTATACACTAAGAGTA
GGGTCAGTCTTCCATAGGCTTGTGCTTATTTGCATTTAATGTAACTCACAACTTTATTAGCTTTGTGTCCTTTTGAAATGCTTATATATTGCAGATCAAA
TTTCTAGTTTAAAGAAACTTTAAGAGTAGAGCAACAATAAGCAGTTAGAAACTATTCAACAATGCAAAAAGGTGACATCAACTGAGAGTAGTTTGTACCT
TGTTTTTACGTTTGAAATCAAGAAACTCGTACACATGCATGGCCTTTTTAGCATCTGTGGCATGTTCCATTACCTGGAGTTGGGAACAGGATCAGTTAAT
TATAGATATAAAGGATTAAAGAACCTCAATTATGGAAACAAAGAATAAAGAATCGAACAGGCTACGAGAAGTTAGGGTGAGTCAGGACAAAAGCAGACCT
TTGTAGCAGTTTTCTTCATTATGGATTTATACCCATCCCTGTCGAGTTTCCTTGCTTTATAAAGAGGCATCAGCAAAGACGCAACATAATCTACAACAGC
CTGCTTAATTCTTTTTGCTCCTCTCGGTTGATTATCTAATGCCTCTTTATTTACAGTAATTTGTGAGGCAGAGCTTTCACACACTAACACATCATGCTTT
CTCATATCCATTTTGGAACTCACGTTTGAATCCTCTTCATCAGTGACATGCATCACTGGATCATAGAAATCTGAATTAGCAGCAGCTGCTTGACATTGCC
ACATTTCAATGGCATTGTAATCCTTTATCCCCACACTATTTGAGCTATCAACCCATGCTTTGGTGAATATACTACTATCTACAGGTGCACATTCTGCAGA
GTGCTCCTTATAGTTAAGCTGACTTGCATTGTCATTTGAGAGGCTACGCTGTGAGCGATTATCAACAGACATTTTTGAACTGTCAAGGTTCACACCAGCA
GCAGAAAAATCAACAGACCAATCCCTCACCCGGCAATTGCGAGAATCAATTTCGGATAAACAATCTTGCCTTCCTACCACACCGCCAGGCCAATTCTTTC
TGATGTCAGACTCATCCATATTTGCATATTGTTCCCGTCGAGCAAATTTGTGAAATGAGGGTATCTTAGGAAGCTGCAGTGGCATGTTACACTTGGCACC
AGATGAAGCATAGGCCTGCAATGAAGGGTAATCATTGTACAGTTGCTTAAGAGAAAAGCAAGATTTATTTGACAAAAAAGAACATAAGACAGACAAAAAC
ATTTGCAATATAGAGAAGCCCAAAAGCAAAGTAATACAGAATCCAACTTTGCGTTTTTCCCCTTTTTTATAACTTATATACTCGAGGAATAATAATAAAA
AAAATATAGCATATTCCCTTCTCATATTGAACAAATGAATCAACACGACTAATAAATCTTGGGATGATACACCATTATGTTGCTTTTGGGCTGCACCATA
TTATAAATGTTTTTATCTGTCTTTTTTTTCTTTCTAAAGCAACATAACAGGGAATCTAGCTTGTGTGTTTCCCCTTTTTTCAATAACTTGCATACTCGAG
GAATAACCAAAAAAACAGTAAAAATGTAGCACATCCCCATATTGAACAAAGGAGTCACCACAGTTAATAAATCTAGGATACAATACATTATAAGACACTA
ACCTCAGCAGCTGCTAGAGCAGCAAGGCGAGCAGCTTCTGCAGCAGCAAACGCAGCCTTCTCTTCCTCAGACATGGGAAAATTTTGTGTTTCCTCACTGG
TATCATTTTGCCTTCCTACTGAAGCTTGAGAGGTTGACGGTTCAACAACTGGAATAGCTCCTATCGTGGCTGGCCTGACATTCAGCTTCTTGTTGTTGAC
ACTAACAGCTAAGTGATTTCCAGCCGATGAAGAAACTTTAGAACTCCGTTTACTGTCTACTGCTGAAGGATGACTGCGGATAGGAGGTTTGCCAGGTGCT
GCAATGTGTTTGCTCTTCGAAGTATCAGTGGCAGTGGATTGTCTTAGTAATTTCAGACCACCATTAGCAGCCTTCTCCTTTCGAAAAAGTTCTATCCATA
CATTGACAAGCTGACTTGCTACAGCACGTATGTCACGGCTAGTATGCACACAGACTTTTTCTTTAACCGTTTTCCCAATACCTGGATAAAATATGACAGG
AATAGAATCAGTTAAATCAATGCAAGGACAAAGCAATACGCTAATGATATGACAATTATAAGGATCATTAGCCATTAATGGATATAGAAAGCAAATATTT
TGAGTTTATAGCATACAAGCTGAAAAATATGAAACATTAACAGAGAATATTGATAGCCCCGATGGGGTTGTGCACATAAATAATTTGAAGGTACAAATCA
GCTTATAGCAAACAATATCGGAATAAAGGTGAACAGTTCCAGAATGGCAGGACTGCCTCTTCGACCCACCCCCAAAAAGAAATCTCAAAAGAAGGTTCAC
AATAGAAAAAACAAAGGAGAGCAGAAGGGGGTGGGGGTTAGTTCCTTTACTCAAAGGGGAATGTACCTGACAGCCGGACTGCAAGCAAATCAGTTGAAAC
AAGTACTAGTAAACGAACACAATGGCGCAAGAGTTGGGTCCCATCCTTTCCCATGGAGTCCTGTGACCAACAAACATTAGTCAGACAACAAGCAATTTGT
GTTCAACAGATATGGCATGAAACTAAAATATGTGACGATTAATACCAGCATCCACAAATTAAGTGTGCTAAGCCCTTCTTTAGTTCCAGCAAAAGATCTC
AAAACTTCTACCGGAAGTTTCAACAATTCTTTTGCGAGATGCAATCTTCCTGCTGTTGTATTGGCCTTACAGAACATGTCCCTTAGCAAATTCTCCCGGG
TCACGATCTTCACCCCATCCAAAGACTCCTTGCACAAAACACTCGAGAGCTCCACTGCTTCAAGTCTTTTTATAATGTCCCTTATTTCACTCCTTTCAAC
ATCTGAATGCCTCATTGCATCCTCCATTGCCTCTACTTCTGCTGTGTAATCAGTGCCTGTAGTCAATATGTCAATTATGCGCACAGCTTCACGTAACCCA
CTCATCATTGCACCACCAACCGTGTCAGGGTGCTCCTTGCAGGTAGCTTCACCTGCAAAAAATAAACAGTTCTCCACAGGCCGGCCCAATATGTCATAAT
CTTCTCCCGATGACCCTACAGCCACATAAGAGTAAGCCCCATAGCTATAAGGATCTTTTCCCCAGTTGGTGACCACTGAAGCAACTGGATCAGGTACCAT
TTTCTCACCATAAAGCTTTCGCAGAACCAGTAACGAATGTTTTACATGGTCATCGGAGCTCATTTCCTGGCCATCTATGGCAGCTTTTCCAACCACTAAC
GCTATAAGAACAGGTGCCCCAACAGTTTTCTTAACATTCCAGAACATAAAGCACCTGCCCCTCTCGTCCGTATCTTCAGCAGTAGCACCAAAGTAATCAA
TAGAATCATCCCAAAATACTTCAGGAAACTCCAAGACAACTTTATTAAGGACACCAAAACCAAGCCTTTGGATAGATAAATCTTTCCACTGGGGTAAAGG
TGGTGAAAATTTAATTGTTTCCGCCTTAAGACACCCTAATGGAACTGTTATAAGCACTGCATCTCCAGAAAACTCTCGTCCATTTGTCGTGGAGACTTTT
ACCTTGTTAAACAAATCATTATTTGAAAGAACATCTTTTTTGCAATATGAAATATCAGTAACAATGTGGTTCAAGTGAACGCAAAGTTCCTCACCTAGTG
CTTCAACAACGGAGCTGTAGCCGCCTTTAATCATACAATGAGCTCCACCAAAACCTCCATATGTATCATCCTGATTCCAATAAGGAAGAGAGACTTCTTT
AAGCAATGCAGCACAACCATACTCCAAGTTAGCAAAATGCCAATCCATTACCCTCCTCTCTGGGGGGCTCAAGATCTCTACCTTAGAATTATTATTTTGA
GGAACTCCGACATCAGAAAGTGCCATGGATTCCACTGCTGTCACTGATAATTTTTGTGATTCATTACCCATATGATTTCTCGCAAACCGGGCCTTCTGAC
GCTTCTTAAGGGCATATTCCAAACCATCCTCCAGGGACATCCGCATCGCATGCTCCCCTTTTTGAGCAACCAACAGTACCATGTCATCCAATAAGCTATT
GAATTCTGCTTCCAATGCTTCATCCAGATCTACTGGTACTTTCTGGCCAGTAGCTACATCGTACAGGGGACAATCACTGTTCAATACAGTCAATTCAAGA
CCCAACTGTGCACAAATCAACGAAGAAGGATCTGGTCTTCTTTCAGTCGCCACATCTGCCTCAATACCAGTAATAATGCTAGCACCAAGGTCCACTGGAA
CAGATAGAGACGAGCGATCTGTAAAAACACGACCACCTATTCTACTTCTGGCCTCGAGCACGGTGACATGGAAACCTTGGCGCTTCAGGTGCCGTGCTGC
AGTTAGGCCAGCAGGACCCGCACCAACAACAATTATTTCTTTTTTCCCTTTTGCATCACAGCAAGTGTTTAGGCTTTGACACCCTAATGAGTCAGATGTG
AACCCACAAGAATCTTCTGAAATCACAATGTGTTTATCGGCTGCTCTACCATCAATCTCTGTATTGTTGGGAGGCAAAAGACCTGGATCTACAATATTCT
GTAATTCACTATCCTTAACTTCACTTGAAGGCACTTGAGCAACTAAACCTAGATCAAATGGTTGACGCGGTGACTGAATATCAAGATAACCATTTACACG
GCAATCATCAATAGGACATTCTCGCGGCTCTGCCAAAGTAGATAACTCTATGGCCCGCCTATCAATGAGCTGGCAATCAGCTCCACATTTTTCTGTCTTT
TTCCCTTCATCAGATAAGACATCATTCTTCTCCGGCATGATAATCTCAGAACTCTTTGACCTCCCAAGAATAAAAGAAACTCCATCATCTCTATCAGCAA
CAGAAGCTCCAGATTTTTCTATAGTCTTCTCTTCCTTCAAAATTTTCAAGCTGTGTTCAGCACCATTTTCAGCTTTATCCTTTTCAGAAGCAATTCCAAA
ATTTATGTAGCCCTGTTTAAAAGGGGTTAAATTGTGAAAAATAATGATAAGCAAGCAAAGAGAAGGTCATGAACCAAAGTAGTTTTATATAGAAAGATCA
TACAAAAAAGAAGGGACGGATCTCCTTTGTAAATCTTGAATAAGAAAGTTCAAATGTTAACTAGGAGGATTGCAATAAACTTACACATTGATCAAGAAAT
GAATAGATTTGCCGTATTAAAGAAGCCCGAGGTGACTCATCCGCTAAAGGGGTTTCAGACACTCCACATTCTGAAAGTGGCAAGACGCGACTGATGTCTT
TATTCCAAAGGCTCAAAATCTGATTCCTGCATCGCAACAAAGATTCACCAAAAAAGTTGAGTCAATTATGAAATATGTAAATCAAAGACGATTACACTGC
ATCATAACAGAAAGTTAACATGCAGATTAAACTATGATCCCCAATCTACGCAAGTTAACAATTGAAAGTGCCAAAAGAGCACCCATCTAAATTATGTTGT
AAGTATTCATAAATGAAACTATTATCTAGAAATTTCACCATAAGAACTATCTTTGAACATTTTTTGTATGGTCTTTTGCCCTCAAAAGGAGGTCCCTAGT
TCTAACTCTTACAAGAGTTCTTTTTAATCGTTAAACCCTTCGACGAGTTCTATCTAATGCCTATTCAAGGAAAGCAGGAGCATATTCATTCCTCTGTTCA
AAATAACCATAGAATACCTTAAGTTTTGCAATAATGAACCGGAGTATGGATTAGAATGAACCCAAAGAAGCAAAATTAAAAGAAACATTATAAACATTAT
AAACATAATTTAATTATCTCATGGAAAAATCTCTTGTAAGGCACTTAATAACAAGGTATTAGAAGAGAGCGGATATGGTATTCAGAGTGCAAAATTTGTC
ATTACCTGCATTCCAGAAATTCCAGTAGTCCAACTCTGCGCTTCAGGAGCTCCTTAAACTTGATTCTTTCTACTGGGCCAACTTCACGAGCTTTAAGTCC
AACAGATACTGCTGCTATCCCGCCATTTTCAGTATCCATAACTGTCAACGACGACTCAAGCTTCTCTCTTGTTTTGAAGGCATGTCTACCCTCTCCATCT
TGATGACTTGAAAAAAGATCTTGCCCATGCACCAGAACGTCCCAATCCACATCCCCCTCATAGGCCATATCCCCGTGCCTGCGTTTTTTGGTCTTGCGTG
AAGCACGTTGACCTGAAAAGATTCTCTGCTCTTTTTCTTCAGCTGCCAGCTTAGCCTCAGTCTCTTCAGCAACACTTTCATCACATTCTGGTGTAATTGA
CGGAGAAGATGTGTCATCAGCCTCATCATCTCCAGAAACAAAGACACGACTTTGATGATGTGCACCTTCACAATTCTCATCAGCCAGTTCACTCTGATGG
AAAACCAAACTGCATTTGCGCAATGAGGTAGCAGCATTATCAATAGTCAATTGTTTGGAAGAATCATATAAGTCATCATCATTTTCCATGATTTGGTCCT
CCTGCTTCATCTGGCTGGCATTAACTTGCTGACTCCTTCCTATAGACACCAGAGACAACCCACCCGCAAACACTTGCCCATCCTCCTTTGGCAAAGAAAC
TGGAGAACAAGCTTGCTCATTAACAGAATCACCAGAAATTCGCTGTTGATCATCAAAGTCACTTGAACACTTCTCTACTGCAATAAAATCGGGCGCCAAA
CGAACTTGAGCATACCCAGAACCTTCCATGTCTGTCTTCTCCTTGGCTGCAGTTAAGCCTTCCAACCGGAAAGTGGAGGAAATCAAAGTCCGACTAAACA
CATTGCAGGTGCTTCCTTCAGATGTATGATCAAGTTTGTTCAATAGCTGAACACTTCTACAAGAACCTGAATCATCTACTCGATTTGAAGAGCACATTTG
ATCATCTACATGAGTTTCTCGGCTGCTTAAAATTGCATTCACATCCATATCAGCATTGAATTTGGTTTCTATCACGGGATGCTCAAGCATCTCAACATTC
TCAGGAGTAATGATACCTGCAGACAAAACATCACGACCTGTTGCCATTGGACGATCACTAAAACCATCCTTGGAAGCAGACTGTTCATAATAAATAGAAC
AGTTCTTCAAGACATCCTCATCGTGAAGATCTTTGCAATTTCCACGCACAATATTATATGTTGTGGCAGTTTCCTCCTCACTAAGTTTACTATGACATTT
GACCTCACCATCTACGACACCTGCGATCTTATTAAAACATGCTGGTAAATCTAATTGAGATCCTTCAATGGAAGAAGTATCATCTATGGCGATGCTTGAT
TTCAACAACTCAACATTGTTCAATGCAGATGAAAGAAGCTCTGGCCTTGAATCAGATTGTAATTGAATGAGTTGCACAAATTCTTTATTTTCAGACAAGT
GCATATCGACTGAACCTCTATCAAGTGCAACATGCACATTCTCATTGGATTCAGGCATTCCTTCAACCAATTTCTGGCACATATTTTTGGATATGGAAGG
AAAGATTTCAGTTGCAGTAGGGCAAGAGTTCAAAACGTCACATAAAACTTCACTTTCCTTCCCTCTTTTCAACTGCAAAGAGCTGTGTGATTTCTTAAAC
ATACCAGATTGTGCTTTCTTCAGAAAAGCTGATAGTGAATCTTCTAGAATACCATCCATGCAATTCGGAGGGCTTTTTCCACTCTCTTTATCATTTTGCA
GGGACATATCCTCAGATATCTCTACTTTCTTCAGCTCCGAAGAAACCTTTGGTCTCTTACCTTTTCTCTTATTCCCTTTCTCAAAACCCTTATCAATTAT
CCCTTCAGATAGACATTCAACATCTGACAGACCGTTTTCCACAATTTTTGCCACTGCCTTCACAGACCCATCTGGAGATTCCACTGTTAACTTACTGGCA
TTGCTACTTGAGCTTTTCCCAATTGTTGACACGGATCCACTATCCTTCTTCGGACCCCTCAATTTCTTCCTAAAACTAGCTAATGTATCATCCATGCCAA
CCAAATGTTCATCCTTAACCGCCGTTTTCTGAACCACATCCTTACTACCACCTAAATCCACCTTCGCTTTCTTCGATTGTTTTTTGCTTTTTAACTTCAA
CAAAGACCCAATAGGCTCATCATCTCCTGAATCAAACTTCATCTCAATCCGCTTCTTAGTTCCTCTCTCTAACCTTAACTCAACATTTTCTTCCTCCCCC
ATATCTAGCAAACCCTTATTAGGGTTATCAATTTATACTTACACCTCCTCCCTCCACATATAACATACAACCCTTCCAAACACTAAATCAGCAAAACAAA
TCCAAATTTCACAAATCCTTAAGATATCAATAAACTTACACTTCCTCCCTCCACATATAAACCTAGCAAAAAATCCTTCTCACATACAACATACAACATA
TCACTAAACCATCCAAACAAATCCCAATTTCATATACACAATAATAACATTCATATCCTAAAACACAAATCTTCTCCCTTTGAACCAATGCAAACAATTC
CACAATACTATTTCAGTTTCCAGTAACTAAAAAAACATCAAATTACGCTAAACTCAACACTTCCCACACCTGTAAATCGTTAAGAACACAAAACAGCTCA
AAATTGAGAACAAAAAGTAACAAAATTACCAGAAAATTAGGGTTTTTTTTTTTTTGAAAGGATCGGACCTGAATGTTGAAGCTGTTGTTCCGTAGGTCGC
GTGAGTGAAATCTTCTAAGAGAGAGAGTGGAGAACAAGAGGGGCTGCGCACGTTAGCATCACCGGCTGAAGGAAAACACTATTCCTACTGTCTCAATGAA
AGATTTGATGTATGATATATAAAATGTATATTGGGATATATGTTTTTGGGGGGATTTATAATAAATACACAAAAAGAGGGTTAAATGTTTTTGGTGTGAA
TAACCCTTGTTTTATTAGAAGTTGGTAAGTAAATGACAAAAAGTAATTATGAAAATTAGATTCCATTTAATGTGTAACGTAAATTTCTGTTAGAGTGTTT
GTCGTTGGACGGTATATTCAAAGTAATGTAAACTGTTGTATTCAAATGTAACGTGGCATTCTATTAGACTGCTAAGATCAATCAATATATGATTTTGATT
TTTAATGATTTGAATGTATGCTTTGATTTTATACAATAATAAGGTTAATTAAGAGTTTGGTGATTTTTTATATTATGATGATGTTGTTTGATGTTGCGTT
TGTATGGATATGAATGTGGTTAGTCAATTAGTTTGAAATTCTCTTAAATGTAATGTGACATATTCTTGAATTGTTAAGATTAGTCAATATCGATTTTTGT
TAATAGTGATTGTACGGGTGTCTGAATTTGTTTAATAATAAGGTTAATTATGAGTTAACCGATCTTTTATGTCACGATAATGTCATTTAATATCGCGTTT
GTATGAATCTAAATGCGATCAATTAGGCTGACATTTATGATCTCTTAAATGTAATGTGACATGTTATTGGATTGTTAAGATCAATTAATAACTATTTTAA
TCCTTGATAGTAGTAGGATGTCTTGATTCGTAAAATAATAAAATTAATATATGAGTTTATCGATCTTTTACATTGTAATAATGTCATGTTTGTACAAAAT
CTTAATATAACCAGTTAGGTTGAATCTTTTAAGCATAACACGGCAACCAACAATAACGATTTAATTCCTTGATGATTTTATGGATATCATGATATATTCA
TAACACAATAAAGTTTATTATGAGTTTATCAGATCTTTTATATTACGATAATGTCATTTGATGATATATTTGTACTAACTTGCATGCGAACAATTAAATT
GCAATTCTTTTAAATAAAATTTATGGTTTTTAATTACTTCTTATTTTTGTGAAAGCTACTTACAATTTTAATTTCATTGCAATTATCTCATGAACTGAAT
TTGGTCAATTAGGTTGAAATTCTCTTAAATAAAATTATGATCCTCTTATTTTATATTTATATTTATATTTTTGGCAGTGCTAGTTACAACTTTAGTTTAA
TGTAAGTTATCTTGTATTTCTTATTAAGTTCAAGTTATTGTGAGTAATCAATATGAATCGTCATAAAAATATATTAATTTATTCGTCAAGGTAAAAAATG
ACTAAATATTGTTTGAACTTCTGGAAGAGAACAACCAAATATAATGTGACATTTTTATAATTTATCGATTAAATCTGTTACGCTAATTTATTTGTGTTTT
GTTGAATTTTTAACATTATAATTCGTATTTTAGAGTGAGAAAAAGAAGATAGAGGAGAAGCAAGTGATTTAGAAGGAAAATTCAAGTTCTTGAATTTAAA
CATGTGTAATGTTTAATTTTGCTTGAACGTAACGTGACATGTTATTGGTTGCTAATATTAGCTAACAATAACCTTAATTCACAATGATTATATAAATACC
ATGACCCGTACAATAATAAAGTTAATTATAAATTAAATGATTTTCCATATGATGACAATTTTATTTAATTTTATGATTGTACAAACCTAAATACGAGCAA
TTAGGTTGAAATTCTCTTAAATATAATGTAACAGATTATTAGATTATTAAAAATAGCTTACAACGACCTTAATCCTTAACGATTGTATGTCTTTCCTAAT
TTGTACATTAATAAAGTCAATTGTGAATTTAAAGATCTTTCTATTAAGATAATATCATTTAATGTCGTATTTGTACAAGCCTTAAAGCGATCGATTAAGT
TGAGATTCTCTTAAATATATTATGACATGTCATTAGATTGGTAAGATCAATCAATAACGACCTTAATCCCTAATGATATTACAAGTATATATCATGATTT
GTATAATAATAAAGTCAATTATGAGTTTATAGTTTTTTTTTAATCACATATTTATATGAACCCTGTAAATGGCTAGTTAAGCTGAAATTCTCTAATAATA
GGATTATTAGAGAAAATTAAATTATTTAATTTAAATGTACAACGTTTAATTTTGTTAAAATATTTTAATTCACCTTAAATGTAATGTGACGTGTTATTAG
ATTGATATGATTGGCCAACAAATATTTTTATCCATAAGAATTATATGGACAATAAGGTCAATAATAGATTTATTAATTTTTTTTCATGTCACGAAATATC
ATTAGAAATCATATTTTTACAAACTTGAATACAATCAATTAATTTGAATTTCTTTTAAATGTAACATGATATGTTATTGAATTATTAAGATCGATCATAA
TAACCTTAAGTCTCAGTAATTATATGAATGTTCTGATTTGAATAACAAAATAAGACATTTATATATAAATGTACTAGTCTTTCATGTCAACTGTCAAAAA
AAAATGTCATTCAATATCATATTTATACAAATTCAAGAATATAAATTAAATATGATCTTATAAACCAAGTTCAAGAGGTCAATTTTTTTTAAAATGCATA
GAAGATATAATTTCTAATTAATCATAGTCTAGCCAATAATAAAAATATATAAAGACACAATATGTTGAAGAAGCATGGTGACAATTATATAATTAACATT
ATATTAACCCTTTTTCTTAATTTCCATACCACCACATTATATCACATCGTTTATATATCTTTCAAGTGTTTTAATTTATTAATATCCAAGAAAATGATTG
CAATATATCGTCAATAAAAAATACAAAACAATTAATATATATATTATTATTAATTTATTATTACAATTTTATTTTTTATTTTTGAAAATCAAAGAAAAAA
TTAATCTCTATTCACAAATATAACCAATGTGGTTATTGAATCTTGATCCAAATTCCTTCACTTGGTATATCTTGATTAACCACAAATAACAAATAATAAC
CAGGTGGTGCTAATTTACCCGAATTTGGAAAAATTGAACTGACTTGATAAGTGAGTATTCCGATTTTTTTTACCTTTTCATTCGAAAGAAGAAGCATTCT
TTGATTCATAGTATTTGAATGTGTGTTAAATCCGGGTGCAACCATCGTCACCTTGATCAAATTTGTGTTGACGAGTGATCCAGAAAGAGTAAAACGAATG
TTAAGACGTTGTCCATACTTGATTTTTTTATGAGAACCCGGAGAAATGATTTGTGGTCGCAAATTGGCAGAGTTTGACTCCAAGTAGGACGGTGAGAATG
CCTCCAAACTTAAATCCGTTGGAAAAAGAACTCTAGTGAAATTATAAAGCTCATTTGGATTACTGCCACCAACAAGAACTCGTCCATCACGGAGTAGAAC
TGCTGTTGAGTGATACATTCTAGGTGTTGCATTCGGATTTTGTACCTCGAATCTAGAACCAGAAGGGTTATCGGGTCGGTAAATTACCGGACTCAAAACC
GGGTTCCTAGCAATTCCCCATCCAGCCGTACCCGCCGCGGCTCCATTTACAATCAAGACATTGCCATTTGGTAAAATTACCATATCACCCATCGTTCGAG
CTAGTGGCATTGTCTCCATGGTCCATTGTGGATTTGGATCTGTAATTGTAATCCGCCCACAAGTATTTAACGCACCTACAAAAGTATTAGCTCTTGCCGC
TTTGAGATATGAGCCAATTGGGGCTCCACCACATACCAGAACCTCAGCTTGAATTGTTTGTGTCTTTAAAGGAAGAAGAACTGCAGAACCCGTACTTGGA
TAGTTTCTTGGATCGCCACCAGGTATTTGTGGATACGTTTTCACTATCGTATTTGTTGTGTGATCCAGTAATATAGCTCGATTGTTCGCGAAAATGAATA
AATTTCCGTCCACATTGAGAAAAACAAATGGGTAGAGATTGTTTTCCTCTTTAGGAACATTAGTTTGTTGAATAAACGGTAGATTAAATACTTTGTTTGT
TGACGCAGTTTTAGGAAAAAACTCGTAATTAAAAGTATCACGGCCTCCTATTATAATTTGGCTTCCGTCAGGAAGAATATGATTGGTGGAATACCATCGA
CTTTGAATTAATCCATTTCCAATTTCTTGCCAATCACAAGTGCTACACGGTTTGAACGTTCTCACCATATTTCTTCCATCGTTGAATCCACCGGTTTGAA
CCAACGTACCGTCAGCGGTGGCAGAGCCCGAGGAGCACCACACATCGGTCTGGACCATGAGAGGTCGAACTGAATTAGTGGACACGTCATATTCTACAGA
GTGGGCAGTGCAATCGATTTTCAATGCAAGGTCTTTAGGATTGTTACGACATTTGCCATTAGGCAAGGAAATATTAGATGCACCAAAATCAGTACGATCG
TATATAATGACTCTGTCGTTGTTGAGGAGTTGCATGTGCATAGCGGAAATACCAATGTTGGACATAAGTAAGTCCCATTTGCCACCTGCAGCATTAGCTA
AGTTTAAGTCATGACATGATAGTAAAAGAAGAAGAATGTTGAAAACAAAACTTGATTTTTTAGTCATCATAATTAGGTGTATATGAATTTTAAGACAAAA
AAGATAAATAGAGAAAAGTGTGTTATGAAAATGTGAAGTAGGGGTGTCCTTTATATACTCTTGGGGTTTATCTTTTAATATTTGAAATAATACAAATATT
AGTTTGCAAAAAATAATTTTGTCTGGAGAAAGAATGACATTTCATAATGTGAAATTGAGCTTAGGAATATTTTGAAGGATTTAGTCAACACCATCTCAAA
TAAAATAAAATAGAAAGCCATGTAGCTATAGTTTTCCCTCCTTGTGGAGGTGTATGAATACTTTGAAGTACTAGAAAGACATAGGTAATGGAACAAAGAG
CCGATGCAATTCAGTTTATCGAGAATATTATGATCGTATATAGGAGATTATGAGTTATAGATGTTATAGACTATAGTAGAAGATTTGTATAGAAAAACAT
TGTATTGCTTCCATTTTCTTTTCCCTTAAATTTATGATGTTATTTGTTGTTTCTTGTGATCTGACGTGTTGAAAACCCCGTCATTATTTTTAAAAAAAAT
TAATTTAAACTGTTTTTTCTTAGAGTCGATGATACACACTTTGCCTCCTAGAACAGTCTCATCACAATTGTAAATGAGGTGCAATTGGTCTCCACAAATT
TACACTAAATATGTGATCTACTAGTAAATATTTTTGTAATTTGAGTTAGATCCATTTTAATTTTTAAAAAATCTGTTTCTATTGTTTATTTTATGTATAT
CTTACATACTTTCAATTTGGTCAGATGTGCCCATATAATAATAATTATAGAAGTTTATAGTTTTATTAATTTAATTAATTCCTCCATCTGTCAAAGATCT
CTCTTGTTTAGAAATCAAAGTACTAATTATTAATTAAATTTCTTAATTTGCATTCATATCTTTGGAATATGCAGCATTGTTTACAATTATGCAATTGCCA
TACATAGTATTTTCATCAATATATGCTGATCATGGTTGCTTAGTGCACAACTACATAATCAATTGTTTATGTGTTCAATTACTTCTGCATTATTAATCAC
AATTAGTACGAGTATTATAATGTTTAAACTAAGTAATTTATAGTCCAGTATGAGAATAGATATTTATGAAGAAAAATTGAAGAATAAACAAATTAAATTA
GTCTAGCAAGTCAACACCTTACTTTGCTATATATCTATTTCTTCTTTTCATCATCTTGGTAAGCTTTGATGGGAGTACAGTTTAGCTAGTTTCATCGAAC
CTAATAATTATTTTTATATATTTTTTTAATAAAAATTTAATATATGTATATAAAAAATTAGTCGCTAATTAAAATTTAATAACTTAGAAGGGTTAAAATT
TCAAATGCACATACTTTATATTAATCCACAAAATAGGATGAGAGTAATGATAAATAACCTTTATAATTGTCCAAACCAATTTTGTGGACCTTTTCACTGT
TGATACTTGTCCAAACCAACTTTGTGGATCGTTGTATTGTTGATTCTTGTCCAAACCAACTTTATGGACCGTTTCATTGTTGATACTTGTTCAAAATAAT
TTTGTCGACCGTTAAATGACATCATCTAAATTTGGATCGTCATACCCTTGAAAATGACATCTTTTAAAATTTCGATCATCATACCTTTTGAAATGATATT
TTTTTTAAAAAGAAAATAAAATTTATTACCTCAATTATCGATATCTAGTTGAGATTTTATATTTTTTTGCAAGAATATAAGGTTACTTATTATGTTAAGG
CATAGACAGGTCTATAATTGTAATTAAAAGAGTTTGACAGAATTTAATAATTTAACCTAAAATTAGATTATGATTCTAAATACGGTATGTACATAATTAA
TTCTAAACTTAAATTTATGAATATATATAATTTATCAAAAGTTACTGAGAGAACACTTGAAACACCAATAACACATTTTAATTTGTTGCTTAAAATTGAT
ATTTTACTGATTCACTAGTTTTGTTTTGTTTTGTTTTTTTTAAGGAACAAAATTAAAGGAACCAATTGAGAAAGATTAATTGTCAAATGACAAATGTTCG
TACATGCAAAAGCAGCTTAATTATTAAAATTATTAAAATAACATACGAAGCATTATGAATATACAATTGGGTACTTAATTAAATTGATTTTAAAGATCAA
ATAATACAATTAACTAGCTTAACTAGTGCATGGGTGTTTAAGTACTCTTCTAATAATTATTTGCTTAGCCTTAAAAATGTATGTGGATATATGGAAAAGA
ATATCAAATCTTTTTATTTAGTAATTTAAAGATTTTTTTTCATAAAAATAAATAAAATTCAAGAATTCAAACATGAAATTTCCTTTCAAATTGAATATGC
ATTTGTTTGACTTTTGCAGGATTAATTATAAGGAAGAAATTAAGTTAAAATATTTAAAATTTAATAATTGACGGAGAAACGTGTGGATGGGTGGCGTTGT
GTGGAATATATATATTTTTTTTCGAAATGAAAATTAAAATTTATACACACATATTAGCATTCTAGTTTAGTCGATTAATTATAATTAAGCTGATGTTTAC
CATTCTTCTTGGTTGGTTACTAATTGTGATTTTTTTAGCGATTTATCTGAATTTGTAAACAATGAGAAGACAGACTTGGATCTAGCCACCGCCTCACCCC
ATAAGTTAGCTACTGAATAGCGGGGATTTAATATTTACTATATATATATATATATAAAATATTATTTTAATTATGTATAAATAGTATTTTTTTTGTTTAA
AAAAGAATTTATCTATTTCCTTTTTAGTTTGTTTAAAAAACAATGATCTCTTTCCTTTTTTGGCAATACTTAAACTTTAACTTTTCAAGTGACATGTGTA
AGACCACAAGATTGAAGGGCATTTTGGTACATTTTACATAACTTTAATTTAGAACCACAAAATTAAAAAATCTTCTTTCTTTTCTTAAATTCCGTTCCAA
GTCAAACTAGATCGTCATTTTTTAAACTTCGAAGAGAGTTCGGTGTACCAAGATGGCTCCGCCCCTAGTTAGCTAAGGGTAAAAAATCATCAAGATCATA
AATAATTTACATTTCCGAACTCAATATCTCACAACTCAAAATTAAATATTTAAAACATGAACGATATAAGGTGAAAAATTCAAAATATCAATAAATAATA
AATAAAATAATTCTAAATTTAACTTCAATACCTTATTAAAGACATGGACCTTAAAACCTAATTTAATTTTTAAAAAAAGGATTACCTCATAAGATAAGGT
CATTATTTAAATTTCTACATCATTATTGCATAAAACTTCAAACTCCTTCCATAAGAAAAAATCCGGAGATGTTTAAAAAAAATTAGTTCACTAGATTATT
TTATTAGATATGCAAAATTTATGAAAATTTTGAAAGGGGATTAAACTTGCTACACTCTTAACAAATAACAAAAATCGTCTTTTCTTTCTCATTGGTATTC
GATCAAGCTATTTAAATTGACTTATTTTAAGAAGTATTTTTTTTAAAAAAAAAAATCATTTGGTGAAAAACAGTTTGTATTTGATCAATAACTTTTTAAA
AAAAACAAATACTCTTTTTGTTCACTTTTACTTGTAATTTTTTGACTTGACAAGTCCATTAAGAAAATGACTATTGATATAAGTAATTTATGACCTTTAG
TACTGAGTCTTGAAAAATGATTTGAAGAAAGGATATTTAATACCAAGGGTAAACATGAAAAAATATTATTATCTTTTCTTAATATGTTAAAAGTAATAAG
TAAAAATAGAAATCCATTTTACGTGAACAGAGAAAGTATTTTTTTAGAATCAATTAATGTATGGGCAAAACTTTTTAAAAGTATTTCGAAGTGTATTTTT
TTCAAAAATATTTTGGAAAAGAACTAAATTTTTAAAAACTTCTAAACACAATTCTTGCTACTCTCGAAAACAGTTATTTTCTCCTCAAAACTTTTAATTT
TTTTTATAAAAAGTATCTTTAGGAAAAATAAAACATTTTTGACCTTCCTAAAACTTGAGTAAAGAGACTATAACCTCTCTTCAAATATTTGTATTAGCAA
TTCTATCAACTTGCTTATTTAAAAGAACCCAATAATTTGGAAAGCTTTGTTAATTGTTCCATCCCTTAATAATGAGGGTCAATCTTCTAATATGGATCCT
TAATACTCATAATATTACTCTCTTCGTCCGGTTTTATTTGTCATATTTTTATGTTAATAGTTAAACTATAAAAACTTTGACTAATATTTAAGATGCATTT
TTTCATCATATTAATATGCAAAAAGTTGTAATTTATAACACTTTTCATATAGTTTTAGAATATCTAATTTTTTTGTTTAAAATATCGAATTAATGTGATC
TAATTTACCTTTGAAAATTACTTAAATTGACTTTCGATAAACATAACATGACAAACAATTTCGAACGGAGGAAGTATTTTATCTTGTTGTTAAAAATTGA
TTGAAAAAAACGATAATAACCAACTTATCTGTACATTATTTATAAAACTGAAAACATTTAGCGGAGACAACGGTAAAATGAATTTTCATGCTTGAGAATA
TATAGACAAATCAATTATGTACGATAAACGAACTTAGACAATATTTAAATATGCATGGTACTTCACATAAGAACCAATATATTAATAACTATATAGAATA
TATATTTAAATATTAATTGAGAAACGATTCTCTATTACGTGCACCTAGGCAATCAACAATTTATTTATTTATTTTTTACGTAAGTTTCGTAGTATTCAAA
GCTAATTACATATTCATTTACTCTTTTTCAAATTACAAAATCTCTTAAAATTTATGAATTTTAGATATATCACTAAATTTTCAAATACATTACTAGACTT
TCGGATACATCACAGGACATATGAATACATAGGCGATAGATGTATCCGAGAGCGAAGAAATATATCAGGGAGGGGATAAGACATCCAAATACATTAGTGA
GCTTCCGGATACATGATCAGCAGAATCGGGATACATAAATGAGGAATGTATTAGAGAGGAGAGAGATGTATCTGAGATGGGATAAAATATATTAGCGAGA
AGAGAGTGATGTATTCGAGAAGGAATTTTTGAAAAACATTTCAATGATAGAAAATTATAGAGATCGTGGTATTAGGTTAAAAAAATTAAAAAAATAAGAA
AATGAAAAATACTAAAATTGATCTCATTAGGTTCAAACTTTATTTTCTTTGACAAATCCAATTTTAAGTACCTATTATTATTAATATTAGTATTGGGGCA
AAATAATATTCGACCAGGTTAAAAGTAGAGTATACAACCTAGGTATATATTCCTAGCATCAATTGACCTGTAAAAGTTGATTAACACGCACGAAATTTTA
TCTTTTAGGCACGTGCACTTTTTATTGCATGCTTTATTAATTATATTCCACATGTTCTTTTTTATATTCTAGATCATATAATATATAGTTGTAACTTTAA
TTACGCTAAAAAGTATATTTAGTTACGAACGTTATTTTGTTGTTCAAGTTTGTTAAGGATGATGATATATTTAAATATACACATTGTGATATTGAGAAGT
GTATTTAAGAAAATAAAATTTAATAAATTTAAGCGATATTATTTTTAAAAGTTTTGTGATCGTTTTTAGCTAGTAATGCACTTCAATTATTACTAATAAC
TAGTAATAGTTTTTAAAAGATTGTAATCTTACAAATATTATTCCTTTCTTCGCCGATCAACAAACTATCTATATACCACCGGCATGCAACAATTATTAAT
TAACTATACAAACCATTAGTTAATTATTTAATACTTGCTTTACGGATAAATTATAATACGTAGTGCTTAACAATCCCTATATACTTTTACTATAGTATAT
AAATAACATCCCCATTACGATTAATCGTATACATTCACATTTAATACAAAGCCTCTACACAACACCATATAAAAATGGCTATTAGAAAATCAGTTATTTT
TTGTTTCATTGTATGGCAGTTGCCTCTGCTTCTACTACTGCCATGTCATGACCGGAATTTGGCTTATGCCGCTGCCGGTGGCAAGTGGGACCTACTCATG
TCCAATATTGGTATTTCCGCTATGCACATGCAACTCCTCAACGACGATAGAGTTGTGATATATGATCGTACTGATTTTGGTATGTCTAATATTTCTTTGC
CTGATGGTAAATGTCGTAACAATAATAACGATCTTGCGTTAAAAGTTGATTGCACTGCACATTCTGTAGAGTACGACGTTTCCACCAACTCTGTGCGTCC
ACTCATGATCCAGACCAATGTGTGGTGCTCGTCCGGCTCTGCCACGTCAGACGGTTCGTTGGTTCAGACAGGTGGGTCCAATGATGGCAAATTTGTAATT
AGAGTTTACAGACCGTGCATTATTGGGAAAAAGAGTAATTGTGATTGGCTAGAAATCGAAAATGGATTAATTCAAAGTCGATGGTATTCCACCAATCATA
TTCTTCCCGACGGAAGCCAAATTATAATAGGAGGCCGTGATGCTTTTAACTACGAGTTTTTTCCCAAAACTGCGTCAACAAATAACGTATTTAATTTACC
TTTCCTTCAACAAACTAATGATCCTAGAGAGGAAAATAATCTTTACCCATTTGTTTTTCTCAATGTGGATGGGAATTTATTCATTTTCACAAACAATCGA
GCTATATTATTCGATTATACAACAAATATGATAGTGAAAACGTATCCACAAATACCTGGTGGTGATCCGAGAAATTATCCAAGTACGGGTTCAGCAGTTC
TTCTTCCATTAAAGAACTTGGAAGCACATACAATTCAAGCCGAGGTTTTGGTGTGTGGTGGAGCTCCAAGAGGCTCATACCTCAAAGCAACAAGAGGTGA
GTTTATCGGTGCGTTAAATACTTGCGGGCGGATTACAATTACCGACCCAAATCCACAATGGACCATGGAGACCATGCCACTACCTCGAACCATGGGTGAT
ATGGTAATTTTACCAAATGGAAATGTCTTGATTGTCAATGGGGCCGCGATGGGGAGTGCTGGATGGGAAATTGCTAGGGGCCCGGTCTTAAGTCCAGTGA
TTTATCGACCCGATAACCTACCCGATTCTAGATTTGAGGTACAAAATCCGAATGCAATACCTAGAATGTACCACTCAACTGCAGTTTTACTCCGAGATGG
TAGGGTTCTTGTGGGTGGTAGCAACCCAAATGAGTTTTACAACTTCACTGGAGTTCTTTTCCCAACAGAATTAAGCTTAGAGGCATTTTCACCGTCCTAT
CTGGATTCAGAATCTGCTCATTTGCGACCACAAATCATTTCCCCTGTTTCCCGCCATAAATTCAAACACGGGCAACGGGTTGACATTCAATTTTCCATTT
CCGGTTTAGTAAACAAAAATTCAATCAAAGTGACGATGATTGCACCAGGATTTAACACACATTCAAATACGATGAATCAAAGAATGCTTGTACTAACAAA
TGGAGTCGTAAAACAAGTTGGGAAATCTTCGTATCACATGAACTGTTTATTTCCGAAATCGGGTTCATTAGCACCACCGGGTTACTATCTTTTATTTGTG
GTTCATCAGGACATACCAAGTGAGGGTATTTGGGTCAGGATCTTTTAGATTTTAATTACTTTTAATTCAATTATTCTAAAGATCTGTTTTTAATTTTGAT
CTTTGAGAGTATAATAAGATAGTCTCTGTTTTAATTGTTGCTTAACTAATAATTATCTTTCATTAGGTATAGATTTTTAAAGTTAGCATCTGTTTAGAAG
AAAAAGATGTGAAACGCTTTGATAAGAGTGGATCAAGTAGGACTGACAAATTTTTAAGTTGACAAGCTTTTAAAGATTAAACAAAATGATACCTTAAACG
AATTTCATAACAGAATAAGAGAAGAAACTAACGAACTTGATTAAGCATATCTCAACTTTATACACATTTTTAAGCTTGATGTGATATAACGATGATGGTA
AATTAAAGTTGAGTTGGATACGATAACAAATGGTGATTTAAATCTTATAGTACGATTTGATGACATAAAATTAAAAGACTCATAGACATTTGCCGAAGTG
ATTAAAGAGCACATTCCAATTAATTAAAGATTATATAAGCTTGGAGCATATTTTGAATTGAATTATTTTAAAAAATCCAAAGTCAAAATATCTTTTTTTG
TTATTGTTTGGATTAATTTAAAAGTTCTTGAAAGCACTTGATTTTAAACTAAAATGAAGGAGAAAAATATGTCAAAAGTCAATTCAAACAAACTACAAAA
AACGTTAAAATTATTTTTTTAAATGACTTATAAATTAAAAGTTAACGTTGGTTAAACCCCAACTTTTGACTTTCTTGGCTATTGTTAAGAACATTTCCTA
ACTAAAGAATAGCTTAAAAGCCAAAATCAATAAATATAAGTCAATCAAAACACCCACTTTTAATCAAATATACCACAAAGACTAAACATTAGAATATACT
AATATCTAAAGGATCAAAAAATTTAATATTGATTATCTTAAACGTCTGAAATAATTTCTTTACTCATTTTTTCTAGATAGATCAATCTATCGAAAGCAAT
ATCTCTATTTTCTAATATAGAAATAAGATTTATGTACATTCTATATTCACAGATTTTACTTCCGAATTACATGAGTAATACGTTTTTGTAGTATAAAAAA
TACAATTGACATTTGTCAAATTCTCTATCTCTCTCTAAAATATTACAATTTCTGAAATAATTCATTAAGTTTTCCATCTCTGTTCATGCATGTCAAAATT
TCCACATAAGAAAAGAATAAAAAGAAACGTGCATGCATGCAAGAGCTCATTATTATGACATTTCAAGTCATAATAATTATGCACTTAATTAATTAATTAA
TTAATTAGTAAAGATCGATTGATTAATTAATCAGTTGATTTGGTACATAACTTACTTAACTGATAATGCATGTATATATCCTGGCAATATGAAACCATAC
TATAATGATTAAAGCTTATAATTCGATTAGCCTAAAATGTATGTGCATATTGACAAGAAATCAAATCTTTTTATCCATTAGTTTAATTATTTATTTTATT
AAATATGTCAACAAGTCAAACATCAAATTCCCTTTCAATAGAAAACCTTTAATAAGGCAAAACTAAATAAAATAAAATTGCATGGAGAAACGTGTGGATC
GTCGATGGTGAAGAACTATTTGTGTGAATAAAATTTAAGTTATTATACTAGGTAAGTATAATAATAGTATAGAATATGTTGAATATGTAGTAAATGTCTA
TAGTACATAAGTAAATACGATAACTTAGAAAATTGAAATCAAGAGTTATAACTAGTTAAAATATACTGATCATAGTTCAACCGCTATTACTAAAAACAAC
TGAATTTTCAATTAAAAAAAAATCTTCTGACAAGCCAATTATGACATTTTTTCTCAAAAATTCTGCCTAAAATTCATAGAATTTATTGAAGGGGAATAAA
CTTGCTTCAAACTCTCAACATGTTTTTCTTCAAAATTCTTTTATGGACAATTTTATCACCTTATTTGTTTTAAAACAAAAGATAATTGGAAATGTTTGTT
CCAAGATGGTTCCTTAATTAACTCAAATTATTCCTAATCTAGTTGTCAAATTAATGATCGAAAATACTATAATATATGTACCATAAGATGGGAGCAAACT
GAAAACAATTAGCGAAAATAAAGGTCAAAATCAATTAATTGCATGAATTTGGCAATAAATTGAAAAACTATAGGGGATACAATGTTTTTTAAAAAAATAA
TGGAGAAAATATTCTCTATACATGAAGCATTTCTTTTTACAACAAAAAGGCATATTTTCTTGTCGGTTTAATGATATTTATAATTCCATGAGAATCAAAT
CCATATTAAGAATAAAATTAAATAAGTGCTTAATCGATATTAAAATAACGAGCAAAAATATGGGCATGATTAATTCACAGTGTCAATCGGAGTATATCTT
TAGAAATAAAAATTAGCAATTTTTTAAATTAGATATCTTTTTTAATAAAGCAGTCAAATAATATAGAGAAACACATCTCGAAGAGTTTAATAAGATATGA
ATCATGAAAAAAATTATCTAATTAATCAAAATATAATATTATACTTCGCACAGACTGATAGTAGGAAAAAAAGATAAATATACTCTCGAATTATGCAAAC
ACTTACTGTCATATTTTTGGGACATTGCTGCACCTGTCGTCCAAAAATTAAAGCATATATAATATTTATACTAAGGGACGTACACATGTCATAATTTTAT
CAACCGATCCGACATTTATTATATATCAAATCAACAGATAAGATTGCGCCACGTGTATTTAGTCTTCCATCTGAGTGAAGAACATATGTACTTTAGTTTT
TGTCAACGACAAAAGCACAATGTCCCAAAAGTATACTTTAAATTTTATTGACGACATAAGCATCAATGTCCCAAAAATATAATGAACGATATCTATCTAC
TATTTACGATAATTTAAAAGTGTATTTATTTTTTTTCCCCAATAATATTATATTACATATTAATCTCATATATCCTAATTAAACACACGGAACAGAGCAT
TCATCTTTCCTAATTCCTAGTGATTTTTAGAACGATTACAACATATGGTGTTGACTAATGAAATCTTAAATATTCTTCAAAAAAAAGTCAATTTTGCATT
AAGAAGTGTCTTAATTACTTGTATCCCCCCTACCCCAACCCACCCCGACCCCCAAACTACCACTTGTGGCAATTATTTATAATGCAAACCATTAATTGCA
TAATTATGTGTATAAATAATACACACATTTAATAGTATATAAAGAACATTACCCATAGCCTTTTCTCACAACAACACAAACATCACACATCATAGTATAC
TCTTCAAAGAAAAACATATCTAATGGCCATTAAAACAAGTCTTGTTCTTTGGCAGCTACATTTGCTTTTATTACTATCATGTCATGACTTGAACTTGGCT
AATGCTGCAGGAGGCAAATGGGATTTACTTATGTCCAACATTGGCATTTCCGCCATGCACATGCAACTCCTCAACAACGATAGAGTCATCATGTACGATC
GTACTGACTTTGGTGCATCCAACATCTCATTACCTGATGGCAAGTGTCGTAACAATCCTAAAGAACTCGCCTTGAAAATCGATTGCACTGCCCACTCTGT
TGAATATGACGTGTCCACTAATTCCATACGTCCCCTCATGGTCCAGACCAACGTGTGGTGCTCCTCGGGCTCTGCCACCTCGGATGGTTCGTTGGTCCAA
ACCGGTGGATTCAATGATGGTAAACTCATGGTGAGAACTTTTAACCCATGCAACACTTGTGATTGGCAAGAAATGGGAGATGGACTAGGTCAAAGTCGAT
GGTATTCCACCAATCATATTCTTCCTGACGGAAGCCAAATTATAATAGGAGGCCGTGATGCTTTTAACTACGAGTTTTTCCCCCAAACTGCGTCAACAAG
CAACGTATTTAATTTACCTTTCCTTCGAGAAACTAATGTTCCTAGAGAGGAAAACAATTTATACCCATTTGTTTTTCTCAACGTCGATGGGAATTTATTC
ATTTTCACCAATGATCGAGCTATATTGCTCGATTACACAACAAATACAATAGTGAAAACATATCCACAAATACCAGGCGGTGACCCAAGAAATTATCCAA
GTACAGGTTCTGCAGTTCTTCTTCCTTTAAAGAACTTGCGTTCACAAAAGGTTCAAGCTGAGGTTTTGGTGTGTGGTGGAGCACCAAAAGGCTCATACCT
TAGAGCAACAAAAGGGGATTTCGTCGGTGCATTAAATACTTGCGGGCGGATTACAATTACCGACCCAAATCCACAATGGACCATGGAGACCATGCCACTA
CCTCGAACCATGGGTGATATGGTAATTCTACCAAACGGTAACGTTTTGATTGTTAATGGAGCCGCTACGGGTACAGCTGGATGGCAAATTGCAAGGAACC
CGGTTTTCAGTCCGGTAATTTACCGAACCGATAACCCATCTGATTCTAGATTCGAGGTACAAACCCCGAATGCCATACCTAGAATGTACCACTCAACAGC
AGTTCTACTCCGAGACGGTAGAGTTCTCGTTGGCGGTAGTAATCCAAATGAGCTTTACAATTTCACCGGAGTAGTTTTTCCAACGGACTTAAGCTTAGAG
GCATTTTCACCGTCCTATCTCGATGTGGAATTCGCTAATCTACGACCACAAATTATTTCTCCCGATTCACATCTTAAATTCACGTATGGACAACGTGTTG
ACATTCGATTTACTGCTTTAGGGTTATTAAATCGAGATTTGATCAAGGTGACTATGGTTGCACCGGGTTTTAATACACATTCGAACACGATGAATCAAAG
AATGCTCGTACTTCCGAGAGGAATTGTACGACAAGTGGGAAGATTTGTGTATGAAGTGAGTTGTGTATTTCCGAAATCGGGTTCATTAGCACCACCGGGT
TACTATCTTTTATTTGTGGTTCATCAGGACATACCAAGTGAGGCAATTTGGGTCAGGGTTAATTAACCATATGCATTTGATTTGATTTACGAATTGTTAT
TTTTCATAATTTTGTTTTACTTCCAACTTAAAGTGTATGGGAAGACTTGTTTTGGTGTTTTTATTTTTATTTTAATAGAGTAATAATGTCATGAGAAGGA
AGTAATTGTTTTTTGGTTTTGGAGAAGAAGTTGCAATTAATTAGCAAGACAATTAGATTTTGTGTTTTTATTTTACAAAATGGACTAATATTGTGTTAAT
TAGAAGAACAATAAAAGATAGGAATAAGCTTTAAATCTTGATTCAGTCTCCGATAATGACATATTATTAAAATTTAGAGAAAATAAATAGAATGGAAATG
GAGAAGAGTCAAAACCTAACTAATACATATTTTGACAAATATGAAATCATATAATCAATGGCAGATTCAGAAATTTTACTAACTCTGCAATTTAGGGATA
ATATTCCTGGTCCAACTTGTGCATTCGAGTACCACTTGGACTATCTCTCTTTTTATATTTAGGTGGTTTAAACTTTATATATATATATATAAATATTGAA
AACTTATCCTCTATATATACAATGTAATTTTTTAGCAGGTAATTCGAGTAAATCCCTTAGCCGCCTATGATAGTTTAAGCTTATAATTAGCTTAGCCTGA
AATGTATGTTAATATGGAGAAGTCTTTTTATTAGGTACCTTAAGTATTTATTTTATTAAAAGTAAATTAGAAGTAATACAAGCTATTCCATATAAATTAA
TGCATTAGTTGAACTTTTGCCAGGATAAAAAGAAAAGAAAATTTAACTATTGGAAAAAGATCTCTATGAAATATAATATTTTCTCTAATGAGATCTAAAA
CTAAGTCATACTATCAAAATATAATTTAAGCAATATATTTGGCTATTTACTATATCTTTTAGGCAATTAATTGATACTACCTATATGATTAAAACATAAA
ACTTAAATAATTCTTCATGTTTCGAACTTTGATTTTATTACAAGGTTTACTTCAATTCTTCATAAATATTTTAAGTTTAAACTAATTAGATCATTAAATG
GTTAGATTTGAAAAAACATTATCGTAACTTTAAATATATTCTAAAACATAACAATTATGATTTTAATGATTTAAATCTAATTTTGAACTAAATACGAGAT
GTTATACAAGTAAGGACTATACTCTAATTAACTTGCTCAATTTAGTGAAATCTTATTTCTATTTAAAAACATTTATACTAGATATAGAATAATTTATTAA
TTTATGTAACAATTTACTCAATTAAGAAAAAATCCAAACATAAAATTAAAAAAAGAACTTATCTAAGATCTAAACACTTTTGATGGTATCTTGACATACA
ATAATTTATACATATCTATTAAATATGTCACGAAAGACTACACGAATTAGCTATACTATTAACTAAACAAAAAATAATAATGATCAAATATAATTTATAA
TAATATATTTTAAAAAGCTATACAAGTATAAATCAAATAAAAAATATAAAAATTATTAAATAATCTTAAGAGCACCTTAGACCTCTCCATGGTCTAAATG
AAGTTTTTAAATAAAGTTTTTTTGGAGATTATTTTGATATGTCACATTTTTCATCTTAATAAATGTGATAATGATTCGTTTTGATTGTTATCTTAATATA
TATATATATACATATGCAATATCATAATCAAACAATATAAGTATTCTAATATAATTACAAAATACAACAATATTATCTCATAAATTTATCTGTAAGAAGT
AAAAATCACAAGAACAAGTGAAATATAAATTCTTGAAAAAATAATAGTATGAACATAGTACATAATACTATTTTGAAAGATATTTTACCATCAAAATATT
TTTTGTAATGATACTATTACTAGGGGCGGCTCTATGTTTTTGTAAAATAAGGCTTATACCTTAAAACCCCTAAAAGAACAAATTATGTGTTAAAAATACT
TATAGAAATGATTGATTATTAAAAATATATTATTATTTTACACATTTTAGTATTTTTTGTACTTTGTTAAAGATAAGAATTGATAAGAATTGAACAAAGT
GAATTACAATTTTTTTTAATTTGTTTTTAAATTTTAGTTTCAAGCATTACTACAAGTATATTGAAATGGGATATACTAAGTCATCAACTTCTTGAGATTC
TATGATTCTAATTCTTATTTTTATTCAATATTTGTCAACTTATTATTTATAGAAATAAATTTGAATAAATATGTATATCAAATTTGTTTATATTTTAGGT
CTCCAATTGAAATTTCGCTTTGGACCTCCAATTACGTTGAACCTTCACTGACTGTTACACGTCAAAAAGTTTCTCCTGTTTCTGTTACGCGTCAAAAGGT
TTCACCTTTTACTTAAAGTTTGTTGATAAATCATGTATTTGAAGTAATTAATCCAAATATCATATTTAAGATATATTATTCAACAACAATTTTATTTTGA
TTTTTATTGAACATTATAATCTCGTTAAATTCCATCATTTCTTTTCTAATTCAATTTGGATGCGAAAAAGTTGCTAATTTGCTACCAAACATAGTTCTTC
TCATTCAAAATACTAAACAAAATTTAATTAAAATTAGCTTCGAATTTTACAACACATCCAAATAATATGAATAAAAAATGTTAAAAAGAATTGTAAGAAC
TATTGTGTATTTTAAAGGATATTGTTAAATAAACTGTGTAATTAGACTGGGCTATTCATAAGTTTAAATTGGGCCAACATTTTGCACACCTAAGGAATGG
ACTGAGCTATTGAATTTCATCGCTAGAATTTGGCTGGGCTGGGCTGGCTAACCCATCCAGCTAATTGACAAAGTTAATTATAACTAACTAAATTGGAAAA
TATGTAATATCTAAAAAGTGTCGTTGCATGACGGTTGAAGCAGGTTAAAATGAATCGAGTTAACAAACTGAGTTGGTAATTAACTCAGTCACAAGTTGAT
TGACCTTAAATGAGTCAAACAATAGGTCAAAGTTCAATACATTTAATTCTAACTAAGTTTTAATGAGTTTATTTACGCGATATAATTTTTCCGTAAAATT
ATTCATACGTTCCCTTTTAACTTGTCAACATAAATGCACCTGTCCAGTAAGATTAATGAAAGAACAATGCGTGCTCAACATTACTTGACACCAAAGATTT
GTTTCACACAAAATATAATAATATCTCTAACTAATTAATATTCTTTCTTTCCCTAGCTAACAAACAATAATACTATATTTAATTATTGCATTTTGTTCAA
CTATTAACACTATATATAATCAGGACATATATTTAGACCTAAATTTATTTATATCTTACATAGAGCTAATGACTACTAGAATAAAAGTTTTTCCTTTCTT
GATTCTAATTGGTCAGCTACTCCTGCTACTGCCAAGTCACCAGAACTCGGCTTACGCCGCCGCCGGTGGCAAGTGGGACCTACTCATGTCTAACATCGGA
ATTTCCTCCATGCACATGCAACTTCTCAACAACGATAGAGTCATCATGTACGATCGTACTGACTTTGGTGCATCCAACATCTCCTTACCTAACGGTAAAT
GTCGTAACAACACTAATGACCTCGCGTTGAAAATCGATTGCACTGCTCACTCTGTTGAGTACGATGTGTCCACCAACTCTATACGTCCCCTCATGGTCCA
GACCGACGTGTGGTGCTCCTCCGGCTCCGCCACCTCGGACGGTACTTTGGTTCAGACCGGTGGATTCAACGATGGTGAAAAGGTTGTAAGAGTTTTAAAA
CCATGTAATGGAAATAAAAGTAGGTGTGATTGGAGAGAAATTGAAAGTGCTTTGATACAAAGTCGATGGTACGCGACCAATCATGTGTTGCCAGATGGCA
GACAAATTATAATAGGAGGTCGTGAGGCTTTTAACTATGAGTTTTATCCTAAAACTCTATCGACAAATAATATATTTAATCTTACGTTTCTTCAACAAAC
TAATGATCCTAGAGAGGAAAACAATCTTTACCCTTTTGTTTTTCTTAATGTCGATGGAAATTTATTTATTTTCGCGAATAATCGAGCTATATTATTCGAT
TACACGAGTGATACGATAGTGAAAACGTATCCACAAATACCAGGTGGTGATCCGAGAAATTATCCAAGTACAGGTTCTGCGGTTCTTCTTCCTTTAAAGA
ATTTGGAGGCACAAATAATTCAAGCTGAGGTTTTGGTATGTGGTGGAACAAAAAATGGTTCATTTCTTAGGGCACAAAGAGGTAAATTTTTGGGTGCGTT
AAATACTTGTGGACGGATTAGAATTACCGACCCGAATCCACAATGGGTCATGGAGACAATGCCACTAGCTCGAATAATGAGTGATATGGTAATTTTACCT
AATGGAAATGTTTTGATCATTAACGGAGCAGCGGCGGGTACGGCCGGATGGGAACTTGGTCGGAGCCCCGTTTTGAGTCCGGTGATTTATCGTCCTGATA
ATCCAGTCAATTCAAGATTTGAGGTACAAAATCCGAGTACTATACCAAGAATGTACCATTCAACAACAATTTTACTTCGAGATGGTAGAGTTTTAGTTGG
TGGTAGTAATCCACATGGGCTTTACAACTTCACAGGAGTTCTTTACCCAACTGAGTTGAGTTTAGAGGCATTTTCACCATCGTATTTAGATTCAGACTCT
GCAAATTTACGTCCACAAATCATTTCACCCGCTTCGAGACGTAAAGTCAAGTACGGTGGACAGGTCAATATTCGATTTATCGTACCTGGCCCGATAAATA
GGAATTTGGTCAAAGTGACAATGGTTGCACCAGGATTTAACACACATTCATTTACTATGAATCAAAGAATACTTGTGCTTTCGAGTGGAAACGTAACACA
AGTTGGAACATCAACTTATAAAATCAATTCGATTTTTCCAAATTCAAGTAAATTAGCACCACCTGGTTACTATATGTTATTTGTGGTTCATCAAGATATC
CCAAGTGAAGGAATTTGGATCAGGATTTAGTAACAAGGTTTGATCAGTCACGATTCAAAGTTGTCGAAATATTTGTTATTGGTTCGAGTCTTTTTCTTGA
TTTCGCAAATAGCAGGAGCTTAATTAGTAAAATGATAAAAAAGAAACATTATTATTAGGTGTGATGGCTACAATTCTTTTTTTGGAATGTTACGTTGTTG
TAAGCATGATAATAAATTCAATTCTTTTGTATTGACTATTGGAATAAATATTGCAATAATAACGAAAGGCTTGCGTTGATCCCAACATTAATTTATATTA
CTTGTTAACTTAATTAATTAATAAGGATTACATTATGTTTGTCACTATCTATATGGTGGCATCGTGTCATAATTTAAAAGAAAAGTGGTGCTTTCCATTG
ATGGATGCACGTAAATTTTTTTTTTTTTTTTGATTTTCCTATTGACTAATTCTTTGCATTTACCTAAATCAAATTTGACCTTGATTCGATCATATTATCG
ATTCGAAAGAGGGTGACATATGTCATTTATAAGATCAATTATTATATACTTTTGATGAAATGTACGTCAATAATTCTATCGAAAATAAATTAGTAAACTC
AAACTGAACATTCCATTGAACAATAAAGCAATGCCTTCATGCGCGTTGCGTCATAATAATGAATATTGAACAAAGAATGATTCAAAAACGATTTTTTTAA
TCATATGTCATTTTCCAACGTCTCACTTAATACAACTCAATGTTGTTGGTCATGTATGTTTATTTATGTTGAATATTTCGACTTGAAATCGAGAGTTATA
TCAAAAGAACCATACAAACAACATAATCAAAATCAGCTGTTCATATTAATCAATGTATTGAGCAACACAATAAGGTCCTTTAGATATGCATCCACTGATG
TACATCCAGGCACAAACAAAAGATATACTAGTTTCGGTACGTTAAGGCTAAAAACATACACGAATAACCAAAAAGAGATTGATTAATCAGCATCTTGAAC
AGCTTAAGCTCGTTCTCCACGAATACGTCTTGCAAGTTGAATATCCTTGGGCATTATGGTGACTCTCTTAGCATGGATGGCACACAAGTTGGTGTCCTCA
AAGAGACCAACTAAATACGCTTCAGCGGCTTCTTGGAGTGCAAGCACAGCATGACTTTGAAACCTCAGATCTGTCTGTTTTATAAACGAAGATCAAAAGA
AGTGTTACTATCATCCAAACCAACTATTTTTTCAAGCACACAAAAACATACATCCTCTGTTTCATCTTCTAAGAGGGTGTTTCAGTTGGCACCGATTAAT
CTATAACAGAATAGAATAATAAAGCAGGGTGGAAAGAGAGTTAACATCACATAAATGTTAAGAATGTGAATACTCTAGCGAATTTATATACTTGAAAGTT
GTAAAGACAAATAATGGTTTCCAATGATTTTTTTAATGAGTAGAATAGTGTCAGACAGTTCAAAACATCCCAAACAGAAACAATGACATATAAATCAGAA
TGGAGAAAGTAACGAAATGATACTCTAATCATCACAGGTTCTACATTTACCACAGAGACCTGAGCAATTTATAAGTAAAATGATGTCAATATTTAGAAAC
ATCCCAAAATAGATAATGTCATATAAGTTGGTGTTGAGGGGAGCAACTGACTGATATTACCTTAAAATCCTGAGCAATTTCACGGACAAGCCTTTGGAAT
GGCAACTTCCGGATGAGAAGCTCAGTGCTCTTTTGATATTTTCGGATTTCACTATAAACAATTAAACATGCATAGTAATTAATCGCTGAATCAGATTAAG
AAAAAACATGATTGTTAAAGAACAATGTCAAAACAAGAGAGATTGAAAAAGTACCGGAGAGCAACAGTTCCAGGTCGGTAACGATGAGGCTTCTTCACTC
CTCCTGTGGTAGGGGCTGACTTCCTTGCAGCCTACCAAATTAGAAAAAAGAACCCTAATCAGCATAACTATAACAAAAATTCCTCCTAAATTTGCAAAAT
CTAATACATGCCCACGTAAATCTAAATCAGTTAGTTAAAGAGTTTAAAATATCAATATTTGGTTTCCACCCGGTTTCCATGGGGGCTCAAAGAAGTAAAG
CACTATCTAACAACTTGTTTGGATATTTTTTCTTAATGTATAAGTATTGTGTTATAAGTTTAAATACAATGTTTGTTTGATTGTAACCTAAATTTTGTTG
TACTGTATCATAAAATCCATTGTTACATAACAATGAAAAGTGTCATTTTGTGTAACGACTGATTTGGTGTGATCGCGTCGCTATCTAATTGATATTTCTC
ATTTCATCATTACTTATTATCAAATGATTTCATTTTATCCTTTACCTTACCTACATTGTATTCATCACAACAATACAATACGAAATACAATGTAACCCGA
TACATTATGAAACAACCATCCAAACAGAGGATTAACAAAGGCTACTTCATACCGGATCAAACACGAGACAGTAAGAGATACATTCCAACCTTATGAAAGG
AAATATTTGAAAACTCAATCATAAATTACAAAAAAAAAAAAGAATAACTTCGCTATGAAAGCAAAAAAGTACCAACCTTTGTAGCAAGTTGCTTCCTTGG
AGCCTTTCCACCGGTTGATTTACGAGCTGTCTGCTTAGTACGAGCCATTTCTTCACAATCTGAAGAGAAAAAAAACGATTAAGCAAATAGAAAAATATAT
GAAAAATCGCTCTACAAACAAGGAAAAAACGTCGTCGCCGGTATCAATAACCAGAAAAAGAAACGAAGATCGTCGGAGAAGAGAATCATTACCTGAGAAA
GTTGCAGAGAGAATTTGAAATTTGAAAGTGTAAAAAAGCTGAGGTATTAAGAAAGAGAAATAAGGGATTTATATATTATTAGGGATCCGATTTTAATTGG
GCCGGATTTGAAAGGGCCTGTCTTAATGGACCCAATAATCAATTTTGTGTACATCAGCCCATATCATTTTGTGGAGGTAGATAAGTTATTTTCGAAAAAT
CTCTAGTTCAATTACAATTTTCGAGATACAAAGAAATATAATATTTTGAGCAATATGAGAAACATTCGAAAAAATTATATGGCTAAACAAACATATATTA
ATTAATTCGTCACTATAGTTGTAGTTTTAATTAATTATCAATTGCGACTAATATACGATGATAATTACGTGGGCTGGAGTTTCGAGTTTGTATAATCTGA
AATTTGTATAACTTTTATATAATTGTTTAAAGGTCATATGTTTGTTTGTATTTAAATTTATTATTTCAAATTTATACAAAAATAACTCAATTATACAAAT
GTATCTGTAAATTATACAAACGAAATATTTTAAATCGTAGATATACAAACTATAGTTATATTATAATTAAATTTATTATAGTGACTATTTATGAATTTTT
TTCTGATTATGATTTATGTTTTACAAAATATAATATAGAATAAAAATATTTAAAAAAAAAATATGCATGACAAATGAATAGATGGATAGTATTTATTTAT
TTTTTGATTGCATAAATAATTTCCCAAATTCTGATTTCTGCATAATTAGTGAATACCATTTCTTCTTCCTTAAAAATTTTGAACTATCTGATGATTTGAC
AAGAGTTATAGTGAGATCTACAGTTCAATTCATCAATGGAGGGCTATGTGTGGGCAATAGCCGCTGGGTTCAACGCAGCTCTTGCAGCCATCTCTGCCAA
ATTCTTCACCTCCCAGGTCAAATACTTTCACTGATTGTTCCATCTTTACCCTTTTTTCTCCTTATTGTGATGATTAGCTGTGAGTGTTGGAATGAAATTG
GTGTAAATAGAGCCGAATTGACGTAGACAATTCATGTGGCTTTAATGGGTGGATCTAGGATTTGAAGTTTATGAGTTAGTGTATCGAGCTCAGTTTAATA
TTACAGTAATAACTAGGTTTATTGTCAAATATTTATAGATATGATAAAAAGAAAAAAAAAAGGAGCTAATGAGTTCACGTGAATCCGTAGTCAGACCTTG
GTGGATTTGGGATTGAGTTGTATGTTGTAGCTGTAGGATCTGAAATTCTGAATTGGGTCCATTTGTAAGATGAAGAAAATGCCTTTATTGAGTTTGAAAT
GGGATGAATTGAGCGGAGCCAAGATTGTCATTTGAAAATGTCTCTTACCAAGTATAAACAGTGTAATTTTCCACAAAGGGAATTCGGGCCCTTACTAGCT
CCGCTCTTGAATAGTCTGATAGACTGGAAAAGATGGATTATTTTTGTGAAACATTATTTGGTCTGGACATGATTAATCACCGCTTGCTATCTAAAGTGCT
ACTTTTGTCCGTCTCTTGTTTTGGATCGAAATGTTGTCATGATCACTGATGTTTGCGTCAGGTAGGCTATCCACATTACACCCTCTTGGGGTGTGGCCCT
TCTTTGGACCCTGCATGAATGCAATATGCTTTATGAATTCAGAAGTCTATGTTTGATTTCTGCAACATTTGTTACGTCTCATAATAATCAAATATAGATA
GCTGGAAATATGAGTTCTCGACACATATATCTTGAAAAATTAGTAGTATTTGCATTGAGCTGAGCATTTGAAGGATTATCAGTCATCAGTGGGATGCCTT
GTCTTTTTCAATATTTTACATTCTTAGTTGAGGGAGGAGTGAGGGAGGTTATTGAAATGGAAGAGTGGGACTATATAATCTGTTTCAGTCTGTTTACATG
TGATGTACATTTCAACTGCAAACTAGATTGATGCTTCTACTTGAGTCATGTCCTGGATTGATCACGTCATGTTTTGAATTGATTCCATGTAATCTACTTC
TGTAGCTTCAGTTCTTTGTCACTAAAGATCCTAGATTGTTTTCATGGTAAATTTTTGGCATAAATCTTTGCCACATTAAATTGTATAATGTCTATTGTCT
ATGTAAATTTGCTTAATCGTGTCACTAGTACTCATTCTTTGTTTCTGCTTCACTTTAATGTGATCCTTTTCAAATTCACAGCTCATCAAATATGGTTGTG
TCATATTATTCAATGTCACAATGTGGGGATGCTATGTCAATAGCCTTAAAGCTCTATCATCTCTACAAGCTACTGTGACTAACTTTGCAACCAACTTTTT
ATCATCTGGATTGGCTGGATTTTTGCTTTTTCGGGAGCCACTACCAATCCAGGTAATTTGTGAAATTTGTGCTACTCTGTTTATGAACTATAGTATGATC
CTCCGATCCCTCTTTTTGGTCAGTCCTCTCTTACTATTTTATGGAAATCCTGGTGTTGTTGCGCTGTTACATCTTGGCACCAATCACGAGTTCTCATCAT
ATATTTCATAAACTTAATAAAATCAATACGGCCAATTGAAATTAATGTTTTTCTCTACATAAAAGGCAGTAATATACCATGGTTTGTAGACACTCGAAAG
AGATTTCTTCTCTTTGGAGGAACATGAGACACTGGGCTATCCCCCCATTCAGCTATCTTAAGAGTTATACATCAAAAATATGATAAAAGGGGTAGGGATC
TTGGACCTTTGACTGGGGTGGTAATGACCATACAATACGTTAGATGCGTTTCAACTTTTTTACAATACACAACTGTTTACACTAAAAATTAATCAGTTTC
TGCAACAACAACATACCTAGTATACTCCACAAGTGGGGTCTAGAGAGGGTGGTGTGTACGCAGACCTTACCCCTAACTTGTGAAAGTAGAAAGGTTGTTT
GTATAGACCCTAGGCTACGAGTAAAACATTTCAAAGCAGGTATTCAAAGGAAATAAAGTAAATGAACACGAGTTCTCTAACTATTTTGTCAATATCATTT
ATTTTTGTAGAACGTGTTCCTGCATATTTTTTTATAATAAGTACCAGTAGAGTTTCTCAAAATGAATGTTAGAGAACTTGTAGAAGTTCTAATTAAATCA
GAAATGTGTTCCTATATGGTTGATATGGCTATTGGTTTTCCTACATGATAATAAACAATGTTCAAGTATCTATGCTTTTACATCAACTAAAACGTAGATA
CATCCCTGAACCCCGTTAGTGTTGACGATAGATCAACCTGTCCTATATGATGAAAATTATGCCATTGATCTATTAACTGGTATTGCTTTTGCAGTGGTTT
GCAGGCGCCTCCCTTATCGTGCTTGGAGTTATTGTTTTGAGCAAGTCAAGCATAGAGAAGAAAACTCATACAAGTTAAATTTAGAGAAGGTGTGAGCCAA
ATATCAGATGTAGATTTTAATGGCCTTAACATGAACTACTGTTAAATTCATGTCTCAGAATCAGTTTATTTTGCACTATTGTGGCTGTTGATATAATTGT
TGCTCTTGTAATATTCCAATACTGGGACTCTCTCCATGTTGTACGACTCTACGTGATCGTGATGTCACTGATGAAATTACGTTGAATATGTCATTGTTAG
TACTTAGTCCTAATATCTATTTGAGGACTGCTTTAAAATTGGTTCTTTAATATACTCTTGCACAATTTTTGGTTCTTATGGTTTTTTTTTGTGCCTTCTA
ATTTTGGGTGTATAAATAGATACTTAACTTTATGTAAAGTTGAATAAGTACACACACATTCTATATGACATAATACAAATCAGTTTGAGTGTTACGTGAA
TTATCTTGCAAAATATATGTGTCCTTATTCAATTTTGTACAAAGTTAGATATATACTTGCTCACACTTGAAATTAAAAAAATGTATGTATCAGTTGAAAC
TAAGTTAAACAAACATTTTTATTCATTAGGGCTATTACTAGATTGTATGGAATCTTTAAAACAAAAAGATTTAACTTGAAATAAGAGAAGTCTCGTTAAA
TTTGGAAAAATAAAACATCAAAAGTTCAAGCATAGTAAAAACTGTAAAATCTGACACGTGAATTCATGTTAATTCCTTTTTCTTTTTCACAATTTATTAA
TAAATCTAATAGTCAAAACTCAAATTTTATTGAATGCTCATTTAACAGATCAAAAAGAGAGTTTATTTTGAATAAATTTAAAAGAATTTAACTATACAAA
AGTATATATTTAACGAATTTTTTTAAATCTACTCTTTTGTTTAGGACCTATTTTGTTATTTTTTCTTTTATAATGTTCCTCATCGGTCGATTAAATTTTC
ACGAAAGCTAGAAATTTTAAAATTTAGTTGATTGATTAAATAAATATTCACGAATTTAATTACCCTAATCTCTTTTCCATTGACCATCCCACATTCTTGT
CATTTTCACTTTCATCACACTGTTTACGGATCAATTAAACTTTCACAAAAATTAAAAATTTAGTTAATTGACTATATAAATATCTACGAATTAGATTACC
TAATACTTTTTACTATTAACCATCCCCTTTTTTTGTTATTTTCTCTTTTATTACAGACTCATAGGTCAATCAAACTTTCACAAAAATTTAAAGATTTATA
AGTTTAACTAAATGACTATATGAATATCCACAAATTCAATTATCTTAGAGCCGATTTGAATTGGTTTAAAAATCGATCAAACTTACTTTTAAGTCAGTAT
TTGATAAATATAAAAAATAACTTAAAATAAATTATAAAGTATTAGATATAAAATGAATCTCTCCTATTTTTTATTTTTTTAACTTAAAAATCGTTTCACT
TTTGAATTTTTATTTTTATCAAAGGGGCACTTAATACCTTTTCCCATTGACCGTCCCTCATTTTTGTCATTTTCTTTCACCGCTCACTGATCAACCAAAC
TTTCACAAAAATTAAAAATTTCAAAAGTTTAGTCTTATTAGAATTTAATCACCTTAATCCCTTTTCACATTTCTCTTTGACTACTATTTCATTTTTCCCA
TAAAAAATTAATTCAGTTTTCTTCTTATATATACAGAAGAAGAAAGAAAGTGAGATGTTAAGTCATATTCAGGTGATATTAGTGAAGAAAAATTCTCATT
TTAGCAAAAAAAAAAAGAGGAAGTAATCCAACCAGTAGCAAGCAGACACATAAAAAGGTAGTCTTTTTGCCTTATTAGTACAAATTTTTCTGTATAAGCT
TCCACTTACAGTCATGGCTTTGCAGTCAATTTTTCAGAAAACACTATAGATATATCAAAGTGGATTTGAGTACTGTAATATTTTTTTTCCAAAGGGTAAT
AAAGAAACTCAAGAAAGAGAGAGGAAGAAAACAAAAAGATGCTGGTATGGGTGTTGGTATTGGTGTTGACAGGTAAAAGATAAAATTAATGAAAAATACC
AAAAAAGAAAAAAAAAAAAAAAGGAAAGAAGAGTTGATGGGTGATGTCAATGTTGCTCTTTCTTTCAACTACTGCTCTTTCTTCACTGATATTTATCTCT
TTCAAGTTAGGGTTTTGAGTTTTGACCCTCTTTCTTTCTTGATTTTTATTTTTTCTCAGATATGTATCAGCTCTGCTATGTAAGCTTTACATGTAGTCTT
TAATGGGTGTATCTTCTTTTTCTACTTTTTGTGTATTTTGTTGGTAAGTTGATGTTTGTTTATAGCTAATTCAGTTGTGGTTGAATGAAATTCTGAATCT
TGTAGGCTTTGATGAGTGTTTGAGCTTGAATTTTGTTTATGAATTGTTTTTCTTTTTTTACTTGTTTTGGTTTTGGGGTTAATTGGTTTCTCAGAATCTT
GATTAGCTGATTGTTTAATTGCTGCTGAAGTTCATTTTCCTGTTTGTATGATTGATCTTCAAGATTTCATTTTTAAGGTGCCCATTTCTGGATTTGCTTA
TTTTTTGGTTATAAAGATTGGTTCTTTCTATGTAGAAAGACTTGGTTTTTTTGTTAGAACTTTCTTTTTTTATGCTTTCGTTTAGATTAAGTCAAGGCAT
TGTTTAATGGAACACTCATTAGCCTTAAAACCTTTCCATTTTTAACAACAGAATGTATGTGGTTGAGCCGATACAGTGAACACTTTATAGCTGGAAGAAA
GTGTTAGTAGAGTGTATGTTGTTAACAGATAATCATAAAGCTCTGATTTTTATTCCTTTTGGCTGTTGGGGGTCTTGGGGGGGGGGGGGCGGTGCTTATG
AGTTACTCTTTAGGTTAAATTGCATCTTGTAATGAAATTTTTGAGGGTTGTTCAAGTTTATCCTGAAGCAGCCTTTCTCAATGTGGCATATCCATTAGTA
GTTGAAACCACAGCAGTTTATTTTTTTGTTGGATAAAAATAATTGACTCGTAGGTAATCCGAGAGCTTCGTAGGTGGGATTTTTTTGGCAAAGGAAAGTC
GAGAGAAAGGGTGATAGCTATTCTAGCAAGTCTTCTGCGGAGGAGTAGCACTAGGCTAGTGAGTTATTAGACTAGTCTCGATTCCTCAAGGTTGTAGTAG
CTGTAATAGTAGTTGAAAAACCTCACGTCCCGAGTGGGCTAAGTCCACAGTAAGCTGTAGTCGTGGAAGATAACTAATGACTACTAATTTTGTTCATTTT
ATTGCAAGTTTTTTAGCATGAGAAGATACTTATATTGTAAATAGACCTGCTACTTAGTTCCAGTCAGTAGGAACATGTTGTAGAAACTGCAATATGTCCT
AATTGATCATTCATGTTTTCGATGAAGAGACCACACTCATTTAAGAAAGTGCTATTTGTAAGATTATCTCAACTCTTTATGAGTTTGACATTTGCAAGAT
TATCATACCAAATTGGCAACATGGAGCTTCCATTTTTTCGTACTGGCCCTTGATAGTTTGATATGGAATTAAGCTGTATTTATGGAATCATTTTGTCTCA
ATCAATCAAGCATTATGAGTTATGGTGCAATGTTGTTTCAGAAGTGAATATTGCATAAATTCTTTTTTCAATATGTATTTTAACTTGGATTTTATCTTGA
AATCAGTTACCATCTGACTGATGTAACTGACTAGATGAAAGAGCTAAGCTTCTTCCCTTTTTCTTTAAATACATATTCTTTCCATGCAACTTATCTTAGC
ACCAACAATAGTTTTGAACTTGTACATAATTGGGGTGATATTTTCTTAGCACAATAGAACAAGTTAATCATGCTGGTTTTACGTGCCAAAATCTTCCCAA
GATCTCTATGGAATTTGTAAAATCCGTGCACCCACTGCTGGAATAGTTTTTAACATACTTAGGCCTAACATACTCTCATCTGGGATTAGCTTATTCATAT
TTTCTCTACCTTTCAGCAACTCCTATGAATTTAACTTTATACGTTTTATGTCTTGCCAATCTGTTGAAATCTGCTCCTGTGATTGCCTTAGCTTTCCATA
ATTCATAACTAATGTATGCTTCTATTTTCCTCTTTTGGGATGGGTTTTTTTTATATGAAGTCGGGATAATTCTAATGTCCGGTGTCTAATGGAACAACAT
ATGTGTATTCTACCATGACCAAAGCATTACAAATCTTGTGTTCTTTTCTCATTTCTGCTTCCTTATGTTTCTTTAGGGTCGACGGAGCTAATGATGAGTG
CTCGTCTTTCAGGTTCTTTATGATTCAGCCTTGACTAAGAGAATGCAGATCTGAACTGTTGGTAGTCGGTAAGTTTGTCATATTGATTCATTTATTCATT
CAAAGCTCATATATGTGCATGCTTCCTAAAATGTAATGGATTTATTATGTTGGATTTTTTCCCTTTTCGGCAACTCTTATGTTTCCCTTATTTCTTTTGT
TAAGATCATTTAAGGGTGAGGGGTTTGACTCTTGATTCTTCCTGCTCATGTGTTCTTTAATTATTTGAGAGTGGTTGGTCTGCTTTGATATGCTTTTCCT
TGAGCCGAGGTTCTGTCTAAAACAACCTCTCTATGTGTAAAGGTATGGATAAAGCCTACGGACACAACGCCTATTTACGCTCTACCCTCCCCAAAACCCA
CTTGTGGGATTGTATAGTTTATAATGTTGTATAATATGGAGAAGAAGGGGAACCTAGGAGCAATGGTAGTTGTCTTTGTTTGACCTATAGGTCACGTGTT
CAAGCCGTGGAAGCAACTACTAATATTTCTATTAGGTTAGACCGTCTACATCACACCCCTTGTGGTGCGGTCCTTCTCTCGGACAGTACATGAATGCGAG
ATGCTTTGTGGACCGAGCTTTGCTATATAAGATAGATATAAAAGGAGAAATTGAGAGGTTGTGTTGATCATCATTGTTGGTTAGCTAGAAAAAACGAAAG
TTATAAACATGCGTGGTGAGCGCATAAAAACCGTCGTGGTTGTAATCAACTTGAATCTGAAAGATCTAATAGAACCCTGGCAACCTAAGGAAATCTAGAT
GTAGGTACAACACAAGAACATAACTACTATAAATTATAAGAATTAACTAAATAGCCATTCACCCAACTGACTAAACTAAAAATAGGCCGTAGATGTATAA
TATAGTGTACAATATAATTCATGTATAATATGTGTATGATCGTTAATAATCAATGTATATCGGCTAGATAAAGTAAACTGTAAATCTGCCTGGCTATTTG
TGTGAAGATCCCTTAAAGATAGTTGTGTCATTTACTTTCTGCACTATAATTTCTGTGTTGGGTATTCAGGGACACTATCCTTCCAAGAAGAAGCTGTGAC
CTATTTGATTATCTAACATTTGGCTACAGGTGTTGGTTTTTCCTTGATGAGTATATGTCGGTTCAGTTGGATTGAGGGCTGACGCTTATTTTGACATTAA
CTACCTGCATATATCATATGGATGACAGCGGGAATCGCGATAATGGAAGGCATAAACCACCTCAGGGTCAGGTATGTAGCAGGAGTTGAGGTTGATTGCT
TAAGTCTACTTTCTTAATTTGGATCTTAAGTATGATTCTCATGTGTTGTAACCAGAGGTGGGTCCTCAATTTAAACTTGATGGTTTGAACCTTTATGTTC
GATACGGGTTCAAAATGTACTGTTTTATTGAAACTTCCGGGATTTTCCATATATATATATATGTCTATGCTTTGTGTCGAAATGCTAAATTTTCCATGTT
TCAGTGGTTGATGCAGCATCAGCCATCAATGAAGCAGATAATGGCCATCATGGCAGAAAGAGATGCTGCCATACAAGAGAGGAATCTGGCCCTTTCTGAA
AAAAAGGCTGCCTTGGCAGAGCGTGACATGGCTATCCTGCAGCGGGATTCAGCAATAGCAGAACGAAATAATGCCATCATGGAGCGGGATAATGCCTTTG
CTACACTTCAGTATCGTGAAACCTCTATGACTGCTGGTCAGATTGTCCGTGGAGTGAAACATATGCACCATCCTCAGCAACATGTACATCACCAGCCACA
TATGGGAGAACCAACATATAACCCCAGAGAAATGCACATGGTTGAAGCCATACCAGTTTCCCAACCTGCTCCGGAGCCAGCAAAGCCCCGTCGAAACAAA
AGAGCCAAGGAGCCAAAGGCAGCAACAGGTTCCAAGAAGACTCCAAAAGCATCAAAGAAAGTAAAAAGGGAAACTGAAGATCTTAACCAAACCACATATG
GCAAGTCTCCAGAGTGGAAGGGTGCGCAAGAGATGGTTGGGGCAAGCGATGACCTTAACAGACAGTTATCTGTGGCAAAACCCGACTGGAAGGATCAGGA
CCTCGGGCTCAATCAAGTTGCTTTTGATGAAACAACCATGCCAGTCCCAGTCTGTTCCTGCACCGGAGTCTTGAGACCTTGCTACAAATGGGGAAATGGA
GGTTGGCAATCTTCATGTTGCACAACCAATTTGTCGATGTATCCTCTACCAGCTGTTCCCAACAAACGACATGCTCGAATTGGTGGTAGAAAAATGAGTG
GAAGTGCATTCACCAAGCTGCTTAGTCGTCTGGCAGCCGAAGGCCATGATCTATCAAATCCAGTTGATCTTAAGAACAACTGGGCAAAGCATGGGACGAA
TCGCTACATCACCATCAAGTAATGCTTCCAAAGTCTTCAATCTAGGACGGTATACCTCAACATCGTTTACATATTATGTTTTCTGTTCATCAACTTCCTT
TAGCCCCTATGTAAGTTTGTCATCGTTCTAAAATGTTAGCTGGATTCGGAGTTGGATCAACGAGAGATAACTGTAAAGAAGCCTGTATTCAGGATACTTT
GCAACAACGTTGATGTTAAATGTATTGAATATCTAGTATGATGGCTCTGTTCATAGTTATTAGCTTCTTTTATTAGTTTCAAGATTATCAATGGTTGAAA
ATCATAATCTGGAGATGTCTTTTTGAAATATTTTATATCGATTCATATATACGTCCATTGCGTTACAAGTGTGATTTGTTATAGCATATAAATATGAATT
TTTTATTTGCTATATGTGAAAGTTGACAAGCTCAATTTTGAGAAGACACTGACCAGGAAAATTGTTCAATAATTCTTTTTATAAAATATCACATGTTACA
TCAATTCAGCAATCAAGCTCATTATGTTGTCTTTCTTGTCATCTCACAAATGATAAATAAGCTAGAGATACAGAGATAGTATAGTTAATTCTCTAATGAT
AAGATCAAAAGAGAAACTAATAAAATTATCGTTCTTTATTATAATATTTTATTAATATTGACAGATTATTCATATATTATATTATAAATAATTTATAGAA
TAAAAGTTTATAAAATACATAAATCTCTCAAATGGATACATTAATGATAAAAAAAAATTAAAGTGTTGATACACTAAAAAGAGGACGGATACATTAATGA
AAGGTCCGAATATATTAATAGCTAAAAAGTCAAAGTGATGATACATTAAAAAGAGGGTTGAATATATTAATGATATTTTTGACTTGAGAAAAAAATAAAT
TTTTTTGAAGATTCGAGAAACTTATAGGGAATAATGATAATAAGTAAACTGAAAGATTAGATTTCTATAATTATTTCAAATTTATAATAATATTTTGCCA
AAAAAAAACCTGTTGGTATTACTCCTTTTTCCACTGTATTAACTCAATAATTTCCTTCCTATATTGCTCCTACATAAAATTAACACAAATTAATTAAATC
GTTTAAAAGTTAATCATCCAATAAATAAATAACTAGTCAAGAGAATCTACCAACTATTAAAACTGTTCTAATTGTTGTACATTCTACAAACTAATTAATT
TAGAGGAAATTATAAATAAAAATCAATCGCATGAAATATCTTAATTTTACCTTTATTTTTCCTTTCCAAATAATAACACGGCAGTGAAACTAATAGCTTT
AGCTCAAACTCAATAAAAATTAGGGTTTTTTTTTTACTTGTCTCATTCATGTTAAAGCTTCATTACAGACAAAGGATAAATATAAAACGATTTTGTAAGA
ATGTACGTAAACGTACAATCCCTAAGTACTACAAGAAAAACGTAAATTAAATTTAAACTGTTTAAATATTTTTATAAGTTATACAAATAATAATTCAACA
AGAACACTAAGCATGAACAATATGATCGATCGCGTTAACCTTAGTATTATATGTAACGCTAAATTTAAAAATCTTCAATTATCTCGCGGTGGAGGAGATG
GAGAAGATTGAGGAGACGGTAATGGAGTTCGAGGATAATTAACGGCTGACCTCCGTCTCTTCCAGCCCCAAGCAATTAGCTGATCTACGCCATAAACGCG
TAAATCAGCTATGAGCTCCGGCAAACTTAACAGAATATCCATAACTTCTCTTTCTAATTCCGTCATAGCAGCACATTGTGCTGCTATTTCAGATAATTCT
TGATGATTAGCCATTAGAGAGACAAGGGACGGCTCAATTGTGTTATAATTAGTATAAACATAAATATAGTTATAACTTATATATATATATACGCTTCATC
TATTTGTTTCAATTTATATGGTAATTTGACCAAGAGACTATAAATGCACACTTCATCTGTTTTAATTTATATGATAATTTGACCAAGAGATTATAACATT
TATATGATACCGTTTGACTGAGTGATTAAAAAAATATCTTAAAGTAATATAGATATTTTAAAATTAAAATTTTATTTATTATAAAAATGTTTTTTTTTTG
GAATGGGCTATAAAAAGTGGGTTGTATGAGGTAGACAAAGGGGGGAGTATTGATTATTACTTATTAGTGTTAATTAAAATCTTTTTAATAATTTTTTTCA
ATTATTATGTGCATATTTTTATTAAATTTCTATTTTATAAAAAATACGATTGATTTAATTATGATTGCATTTGTTGGTAACTAAATCTGTATTGTTTTCT
ACTTCTTAGTTTTGTATAATTCACTTTAATTTAAATTTTGTCTTTGTAAAATTTTTCTCCAAATCTTTTGAGTTTTGACTTAGATATTAAACAATTAGAT
TTAAAAAGCATCGTTTTAATATCAATTACTATGATATTGATTAATTTGGGTTATATTATACGAGTGAAAAATGATAGTACAATTAGAATACTCACTTAAA
TCTATTTTCAAATAGTAATACTTTTTAATAGAAAATTTTAACAGTAGTTTATATAATAATATACCATTAGTGCACTTTTTAATTTGATTTTATAAAAACA
ATCAAGCAATTCAATTGTAACAATATATAGATGTGAGAAAAGTAGAGTTTTTAAGTCATTTTAAATTTGTTTTAACTTATTTTTTAATCTTGCAAAATAC
TTTATAATTTATTTTAAGTCATTTTTTAAACTTTATATTTATCAAACACAAAAAATTAAAAACTGAATTAAAATAGAGTTTGACCAACTTTGAAGTTAAT
CCAAACATACTCTTAAAGTCAACATTGAAAATAAACGATGAATAACTGTTGACCTTTCAAAGAAAGAAAGCAAGGTGAAAAACTAAATAAAAACAGAAGA
ATTAAAACCTATTATGGCTAAAAAAAACAAGTCATTTAAAGACATGACCGAAAAAAATACTTTATCGTCGAAAAAGTGATTAATAAACGTTATTTCATGT
CCAGAAAACCAGCTGTTCAATTAACACACTATCCACTGTCTACCAACTCAAATTTTTTATGAAAGAATTTGACCTAATAAAAGATTGAACTTCTTCTATA
TTGATTGTATCATATCAATTGTTTACTTAGAATTTTTCAACTATTCTAGTGCTTGCGCTAAGATTCACCGGTCATGTATTGCCATCAGAGTCATAAATAC
TCGAAGTAATTAAGCTCCTGTCTGGCCCCTATTTCTTAAGGGCAATGAATGAAGTTTGAGATACATTTTTTTTAATTGTATTCAAAGTTTAGAGCCTGGA
AAAACACAATGGAGAAAATGAGAGAACAAAGGTCAATTTTTACATAATGGAGAAATTGAAATGCATGTAACAGAGTATTTAATTTCTCATCTAAGCCATT
AGAAACATCAACAGGCTTTCTTTCTCTTTGTGCTTTTAAGAGTTGCAATGAAATCATCATCTGAGTCTTTCTTCAGTCTAAACTTACATCTTAAGCTTCA
AACACACAAATTGAGAGTCCATTTAGATTGAGTGAAGTGCAAGAAAAACACAATTAAACTATTTCGTTTTCTTGAGTTTCATACGCAAACCAATAAAAAT
GTGAATTTTATATCTAAATTATAATTTATTAGTTCGAAAAACACATTTTCTCCCTTTTTTTCTCTTACAAAATATGATGATAATGTCAATGATTGATGGA
CTTTACAATTGTCCAATTGGCAAAAGTGAAATTCCACAAAATTAGTCAAAATAGATCCCACATAGTAAACTTTGACTTGGGGGGCCGGCTATAAATGCAT
AATTTCATACACCATTTGAGCGGAGTAAAATTATAATTAGTTGCCAATGAAATGAGTTATCAAAATGAAAGCTAAAACACTTTTCACGAGTTTTATATCA
TCAATGTCTAATCTGATGTTACGTATTATTCGCTATTTTATATATTTATTTCTTAAAATTACACTATGATTGAGTTTGTGTATAATTTAAATTTATGCTA
TATCTTAATTTTTTAGAAAGTATTTTATTTTAACGTGTGATTCATCTTAAGTGTAATTTACGTTACTTTTTTCAAAAGATAACTAATCTAAAAGTTTATC
AGTACTTTTTTCTATTGGTGGACGTCGCATACATGTCACTGTAGACATTGAAATTTTGTAGGACTCTATAAGATGCGTTCAATTCGAGTTGAGACTCTAC
AAATTGTGTTCAACTCAGATAAGGATTCTTGGAGGCTACTCAACCCTAAACCCTAGATATTGCCTATATAAACGGTACTAAATTCCCTTAAAAGGCATCT
CGAAAAATCCACAAAGAGATTAAGATCTCGAATACTCCATAAATTGATGGATTATTCATATAGAGAGGTCAAATCAAAATCATCCTAGTTCGAGAAATAC
GCCACTAACGACCCTCGAATTATGGATAAATCATCTTAGAGAGTAGAATCAAGGAAGGAACAGATTTGTACTCACAATCTTGAAGAATAAAATCACGTTT
CTTCATATTTTATTTGTATGATTTGTTTATTTTCCATATGTTTAAAATTTGTTGCAAACAGTCGCAAATCTAAATTTAACAAGTTATGACGTGAACGATG
AACAAAAATCATTTGTATTTAAAAATCAAGCCTTAGTAATCAGTAAATTAAGTTGAAAGTCACGAAATCTGAAGTTTGATAATCTAAGCAGATAAAAAAT
CATGAGACTAATATGTAATATAAATAATCTGATAAATTAATCAAAGATATGTACAAACGACTTTAAACAACATAATTAGAATTATTTTATTGGAAACTTT
ATTACTTTAACAATTTTTACCTGACACGAATTGATATTAGTGGACCAAAATCTGAAAATATGAATTAATTAAACAAAAAATATATAAAAAAATGTCAAAT
CTTAAGTCAACATCGGAGAAAATCCTGTTTTTGTCGTAGAGCGTAGCATTGTTGCACTTAGATATAAAACGGCCCGTCATTTTTTTAATTTATTTATGTA
AAATACAAAGTTTTTGTCCTTTTAATTATCATACATTTATTCTCATAAAATTTTATTTATTTTTAATTATTGATTATTACATTATTTTTTCTTTATTCTT
TGTTATTATCTATATATATTTTTCGTGTATCGTTTTCGTCTTAGTTTATTTTTAAAAAATGATTCTTTTCTTTTTTATAATGTTCTAATTTAAGCCTTTT
GTAGTATTTTAAGGATTGCAAGATTAAATAGTATTTCAACATATCGACATAAATATAATTAAGGACTATAAAAGAGTATTTCTTACGTTTCCATTTATAT
GTCACCTTAATATTTGTCATTTTACAAAATCATATATAAAATATACTATACTTTGTATTTTATCCTCGAAAGTTATTAGCTTTGAGAATATATAACGACC
AATATAGAAAAAATTAGTAAATATTTCATATCCATTAATCAAATTGATTAATTAAAATGAATTAATTCATTTTCAATTGACGATTTGACTTTAAGAGAAA
CTAAATAAAAATATAATAATAAATTTATCTAATTTCTTAAGCAACTAGTAAAATCTAAACATATAAATAAAAATGAGAACTAAGATTTCATATTAAGTTA
TGCTATTTCATTATTTTTAAAATGAAAGAGAAAGTAAATATTATTTTCTCTAATCCATAAAAAAGTTAATGTGAAATGACATAAATCTTTAAAAAGATTG
TTAAGGACACAATTGAATAATATTTTTCATAATTACCTTTTTAAGCATTCTAAATTCTTCTTCTAAATATTACTATAAAGTAATTAAAAATATCACTAAA
AAGGATAAAAATAGAAAAAAATTTAATAATCTTTTTAAATTTTGAAAAAATTACTTATTTTGAACCATCTCAATAATTTAATTTATATATTTTATTTTTT
TTTCCAAATCACACTTATAAAATATAGTTTGTTGTGTGCAAAGACAAAGTTTTTGTCTCTTTCACTTCTTCTCTACTCTTCTCTTTCATATCAGTACAAG
TTATTTTCATTTTCTCTTACAAATTCAACCGTAATCACCGCCATTTTCAGCGGGAAATTCACCTTCTCTCCAAAATCCCATTTTTTCCCCTATAACCCCA
CCCCCCACAACTTCACTTTCATCAATGTTTGCACGTTTGTCTCTCATCATATTCAACTGTAGCTCCTTTAAATTTTGACTATAAACTTTCAGGTACTCCG
TTTTCTTCCTTGCTCTGCTTTTCTCAATCTTGTTTTTCATTCATCTGTTGTTTGGGGTTTTGTGTTTGTTTGAATTGGATTGGGTTGAAACAGTTTTTTT
TTTGGGTGGGTTTAAGGAGTTTTCTATTTAGGGTTTTGCTGGGAGCTGAAATTTTGATTTATTTAATGAGAATTGCTGAAGTTCTTTGATTATTACGAAG
AAATAGCATTTGGGGTGTCGGAAAAATTGAATCTTTTGCGGGTTTTATTTGTTGATTTTTGATGGCTCAGTCTAATTCTAAGCCACCTATGAGTAGTCAG
AATTTTGGTGTTGGAGCTGTATCTCATGTGAGGTCGTTATCTCAATCGAGTATTTTCTCGAATAGTTGTTTGCCCCCATTGAGTCCTTTTCCTCCTAGTG
AGCCGGGGATGGTGTCGGGTCATTCTAGCTTGAAAGATATATCCATGGAGGAAGCAGATGTGAATTCTCAAGGTGTAGGAGTTGTGTCTTCGTTTACGAG
GGATGGTCTTCCTCCTCGGAAGGGGCATCGTCGATCTAATAGTGATGTTCCATTGGGATTCTCGGCTATGATTCAGTCTTCACCTCAGTTGATGCCTATA
AGTGGTCAGAAGGTTTTAGGGAGAGCAGTGAGTCTTGGGGATAGCAATGGAAAGATTGATGAGAGGAAACCAAAGGGAGAGGTTACAGATGAGTTGTTGT
TTTCCTACATGAATTTGGAAAATATAGAGACATTGAACGGTTCTGGCACGAAGGACAGAGATAAGGACAGCATTGTCAGTGGGACAAAGGTAACCGGTTC
TGAGAGCAGCAATAATGAAGCAGAAAGTGTTATGAAAGGGAATAATGTTAGTATCCAACCAACAAATTTAAGGGAAGGAACCAAGAGGAGCGCTGATGCG
AATATTGCTCCAGCTGCACGTCACTTTAGGAGTCTTTCCATGGATAGTGCTATTGGAAATTTTCACTATGGCGATGAGTCACCAAATTTACCAACTTCTC
TGATGATGCGTTCCGGTCAGCTTTCACCAAGTAATTCAGGAAATGAAAGTTCGAGCAAGCACAATCTTGACTTCGGAAATTCTGAATTTAGTGAAGCTGA
GATGAAGAAGATTATGGCAGATGAAAGACTTGCTGAGATTGCAGTTTTAGATCCCAAGCGTGCTAAAAGGTATGGAAATAGATGCTAATGTATTCTAGTT
TATATTTGTATCCCATTAAGAAGCATAAACTTGAGTTATCCATGAAAAATTGAAAAAATATATATAAGGAGGGTGCTACATATACAATTGTACCTGATAG
TTTCTTTCCTCAGGATTTTGGCTAATCGTCTGTCTGCTGCTCGATCCAAGGAGCGAAAAACACGTTACATCTCAGAATTGGAACACAAGGTTCAAAAGCT
ACAGACAGAAACAACTACCTTATCCACACAAGTTACAATCCTGCAGGTGCCTGTAGAAAATATTGTGGTGTACCTTCAATAGTTCTTTTATGAACTTCAG
TCTGTTTACTGGATTTTCATTCTTGTTACAGAAAAATTTTGTTGAGATTTCAAGCCTGAACAGTGAGCTGAAATTCCGCATCCAAGCCATGGAGCAACAG
GCACAGCTTAGAGATGGTATTACCGTTCCAATTTCTTTTTTCTTTTGTTTTCCAAGTCCCTAGTGTGTTGCAAAAAGGTATCTAGAATAAAATAAGATAT
GTTCCATAGTATAATCGTTTTAAATTAGAATATACTCTAATGTTTTTTTTTACCTCTTAAAATTAAATTCATCAAACTTGGAGAAGTTTGGAAATAATTG
GGTGTTTACTGAATACAGCTGGATAATTAGTTTATAGAAAGAGAAGTTTGCAAATTTAAGTTTTATAAAAAGAAAAGCTTGGAACTTGGCCTGATTTGAG
CTTCATGGTTCTAGCCTTCTACATATTGAATTTGTTGCTATTGTTTGAAGAATTTGGGAGGAAGGGAATTTTAATGGTTCCCGTGAACTCATAATTAAGT
AGATCAGTTTCGTGAAGTACTTTTATGTGAGGTGCAAAAAGAGAAGAATAAATTAGTTTACAATGGCATATAGAGCCTTTGAAAGGGGAAAATAGGGGGA
GAAGGACTATGGCCTGCTGGAAGGAAGACGGGGAGAGAGATGGTAGAAATCCATTTTAGATCTGTGAAGATAGGCGAAGAATACTCTGAAGGAAGCCAAA
TAGGAAACATACTATTCGTGTCAGGGAAGCCTATGAGATAAACGGAAAATAATTAGGGACCCAAGTTCACAATAATAACTCAATGATATGTGAAAATGAT
GCACAATCAATATCTCTTTGATTACTTTTGTTTGGTTGGTTGGAAATTTCAAAATGTAAGCAATGTGAAAATTTCAATATCCCTCACTGAGCACTGAAAA
ACCCGAGCCAGATAACCAAAATATTTGATGTACCTGTTTCAGTAATAATATTTGATTCTAACCAGTAACTAGCTGGCCTACTCAGGAGGCATGATTTTCT
TAAACAGTTCCACAACATCAGTATCTCCTATTGAAAAACATTATATTTTCCAAAAAGCAGGTTTGCCTGTGTTTGTTTGATTATCTCAGGATACATTTAT
ATTAATCTGAAGGAAGGACAAGTTATACTGTTCTAGTCATTTGGATTGACCAGGGACAATGTCCAAATCACATTTTATACTCGACATTCAAGACATATAG
ATATGCTGATACTATGTGAACATCTGATGCACCTACCCATAAAGATGGATATTCATAACTTTAGCTTTCCGCTGCAGCTCTGCATGAGGCATTAACTGCA
GAAGTCCAACGTCTAAAGCTTGCTGCTGGGGAACATAGGGAGGAAGGACGGTTGCCTAATAACATGACACAACAGACACCAGTGAAGCATAATATATTCC
AGATGCAGCGTCAGCAGCCTAGTCAAATGCAACAATTATCTGTTGGTAAAGCATCTGCGGCTTCAGCAACACCTGCATCCGCCTAGTGGGCGAAGATTAA
AGCCTTTGAGGAGGTGAAGATTATCTCTACATGAAGCCTAAAAGTTTATTACTTCAATTATCGGTCTTACATGCTACGCACAAACAGTGAGAAACTAAGC
TTTCAGATAGTATTATATTCATATAAGTTTCTTATGTGTGTCTGGCTACAATTTATACTATATGTAGTGAATCATTATTTTGTTCTTTGGAAATGACTGT
ATCAATAAATTGGAGTCAAACTTTGTGGTGCCAATGTTTTCTCCTATACTGTTCTCTACTTCTAAGGGAACTTGAAGCCCTTTTGTCTGGCTGTTAATTT
GCACTTGCATAGTATAAAATCCATCTGCATACAATAGACCCTTCTGATCCGAAACTCCGATCAGGGAGCTTAGTGTGGACTATAACTCATATAAAATCCA
TCTGCATACAATAAACCCTTCTGATCCGAAACTCCGATCAGGGAGCTTAGTGTGGACTATAACTCATAAAAAGTAGTAGTTCTATGAATTTGGGCCACTT
CACCATATTATTGGTTCAATGGGACTAGCACAACCAGACAAAAAGATCATACCCTGTCTTGTTTCCCTCATCTTCAATAAAAAAAGAAAAAATTAAAGTA
GTCAAAGTTGCAGAAAAGCAGATAGTTGCCCAAAGCATCTTGCAACAAGAGTTGCATCACCACGAGTCGAATCTATGACTTATATAATATGAACTCGAAA
TTATTTTAGATAAGAGATACTTAGATATTATGTTTATTTTTTCAACAACCTATTGAAAAACCTCTACTTAGTTGTTAATCACATGAAAAAAGTCTCATAA
TAATTTTTAAGTTCTAATAAACAAATAAAGAAAATGTCCAAGAGATAATTCCAAAAAAAAAGAAAAAAGAAAAAAAGAATATGGATAATGACCAAAGAGT
ACAAAATAAAAGCATATACCTTCTTTTCAAATAAAGAATACCTCGAAATTCTTTAACAGACCAAACCCGCGGGAACCTTAAACCCTACTACACACAATTC
TATAAATCTCTAACATTATAAAATTTCAGTAAATTTTTAAAATATAATTGTTTAAATTTTGTTTCAAAATCTATAACCAAACGAATAATACAAGTAAAAA
GAAAAAAAAAGAAGAAAAAAGCCAGTAGTAGTAGTAATTATCCATTCCACCAGTTGGTATTTATATTTTGCACTCACGTAATTTTATATCTTTTAATTTA
TTAAACCAATAAAAAGCTCACATTCTCGGAATACACAAAACAAATCTTCTTTTTAATAACTCTCAATGCTTTTGTAGGGTTTCAGATGTTTTCCTACTAA
AACTTCTTTTGCCGCCGATTACTGACAAATCTCTGTTTTTTTCACTAATTTTTGTGGGTTTTGTGGTACTGACGTTGAGGTTTAGCAAGATCTGATTTTT
AAAAACTTTTTTTTTGAATTTTTTGACCGTTGAGTTCGCCGGAGATGTCGGAAGTGGTGGTGGTGAAAGGTGGGGAGTTGTTGTTTTGTGGAAGTACTTG
CTGGGATTCTGTTGGTCGCCGGAAAGGTTTGACGGAGGGGAATTTGGTGTCGCCGACGAGGCTTCGTCCGCTTGTTGGTGTCGACATTTGTTTTGTTGCT
GCTGGTTGCGGTATGCTCTGTTCTGCTTGTTTTTTTTCAGATTATTTTTTCTTAGTTGTATACTTTGTTGGTTTTGTTTAGAGCTCAAAAATGTTGTGAA
ATGTATGTTGTGGATTCGTATAGCGTAACCCAATTTAAAGTTATCATCTTTATTGTGAGATTATGGGGGATTTTGGCCATGAGTTAAAGTTTGGCCGTAA
AATTCCGGAATTTGAAGAACACGGAAAAGTTGTTTTCACTTCAAAATACTTAAATAAGTAAAAAAAACAACTCCATTTTGTGTTCATGGTGAAACACAAC
TCCAAAAACTACTCTTTTTTTTTCTTTCAAATACTGACAATTTTCAAGGCTAAACGCTTCCATAATGTGATTGAAGACTTCCCTTTTTGATTGCTTACTT
TCATTCTTGGTGGAAATGCAGCTTCTTGTCACTGTGTAGCGCTAGATACTGAAGGTCGTTGTTATACATGGGGAAGGAATGAGGCAAGTGTGTTGTCTGT
GTTCGTTTTTATTTTCTTTTGTCCCTTTTTGTGTTGTTTTCTCGATGTAGGGAATCTGAAGTGTGTTGTGACTTTGCAGAAAGGGCAGCTTGGTCATGGA
GATAACATAACACGTGATAGACCAACGGTTGTTTCAGAACTATCTAAGTAAGTTTTTTCTTGGTTTTGTTCCTCTATCAGTGACAGATATTGTAGTAAAA
GTTTCAAAATATATATTAGGTTCAAATCATTCATACCACAAAGGAGTAAAGGGTGCATAGTTATGCCGTATCCACTTCTTAAAATCCTAAATTCACCCTC
TTTTTTCTTCTTATAGTTGTTTGATTCTCTTTTTCTTGAAAACATTGAGACAAGATCCCATCTTTCTACTCTCTTTTTTTTAAGAAAAAGAATTTACCTT
TTTATTTTATTTTGTCATTGTGCTCTTATCACTTGACCAAAGCCTTGGGGCAATGCATACTTCTAGGGTACATTTAAAATGAGATGGAAAGAAAAGAATG
TTATAATGGTGAATATTCTGATGGACAGTAATGTTTGTTTTTTTAACTCAGAACTGAGATTTTGTGTCTAGAAGTAAGAAATTCTTTCAATATCCTTCTT
ATATTTCCTGAATGGTTAGCCCATGTCTCCTGAAGCAATTATGTCTATCAAGTACTTATCTCTGGCATCACTTAAAACTTTTTTGTTCCAGGTACAAAAT
TATTAGAGCTGCAGCTGGAAAGAACCACACAGTGGTAGTTACAGATGACGGACAGTCCTTTGCTTTTGGTTGGAATAAACATGGGCAGCTCGGTATAGGC
TCTGTAAAAAATGGTGAGCTCCTTTGTTATCCTCTGTTGCTCCTTACCTTCTCTGTTTCTGACTCACTTGCATCAAAAGAGAAGACCTTCTGTTAGTATT
CAAATTGTTGTTGTCTCAGTTGCATGCACATTATTTCATCTCCCTCTTTGATCATGCATTTTTCTTCAGATATGACCTAGGTCAAATGGGTCCTTCATTT
GTTTTATAACTCAAGTCAAAACGGGAGAAACAAGTGTGTGGATTCATCATATTTATACAAAGTTACGAAAAACCTAGATGCACATGTATTGGATACTTAA
ACCTATCTGGAATTAACACACACTTTTGCACCTTGACGCCTACACTAAAGTACCAATTAAGTGAGGCTAAGGGCACAACCTGGTTTTCACCAAGTTTCTA
GGTTTAAGCATGCTTTGAACAAACCTTTAACAAAGCTAATCTAGTGTAGGGAAGAACAATAAATTTATTATTATGTAAGCTAGTGTAGGATCCAAGTGAA
AAAAAAAATGAGCTAGTTTAGGATGGAACCAAGAATTTGCTTTAAGCAACGTTGTCTTTATTTCCTAGAAATATTAGTCCACTAATTTCTTCTGTCTTGG
CTTATTTTTTCTTTCATTTATAAAACAAACTAAGATCATCTCTTTTTTGTATTGTTGCAGAAACTGAATTATCTCCAGTCCGGTGTGCCGTCACTGAAGT
CAACTCTGTAGCTTGTGGGGCTGACTTTACTGTGTGGCTAACCTCAGTTGAAGGAGCTTCTATATTGTATGGTTTGTAAAGTTTTTACTTTCTATTACAT
TGATAATGCTGTGTAAAAATAAAAGATTTTGGCAGTGGCGTTTTCATCTCTAACTTTTCTTGCACTCTGATTTTCATGCTATTCGTGTCTTCTAGAACTG
CTGGTTTGCCTCAGTATGGTCAGCTTGGTCATGCTACTGACAACGAGGTACACTTCATGAAAAAGTTTTTAGTTTATCTTCTGTGACATGGACAAAGACT
TCCAATATTTTATTGTTATTTATCGGAAGTTCTAGACTTCTACATGCTGTATAACAAATTAAACAATCTCAAATTGCAATATTACCTATCGGTAACAATA
TGTCATGAGAAGATCATCTGTTCAATTTGATTGATAGTGATGCAGCTTCTGTGATACTTCTACATAAATTGAAATCACAATTAGCAGGCAATTGGATGAG
TATAGTTGTTATCGTCCCCCATCTATCTTGTGTTCTGTTCAATGCCTTTTTGTCCATTGCAACAGTATGCACTTGTTCTTTTTGCTAATAGAGTGTGGAA
ATTTTTATCAAATGAGATCCTACCTCTGAATACTGACTTCTATATTTCTCCCTCAGCTTTGATTTCTTCCTGCTTTAGGCACATGAAGTATTTATATTTT
ATGAAGCAAGGTGTTCCATTAAAAAGAGCTTGCGCTTTATGAACATAAAGTTCTGGAGATATTGGTGCACTAAACAGGCAAAATATTTAGGGATACAAAC
GCCTCTATCGTGTGTCTGTGCAGCATCATTGGAGGATATTTGCAGAACTTCATTTATTTTTTACTATTGATCTTTTGGAATGTATTGCATGACATGATCC
ATACATGCTGATGTCGGGTCCTAATTGCCGTATCAAACGACCTTAATATAGTCATGTTTCTGCCTTTTCCATTTCTTGTTTCCTTGCTTTTCCAATTTCT
ATTTACTTACGCTTCTTGCCAATCTGAAGCATGTAGGTGATAAGCGTTGTGGATAGCACATTTTCCACAAAATAATCAGTGTTTTCCTATTCCTAAAAGA
AACGTTGTTTTGTTCTCCTTCATAGTGGAGTGCTTTTATACTTCATATTACTCTTTTGTTTCCTGATGATATCTGGTCTAGTATTTCTCCAAAATTAAGT
GTGGAAACCTAAATGTAAATGCACCAAATTGGGAAGACGATAGTAAACTATTTTGCCCTTCCATGACAATACCCTTGACGTATAAATTTGGAACTTGTTG
TAATGAAGGCGTTCACACAGTGTTATCTTTAAATTTGAACTGGGAGTTGTTGCCTTGTTTGATTGATTTGAGGATGCCCTGTAACATGCAGTATAATACC
AAAGATAGCTCTGTAAGGCTAGCTTATGAAGCTCAACCCAGACCTAGACCTATAGCTGCCTTTTCTGGAGAGACTATTGTCAAAGTTGCTTGTGGAACAA
ACCACACAGGTTCATCTTAACTTCATTTTAATAAATTTGTATATTGTCATCTTTCAGATATGTCAAGTGCATTTACCTTCTTTTTTTCTGGATTTCAGTT
GCAGTGGATAAGAGTGGATATGTTTACACGTAAGTTCCACCTTAGCTCTTTTGTATGGACTTTACCCTGTGTACAGAAGCTAATTTGTTCTTTCTCTGTT
TTGACAATCATATCTTAGGTGGGGATTTGGCGGTTATGGGAGGTTCGTACATCCTATTTCATATTTGCATATTCAGATCTATGTTAATGGACGTCTGTTG
AACCGCCTTGGCTTTCCATGCTCTTTTTGGGCCCTTATTATAATAAACATGAAATGTTTGATTTTTTTGGATTACAGGCTTGGTCATCGAGAACAGAAGG
ACGAGTTTGCTCCTCGACGAGTTGATGTTTTTACACGGCAGAATGTCTTGCCTCCAGATGCAATAGTTTCAGCAGGTTCTGCCAGCTCATCATGTACTGC
CGGTATGATTCGTCTTGTTTTCTCTCCATTCTGTTTTGATATCATTATTGAAATCTTATCCAGCGCACTTATAAGTTACTGTGTATTCACATGAGATGAC
ATCATATTTGATATCTCTATTAGCTGCACTATTTTACACAACTTTTTGTTTCCAAAAAAATCTTTCCGCAAGTTGTCCAAACAGCTCAAAGTATAAGTTG
AATGAGTATTCATTCAAATGAGTGAATTGCCTTTATTAAATCTATGTTCTGACCAACTATGACTGTATATATAGTGTTTGCTCATTTAGTTATTGCTTTG
AGAAGTGTGAACATCTAGCAAGCTGACAATTATATGTAAAAAATATGTAAAATTAATGTGCGGTTATATATGGTTTAGTATGGATTACTTGTGAAAATAG
GTAAACGCTAATCTAATCCATGTTAATGCTTAACGAGTTCGATTAATTTCAAAATTTTGAAAACTCAAGTAGTTCGAGTATTTTCACATTAGTAACTCAT
GATAGTCTGTCTTTATTGCGGATTTGGTATTGGATATGTTTTGCAAAGCTTACATAGGTGGAGTTTAGAGTTTGAGTAATCATTGGTGAATGGTGATGAA
AAAAAAGAAAATGTCCAAATAAAAAAAACATGATGCTAAATAGAAACAGCCTTTCTACCTTTGAGGTAGAGGTAATGTTTGCGTACACTCTATCTTCCCC
GAATCCCCTTTTGGGACTACACTGGGTATTTTGTTGTATAATTGTAGTAATAGTATTTAAATATTATTATTATTAACTATTATTTTGTATGTAATTAATT
TATTTTTCATTTTATTTTTATATGGTATGATGATGACATCAGTTTGAACTTAAATGGAGATAATTATTCATATAGCTGACCTCAACTTGGTTGGGGCTGA
GACATATAGTTGTTGTTGAAGTAAATTTATGTTTGAAATTTGCGCTGCAAGCCTGCAAGTAATATGAAGATATGATGAGGTCACGTTCTACTAATTGCAA
ATGACTTGGCACTTCTAATAAAATATTCTTGTGCAGGAGGAGGGCAGCTTTACATGTGGGGAAAAATTAAGAGCACAGGAGATGATTCGATGTATCCCAA
ACCTCTTCTGGATTTGAGGTTATGATGTTTACAGCATTTGCATCTCCAATTTTTTATTTTGGTCATATAGTATTAGTGTAGATACATCATGAGTTGCATG
TGTGATATATTCCACTTTTTTGGTTGAATTATTATTTATCCAAGATTTCTGGTTAGAACCATCTGCAATAACATATATGAAGATGGAGTTCAAATTTTCT
TTTCCTTGTGTCTCGTGACTAGGGGTGATGGAGTGATTTCATTGCAAAGTCCTAGCAGAGAGTCTCTACCCTTGTATTTAATTATGAGATTCAATATTTC
ATGTTGGAATGTTATTTAAAATCAATCACATGGTAATAATGTATTGTTGTTTCTGCCCCCATAATCATTGGCTTGGATTGTTTTAAACTGGATATTCTCT
TTTCAGAAGCACAATATTTTTTTCTTTGGTCGCTAAGTCTATATGACTGATAATCTGTATTTCTAGTGGGTGGAACCTCCGATGTATGGATTCTGGCTAT
ATGCACCACTTTGTTGGTGCTGATTCCTCTTGCATAAGTTGGGGCCTTGCACAGTGTGGGGAGCTGGGTTATGGACCACATGGACAGAAGTAGGTTTGAT
TCATATCTTGTGTTTTACTTTTCTTTTCGGTGACTTGTGTGCGTTTTGCTCATTTATTTTGTCTATTTTTCTAAAGATCTTCTGCAGTTCCTAAGAAGGT
GGACATTTTAGATGGCATGCATGTTATCAGGTTAGTGTATTTCTGTTTAAAAAAGAAATTTTGGAAGATGGAACTTTACATCAGAGTCTGAATCCTAGTG
CGTTCCTTTTTGTGTAGTGTTGCTTGTGGATTTGCCCACTCCATGGTTGTTATTGATAGGACAAATGTTGAGGATCGACTTGAGCAGGTAATGTTATGGT
TACAAGGTAGTGTTGCTTGTGAATTAGAATATGATTTTTTCAGTTTATATGTACAGGTTTTTGGTTGAGTGTAATATTTGTTTGTGGATGGGTGTTGGTG
TGTGTCTGGGGGTGCTGATACATACATCAGTTTCAATTTTTCTTTATTTGTATTTATTTGCTCGTGTAAGTTATCTAATTTCTCCCGTTTTACCTGACAG
CTTGATGTATATGATGGCAAGGCTTCTGAGGAAGGTATAGGTCTAAGCTTCATCTATCTTCATAAGTTTTAGCTAATTGTACTATTTCATTTGGAAAATA
TACTGGTTTTCCTCTGAATTTGCTTCAAGGGCAGTTGACTTAAGTAGCCATTGAATTGCTAATTCCTTGGGAGATGAAAGAACAAGGAGTCTGTTAATGA
TGTTCAATTCATCTACTTTGTCCTTGTGTCCTTATCTGTTTTCGATACAATGCAGGATAAGGTTTGATTATATATGCTATTTGCAAATAATAATATGTCA
AAGAGTCCATATGACATCTACATTCAGACAATTTATATATATATGTTCAATTTCAAGGACAATAGCTTGATATATGAAGATTTAATGTGCAGGACAAAAA
ATTGTTGCTAAGTATAGGAGAATATCATGATTAGGTGAAAGTGAAGTGAAACTAGATTAGTTTTTGTGGTGCCTAGTACAGACATCAAATATGTACATTT
AGGCTTCTAGGAATATATAGTGATAGATGCAATATAACAATTAGGATAAATTAAAGGACTGTGCTGTGATAGAAGTCATCTAACAAGCTACAGTCAAGTT
TTATAGAACGGTTGTGAGGCTAGTAATGTTGTATTGGGGTGAATATAGGTCTGCAAAGCCCACATGTCCTCGAGATGAATGCCATAGATGTTGATATCAT
TGGACATAGAGGATACACATAGAGAATTTTGCTTGAGACACTTTTGCCATGTCTTACAGACTTCGAGATGTATCATCTGCAGGCACAACTATATGATAGT
TTGAAGGTGCAACAATATGCTTGAATTTCATTTAAAATGATAATTGAAAATAATGAGCTAGACTTGAAATCACATGTGTTTGGTTTTTTTAAAAAAGATT
TTACAATTTAGCAAAATCAGTGTTAACTTGCCTAATAACTAATTGCATGAAAGAATAGGAATCTTAGTGTTAAACTGTTAATACCAACTAGTTTGGATTA
ATCACTTAGTTGTTGTTTCTTATGTTTGGTTGTTTATTAGGATTTTTCTTTTCTATTGTGGTCAGAGACATATTATTTTGGTGGAGGATAAGTATTGAGA
TTTGCAAATGCTCTAGTGTCAAAACAGTCTTAATTTCTCTTAAAAGACAAATCTTAAAATTGGAATAATATAACAAATTGTGTTGTCAAAAAAATAATAT
AACAATTTGTGTCAAATTTTTCCGATTTGTTTTATCGAAATCCTTGTACACGGACATGACAGGTGAAAGGTTATACTTCTCTTGTTGAACTGAGGAGATA
GTTGGCATGCAACCCTATTTATTTTACAATCATTTACCTTTCTTACTATAGTTGCAAATTGTTCTTTGCTGCAGTGGGGGCAGAACCTGTGAGTGAATCT
CCAGCTTCTAAAAAGACTACCAAAAAGGCATCTGCGAAGGCGCCTGCAAAGTCAAATAAACGGAAGAAGTCAAAAGATGCATCTGAATCTGAAGATGAGG
AAGAGGAAAATAGTGATGATGAAAGTGATGACTATGAGGAACAATCGAATGGGCGGGCCAAGTCTTCCGGCAGGGGTCGAGGAAAGGCTGCTGGCAAAGC
TACAGCTGCTAAAAAGGGCGCAGGTCGAGGAAGGGGTCGGTCTCCAGCAGCAAACAAAAGCTCCCCACCTGAAGTGAAAGTATCGACAGGTAAAAGGGGA
AGGCCGAGGAAATCGTAAGAGTACAGCTTTCCTGGTCAAAATGTAAGGCACTCTCTATATTATGGAATGTATTTTTATTCTCCATTGGCTAATTAGTTGC
ACTTTAACAAGTAATTAATTTTCGTCATTAACTCCATTCAACATTCTGAAATTTAGCAAGTGTAATCCATTTGCGTAACTTGTAACCCGTATTGACATAG
ATCATTGACTGAAAAGACAGGTGTTTATCCGAGCTTGTACCTAGTTAAGCTCGTTTTTTGGATAGGAGCGGAAACAGGGGAAAAGAAAGGAAAACCCTAT
TCTGCCCAGTGTACTCTGATTTCTATTTTTGTTACTAATTTGTGGTGCAACTGAAACACATTTGTTCTGAAAATCTATGCTGATTAGTAATATTGCTGTG
TAAATGAAGTATTTATCAGAATGTTTTGTTGTAGTTGATCATTTTAATGTTGCGTTCTAGCCTTGTTGATGATCAATGATGAGACTTACACAACGATCAT
GCTGAGTATTGATTTATCTTCCTATAATATCATAAGCATGTTTGGAGTCTACTTGGATGGACAAAAGATGGTTTGTCTATGAGCTAAAAGAACCAGAAAA
CAGAAAATGTTCTTTGTATCTTAAGAGTTCTGAGGAATTCTTGTAATACAAGTTGAAGTGATTCCAATGAGTACAGTTTAGTGCATAACTATGTTATTGT
GTGTGTTTTGATCCCTACAGTTTTAATTGTGGTTGCTTGTAAAGTCGAGCATGGAACAGATAGCAACTACAATACAAATGTCTTGTTGCTTTCATTTATG
GAAAGTTAGAGGTGACTTTTCCCTTTGTAGGGAACAAATGTGGGGGCCTGATATAGTAAAGAAAATGAAGGGAATTTAAGTTTTTATGTCTAAATCTTAG
ATCTAAGTACTTAGTAACCTTCCCCCTCTCCCTGGATCGTGGATTAGCACGACTCTTGTGCAAAGGTGATTTGCTTAGAATTTTGAGTTTCATGATAACC
TCTTGTTATTGTTACTATGTAAACCTCCTTGTTGATGAAATCAACTTGTAGGTGTACAATAGAACATTATGAAAAAGGTTTGTGGTGGGGTTATTGTTCT
CTTGGGAACATAGTGTTTTTCTTTTGATGATGATTTTACAGAGCAACAAGTGAGAAGGACTAAAGAAGAATGAGAAGGTTTAGGAGGTTACATTTGTGTT
AAGTATAATGATTGGAACTTTTCTCCATGTGCCTAAGGTCCCACCACCCATTTTTATACAAGTAAAAAGTTGCATATTTGTGTGTGGAAACTTTGTCTTC
TATTGTTGGTACCTAAATGTGACTTGCCCTCTTTTGTTTCTCAACTTTAAAGTAAGTTTGTGAAGTTTTAATAATGAAATTTATGCTTTCAAAGTAAGCT
TCATTTTTCCCTTAGAATCTTTTAGTCAATTTCCATTGTAGTTTGCTATATAAGGTGAATGGGACCTGAAAGTATCACTAAACCTAATTAAAATCTTGAA
GGAACAATCAAAGCTAAAACTAAATATTGAAAGTTTTTTATTATTTGAGTTGTGTTTGTGAATAATGGAGGAGAAGGTAGAATAAAGGAGGAATCTTTGG
TAGGGTTTGAACCCCACATATCCATTATTTTTTACTTGGTCCTTCCTTTTATTAAATCCAACGTTGTTTGTTCGGAAACTTTGGTTGTTAGAATAAAATA
TGATTCCAAAGAAATCTCGATTGTTATTAGTGAAATGTTCGTTTAGCAAATGATTGTTGTAGATAGGCTTAGTTATACTTTGATACCTTACAACAACGAC
GATAATTCTTATAAAGTCAGTGTAATTCTATAAGTAGGATCTCAATTATTCTTATTTTCTCAAACTTAATAGACAGTCGTCTTGTACTGTGACCTTGTGT
ATGTGTCTTGATTTGTTAGTTTCACATTAATTAAGGGAATGAACGATTGCTATTTTATGTGATTTACGATAATTTTTATCTTATAAACTAGCGGTTAGGT
TATTTTATGTCCAAGATTCTTTTTCTTAACATGGAAGCACAACTATACTCATCAATAATCTTGATTTACCTGGACTCTCACCTACTACGTTTATCGATCT
TTCAATTAACTGAAAAAATATAACGTTATCCTTTTATATGACTTATTGAAAATTCTCACCTCAAAAACTAACTAATCGTTTTAGTTGAAGCATGTTCGAA
GATCAATTCTCTTAACTACTTTTAATTGACTAATTGTTGCAATCAATTAGCCTCATCTATTTGGTGACAAAAAGACAAGTTACTTTATTGTGTTACCTAA
ATATAATTATTTCTGAAATAGATTATGCTTTTACACTAAACTTAGGTGTAGGGAAAAAGAGACAGCATAATCTATTTGATGATTTTTTTTCCCCCTATAT
TTTGTTGGATTATTCTAATTGGATCTTTAACGTAGTAGTCCCTGTCTAAACTTAATAATTGTTTTATTATTTTCTAAAATTAGTACTTACGTACTTAACA
GTTTTTAAAATAATTGAGAGGATAAACTAGTTGAGCACAAAATAATTATAGTCAATCACATTTTTCTCTTTCATTTTTATTTTAAAAACTTATAGACAAA
AAAGTCAAATGTATTACGTGTTTATAATGTACAACAGGACTTTAATTATTTTATTAATTGATGGCATTTTTTCTACTTTGAGAAAAAAATAAATTAGTAT
AATATTTCATTTACTATTTACTCGTTTCATATTATTTGACTTTTGTATTAAAATTAGATATTTTATTTTACTTATCTGAATTTAAAAATTAAAAAATTTA
TTATATTTTTTCTTTGTGTTCCTAATACTAAATAACTATACTAAAATGTAATTTTTACCGTTTCAAAATGTCATTACGATTATTTTAATTGTATAAAGAC
CTTTATTAAAAAAAAAATTAAGAACTGTATCAAGTCAACATGATTTAAGTAAGGCCGGGATCAACTTCTGATTTGGGTTCATTCAAACTTTCGACGGAAA
ATATGATTAAAATTAAATTTATATATACAGTAGATTTTAAAAGTTCATTCAAAGAATTTATGTGGTTAATTCTTTGGATTTATAATCTCTCTAATTGAAA
ATTTAAATTCAAACCACTAAGGTCGAATAGTATAAAATGAAGAAAATATATATTTATTTATTGTATAGTTTTACGTTTTAAATTGGGTAATCAATGAATT
ACAACTCACGAAACTTGTGTTTATTGGTTATCGATAAGACCAATATGTATTTTTTTTATATGTGAATTATCCGTTAATCATTTTGATTAAATAAATCTCA
TCAACATGTAAATTATTTGAATCTCACATGCAAAATATATTAAAAATATATATTTTTTAAAAAAATAAATTCACCGATTGGCATGCGCTGTCAGTTGTAA
GAAAACGGGTCGGAGGTTCTTCTCATGTGCTCCGCATGTGTCGGGTAACCTGTCCGAAAACCATACCCAATGAGGACACGACACCTGTCAACAACTCGGA
AAAATGAACTTCTAACCTAATTTAACCTCAAAAGTTAATCGACAAAGAAGATTCTACGAATGTAAGGAGATAACTCGTTCTTCCAATTTCTAACATTATT
TTCATTCATATTCAGAATTCGAACTCAAAAAAGTATCTTATTAAGGTTGAAATAATTTTACCACTATATCATAACTCATGTCGATACTTAATTAATGTTA
CATTAATGAAAGTTGTAAGATATCTTTTTAAATAGGATGCTTCTTATTTCGAAGATATCAAATATTTTAATATAGTATAAAGTTTAAAGTAATAACATAA
AAATTAACGTCATTTTGAAATATATTTGAAAAAGGCAATCATCGTTGCGTAAAGTACATTCAAACCTTTTTGTAATAACATTTTCTTATAGACTGAGATT
CTAACGGTGTCACCGCTACTATTAAATTTTATGTTCCTCTCTTATTATATCATATGATATGATATACTAAGTCCGTAATAAATGATTTATTGTGATTTTT
AAAGATAACGATATAAAAGATATCTAAAAGAGGAACACAACAAATTGGATATATATTTAGCGAAAAATGATTATATCCTAAGATATTAGGATAAAATAAT
AATAAAATTATGCTCAATAAATTTTTATGATTCGACTCTTTTTCAAACCCTCGAAAGTTTGAAAAATCAAAATATATTTTAGGATTTAACTTACACTTAC
CTTAAATATAAGGACCATTTTTGTCATTTTCATTAAAAATAAGGTTGTAATCTCCAAAATTATCCTTAGCTTTTTTAGCATCAAAGAGGCAAGGACCACT
AATGGTCCACTAATAGGGAGTTGGGACTCACCATATATTCTTTTACGATCCAATCGATATTCAGTATTCATATTATTCAAATACATGCTCGTAGAATCAA
CTTATGAAAATATCACTCTAAATAAGATTTTTTTTTTGTTCATAAAACTCAAACGCGAAGTATATAGATAGAGAGATCTCAACTATCCTACGGTGAATAA
TGTTTTGCATCTTCTAAGTCACAAATGTCATCAATTTCTTAAAGTATAAATAGATACCTTTCTTTAATGTTACGATTGTTTTGTTCTGATTTCAGTGTTG
GAAAAAACATCTTAACTTATGGATTAACTTTACACTAATCCATCATTAAGATTTTGGTTTAATTGATCCCATCTTTGGTCAATGTCAGTTAACGACTATT
TATAATGATAATCTACACAACACACCAACTATAATCATCATTATCTTCTTTAGATTATAGTTTTTGATTAAAAAGTTAATATCAAAATAAAAAAATGTTA
CTTAAAACTTGAATTTTTGTGTGAGCATGTATTTCACTTAAAACTGAAATTACTTAAATATATATATTTATCTTATTTAGTTATATGAAATTAATGTAAT
TTAATATGAATATTGAATGCAAGTAAATATTTATCTGTTTTGTAGAGTAAGATTTTAAAAGTAAAGATAAAGGTAAAAGATAAAACTACCTTAAAAAGTC
ATTAGATGAAAGAATATATATTATGCTAAAAGATTAAAAAATAGTCATTTTGTAGAAAAGAAATAATAAATAGATAGATTATAGTTAATGTCATTTCTTG
TGATTATTAGTTGAACAAGATATTGGTGAACTACTTTTGAATTTTCAAATACTTTTTGCGTAATTAAAGATTTTTTTTAATTGTTTTCATTTATTAATTT
CTCTTTTTGTCTTCCTTTTTAATTTACTCAACTGTATTTTACATTGATTTCTTTCCGAACTAGAAATTTATTTATTTAATATAGTATAGTACATAATAAT
AGTAATAAAAGAAAAAGTCATTTTCAAGTCAATAGTAGAGGTTACAGAGAGAATGGAATGAAAAAAGCCGCTTATCGACGGAACGAGGAATATAATAGAG
TGATAAATATTTTTTATTTTAATTAAATTTTTTTAGCTTAAACTTGCTTTAAATAGTTTTTTACTTTAAAATATAAATATCACGGTATAAATTTAAATTT
AGTTAAGCATGAATAAATATATATAAACTTATCCGGAACATAATTTTTAGATAGAAGACTGATAGAATATTAGTAGGTAATAATGTTTTATCTTATTGAT
TTGTTCATCTTATCAATAATCGTAATATTGTTTTTGTTTATCTTTCAATTTTTATAACTACTGTTATTTCTTATATTTTTATTACTTTTTCGAATTATTT
AAACTTTTTTTTTCAAAAACAATTCATTTATTTTTTAAATAAGAGTAATATTTATGCATAATTTTATTCGTAAGATATATATATTCTACTCTCATTCTAT
TCTACGAGATTATACTGACTATATTATTATTAATAATATCGAATGAATAATAGTAAAAGAGGAGAACAGATCTGAACTTTAATTTTTAAATAGGATAATT
TTTGTCTTCAAGTCATAACGGAAATATATTATTAATTATTGATATATCTTTTTCTTTAATTTTCTTTTTTTTTTTTTTATAATATAAAGAGACTACTGGG
ACCTGTAAAAAAAAGAAAAACTGAAGCCACGGAACTCAAAATACAAAATTTAGCTAGATTTTAGGAGAGTGTTTCAAGTCCGTCTTCTTTATTTTTTTTA
TTTTTTTTTTTACTTTTAATTTTTTTAATTTTTATTATCAGCTCATGAGGTACAATTTCCAACAAATATAGAATATCTACTACAACACTTAACAAGATTG
GTCAATCAGTGAGTGAAAGAAGAAGAAGAAAATGGGAAAATCTACAGCTTCTTCTTGCTTAAAGATCATTGCTTGTGGCAGTGATTCTGTTGACCGTGAT
GAACTTGAAGCTCATCCTGAGGTGAAAAATCTACACCCATTTTTATCAGATCAAATTTTCATGTAGTATTTTATTTTTCTTTTTGCATTTCAAAGATGGT
AATGTGTGATAAAAATTGAATCTTTTTTGTGAGATAATGGTTTTGAAGTGAATCTTGGATCAACCCATCAAAGTATGGAGTCTGATCTTTTGTGGGGGGG
TTTTGTTTCTACTAATTTGATAAGTTTTTGAGATGATGGAGTTGAGCTGATTTGGTTCTTGAATAAAGGAGTTCTTTTTTTTTTTTTTTTTTGTGGAAGG
TATGTAGGGAACTTTTGAACTTTGTGACTGGATCTCTATTAGGGGATGTAAGATTGTGGAATGGTTTGGTTGAGAACTTGTTAGATGTATTTTACGTCAA
TGTTAAATGAGAGTGTTTAAGATATTAAATAGTTCAATTTTTCATGTTTGTTAGTTAAGTAATTGCCAATTCCAAGGAAGGCTTGATTTTGGTCAGTTGA
TATAAAACCAGTTACATTTTACACCATGAAGATGTGAACTGTATGGATTCAATGTGTTTTAAAATGGAAATGAAATGGATCACTATTGTAAGTGGCTTTC
TTTTGGTTAGAGGGGAACGGGAAAATAGTGATGCAATTTACCAAGAAACGAAAATTGATTCGATTTGTGACCGTCAATTAGGGATGTGTTGTCATAAGGT
AAATGCTAGTGAAGCCTTTCAATTTCTGTACCATTCAATTAATCAACGTCGCCTCATCTTAAAATACCATACTTGGCTTTCAGTGTTTGACAAAAATGTA
GTTTCATTAATTGAGCTGTACTTGTTCTTAGCAATGTCTTCTCAATTTACAGTGTAAGTTTAGATAACATCTAGTTCTCTTTTCAAGTTGAGTTTGCAAT
ACTTCAACATCAAGTTAATTTTTTATGATGACATCGACATGATACTCTGATGCAAGCACTACTTGTTTCCAAATGGTGTATGCCAAATATATGTTGTCTT
CCTTCTTACATCATTATGGCCTTGCTTCTGGTGTAGTTTGCAATATAAGTTGAGCTGATAATTCCAGCTATGAGACTTCACATTACCTACTACCTGATTG
GTGGAATGCATAAGTATGGAAAAACAAATGAAGTACCAGTCCGTTGACATACATGTAATGAAACATGATTAAGAAGACAAGCTTGTGTATGATTTCATTT
CTTTATCTATGGTCTCTTCATGGGAGGTTAAGGGGTTGGCAGAAAAGAAATCATCATTTGTATCAAAAGTGAATAGATGTGATAAAGAAGATCTTGTTGT
CAATGGATTCAGTTCCTACTATATGCATCATGACTCGTCTATGTATGCTTGTTACATGATTCCAGAAATGTTCAATCTACAATCTGCACACCGTCCTCCC
TTGTCCGCCGTGGTCCATAGTATGGATCTAATAAAGGTTCCCTCTTTGTACTTCTACTTCATGGGTAAAAAGAGAAATGGATGTACCTGTGGGTGGATGT
TAAACTCAGCTACTAGCAATACAACTTTATATCAGATTGGATGTTCAGTTAAATATCTTTTCGGAATTTATCTTTTGCCTTTTCCTCCTCTATTCTTTGT
TGAATGAATTATTTGATACATTTTCCTAGAGTAAAAGCTCAAGTGATAAACGTGGATGGAGTTTCCGCAAGAAATCTACCAGGCATCGTGTATTAAGCAA
TTCAGTAGTTTCAGAAACACCATCTGGGAACAAGGACTGGCCAGAAGCTGCTAATGCCAATCTGCAAACACAATCTAACTCTACCATTCCAGAGAAGGCA
TCTGTCGTCCAATGGGCAGATGAGAAACCCCAGTTTTCAACGGTCGAGAAGTCCCAGGTCTCGGCAGACGAGAAGCCCCAGATCCTGGAGGATGAGACGC
CCCTAGTCTCTGTGGATAAGAAGCCCCAGGTCTCAGCGGATGAGAAGCCCCGTGTCTCCACAGACGCGAAGCCCCAGCTCTCGGTGGAGGTCTCAGTGGA
TGAAAAGCCCTTGATATCCGAAGAAGAGAAGCTCGAGGTCTCCGAAGATGAGAAGCCCAACATCTCTATAGATGAGAAGCCTCCTATCTCATCAGAAGAG
AAATCCCTGGTCTCAGACTTGGTGGATGCAAAACAATCAGAGTCAGTAATAATAGCTGGATTTAATGATGCTAAAGCTGATGTCATTCCGGATGAACACG
CTCTTGTTATTCAGACTGCAGTCAGAGCATTTCTGGTACCTCAATTTTGTTATATATTCTTTCAATTAATTTGACCATTTTATGGTTAAAGGTTTTGGCA
ATTATAAAGTTAATTTGTATTTGATTGTTTCTTCTCCTAGGCACGAAGAGCTCAATTAAAGCAAAAGCATATAACTAAATTGCAAGCTGCTGTACGTGGA
CACTTAGTTCGTAGGCAAGCTGTAGGAACTCTGCGATGTGTCCAAGCTATTGTCAAAATGCAAATTCTTGTTCGAGCACGTCACACTAATCGCATTGCAG
AAGAATCTAGTATCAAGGAGAAGCTAAAAGTAAGTATTGGAAAGATCAAGAGTATGAAACTATATTGGCAATATTTCTGTCTCAAGCATAAATTGGAATG
ATTCTGGTCTCCTCGCTTTGGAATCCTAGATCAGACACTAACACACTCTTAGCTATTTCAACTGATGGAGTCACATTTCTTATGTTTCTTTATTTCAGGG
AAAAGAGAACTCAGGAACAAAATCAGAGTTCACATACATTTCAATTTCAAAGCTACTGAGCAATAGCTTCGCTCAACAGGTATATATTAGTCATTTTCCG
CTATATGATCTGAAATATGCGATATTTTTTTAAATATGTATCATTTCCCATCCAAACTGATTTGTTATTTCTCCTTTGGTACAAGCTCCTTGAATCAACT
CCAAGGACCAAAAGTATAAATATTAAGTGTGACCCTTCCAAATCTGATTCTGCCTGGAAATGGTTAGAGAGATGGATGTCTGTTGCATCACCAGGAAATC
AACCGTCACCACAATCAGAATTATCTGCCGATCAGCAGGAGAATGAACCTATCGAGCACCCCAGTAACCTTATTGAAAATGAAGTTCAGCTTGATTCCGA
GTCAATGGACTTCAGACAGGGCGAGGAGGCATCCTTGTCTGCAGTGCCATCTGAAAGTGATGATAATTTGATCACTTATGATGCAGACAGCTTAGATTTT
CAAGCCAACATACCCTTTTCGCCTCCTCAGCCTCAGAATGTTGATGAAAAAACTTCAAGAGATGACACTTTCTGTTCTATTCCTACTCAACATAAGGAGG
CCAAGGCTCTCCCTGAGACGGTGCCCAATTCTTTCCCTGCAAACACTGAAGTTGAGAGAGAGGATACACATTCCCTGGAACTTTCAGAGACTGAGAGCAA
AAAGATTTTACATGGATCAAGGAAGGCAAGTAATCCTGCATTTATTGCTGCTCAGACAAAGTTTGAGGAACTCACTTTGGCAGCTAAATCAACCAAAGAT
TCTAGTTTGCCCAATCATAAAACAGAAGATGAATCTAGTGAAGATACGTTTTCAACTATCACTAATCATTCATTTGGGGCAAGGGATGCTGCTCCATCAG
AAAATTCTGTTCCTCACAGTACAAGAGCTCAAGTTGGTGGTTCAGAATGTGGCACGGAGCTTTCTATTTCTTCTACCCTGGATTCACCAGATAGGTCTGA
AGTCGGAGGTCATGTATTTGAGCAGGAACTTCCTTCCAATGGTGGCACTGACCATCATAAGAGCAATGGATACCCTCACATTGAAGATGATAGTACAAAT
GACTTATCACACTCCGACTATGTTCAGGCAGGGAGAGAGGATCCTACTGATGATGCTAAGCATGTAGATGTTATGGTCAGTTCAGATCTATCACCCGTAG
AGCAGAAGCCAGAGAACAATTCAGTTAATGTTCAAATAGAGCAAGAAGCTAGGACGGATCGGCTAGACAAGTCATCACCAGACGCATCTCCAAGGAGCCA
TATAACTGTCCCTGAATCCCAAGGGACACCTTCTAGTCAAGTGTCCGTGAATCCTAAGAAGATAAGAAGTGAAAAAAGTGGATCGATTCCCAAGCGCCGC
TCTGCACCTGCTGGCAAAAAGTCTCCTTCAAAGTTAAACCATGCTCCAGGTACAACTAGTTCGGAACAATTATCTAAGGATCATAAAAATGAGAAGCGAC
GAAACTCGTTTGGTTCAACAAAAGCTGGACTAGCTGATCAGGAGGCTAGAGATAACAGTACTAGCAGTTCTCTCCCAAGTTACATGCAAGCAACAGAATC
TGCAAGAGCCAAAGCTATCCCAAATAGCTCCCCAAGATCTAGTCCAGATGTCCACAATAAAGATGAATACATCAAAAAGAGACATTCACTCCCTGGTTCA
AATGGTAGGCAAGGTTCACCTCGTATCCAGCGGTCTCTGTCTAATGCACAGCAGGGTGCAAAGGGAAATGGAACTCAATCTCCACAAGGTATTTTCTAAA
CCTTCAGATGCCTTGTATACAATCTATTACTATTGATTACTGCAATGAGAGAACTACTTGAGTTTCTGAGTGGAGTTATGACCCGGTACTCCAACTCATT
TCCTGCCTAGTACGTCCTTTCCCCCAATGATAAAATCGAGATAGGATCAAGTATGTTATTCACAGTCTAGTCACCTGAAACTATTAAAACTGTGCTGATA
TAGTATCACAATGATTTAGATGAGCAAAAAACCTTAGTGTTTTAAGCACTAACAAATGGTATCAACTCCCTTTTTGAATCTGGCATGTACGTCAATTGCA
GCACTGTTTATTCACACGTCGATCACCTGACACTTATTCTTCCCCTTGCATTTTGTTTCTTTTAACTACTATTACTATGTTATATTTAGACTGCTTAACT
ACACTACTTCAATCGACACCAAAATTGTTGATTGTGAACCATGCATGTGTGTCCCCTAGAGATCCGCTTATCCTTGAGCTTTTTCATGCAAATTTTGGCA
GTTTGCACTGGCATTAAGCTTCAAAAGGATGAAATTCACTGACAATTTATGATGACAATTGTGGGGCACCATGGTTCTTTAACCGTTGGGCTAACTTTTT
TCTTCTTCTTCTTCTTCCAATTCTGAGCTTTGAATTCTCATATGTAATATTTTGTTGGTGTCTGATGTGTGTTTTTCAGAGAGGAAATGGCAGAGATGAG
TAGAGCTCTGTGGCTTATTGGCAATTCCTTTGGGTGCTTGACATCTGTTCTTAGGAACTCCACAGCAAAGCTATACCCTGGGCCATTATTTATTTGTGAA
GAGAAATGTAGAAAGAGCTATTTTTCTTGTAAATTTACTATTTTCTCATGCCTACTCAAACCCCCTTTTCTTTTTCAAGGATTTTGTTTGAGATGCTTGT
TCTTCTTTTTCCTTTACATCACCTTTGTGTGTATCTTTATAATATTGTGTGCTTTTCTGGCTGATGTATTTTTCTGACTGCTAATGAGAAGTTTGGAAGA
GTTGCTTTCAGCTGTAGGTGTTGTCAACCCCCCTCCCCCACTATGGCATCTAAGTTCATTTGATTCTTTTGTGTATTATGTGAAAATTGCCTTCAAATTT
ACCCAAGTCAGCTGGAGAACTATGTAAGAAGCAGAATAAACTGAGGGTTCAATAGGTACATTTATATGATGGAAATGGTATATAAGTCTGAGAAGCTTTA
TCTAGAAAGGCATCTTGGGTGATACAGAAGGTTATCAAAGCTAACCAATATACTTCCCAAGAATCTCTTTTGAAACACTCTAATTTTATAGTTTTAAACA
TATCATACGGTGAATATAAAAAGTTAACATTAAAGAGTTATCGAAAAAGGAAAGACACATTCTTTTTATAACAGAATTAAAATAAAACTAAAACAAAGAC
AAAAATAATTATGGAAGTCATTTCAATGAAATAATATACACGGAATAAAACACTTGAAAAGAATTGTCTTTGAATGTTTGATCACTACTAAACATAAAAA
GCTGCATAAACTTATCAGGGAAGGAATAATAGAATTGTTTAATTACCAAAAAGAAAAAAAAAAGGTTTTTTATACTTGCACAATTACTTAAAAATTAAAT
GTAAATACTTTTTATTGGCCACTTAAAAATAAAATCCAAATATATACTCAAAACTCAAAAGAGAGGGGAAGCAGAAACCAGTGTAGCCAAAAGAGAAAAT
GTTGAAATTCTTGTCAAAAGTGAAAATCGAATTCAATGCCTTAGATCCACGAATAGCTTCATGTATGGAATTTTTGGCTCAATGTAATGCTCCTAAAGCC
AAAGAATCAAACCCAAGTTGCCAAATTCAGGTCAAGCGCCGCACTGATGACCATCCACCGCAAATCTCTGTCACTTTCGTCAATGGAGTCGAGCAGACCT
ATGATGCTACTTCTACACCCGCACAGAACATCCGTACTATGATTCTTGAAAAGGGTCAGTACCTTGAGACTGAACAGATGTTTCGTGAAGCTGGTGAGAA
ATGGCCTGTTATTATTCCTGATGAAGAGCTTAAACAACCATTTCTTGGAATAAAGGTGATAGCTTTTTCCCTTTTCCATTGATTGTATGTGGGTTTTTGT
TGTGATTTGGTTGAGGCATATTGTCGAACAGGTTGAGTGTACCTACTTATGTTTTTTCTTTTAGTTTGATTTGTGTCCCCGGATTGGGGTTGAGAATGTT
AGTGCAGTAGCGGAGTCGGGATTTTCAATAAGGTGATTCAAAATATATCAAAGTAAACACACAAAGAAACCAAATGAATCAAAAATATATAATTTTGGCC
TTGTGTATGTATGTAGTTTAATTTTCAAGTGCTTGCACCCCTAACTCTGCCCTCAAGAGGGGGAGAGAAGATTATCATCTTTCTATAATTTTCTGAAATT
TGTAGCTCTTTGTATAGATATGCTTCTCCAAGGATGATATAGTTTGTTTGTGATCCTCTACAACTGGACTGTCTAAATTGGATGATGAAATGAGAACTCT
CTTGTTATGCTGGAGGTGTAACACATTCATGATTATTGTTACTATATTGTAGCTCGTCCTGTATCCGGGGCACCCTTATTTGCTATTTTGTATATCCCGT
CCTGATTGAGCTCTTATCTGATGATCTATTTTCAAAGTCTTGGAACTTTTGTTTGCTAATTTTTAACGAATCCGTGTTTCTGGGTTTGTTAGCATCTGTA
CTGCCTATTGTTATCAACTAAAACATGAAAACTAATGAAAACTCCTTCAATTCGCATGAACTTGAGTAGAACAGTAAGATGCTCTCTTGTAGTAGTTAGT
GGCTATCAATTTACCTAATTGTATGCATATGATTATGTTTTAAGAACCCTCACGTAATAATTTGTTGAGAAAGAATAACATGTTAATATTTGTTTGGTGA
ATATTATAACAGGTTAACATTCTTGAAATACTTTCTCTCCTTGATTTTAGAAGCTAAATGTTGCATTTACCAGTTCTTCTATATGCCAATGTGTTGCTTT
GTGTTTGTGTTTCTTAAAAATGATACACGAGACAATTCTTAGATAGCTGAGAGTATGTTTATCATGCGGAGAGTAGCCCACTATCATAAAGAAGGGATCT
TTATATCATGAAAGGAGTTGCATTAAGGTTTTTGCCTTTCTAGTTGTCAATATGTATCATTTAGGTTTTCATAAGACATCAGTTTGATGGATCTAAAATT
TCATTAGTCAGTTATCCCAAAAAGATCAGTGGAATCTAGACGATGTACAGAGTTGTGATTAAAGGTGCTGCGATAAAGCAGTTTTTGTCTCACTTATTAC
TTTCTACAGATAATGTAGTCGTTTTGAGGAGCTGTGTGCCTTGATATCAGACCCTTGGAAAGACTATGTAAGATTAATTGTATAAGAGACTTTGAGGAAC
TTTCTATTTTTAACCGGACCATCGATAAGAGCAAGAATATATTTCTTTGTAGTTGATAGTTGATACTGATTTGGTTGCCACTGAAGAGTCACTCGTGTTG
GTATGCTTCAAGATTAATTGCTAGTTATTAGTCTAGGAAGGTAATGTAGTCTAGGAGTACTAATAAAATGAACTTCTTTATTATGTACATAAAGTGATTG
ATTAGGGCTAAGTTACCTGAGGTCTCTCCACCCCCCCCCCCTCCCCAAAAGGGAAAGTTACTGTGTAGAAGACAATAGTTGTGAAGGACAAGGCGATCGG
AAGTGTTAGAGATCTGTGCTTTTAGATGTCGAACAAATTAAGCTCAGACAGCCCTATCAATTGCTTTTAGGTCTTCAACATGCCCTACAAGCTAGCCTAA
AGTGTGTTTAATTTCCTATATCTCTCTTCCTGTTCCCTTCTCGTTTTCACCTTTTCCCCCCTGTTTTGCTTGTCCCGGAAAATCTATTCTTCTTCGATTT
GAATATGAAAGAGATCTTGACATTTTGGAATCATATGCATATGCATTTCTTTCTCCCAGAGATATAAGTCATGAATCTCTCTTATCCTTGCTCCTTTTCA
GAAAGAAGTTACTTTTCCTAGTAAATTATTTCTAGTACGTAGAATGTTCTACTGCCCAAGAACTTTGAAATTATTCGTTGTTGACCACAATCTTGTTCTG
CATTGGTGCTGCTTAGGTTTGAGAACTTGTTGAAACTGTTAGCTAGTTTATAGATAGATCACTAGCTACTTGTACCAACAAGCGTGTCGTCTATGTAAAA
CTTCATTATTCCTAATTATTCATTTGGTTAGTCTTCTAACTGTATTTCTCTACAAATTTTCAGCCAAAGAAAGCAGAAGAGAAGAAGCAATAGTCGAAGC
TACTCACACCTAGCTTCTCATCGGGGCATTTTTTCAGCGTTAGATCAGCTATATGACATTCCAGAGAGATGAGTCTTCAACTAGGGGCAAAGCTAGTTTT
TTGTGGCATTTATGTTAACAAGAACATTATATTTGTACTAGATGATGAATTTGCTATCCTTTTGTATTGTGAGACTTTGAAATGTCTTCCCAATCCTCAT
TTCTCCAATCCTTGCAAAAGAATAAAATTCCCTTCCAAAACGTTTGATCTCATTTTGGAATCGACTCTAATACTCTTGTCTGAGAAGTAAACAGTGACTG
GTATGTGCTTTTTTCTGGCAAAGCCATATTTGTTTCAAAGTAATTGATATTCTGGAAAAAAAACAAGTAGTATTACTCTACGCAAACTGTTCCAACTATA
GCAGTATTAATTGAGTGAGGATTGTATAAAAATCATAGATGATGGATAATATTTGACCAACCAGAGCATCTCAAATCTAGTATACATCTTATACATAATA
TGCATTATGTTTGTGTACTATATAAACTCACTTTTGACACAACAGATAACAGAGAGTGGGTGAAATACAGACTTATATAGCCAAACATACAAATCTTATT
CAAAGTGTAGTAGCACATAAAACTCCAACATCTCCTTATATATACATTAAGATAGAAGTCCTGGATCGTGTGAAATCTCTTCTAGGGAAGAATCAACTCA
TCGATCTTCTCTACGAACTCTGTTAGGGTCAGAAACCATATCCATCATCATTTTCTCGGGGGAATCTTCCCAATTTCCAAATGTTTTCAAGTCAACCTGC
AGATAATATTAAGGAAAAAAAAATTTACTTTATCATGCTGCTGATAACATGATGAAACAATGAATAATGTCCACTGAAGTTGTATTACCTTTCGTCTTTG
CTCAGTAAAGAGTTCTTCCCTCTTTTTGTACGATGACTGAATATCTCTAGCCCTTTTTCCTCCCAATCCCAATACCTCCACGTCCATAATCAGAGCTTCA
ACCGGTAAGAACCCCTGAATATGGCATTGAGATGATTGAGAACTTCAGAAGAGAAACAACAAGAACTTCTGAAGAGCAATGGTCAGCAATTGAAGTATTA
TCATTTATACAGAAGGCATTTTTCCTTGGTACTTATACAAGAAATAAAAGTTAGTAGCTAATGCTAATCAAGTCACAAGTATATTAACAAATGTATGCAA
ACTAAAGAGTGGATATGTTGATTTGTGTTTTTATCGGATCCATGTGCTGCAGACTCTAAGCTAGTTTTCCAAATTTATCGCAGTTACAAATAAAATCAAT
TAAATGCCAAGAGCAACTTCTTTTTGGTCAAAGAGTGAAAGCGTTGTTTGACTAACAGAGGCATGAAGGGGAACAAACAATATGCAGGAAGTCTATACAA
CTATCGATACGCGAAGTATTTTCACACCTCTACCATATGACTCATCTACTATACCTGGTCAGGGTAAAGAGGACCATGATGGTAAGTTTTGTCACAAGCA
TGATGACGAACTATAACTTTAGCAAAATCTTCATCTACAAATATTCTTTCATTGCCAGAGGATCCTCCAAAAGCAAGTCCGACAGGCTTTGGATGAGCTT
CATATTTAACGGTTCCATGCAAATGGCTGTAAACAAAGTTTTTCTCCTTTCCTGTCAAAGAACATACATTAGCCTTAGGCACATCATTCATGTAGAACTA
TCCAAGCTGGTAAGACCAGATACACTACCTGAAGGTGTGAATACATGAAAAACTGGACTGATGGAGTATAAACTACCAGAAGTCCCATAGAAAGTGTCAT
GATTTTCTAAACCCTGATGAATGAGAGAACCAATAGTCCATCTCCTTGCGTCATTATTGGCCTCATGAGCAGAGATAAGAATTAGCAATGGAGCATTATA
TCCTTCAATATTTGACCAGAATCTGTTCAGACCTTTTCCATGAAGGGAAGACCTGTAGGTGGGAGAAAAATGAAAATCAATTCAGAAAGATAGAAAGCAA
TACAAGAAATTCAGAGAGTTCGACTAATAGTCGACATAAACCATGTACTAACCGATAAAGTAGGTAATCATCTACTTCCTCTGCAGCACTTGGAAAGCAT
ACTTTTGAAATTTCTTCACTTAAATTGCCCCTCAATGTAAGTGAGATAGCCCAAGCCCTTCCAGAATTAAGGAGATGGCCAACGCTCCTTTCCTTTGCAG
AAATATCATGTGAGAAAAGGTCCGCTTGGTCAAGTTTTTCCTGCTATCAATTCAACTTCAGAGTTGGTGATTGCAGAATTCTAATTTCTTGATCACAGTG
CAGTAAGTGTTCATATAGTATGGCATCACGGGCAACAAATAACAACTGTCAAACTTGCATAACTGCTTATCTTCGCCTTTTATCAGAAAGACAACAACAA
TAATCCGCCAGAATATGAAGCACTTGGAACTCCAATAAAAATCCGGCTAAGGGTTATAGTAAGATGTCAAACTCAAACTAGAGTTCTACTTGGACAACAA
GCTTTAAGGATAGCCCTGAGAGATAAGAAAGGTGCTGTGTGTTGGTAGTTCACTTGTTTTTTTCCCTCCATTCTTCTACCATTGTCTTTATATATCAAAG
ACATGGTCCCGAAGTGGAAGACATATTAGTCTTGAGAGATTCAAAAAGGTGATAAATAGATGTTACAGAACACCCAATAGAATTAGGGATTTTCAGAAGA
TGAGAAATATTGAGTTGACCTTATGGTAGTGATGCAAGACAAAAATATATAACATACAAAGAGTAGTAGTAGTTGATGATATGAGCTTAAACGAAGAAAT
GAGGATTCATGTAGCTGATCCCAATTTGTTTGGGACTAAAGCGTAGAAGCTGTTGTTTAAAGTAAACTATTTTGTTCAGATGAGAACCACGAAACTGCTA
TGATGTGCATAAAAATGTCTAGACCTTTGTACCCAAAAAAAGGATTCAGTGAAATCCACGCCAATTCTACATTACAGAGGTTCTCTTCGCATGCGAGAAA
ACTACATGAGGCACAACATGCACAGATGTAATCTCATGAGAAAGAACTTAAAAATTGAAAAACTACTCGCACTAGATGTATGTTTTTTTCCTAGTAAATA
TAGAAAAAGCAAATGTAGACCTCAAGACTATGGTTTACGTTCTTTCTTTTCGTTCTGCCCCCCACCCGGAACCAAGTCCTGAAACTAACAGTGAGAAAAA
ACAAGAGATGCAAAAATTGAAAATGGAGGACAAATGATTAGAATTAAATTGCAAAGTAGTAAACATGATGGAAGACTCCTTCAGTTAAATCATTGCAACC
AGCAAACAAACTTATCATTTCTTCAATTAGATATGAAAGGCTTAAAAGCACGGCAGAAATATTGCAACCGACTGAACTTAGAAATCTGTATAGTATCCTA
GTTTGTTGTTAAGTAGTTTCGACTATCACATTATTGTATTGTTGTTTTTGGTAGACTTTGCACTGTTACCTTATTACTTGTAGTATTCTCTTCACTGTCT
CCTTCTTTGTACCTGGATTTGTTGCACTTGAGCCGAGGATCTTTTGAAAACAGCCTCTCTACCTCCACGAGGTAGTAGTAAGGTCTGCGTGCATTCTAAC
TTCCCCAGATTTCACTCATGGGATTTCACTCGGTATGTTGTTGTTGCTGACTGAACTTAGAGAACTAACCATTACCTCAACAAAGGGAAGCATCAAGTAC
ATGGCACCCTTTGATAACAGAAAGAATTACTCTTGTTATTTCAGAAGACTCGTATTGACTAGTAACCATTGGGTAACAACACCAATTTCAAATATTTAGT
AACTCACTTCTAAGAAAGACTAGCTTATCAAGCATGTTAACGGGCAGAAACTTCATGGTGAAAACTGAAGGACTCATGGGTCAATTGTTCTTTCATGAAG
GATATATGCTACTCCCTCTGTTGTCTCAATTTATATGAGACTATCCTTTTTAGTCCGTCTAAAAAAGATGACAGCTTTCTATATTTAGTAGCAACTTAAA
TTTGAACTACTCATTTTACCCCGAATAAGATGATTTATAATTGCACAAATATCTATAAATTATTTTGAACCACAAGTTTCAAAAGGGTTCCTTTTCATTC
TTAAAATTTGCGCCCAGTCAAACACTTCGACATAAATTTAGACGGAGGGATTACGACATTTTTCTCTTTGCCCACAAGAATTAGTCTCATGACACCCTTT
GGACATATTGAAACACCTACTTTACTCAGTTTTTTAATGCACATTGCCTTTATGATATCAAAAGAATCAATCAATACAAGACACATCCTTCAATTTTTAA
ATTGAAAATGGGAGTACCTCGTGAGCGGCTACGTAAAACAGTCTAGCGTGGACAAATTTTCCAAAGCAATCGGAGAGGCTTGGCACTGTCTTCAAAGCCC
ACATTATAATTTTTGCAACAGGAAGTTGTATATCCATATCTAAAATGCTGTTATCCCATAAATCCATTTTTTTATCTGCTTCGGCACAAGAGTTTATAGC
TGACAAAACCAAATGTGTAACATCAGGAAGACCAGAATCACCTAAAGTAGATGAAGCCTTCAACTTGTTCGAGTCCCACCACATAATCCAACACATAGAA
AGAAGCATCTGAACATCAACTGGCAATAAAAATCCGCTGATTTTACAATCATCCTCATCGGAAACGATCTGTAGTTTTTCTGGAAGACCTGCCTTAACAG
ATACCATCCCAAATAACCTCAACAAACTATTAAGTGAAGCTGAACTAACTGTCCTTCCAGAACACTTTATATGGCCCTTTAGAAACTCAACCCAGCTGAT
ACCTCCCTTTTCAGACAAGAAAAACAAGTCAACTATTGAAGAACTCAAATTACTCATCAAAACTGGAAATTCCTTTGGCACTACAGACTCTTCGTTTGTT
GATCCATCAATAGAGAACCCAAAACATTTCTGTAACCAACAACATAAACTAATCACAAAACAGCTCAAAAAAATAACTAAACACAGAAAATTCATGAAAG
TCCCAACTTTTGCCACAAAAGCACTTGTGGTTTATGCAAAAAAAGTCTCTCAAATGTAAACATCTTAAAACAACCAAAAAATAACTCAAAAACTGAAACG
GAAGATCCATAAATTCCACCTAGATTCCAGTTTTTACTACAACCCCATTTGTGGGTGATTCAAGAATAGTCACCAAAATGCAAATTGAGCACAGATAAGC
AAAAGTTTAAAGTTCGGGAAATCCATAAATTCCATGAAAATTTCAACTTTTGCTAAAACCCCAGTTGTAGGTGATTCAAACAATGTCAGCAAAATGTAAA
TTGAGCAAAGATAAGCAAAAAAAAAAATTTACGTGCGGAACAAGAAGAAGAATTACTTGAAGGGAATGAATGGAGATGGAGTGAGTTTGAGGATCAGAAA
GAACAGAGAAAGCTTTCTTAAGATTAGGAAGAGCTCCAGTTGAAGCAGCTACAGATTCTGCTTCCCGTTGCTCCGGCGACACTTGCTCGGCCGATGAAGA
TTGACCCATTTCAAGCTTAACTGAAGTCTGATAGACAGATTTTCCCTTTTGCCGGTTGTCGTCGGTGGAAGATTGGAAGTTCAAAGCATCAAGGAATTGT
TGAGAATTGACACGTATTAATAAGATTTATATACATTTCGATTATGTGGCTCTTTGTGCCACCCAAAAGACAATAAAATATTGAGGCAATATTTATTCAA
AAATTAGAAAGTAGTAGTACTCACTTACAATATTAATATATATTTTTTTTATCGTATCTTAATCGAGTTTCAATATTAATATATATTTTTTTTAACGTGT
CGTAATATTTTGCTTGCACTTTGCTAATACAATATATTATCAAGGAGGTGATATCAACGTCTTACAAAAATAGTCAAGTGATCATAAGTTCAAACTATGA
AATCACCGTCTTACAAAAAATGCAAGATATTGTACTTTCATTTCCAAGTCATAGCAACTTTCTCCATTAAGAAACAGCCTTGTAAGACAAACAAGATGCA
GCTGAAAACAACTCTAATATGTGGAAGGCATAGTTTAATATGCTAAAGCTGTTTTCTTACAGAGTCATCAACACTCATAAATTACAACACTACTATAACA
GAAACCTAGTGAATCATCTTCTTGTTAAGTTGTTCAACAACATTACATTTGCATGTTGCTCCATGCAACTCTAGTGATCAATCACTGTGAGCTCTCATAG
ATCACTTGTATTGAGCTTAGTTTGGGAATTCTGATGTTGATCCATTGATGCTTTGCAGTCCAGCAGAGTTCAGTAGCTGCATTCCTTCCTCTCCCATTTG
CTGGACTTCAGTAGGCGATAAAATTCTGATGCATCGAACACATCCAACAAATTCCCTGCAAGACCATTCAAGAGATATTAGTTGAACATCATCATACTGA
GTTTGTTTCTGGATTATGCATTGTGAAGTTATTGATCTACAGTTAAAAATGCATAGTATGCGCTTCGTATTGCAACCTGAATATGAGAGAGATTTGTGTC
AAAGAGAACTTACTCCCAAGGATCATCCCCAACAAGGAGGACATCATTCTCAAAATCCACATATACCAACTTCCAGCTCGAGCCTCGAGTGTCATTCAGA
AGCCCCTCAAGTCCAAACATTCTTTCAATTTCAGACCGCAGCTCTTCATAATTTTTGAAACCAGAGACATCAATTGATCTTCCTACAGATCCTGTCTTTT
GAATCTGTTCACCAGTAAATCCAGTCAGATTACATATAGAACATTGAAATACAAAAGTGACTATTTCGCAGTAAATAAATGGATAATATATAAACAGATA
AACAAATAAAGATTGCATATGCAAGGACATGTTATGAAAATGCAAAGGGAACCCTTAAAAAGAAGTGGTGAAATAACCGAAAGAGACAAAGAAGATTCTA
TAACTCAAAGTAATGAGTTAACATGAGCATAATACCTATCGACTCAGGATTATCCTTGCTACTAAGATTGATATAACATAGCTACAACATATAAAGCGCT
TACCTTTGTATATGTCCGCACACGTGGAGCAACTTGCTGCCATGAGCTATTCTGCAAAAGATTGCATTCATCAAAATTTACATTGCTTGATGATGCACCA
CCCGAGTTGTCAGCAAATTCTTGTACAGAGAAATTCTGAGAATCTGCCAGACTGGCTGATGTAATTTGAGATTGAACATCTTGACTAGAACTGATGTTGC
CTAATAGAAAATCTGAAGGATTCTGGAAATCAGTATGCTTCAAATTGCAGAACTCATCTAACACTGTGCTCGAAACAGAATTATCAATCACTGTGCTCCC
GCTGTTACTATCAAAGTTAAGACAGCTATATATATCACTTTGGTTATGGCTCTCCTCTGACAGGTCCTTAAAACCATAAGAATCAGGTAGGAACTGCATG
TTAGTTATGTCTAGTGGAACCTGAAGGTTTGTCTGGGAAAAGCACTTAACATCATTCAACTGATGATCCCACAAATCCTGGCCTATTGGAGCTAATCCAT
GACCAATTGTATCAGGCAACATAAAAGAATTATCATGCTTTGTCAAAGTGGAGGTCGACACAGGATATTTGAGCAATCCAGCAGCAGATTGGAGAGAGGA
CATATTCCACTCATTATTAGTTGGGCATTGAAGGATATTGTTGGAAGCAGCAGAATCAATTTGAGGGTTATGAGGAATGAGCCATGGACTAGCTTGTAAT
TGAGAAAAGCTGTTATGGTGGGAAGCTGTCACACTCGCATCAGTTGGAAGATCATGGGGACTTGCAGGCTTGATAGCCACTTTGTCTTCATTACACTGAA
ACTGATCTAACTTAACTGATGAATTACTAGTTTCTTTTCTTGGCTCGGAATTTTTTCCAATAATGTCAGTTTCTACTTTTTCCGGAGGTTTAGACTTCGC
CTGCAGAGTTGCTTGCTGTGAAGAAATAGAGTTCACAACACCAACAGGTTGATTAAGGACAACTTCCGAATTTGTTTCACTTTGTGCAGGTGTAGCTTCT
ACAGTTATTAGCTCAGGTTTTTGGTTTCCTGCTGGCTGTACTACATTCCTAGCTTCCTGAGGTAGTGCAACCTTAATGTCTTGTACTGTGGGAACACCGC
ATTGAAGACCAGTAAGGCCAGGAGGAGGTCTTATCAGCATCTTCATTAGCTGTTCTGACCATAGGTTTGAGATAGAGGAGCTCTGAAGATCCCCATATAC
ATTTTCAGGAACACGCATGAAAGGGCGGTGCTGCATCAAACTGTCCCACTCAGTTTGTGCTCCTGTTTTAATCAAAAGTTAAAACTATCACAAATTTGAG
TTAATCAAATGAGGAAGAAGTAAGGATCAACTTACCCAAAAAGGTAGACTGGTAAGGTCGTTTGAGGCCTGCAGTCAGGGAAGGAAATATGAAGAGACTT
TCTGGTGTCTCAACTTCCCATGGACTAACTCTATTCTGCTTGTCTCCACATCCAGGCTCATCCCACTCTACCTGTTATATAAGTCCAGTCAATTTGATAG
AAAACTGTGAAGTGCCAATTAGCTCACATTTAGGAAAACATGATAATAAGCTGCAATCAGTGTGAAATTTTAATCACCTGAAGACACCGCCACTTGGAAC
TAGGCCATCTCAGTGGATCCAAATCACTAATTCCGCTAATAGTGCCCATATATCTGAAAGAGAGGATGAAAAGACTTCAAAGTCAGATGAAGTGAAGAAG
ATCTATAATCAGAATTTAATTTTAGAAAGTTGTCCCACAAATTCCCAGCATGAAAGATATACCTGCGTTTACCCGATTCCTCAGTTTCAAACATCATTCC
AAATCTCATACCAACAGACAGTTGTGTGTTATAAATAGATTTTCTATATTTGGCCAAAGGAATGACAAACTCTGAAGGGCATGCCCTGTAGAAAATAAGC
ATCTAGTTATAGGCAAATCTCACAGCTATGTGAAGTATGAAAATGGAAGCTGCCGTTATAGACATACCTAGGATTGTAGAATATTGTGAATGTGCTTCTA
TTAGCAGCAGCATGAGCAGCAGCAGCAAGTACTCCAATATGCATACTATCAGCAGACAGAACTGAAGAGGGCAATGAAGTTTGCTGACGGTTAGCGCGCC
TGACTCCAAGCAACAACTGTGATTTCTCATCCCTGCAGCAGTAAAATTCAAAATATACCACGTAACGGATACTCTCTTGTTTGCTTACAATCAGAATGTT
TGAAATTTTATACGCACATATTTCTCAACATTGAATAATTCATGAAGCTGCAACTTTCATTACTTTATTTTTGCAATACCTGATAAATAGAACAGAGTCA
CCAGCTCTAAGGCGTTTTGCTCCAACAAACATGCTCCATCCAGTTGTGAGAAGATGTCGCTTTGGCTGCCCTATAAAGTAAGACAAAACAGGTGGAATAA
ACATTAAACTGATAGCCAAGTGAATCATGAGAAGACAAACAACCACCAAATTAAACCAAAACAAAAGAGATTAGAATTTGGTATAATGTATTTTCAGCAT
GCTCACCGCGGTATATGTGACGGAATGTCCAAGTATTATCATGCAAGTCTCGTACAACAAGCTCTTGCGTTGGAGGTTGCATTGAATAATCCTAAAAGAG
CAAGTAAATACAACACAAGACATCAGGAAAACTCTTAAGTCTTATTTTACTTCCATCTGGCAAATGTAACTCATTCAACAAAACATAACTCTCACCAAGG
GCGGGAACAGCTTTTCTGCTGCTCTTCTAGGAACAGAGAATCCTCCATGTGTGCTTGTATCACTGGCAGTCAACGTTTTGCAAAAGAACTCAGTTGGATG
CTTATTAGGCTTCAGCCCAAAATCTGGAATGGGGAAGACATCTTTCTCCTAACCAAGAACGCATACGAGAAAAGAATTTCAGCATGCATACCATTATTAC
TTTTGCATCTGTATAAAAATTAGTACAAATAGTAGATTAGAAAACTTACAGAATTCACAGGTTGGAGGCTCATTTGCGCATAGATCTCATCTGTCTCCTT
ATCTGCCTGTAAATGACACGACAAAACAAACAACGTATGATATCACAATAACTCCATATAGTACTCCAATATAATAATAAAAGTTATTATATGGAGTAAA
AGCATCATCTTAAAAGCACATACATGCAGGGTAACATTGTGAACTTGGCACAACAACTGAGAAGCAAGATTTGGATAATTAGGTATCTGTGAAGTTGCTG
TTCTATTCGTGGAAACCGCCACCTGTTGCAACAAGTTAGTTTTTTATCAGCTTCTCTTGGAAATAGTCTTCTTTCAACAACCAACAAAGCACAAGCTGTG
AATGGACAGAACAAATGACCAAAGGACTCTGTTATCCATAGGAGATCTTAGGCTTTTTGGTTTTCCTAACTACACTAACAAAACTACTGGAATACATTTA
CCAGGATATCCATATTTGCTTGTATAAAAAGAAGTCTTCAATATTTAAAGAAAAGAAAGGGAAAGGCTTTACTAAGAAATGAACATAAATTATTCTTAGC
CATAACTACAACTTGATTCAAGTTTGAATTCTACAAATACAAATTTACAACTTGTTTTCATGATTCCCTTCAACATTCTAATAGTACAAAAGAAAAGAAA
ATTCAGAACAAAACAGCTCTCCTGGAACATTTGTTTGAACAAGCAGGATAAGAGAGTATTTTCTTCAGATAAATGGTTTGAAGGACTACGATTGAACAAT
CCGGTCTTAAGTCGATGCTAACAGATTCAAATTCAGACAATTTTGCACAATTTTGTAAAGAAATGCTGATAAAAAGTAGTTGTACCAAACAACAATAACA
GTAAAAAAGATCAAACCTGTTCACTGTGCCCCTGTGGGAAGTAATACACAAGGCTTCCAACCTGAGGCAAAGTTACAAGTGGGCCAGCACAAGCATGCCA
CAACTCAGAACTAATTAGCTTTCTTCCTCCCCCTATATTGCATCAAGATTCAACAAAATCCACGTAAAGATTCAATTTTTACAACTATTAAAACTAGATA
ATCAATTTCAAGTTTCAATTTTTATATTCTGCCTAGTCTGAGCTAAGTTCATACACAACTCCAAACACCAAAAACAAGAATTCACAAGGAAACTAACCAG
TATGATCCTGCATTTCCTTCAACAATTTCATTTCCTCAAGTAGAGTATGTGCTCCACTAACCAAACTCCCTGGCTTGTTCTTCTCTTCAACAGAACCCAT
AAAAACCTCTGTGATTCCCTTTACATCAACCCCAAAACCAAAACCAAAGACCCCATCTTTCCAAAAAAAAAAAAAAAGAACTCCCTCTAACCACCAATCA
GCAAGTCAACAAGATGACATCTTTCTTAGTTCAAACTAACATAACTGCCAACCCACATTTCAAGTCAAGGGAATGATTCTTAAGAGGAATGAAAACATAC
TACAGAACATGACAACATCTTCTTGGAGAATAAAAGAGCAAAGAGAGAATCTAAGTTATTATACAAGAAAACAATCTAATTGGACACAGAGAGCATGCCC
AAATAATCCAAAACCAAAGAACAAACACCCACCCTGCAAAAAGAGTCTTTCTCTCTGCAATCTAAGTGGGCCTTACTCTCCATCAACACCCCATCAAAGC
AAAATCCTTTCTCCTTTTCTTTTTTTTTCAATTTTTGCAAATTATAAGGAAGAATATAAAGATAAATCCAAAAGGGGTCAGTTTATTTTTTCCATCAAAG
CACGCGGACCAAAGCATGAGGGGTCTTTAGCTATCAATTACCTTTGTTAAAAATCAAAAAAAAAAAAAAAAAACTTTCTTTATCATCAAAAGAAACCGAC
CTTTCGATGAAAGTGGTCATCATTCTGATTCCTCTCTTTCTAAGCTTTAGAAATGAAAACCCCAAAACCCCTTTATGATAAAAATGAAAAAAGATTCAAT
TTTTATTAACTCTGCACATACTACTACACTGTTTTCTTGAAAGTAGAAAAGAGTGTTGCATGCTCTTACCCTGTACACACTCTTTTCTTTTCTCTCTGTA
TAATAATACTTTTAGGTTGATTCTTTTGCAGCTTTAGAGAGAGACTCTTGCAGCTAAAGAAGGGGGGAAAACTAAGTTAACACGAAATCGTACTAATAAC
ACTTTGTATGAAGAAATTTAGGAATCTTGATTGATTATAACTAATAAAGAAATGACAAAACGTACTTTGTTTGCTAAGCTTTCACACAATACTATACAAG
AATTAATTAATCGACTAAAATAAGTTAAAGATCGATTATTTGAATTCGTAAACATTGCTAACAAAGCAATATATTCATCAAAGTCTTGCTTTCATTGCAT
TTTCGTAAAAGGTTATTTTCGAAATTTCAACTTCTAATATCTCTATTTAAATGGATGTATAATTAATTATGGGTTACTTATTTGATTTATTATCGCACTA
ATCTAATTTAATATCGTAAAGTGATATTTTTTTTTATCGTACGAATTTATTATTGGTGGGAGGTATATTGAGGAGTAATTTTCCTTGTATATGATTTTGG
AGAAATTTTCGCACTTTATTAATTCGTGTATCTTTCAAAGTCATTTCATCTCAGAAAAAAAAAAAACTTTAATAGTCAGACCGTCTAAATCAGGTTATGC
ATACTTTGAATAATTTCGTATATATTATTTTTCATCAATATAGATATTTGAAATGAAAAATAAATTTATCAATCAAAATTAGATTAAAAATATATTATTA
ATTTTAATATCAGAACTACACCTTAAATATTGCTCATCATTCAATTTCTTAACATAATTTCAAAGTTGGATATACTTTTCTTGATATATCTAATTAGGGA
TGTCGTGTTATTCATTTTCAGATATCAAAATGTCTAGTTTTGAACATGATACGAAATCTTTAAATTCCACATTATTGTATAAATATATATTATATTCATG
TTATGTTATATTATATTAGCTTGATCGTTATTACATAAACCGAATGAGATAATCCTCAACGATTCAACCACTAATACAAAAAATTCATATAAATTATTAT
TTTTTTTCCAAATTTGAATAGAGAAACAAAAAGTACAAAGAGTGGTAATATGGAGAAAGTTACATAATTTTTTCTCATGTGGAAAGGAAGAAGAAAATGA
CAAAAGAAAAAATATATATTTTTGGTATTAAATAAAATCAAGAAGAAATATTTTCTCTACGTGGGGTTTTCATTTTCCATCTTTTTTCAGTCTTTATGGG
CAATTCCCTTTATCCATCGGATTTTCTCCCCACCCTCACACAAGCGCGTGTAATACACGACGTCGGCGCATGTTAGCATAGTCATTTGTTTGAAAAGAAT
ACTTGAAAAGTTGATAATTTTTTAAACTTTGGAAAGTGCTTTGAAGGATTTACTAGGAAAAGAGTTTCTCCTTTTGCACCTAACTAATTGCGCGGTACAG
CGGATGAAGTTATTCGTGTTTTAATTAAAATTGAATTTCTAATATTAAAAAATTTCTCTCAAATGAAATATTAATTGAACGTTGATACAATTCATTACTT
TTATCTTGTATTTTGATATAAAAATTTATCTGTTTATCTTGATTAATTAATAAATTTAAAAAAAGAAAATCAATTGATTTTGAGATATTTCTTTGGTCTT
AATTATTTTTTTAAAAAAAATTAACCAAATATATTTTAAATTTGAAGTTTCTATCCTATTAATTGAACTATATAATCAACAAGAAAAAGAAGTAGGTGTA
CAATGTATTTTACATAAATTTTATGAGTTAGTTCGAATAGAGATAAACTCTATTTCCATATTAGTATGTTCCATGTTAATCATTCTTTTTTGTTTTTCAT
AACCTTAATTAACCAACAAAAATATGTGCAATTATTATTTAACTTTTTTTCTTAATATGCTTAGCAATTGGACCTACTTGCTCTCATTGGATACTTCCTA
GCTTTAGTATTTTCACTTAAATTAGTAAAATTTTGAAAGAAAAAGAAACAGATTTAAAATAATTTTATCTTTCTCAAAGTCTGAACGAATTGACTAAAAT
ATATATTGTATATACGTTTCGTTTACTAAAACTTTGCTAATAATTCTTCTTTTGCTATCAAATTGTACTTCCAACAAACCTAATATACAAAGAATGTAAT
TATATTCGTTGATAATTATGTGCAATAGTCATAAATATTCTAGATGAAATAGTACGTACTACATATAGATAAATATAGTGCCTTAATTAATTTATTGTGC
TTAGCTAAGGACAACCTAAAGTACATAATTTTTTGTATAATATATATTTTCATTAGATGTACAATATTTCTATTCAAATTCCAATTTAAATACATAATTC
TTTTATTTTATCAAGTATTCAATATTTATATTAAAATTTCGACGAAAAGTATAAGATATTATAAAAGACCATGAAATGACTAATGAGTAATGACTTTGGT
GTTGAGCGTAATGAAGGGGCCGTGCCACTTACGTGACTAAAACACTCCTAATTAAATATTAAAGGATAATAAAAGATACTTTCTCTCTCAATATTTAGTC
GTCGATTTTAGAAAAGGTAAATATATTAAGATAACAATAATTAATATAGTAAAGTTACAATTTTATCCTCATTAAATAAGCTTTCAAAAAGAATGAATTA
AAACTTAGAAATTTTCAAGAGTTTAAATGAGGACATAATAGGAAAAAAATTATTTCTTGATTTATCAAAATTAATATGTAAATAGAGATATCTAAAAGAG
GAAATATAGACAAGTAAATAGAGACAGAACTAGTAAGAGTTAGCAATTTCTACACAAATTCTTTAGTATATTTTGAAAAAAATTACTCCACATTAAATAT
GTGTATCAATTCAACAAATACAAAATATTATTGAAGTTAGATTCAAAACATAAATAATGAAATGACGCGAGAAGTCATGATAGAGAAAAGTGAATCGTGT
TAATCAAATTTAACAATTAAGAGAGGCAAAAGAAAAATTTATTACTCTATCTGTTTCAAAAAAAAAAGACATTCTTTCCATTTTAATCTGTTTCAAAAAG
AATGATTATTTCTTTTATAACAATTTTCAACATGACATGTTTAATGCTACAAAATTAAAAGATAATTTTATACATTTAACATAACTTTCATTTAAAACCA
CATAAATCAAAAGTTTTTTTTTATTTTTTTAAATATCGTGTCAAATTAAATTAGATATTTCTTTATAAAACGAAGAGAATATATATATTATGATCGATGA
TGATTACTAAAAACGATCTTTCTAAATGAGTTCATCACTTTATATATTAATAAAGTTCAAACATTCAAAATACGTTAAAATCGAAAATAACATAGCATTT
TTTATTTTTTTATTTTTAAAATAACGATATTTTCGTAAATTTTTATTTAACCAACCACCATTGATATAAGGGAAATACAAAGGGAAAGAGGCGCCGAAGA
AGCGAAAATGCAAAAGGCATTCACATGGCTGACCTCTTTGTGTGTGTGCGTGTTTTAGCGATTAAAATTGTGGTTAAATTTATCTGTGATCTCACGTGTT
AAATTATAAAATTATTGATATAAATTATATATATATATATATATAAGTTTAATAAATTTTAAATTTTAAATTTAATTATTTTTATTAAAGCTGATATGCA
TACTTATTTTAAAGAGCAAGAAAACCCATGTTTAGCGTATTTATGCACACTTACATATATACATCAAATAATAGAGAATTAACTATGAACAAATAATTGA
TATTATTATTAGTATATGATTTTTAAGCTGATCTTAAATACTTTCTCCAATTTATATAAATTAAATTGTTGAGACGTTTTTTATTTTTTAAATTAATTTA
ATTATTTAATTTCAAAATTATTTTTAAAATATTTAATATTAAAATTATTTATTAATTAATATTTAGTGTTTTTTAAGATTACAGAATTTAAAAAAAAAAA
ACGGGTGAATCGCAGTTTACAAGGACTGAGAATATTTATTTTACTACTCCTATTCTTAGGTCTTTTAACGATCACCTATTAAAATTCTTGTCAACTGTTA
TCAATTATGATTATTAAGTTGAAAATTAATAAGGATCAGAGATGTATATGAATTATTAGTACGTGGCTACACAAACTCTAAAAAGAAATAGGCAAATTCG
ATATAATTTTACAAAGTAATTAGATTAATTAATTTAATACGATGTAACTCTACTCCTAAGTCCTACTATATAACAACAAAATGACATTAATTAAGTGAAT
ATTTTTGAGGCAATTATTTTATTTGTTAATAATTAATTTGAAGATTGTAGCATAATTAAGGAACAAGAAGAGAAATACACTAATCCCGGAGAGAAGCACG
TGAAAATATGCATGAGGACCACGAATTATCATGCACGCATGCATTTTGTTTAAATCAGAGCCGTTAAAAAAATCAGTTCATTGAGATCTGGGCCCAATAG
CACGCCCCAAATTGCCTTTTTTTGTTAAGTAGGGCCCGGCCCATTAAGCGCAGCTTTCTATGGTCCTTTGGAACTTAAACTCGCCGCATTATTCTGTACA
TTTATATTCCCTTTTTTTCTGATTTTATATTTTCCAGAAAAAATCTCGATTTTCGTACACCGTCGATTAGAGGACACGTTTCCATCATCTAACCGGTGAA
ACTATTTGTGGGTCCATCAGGTACGTTAGGCGGTGGATCGATGACGAATTTTGATTTTCATGACGTGGAAATTAAAAGAAAGGTTATATAAAAGATCGGA
ATAAGAATTGTGAACTCGTTATAAAGCTTGACAAATTTTATTTGAGTTAGAGTTGCGATTTAATTTTGAAATGATTTCAGAGTTTATACTGATTGAGTTG
AGAATATATTAATGATCTTTGCATGTCACACTACGAATCGAATAATGGAATTGCAAAATAGAGAGATTTGAATTTAGTTGTAATAGGGTGTTGATGAGAT
TTATTCCATATTGCATCGGGGATGAGAACTCTGATCGATTTTATTATATGATCTGGACAGTTTTTTCCGTTTGAATTAGCGTGTAAGTTAACGTAAAACT
AAATTTGATAATTTTTTAAAAAAATGAATCGATATTTGTATGACGTAAAGATTTGAGAAAAGCTTATTCTCGAGGCACTTTTTCTTTTATAGTTGATTTT
CTTTTCACTTGCCAAAACTTTTCTTCCTTAATCTTATCGAACAAGACATTGAATACATGAGCTTAGATAAATTGATATATTATTCAAGTTAGAAATACTT
ATATACGTTGTCAAGTGTCATGTTAATGTGGACAAATTTGACAAATCGAAGTATCTTACACAAGCAAAAAAATTTAATCTAATGTCATCAAGTTCTTTCT
CGAAATTTGACAAATCAAAATAAAAAATATATTCCGTAAATTCGATAAAAGAAAAAAATAAAATTTTGACGATAAATTTTTTTTCACTTTGTGTCAACAT
AAATCTACGACATGAAAAAAAACATGTAGTACAATTTTAGTCAAGAAGTTAGATCCAAATTATAATTATGAAACTTGTAAAGAATAAACAAAGTAACCAT
CGTATAATCAATTACATTATTATACTATTATTTGACAAATTGTATTTTCCTTTCATATGACAAAAAAAAGTTGTCAATATTTGACTATACAATGATGAAT
ATATCTTAATTTAATAATTTATCCGTAAAAAGCTAACAACAACAAAAAAAATGTAGTAGTAGCAGCCAAAACTAAAAGGGAAGTACCACTAATTAAGTTA
ATAATGGTGTTGTTAAAGAAGTAAAGCTATTATTGACCACAATTATTTTATCCTTTAGTTTTATTGCACCAAACATTGAGGCTAATTTAGCATGCTCTCA
ATTATTGAATCTTTTAAAATTATTATGGGCCAAAAATTCTAGCAGAAAAAGGACGAAAAAAGAATTATATTATTATTATTATTAGAAAAATGAAACTCAA
TTACATAGTCAAACTGTCAGTCAGACAATATGACATTTTTTTTCCAATAACAAACAAAATTTCCACCGAAAGTAGTAAAAACTAATCCAATTATCCACCA
AAATAAATTTCCATTAAAATAGGAAGATTTCTTCAACTAGAGGATCTTAACGCGGAAAATATTTATCTGTACTTGATATTTATATAAAGCAAATAATATA
AAAGAGAGATGCGTAGTACTTATCGGTAAGTGATAAAATTTTATAAATAATGTGTATGTATTGTATTCATTTTGATTGATGTAAGTATTTGATATTGATA
AGCTTTTTTACCACTAAAAGTGGTTTCTTATATAATATATATGATCAACTTAAAACCTCTACAAACCCTATTTAGAATCCCTAATTTCAACTTTTTTTTT
CTCATTTGATGTCAATATTCATGTTGCAGCTTTAGATCCTAATTAATTCAAATTCACGTTATTAAAATGACTTATTAAAAATAAATTATTTTTTAAAAAA
AAAATCATATCAAAACTCAAACTCGACCCATTGTGACATGATAGCAAAGCTTATAGACACATCTTATACAAAATTTCCTCAAAAAAATTGTTATACATTT
GTAGTAATTATATTAAAAGAAAAAAAAAGTATCGCGAGTTTATTGTTCTATATTTAAATCTTACTATGAGCATTCATTTAAGGAAAATCAATGTATAAGT
TCAAATTTCAATAGAGACACAGACATATATTATTAGATAAAGTTATTTCATATTTGTATTAATAAATATATTATAATTAATTAATGAAAAATTTACTCAA
ATATCTACGATAAATAAATTAATTTCTTTTTTAATTTGACTTTATTTTATCACTTTTATACAATATATACATTCTCCAAAAACATAGAAATTATATTTCA
ACCATTACTATGATTGGAAGAAATCATGGTACCCCACAATGTTATTGGTAGAAGTACATAATATCATAAAGATGATCCCTTTTTTCACCAAAAAGATAAA
AAAAAAAAGTAGAGTTATTGGAGAAAAAAGATGAAGAAAAAAAAAGTAATTAATTATAAGTAATCATAAATCAACTAATCATGTATATTGCTCTTTTTAT
TTGACCTTAGATTGCTTCTAATAAAGCAAAAGCACTTTCTTAAAAGTGTGAGATACGTATCAAGAAAAAAAATAAGAGTGGAGAGTCAATTATCACTATC
TGAAAAATATCTTTTATCTTTTTTTAATTATATATATTCAATTAAAAAATAAAAAACATTGTATAAATAATTGGCGTTTGGTCAATGTTTTAATAATTTG
AGATTGTTGAATGATGAAAAGATATTGGTAATTAATTATTGCCCACCTTATAATTGATTATTATACCAAACGCAAAATCATCAGCCTGCATGCGTACTTT
TTATTTTTCAAAAATAAAAATAAAAATTGACATTTATAAATCCTATTTGAATCATATTTACATACCATAAAAAGGATAATGTTTTTCTAGTTTTCTTTTT
TATGGAACATAATTAGTATTATTCATCCTGATGTTTATAGTTATTAGTTTGGGATAACGCACAAGTATCCCCTCAACCAATGCCCGAAATCTCAAAGACA
TACTTATACTATACTAAGGTCCTATTACCCCTGAACTTATTTTATAAGTAATTTTCTACCCTTTTTTAGTCTACGTGGCACTGGTTTGGAAAAAAAAGTC
AACCATCATTGGACCCACAAGATAGTGCCACGTAGGCCGAAAAAGGGTAAAAAATTATTAATAAAATAAGTTCAGGGGGTAATAGGACTTTATTATAGTA
TAAGTGTGTCTCTGAGATTTCGGACATAAATTGAGGGGGTACTTGGACATTATCCCTTATTAGTTTGTTTATCATTTGACAACTGTTCTTAGTATATATA
TATATATATGAATATCAAGAATTAAGTGGAAGGTTATTTAATAGGTATTCGAATATCAACTACTCGCTTGCTACTATCAATTTTGATTTTTTTACATATT
TTCGCAACTTTGTTTATGATATTGTTTGTTGTGACTACTTTTCTTCTTGCCATTATTTTCTATATGACTTTTTTTTTACTGTATTTTTTTTCTTATTGAT
TAGAATATGCTTAGCTTGAGTAGATGGTCTATCAAAAATATGTTATTTATCTTCAATACTCATCGCTATATTGAGATATGTTTGCATATATATATACGCA
CCACCTTTTGCTAGATTCGACTTATAAAAATTTCAATGAATAAGATGGTATATTATTGTTGTTGTTCTGAACAAACTAAAAGCAATCAAACCAAAAATTA
TTTAAAATGATGAAATTATTAATATGAATCTTCAAGATAATTGTTTAAAGTTCTCGGATTTAGAGAGTAAAGAATTTGTTTTTTTCCTTTTTTTCACTAC
TCAAAAGATTTGTACTTCATTCAAGTATTGGATTTCCTGTCTCATGTCAATTAAGAGGAGTCATGGAAAGAACAGGTTCAAAGTCGCGATCAATTCTTTT
TTCAAATCCTGCTGCAGTTGCACAAGCTCTTCCCGCGTGCCACAAATGACCTACAAAGGAGAAGAATCCTAGAACAAAATGAGAGGTAGCTTTCTGCGAT
ACGTTTATGACAATTTTCTCATTATTGTGGGTGACAAACATGATCAATGACGGAACAACGAGAACGAGTTAAAAAGAACTTAGAATTTTAAGTTGGCAAA
GCTTTTGAAAAAAGAATCGCAGACATGACACCTTAGATAAATTCATCAACATTAGAATAGAGAGAGAAGTAATTAAAGAGATAGTTCATATGACTGCGCA
CACACTTTTAAACTCAACAACAATGAAGTCTAAGAAACAAATCTATACAAAATATGTTGAATTAAAACAATTAATGCGTACTATAAACTTGATTTTCATA
TTAGTAAAACAATTTTATTAACTAAGTGGACACAACACTAAGAAACTAAGTGGTTGAACTTTATGGCACAAGCAAATGATTAACATCATCATTATAATGT
AGTAAGATTTCACTAAGATAATCCTAGAAAAGTTATTTTTGAGAACATATATTATAGAGTATAGTATTAATAGTTTGATAATTGTATTGGCATGGGGGTA
AAAAATAAAAATAGGGGGTCCACAAGTGATGATTGAAATTGAAAGGACTTAAAGGCAAAATAAAAGAATGGAATTGGGCGTGCTGCTAAGGGAACATAAG
AATAGTATAAAGTGTAGGGAAGTGAGGAAACATTTTTTGTTTTTGTTCTCTCTTTATTATTCATTTTGTCCCTTTTATATCTATTTTTATGCAATCTTCA
CTTTGGTCATTTTTCTTATTGTGGGCCTTAATAGAAAAAAGCAATGCATGTAACTTACGACAACAACGATAACAATATATTCAGTAAGATTTCATTAAGT
TAAAATTGGAAAGATTAGAATATACTTAGATTTTATCATTATCTGTAGAGATAGAAAAATTGTATTTAAAAGATGTTTGATTCAAGTGCATTAACATCAA
GTAAAAAGGAAAAAAAAAACATATTAAGTAGGCGTTTGGTCATGCGATACCATATCACAATATGGTATCGTGAGATGGAATCAGCGTATGGACATGCAAT
TTTACGCTGATTCCATATCATTAGATGTGATTTCATATTTTCAAAATATCATGATATGGAATCATATGTAAAATACCATATCATGATTTGAGAAATTTTA
ATACAAAAAATTGATCCACAAGTTTATATTTTGTTTAAACAACCCCACATTTATATCTACTAATCATTTACTTCACATATATATAAAATTTATAATCACA
TCATTACTTTTTATAATTTATTATTCTCACCGACATAAAATTTATTATTCTCTCCAACAAATAGTCACTTTAACTCGCACTTCACGATTATTGAGTAGTA
AAATCTTGAAGAGTCCGTGAAAGGTGTTTCATTTTTACTCAAATATATTGATGAAACAATTACTTAAGTTGGAGAACAAATAACTTTAAAATAATTTATT
ATGCAATTTTATAATTTTTTGTTTATTTGATAAGATTGAATAAACAATTGAGACTATTTTAACAGTTTTAGAACTTATGGGAATTTATGTTTTTGAGAAA
ATATACCACATCAAAATTTCATATCGCACGTCCAAACAAAACTTCAAATTCATCTCATGATTGCATATCATGATTCCGTATCATTGATACCATATCACAT
GGCCAAAAGGACCCTAATTAATAAGAAAAACATTGTAGAGACTACAACCGAGAAACAATAAAAAGAGCAATAAAATAAATAGTGTAATACTCAAAACACA
ATAAATAACGTATGACAAGAAATACAAAGGTGCGACTAGTACGAAGATATGTAGTAATAAGTCTAAACCGTTGCAAGACAAAACAACACTTTACCTTTAC
TTATAACTTATTGACATAATATACGACATTTACTCCATCATATATAGAGTCACGTCCTTGGTAATTTGAAGTCATACAATGTCCTGTCTAATTATATTTT
CTCAATACTTTTACCCTACTTCTACCTCTCGACGTATCCCCTGTAGCCAACTTTTCACACCTCCCCTCCTTTGATTATTTAGAATGAGAAGATGGAAATG
GAAAATGAAAAATGTATCAAACCAAAGTCATACTACTACTGGTTTTCATCAAGGGAATATTTGTTTGGACTGAAGAAATTCTAAGCTTTGGGCCAAGGCC
CATTCTGAAAAATGTATTATGATTTGTATATTTTACATGAGAATAAATGGGAGTCAAATTCAACAAGTCATGCATGATCCAATTCGATCTTTTTTAGCCT
ATTTGAGCCTAACTCATTTTAGCCGATAATAAATATGGATGGATCATAACCCAACTTAAATTTTAGTTCAAATCTTTTTTAATTTCTTCAATTTCAGTTC
AACTAGGCACTAGCCCATTTAAGACTTCTAATGAGATGATCCCTTAAATTTATGGAATTTTTTGAAAACTATATATATAATATTTTGCTATAATTTAAAA
ATAAAATAGTAACTTTCGTCTTACTAAATAAGTTAAATCTATCAATCTCAATTTATGTGGCATACTTATTTTCATGCTTTGATCGACAAGAAAATATCAT
TGATTTAGATTATTTTTTTTTTTAAAAAAAATAAAAAATTCTTAAAGAATCTCATAGACAAATTTGAATTTAAATAGTACAAGCCCAATAAACCCTCAAA
CCCAAGCCCAACAAACCCTTACCCACTCGATCCAAAGTTCCAAACCCAATAACCCATCAACTTTTGAAAAGCTAAGTTGGATTGTTGGATCTTCACAATG
GCCCAAGAATATAGATGATGTTTTTTTGGGACCATCATTTAAATTATATCGTATCGTGTAGAAAAAATAAAAATTTACCCACGTTAGAATAACTTCAAAC
GTATGGTGCCTAGAATTTTCATAGGATTGAAGTACATACACATATGACTAAAGAAAGTCATTTTTAATGAACTTTAGGCACGTATGACTAAGCTTCAACT
GTTTTTTCAAGACGTTCTTGCACATATCACTGAAGTTCAAAAATTCTCGTGATTTATAAACTTTGGCTTGTTGTTTACTCAAAAAATCTCATAATAAGAT
AATGTAATTTTGGTGGATGCAAGTACATTGCATTCATGCCATATTACCTAATGATTAATCAAGAGAAATGAAAATAGAAACAAATTTCATAGGGGAATCA
AATAATCCATTGGTTATTTGGTTTGTTATAAGTAACACCCCATATTCTTTAATGGACCCCCAAAATATTTAATGTTTATAATGGGACCATCCACAAAATC
CAGATGAAAATGAAAGCTCAAAAAGCAAAATAATACTCTTCTACTTTATTAAAATTAATAAAATAAATGATAGCATGCATGAGTCACTATCAATGAATTT
AGAAATTATTATATATGGAGAAATTCAAGTTTATGTTAGAATATTATATTTCGTTTTTGTAATTCGAAACAAAGAAATTTCTTATTAACCACATTTTTGT
CACTTTACAAGAATTCTTTAGTATGTCAAGGAATTCAACATTATGTATTAAATAAACATAACCTACTTGTGTAAGATATATAATTTTTTGACGAAGACGA
TTTAATTGAACTCCTTAATTGTATTTGCCGAATTCCTCCATGCTTGTTGTCACACTCACTAGTAACTAAAAAGTATGATTTACTGATCAGTGAAAATCAT
GCAAGATCGAGATTCATATTACAAACATAAACATAAACAGTAGATGATTTCTCCTATCTGCATACATTCTTTTGTGAACAAAGGTTGATAGTATAATTTT
TCAATTAAAAATCGATGTTCATATTCAGATGAACCCCTTTTACTATCTCAACCCTCTAATTTAGTCTCTCAACTCCCAATTGGTGGTCTCAGATAATAAA
TAGGTATTCGTTGAAATAATCGAAACAGATAGAGTATAGTGTAACCACTATATTATTTTTTTTTATAAATAAACAAATGATACATGAGTCTAAAAAGGAA
GGGAAAAAAATACTTATAGTACTAAATTTTATTATTTGTGGTTTGGTAAATGGTGCATCTTCCTCCCATGTGAGGGTTTAAATTTTTTAAATTTTTATTA
TAATAAGTAAAATATGCATTAAAAAATAAATATAAAAAAATTAAAACGAGAATTCCCGTTTAATACGGACTCCTAACATGCTTCCATGCTATTTTTTAAT
TTTTCTCTCCCTCTCAATAATTAAAGAATCAAAAATAGCCCATATCTTTTTAATTTCTTCATAACTTTAATTAATTAATTAATTTAACTAATAGTATTTG
ATTTTTTTTTAAAAAAAATTATTTTTAAATTATAGGGTAATCATAAGAAGTTGAATTATTAATTTGTAGACTAGTAGTTAAGCCACTTTTGGAATCTTTA
TTTGGTTTATTACAAGTTTGATATATAATTTTGACCCATTCCACACAACACTTGTTACTTCTGACACTATCGTAATGAACTAGAGATCTTTAAGATCTTT
GCAGATATGTGAATTATGGCATTTTTCAATTTTATAATAAGGTTTCTTGTTTAAATAATAATGAGAAAATTGATTAGTATCTTCGATAGATGTGATCTGC
AAATAATTTTATTGGTAATTACTAATGTTGTAACAATAAATGGTAGCTTTGGTTTTCGCAATTTTTTTGTTTTTTTTTGTGTGTGTACACAATTTGTATT
ATGATTTCATTCGTTGAATTTCTAGTTTCTAATTTAGGAACCGTCAATAGGAAAATTATATTATTTGGTAGTATAGTAAAATCAACGATAATAATAAAGT
ATTAATGTAATTTTGCGAGTAAAATATGAGAAAAGAGAGATGTATGAAATTTTATTCCTACTTCAGAAAGGTAAAAAATTGATTTTTGATCAATCTCAGC
TCAATGTAAAACATAAAAAATAGATATATAAAAGTAAGTATGATAATGAAGAATTCATATCGAAAACAATGAATGAAAATTGTCAAGAAGTATAAAATAA
CAAAATGTGACACTTGATGCTACTATCTTAACAATGTACGTATGGATGAAATGTAATTTATTAATATGAGTTGGGTATAGTGGGGGAAACTGCTTTATTC
TTAATCAAAAGTCTTAGTTTGAAGTCTTGGTTATGAAGATATCATATTGGAAGCGTCATCTTCAAATGGATCAGCGCACAACCAGAATCTAATCGGGACT
CTCACACGAACTCAGAAAACAAGGAAAACCTAATAAAATGTATATGTCTAGGTTAATGGATTTCACCCCGCCCAACATGATCAATAGTATTTTTACTTAT
TCTTATGTGTGACTCAAACACTTTTATTGATCAATGATAGAGATAGTCAACCACTTGAATAAGTCTCACTTGTAAATGAATTTTCTTCAACTTAAATCTT
TTTTTTTATCGTTAAGAAATTAAGATGTAATATTTTCTCCATTATTTGATTAATAGAAAAATAACTCGAAATTAATTTAATTTATACAAACTAAGATGGA
AATCTCTTAGCTCTATATACAATTAAGCTAGCAATTAAATTATACATTATGATAATTAGCCACTATTAAATATTATATCTTCAAAGGAAACTATACATAT
TTGGTGAATCGATCAATCATTTTCAATCATTTGAATCCCTTTAAAAGAATTAGAAATATTAAAAATGATTGAAGTTTGAAAATAATTAAAGTCTTAGTAA
CATCCAACCCACCAAGCTTGTTGGTTAGTAATTAAATAATTTAATGATCACTAGTGTCACAATAAAAGTCGTTTAGTTGCATCATTATGCCCCTTAATCA
CGTAAATGAGTCGCTGAAACCCATTTTATATTGTTAATTACCAACTGTATTACTCCATTTAATTTATTGTTGCATGCAACTTTTTCCTCTTTTCTTTTTA
GAGAAACAAAAAGTTGACACAAAAGTAAATAATTATAGACAACAAATAAAATTCATATTTAATCTATTATAGTTCTTTTGGTATATTTTAATTATTGTGT
TTACTAAAAATAACTGATTCAAAAATAGTTATATTTTTTAAAAATCAATATCCAAAAATAACTAAAGTACTCAAGGTTGATTGTTGTTCAGGTCATTATA
AGTGTGTTCCAAGCTATATAAACATTTATTTCTACTCGATACAGAACAAATTTGATTATGTTGAGGTTATACCATTTCAAGTCAGCCTCAGTATTGCAAT
CCCCAAAATTTCTCTAAATAGAAAAAAAAATAACGTCAATCACATGTCATAATCTGATTCATTCATTTGTCATTCTCAGATATCGCCCAAAATAAATATT
ATTTAAAAATAGATTTGTTTATAAATAATTAACTTTCGAGTACTTATTACAATTTGAAATATTTTTTTTAAAATTTTAATAGGTTCAATGAAAGGCCGAA
TGTAGATTCATAGAATGTAACTACAAGATTCAATCAAATTCAGAACCTATATATATGTTACATTTCTAAAAATATAAACACATCAAACTCTAACAAATAA
TTTATGATAGAATTATTCGCGTCTAATTTAGGTCTCGAAGAACAAAAGGTATGGTAATGGACGTGTACGCAAATGAATGCTGTGGGCTGCGCAACATGCT
CTATAATATGGGAACTAAATAAATAAAATACTCAAATATATATAAAGCAAATATCACATACGTCTATATGGGAACTCAATATTATAATTAATTTCTTGGG
AACAAGCAACTTTAATTATTTACACAACACAAATATATAATATATAGTTCAAGCTAAGCAATTATTATGTATGTGTTGTTGTAGAAATTTCAATATTATT
TGGCATGTTGCTAAAATTGGAAATGTTACATCAAAATGACAATGAATTTTTAAGCCTGGTTTTACATTCCAATGTGCAAAAACAGGAAGGATTATATAAT
AAAGATAAGTTAAGATAATGTACTAATTTTTGCAATTTGCCAATTTGCATATATATATCTTACTTACGTACATCATGTGAATATGATAATTTTTTTTGAC
ATATCATAATTTATATCCAGCTAATAACTTTAAATTGAGGGCATGATTTTAATTTATTTTTTTCATTTACGTACAACATGTGTCCTTACCCTTTCAACAT
GGAATACTTCAATGTACTACAAAAATAAAAATTTATCGCACAGAGTCTATTAAGTAGGGTTCAAATTCAAAACCTCTAATTAAGTGTGGAACAATTTCTA
TCTTTTTAAGAATATTATATACCCTATACGTAGAGAGCATACAGGAAGGGTTCTGTTAGCATCTACGATCCTAGATTAGATGTTAATGATCATGTTATGA
CTTATGACCATTCTCTTATACCAACGTTTTAAAAATTAAAATATTTATGTTCAACACACAAACATATATAGGTATATTATTAGTTCCATTTTGGAAGAAA
ATAACTTTGTCTAAGTAATTATCTTGAATTAAATTCCTCAAATAATATAATGAACTCAATGATTTTTAGAATGAACGAGTGGTTAATTCCTACGAATTCT
TCTAGAATACATCAAGAATAATTAACAAAAAAATATATTATACGTATTCATTTCATATATTTAGAGTAATTAGGTGTATATACGCTCACATATAACCAAG
AATCATACGAGAAAAATTAAGGTACGTGTAGGATTCATTTTTTTTCTATCTCTCGCTCATAAAACTACATTGGATATATTGTTATACATAAAAAAAAAAA
GTAAATACGACATGTATCCAAGGGTATGACCTAGTAGTCAATAAAGTGATTAAAAATCTTAATATTTCATATTCAAAACTCAACGATCCAAATGTACGAA
AGTTATCATAAAAATAAAATAACATACATAGGTCAAAATAATTACAATAGTTCCTCGATCGATTTCAAACCACACATATATAATATTACACGTCTTTGAA
GTCTCTGAACGTCCAAAATTTCAGTCAGAATTCCAGTTCACCTTAACCATTATTGTCAATAAATTTCTAATATGCTAGCTCTATATCGAAATTTTTGTCT
CGATTCATATGACACAATTAAAATTTTAAAAATCACTAAAATTTATTTTTTGTTATATTTTTTTACAATTTTTATTTTATGCAGCTTATGAATAAATATA
TTTTATTTTAAAATTTAAAATTTTCATGTCAAAATTTAAAAATTTGTATATCGAAATTTGTAACGTGATAATATTGTCTGCAGCGATATATTTGATCATG
ATATACCAAACTTTATTAGCCTATAGATAGATTCTCATCTCACCGTCCAAAATTATTAGGGGCTCTAGACGTGGCCTCTTTATAAAACAGGCTTTTCAAA
GCTTTCGGCTTTATCGCGATTGTAATACGATGGTAAAATTATTTCATTTTTAACTAAAGATTTTGGATGTGACTTGAATATGGAGAATATCTTATCAAGA
ACATCATTCTCGAATAGATATATAATGTGTGATTTGAATTTAATCGAGACTTCAGTGTAAATTTCAAACATAATCTGAGATTTTTCGATCAATTAATTTA
AAAGAAAAGTATAATTGGACTTTAATATAATTTCCATCGATTTAACTATCTGTAAAAAAATATTACCGATCTTAATTTGAATCTCGATAATTTTTCAAAA
ACAACTTCTCACTTTACTTATAAAAATAGACCTAATGTATATGTTGAGTTCTTAATTATTGTATATGTTTTAATACTATATATTCTACAAATTATCTTAT
CAAAGCTT