BAC Sequence – LE_HBa0099H05

>C06HBa0099H05.1
CGAATATTGTAAACAAATTTAGGAATAATGTTTACCTGACGAACAAATCCTTCAAGATTGGAGAGTTTCCCCAATGCAAGAGCCATATGATGCATTCCAT
CATGGAGAGAAGCAGTGGCAATGGTATCAATTAAAGATTGTTGTAGTTGTTCTAGTCCCTGTGAAAGAGCTTCCTCTGCCTGTTGGGAAGATTGTTGGAG
GCTGTATATTCCAACTACTTGTTGCTCTGTTAAAGGGTCTAATTGTCCTATCAACATCTGTTCAATTTCACAAATGATCATAGTATGATTAGAAACAACA
AAAACAGTAAATTTGATCTCATTCGAACTTTGACATGGACATATTGTAGTTTTACTAGAAGAAAGATCATCTAAAATATAATTATAATTACTTTACAGAC
AATTTGCTGTAACAGGTTAAATTATATGATATGCCACCACCTCGACCATGTTTTTCCTTTAAAAGGACAATCTTTATTCGTCATATCTTTATGAAAAACA
TATTTACTTCGGACATAACAATATACAACTTTCTTTTTTTTGCTTTTTCATGAAAATTATCCAACAATAGGTCAGAAAATCAGTCCTAAATTGCAACATT
TACCTTGATAAGCTCAGAGGGCCTAAAACCACCCATCCAAAGGAAGCAGCGTTCAGCTGGAGTTGTCCACGTTCCAGTGATTAGGTGAAATACATCAGAT
TTTGCTGCCACACCCTTTAGGCTGAAAATTTCGTCGTAATGAGCAAGGTATCCATCAACTATTAATCTAAGATCACCATCTGATAAATGTGCTTGTAATG
CAGTTCGAAGCTCGGCTATGTGCCTATGATCATCATCCAACCACCTTGAATATTCCATATCAAATATTGCAGCACCTGCAGCAAAAAATTGAACAATGCA
TTTTTGTCAATTGTTTTTATTAAGGCTCTAATATTAGCAAATGCATGGTGTTGACATTCAAACAGTGTTTTTATTTTTATGAAGTAGTAAAAAAGTAATA
TCCTTTTAACTCTTATTTTAGTAATACTAATAGAATATGTAAATTAAATTTAAATCTCTAAAGATTGTATTCAGTCAAATACAATTTCAACCCATATACA
CTGGAGTACTCTGATTTTCTACATAATGTCACACAAAGGAGTACAAAAGAAAAAGACAAATTTTCTGTAGTCAAACTCAAGTTGTTTGTCTGCTACTAGA
AGCCAATAAGAATTATAATGCAACAAATTCTGGGTGCTGCCTGTATAGTCAAAACTCTGAACTATAATGAGTTAAAATGTACTGATAGGTAAAAATTTAA
TTACATTGGTAATGTATACAGTAGTATAAGTTGAATTTATATTCTTGGTTGTCCATAAGCAATGCATTGGTTGAGAAAATAAAAAGAGAAGTCCGGTGCA
CTAAACTCACGCTATGTGCGGGTTCGGGGAAAGGTTGGACCCAAAAGGTCTATTGTACACAGCCTAACCTTGCATTTCTGCAAGAGACTATTTCCATAGC
TTGAACCCGTGGTCACATAACAACAACTTTACCCGCTACAATAATAGTCCAAACTTACCAGAGCTGATATTGGAACCAGCAGCAGTACCACCTCCCAAGA
AAATCCCCTGTTTGCCACAACAAGCAGTAGAAAAAATCATTAAATAACCACTGCATTCATTATTCTACAAAAAAAAAAAGGGTGCAAGTCATTTTCAAAT
ATGACCAACCTGAGAGCTAGCCCTTTGAAGTTCTTGTTCTAGCTGAGAAAGTCTTATCCTACTTGTTTCTAGCTGTTGTACATAAGCCTGCATAAATGCA
AATAATAATAATGAGAATGGAAAAATGTAAAGAATATTGATAGAGGAATTTGGCATATAAATGACTTTGATAATGGAAACAAGAAAAACATTACCTTTTT
TCTTATCCTGCTTTTCTTTGCTGCTTCTCTATTTTGAGCTAAACGTCTCAATGTCTACAATAAACAAAGTAGAAAGAAATAGTACTGTTTAATAATTTTA
AAAGTTCCAATTAGGAAACAAGATAATTTAATTGTATATTCTTGGCAAAGCGAATATGTGTGGGCACCCCCACCTTAGGATCAAGTACCCTCTCTGAGGT
TGAAGCAGCACCTTTTTTCTACAAAAAATATATATTAAAACAAAAGCTAGTTATATATACTAATGTTGTTTAATTATGTAGAAATATTCAAGAAGAGAAT
ACTTCAATTGCGTGAAGATAAATATTCGTTAAGCAATTAAAAAAAGTAGTATAGCGTGTCAAATAATGCAGATTCTTTTTTTAAGACTTTAAGATTTTTG
GACAGAATCAAAGTTGTATATTTTCAAACACTACTACTGGTGTGCAAGCATTTAAGAATAAAACATCTGATGATGTATACATGAGCTAATTCATTGAATC
ATCTGGTATTCTTGTGAATTTATTTTTTCTGGTTTCAAGAAAGATTTAAAAACCTGAAGAACAAGGAGTTAACTACAGTTCTAGGGATAAGTGAAAATAT
TATAAACTGGAGCTTAAACTACAGTAATGAATAGTGCATAAGGAGGTAAAAAGTATAAAAAGCACTGTAAAGATTCTCTTTTCATTTCACTTCTGATCTC
AGAGAATCCTTCAGAAAACTGTGTCTTAAGTGTATTCATTAGCAGTTGTTGGGATTTGTGATTGTGTCTATACAATAAAGATTCCACCTTTTTTCCTGAG
ATCTTGGGATATGATAATAGAAGAGGAAATAAAGTTTTGTGAGAAAAACCTTTTCACTGTTGGACTTGGAAGATAGTTCAGTTTGTAAAACTCCTGTTCT
TGGATTATTATTACTTGCCATATCTTGAAGCTGTTGCTGTTCTTGAGATTTGTGTGTTATCTGAAGTTGATGGTCTGAAGATGCTTTTCTACTGATGGGA
GATTCTGGCTCAAAATGGGGTTGAGCTCTACTTGAAAGTGAACCTGAATCAGTACTTTCTTCTCTTGATTTTGAGTTTTCCTATATGTAAAAAGACAAAG
CCAAGAAAACAGATTTAAATGGTGTGCAAAATTATCTTAACCTTCATTATATAAAAGTTTCCAAGAGGGGTTTGCCTATTTTGAGTAAAAGTCCAAGCTT
GTATTGCACAAAGGACAATTTTAAAACAACATGGTCAAAGAAGGATAAGCATAAAAAGGAAAAAATAAATTAAGTACTCTTGGGGTCTGTTGGTATCTCA
TAGGCCAAGAAGGGAACATCTCCAAAGTTGCAGCAGGCTTCCCTGTGGCTGCTGCTGCATATAAAGCTGTACAGAATCACAAAAGCAAAATCTTCAAGGA
TCAGCATAAAAAAAAAGAACATAAGAAAGAGAAAAAAAACTTTCAAAACATCATAAAGGGAAGAACCTAATCTCCTCTTTTTCTTTTCTTTTTTTTTCCT
TTTTAGCTGCAGTTATGAAGTCAGTAAATCATGCAAGGGTTCATGTTTCCTTGTTTGAAACCCCACGCCATTCAAGTCTTTTGCACAAGAATGATTACAA
TATTGGAAATAGTAAGCCTCTTAATGAACCTTTCTATGGACTTATTCAAACACCCTTTGCTTCTTTGCTTTACAGTAATGAGTTGGTTATACATTGCAAA
CGTCAGAAAGAAAAAAAAAAACCATACATGCTTTAGCTTCATCATTACTCATCTTAAATCCTTGCAGTACAAAAGCTTCTTCTAGCTCTCCAAAATCAAA
ACCAGCTCCTTCTTGATTACCACTACAACACAAAATATGTTAAAAGCTGAAATTAAATGTATTTTTAAACCAAAACATAAGGGGAAAAAAAACAGGATTT
TTAATTACTTGGGAGTAGAATGATACATGAAGCTTGTGCTAGCAGGATTTAACCCCCTATAAACAGCATATGGCATATTGTGATTATGGTGTGATGATCC
AGAATCTGTCAAACCAGTTTCTCCAATTCCTTGACTCGCCATGCAAAAAACCAACCTTTTCAGACCATTCTTGAACTTCTCAAAGAAAAAACAAGAAAAA
GATGTAAGCTTTGAAGTAAAAGTAAAACCAAAGAAAGATGCTAGTTAAATTTTTCACCTTAGTTTCTAATGAAATGATCTTCTCAAAGAACCAAATGAGA
ATTAGACAGTAAAGATCAAAACTTTCTTGTCAAAGTATATATGTGTCACACACACAGAGACATATATACAAACAGCTAGGGTCCAGTTTGTTGATCTTTT
ATTGGTCTTTCTTTCTCCTCCTCTAAGAAGAAAATAATTAGTCTTTATACTAGTTGTGTTTTTTGTTTTTGGAAGGGTGGGTTTTATTACTTTATCTCCC
TCATCCTGTTGTAATCAATTATAATGATTATGAAATTTGAAACTCATCTTATGGTACAGAAAATCTTGTCCTTTGCAGACCTGTTCTCTCAGGGCTATTT
GTGGGGTTTGAAAACACACAAAACAATTTTTTTTATTCATCAAGAGAAAAGGACATGGGGTCACTAAATCAGTCTCCTACTCCACTCTCTCTCTCCTTAA
CCGCCTGTTGTTCCTCATTGGCCCTTTTCTTGAGCCATTTCAGAGTTGTAAGTACTAATACACAGACCACCAAACTTGTGATGAGATTAAAAAGTACTAC
TACCCTTGTGATGGTTTCATTTGTAATTTTGGCAGTGTTCGAGTTAATTTGTGTATGTTTGATTATTTTATTGGATATCTAATGTTTTGTTTTAATATGA
AATTGAATAACTTTGTTTCTTAAAGTTTAAGCAGTTAAAAAGAAATGATACACTTTATTTATTTAAAATCATGTGAAAGTATTTGAGTGAAAATTAAATT
TAAGAGAAAAATATAATTTCCAAAGTGTGTAGAGAAGCAAAGAATTATATGTAACTATAGATTATTTTTTCGAAGAGTAAATTAAAAGTCTGAATTTAAA
TCATTTACTTATATAAAGAAAATGTTATGTTTTTGAAAGATGAATCGAAGATAAAAGGATATTACGTGAATTGGAATGTAAGGAATAGTATTTTGTTTCT
ACAAGAATTTATATATACTAACATGTTGACTGCCAAATAATTTTTTTATCGACTTATGAATAAAATGAATTCGAAAAGAGTAGAGTTTACCTGAAATATG
TTTACGATGTTTGAATTAAAATGTGATTAGTTCTTATTTCCGTAAAAAACCAAAAAAAAAAAGTGAGAGTAATAAATAGATTAAAGTTATTGCAAAATAC
GTTTTACGTGAAATATACTTAAATTCTTATAATATTTGCACTAATAAACAATTTTTTTTTTAAGTTACAAAAATTAAAAGTTTACAAATCACTTCACTTA
ACGATATTTAAATGTTTCATTATTTATTTATTATAGATATGTCATGTATTCATGACTTAATATAAACTTAGTGTGCAAATAAATAATTTGTTTTTCTTTT
TATTTTGGAAGTCACTCATTTACACACCTAGTTAATAGAAAATGAATTTCAAAGTTTTAGGTTGTAGCCTATCAACCAAAACTTTTTATATAATGCCCAC
TACAACTTGTGTTCATAATTAACTAATCAAGCCTTTGAAATGGCTTTGTTTGGTATTATCCCCTTCATTGATAGGTCAACATCCAATCCTTCTCTCGTAA
GGGCGTTGAGACCATAGCATGTTACACGAAAGCGCCGCTTTCTCTGTAGTGTTGTCACACAGCTGCCCGCCTAGAAGAGCAACTCGCTCTGTAGTGTTGT
CACACAAGATAAGCACGCCGCCCGCCTGCTGGCCGGGCGAATCGAAGTTATCTTCCGGTCAACTGTCCATCATCACCTAAAACAAGAACACACCAAAAAT
TCTATTAAAAAAAAATGTTTCTTTGTGTCCCTTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGCTTATGCATTCTGTAAAACAAAAGAACATAACAATAATAATAAAGTTTATCAAAAACTAGAA
CGCTAAAAACTCAAAAGAAACGTTAGTCTAAAAACGTAAAACAAAACAAAGTTCTTGACCGGATTGTGCTTGAAGTTTCGGTGGTGAGGCTTGGTTTCGT
GGGAAGTTGGCAACATTTAAACAAGTGTGGAACGACATTAAGGTATGAGTTTTCATACTCTTGGTCCCTTTCCCAAGAGACCCTTAAGACTCAATAATTC
TATTCCGAAACTAGGATTGTTCCCCATTACATATTCACTATCACTAACTCCTATCGCTGATCTTAGGTTTGTATGTTTGCTGGTAGATTAGGTATGAGGT
GTGATTTTTGTGATAATGTGTTCATGATTGTATAAAGGATGAAGTATGTCTGCCAAAATTTTGTGAAAAATGTATCTGTATGCCGTGACATGATTTTCGG
TTTTAAGCCTTAAAAATGATATGTTTTTTTGGTTGATTTTTATGTGTGAATGTTTGTGTAAATTATGAGGCGTAAAAGTGGTGCAATGTTGCTGGATTTG
ATGGTAATTCTTGGCTGAATATAAGTCTTAAAAAGATTACACTTAAAGATGCACCAAATGATCCACGAAATGCCTAAAGAATTAACGTATGAATGATGAT
AAAAAGAAGCTGAAAATAGTGAACAAATTTCCAGCATTTGGTAGGTTGGGTTTTGGCCAAACAAAGTGGTACAAAATACAATGAAAAATGAATGTAAAAT
AAGTGACATAACTAAGGATTGAACCCACGACATCATTACATGAAATCTACAAAAAAAATCAACAAAAGATAGAGAAAAATCGGTTGGAAGAGAACAAATT
TCCAGCTTGTTGGATATTTGAAGTCTCGGCCAAGGATGAGGAAAACTAGCTATGTTTTTTATTTTTTTTAAATGTGAGGTTATTGGGGATTGAACCCATG
ACCTCACCAAATGAAAATTACATAAAAATTTAATGAGAAATTTGAAAGGAAAAATAGATGTGGTGAGTGGGGATTGAACCCACAACCTCTTGAATGGATG
AGAGAGTTAGGAGAAAAATAAAGGAGAAAATAAAATGTGGAGAGTTGGGATTGAACCCACAAACTCTTGAATGGATGAAAGAGTTAGGAGAAAATAAAAT
GTGGAAAGTGGGGATTGAACCCACAACCTCTTGAATCGATGAGAGACTTTGGAGAAAAATAAAGGAGGATGTGGAGAGTGGGGATTGAACCAACAACCTC
TTGGATAGGTGAAAAAGTTGAGAGATAGGTTAAAAGAAAAATAATGATCTGGTGGGGGATTGGACCCACAACCTCCTTGCCTTAAAACGAAAAAGGAGAG
GAGAACAAGAAAGAAATATTATGGGTTGATAAGAATCGAACTAGGATCTCCCGAATTTGAAAAATGCAATTATCAAGTTTAAAATAAGATTAACTGTTGT
TCAAGGGATTCGAAATTCGGTTTCCTTGCCCTATTTAGTATTGACAAATAAGTCATACGTAAGCAAATATTTAATGAATGCTGCCTCTAAAGATCAAAAT
CAATATATTGACATATCTACAAGATGCATAAGTCTTGTACCACATAATCTTGGGTAAACATGAATGACTTAGACAAACTATGAATGAAGCATCATGGCTT
GTATGTGTGGACTCATAAGTCTATCATACATTTAAAAGTAAGTGAGTCTAAGATGTATGTGATAAAATAATGTAACCCTATAAAGGTTAAGTAAGAGTGT
GAAACACACTAAATGGCCAAGTGCATTCGCATATGATGAAATGAACATTCATGTGAAGGGGTGAGTAATTATGAAAATCAAATGTGTTAAATTTATTTAA
TTAGGTGACAATATGATAAGAGGCTAATGTAAAAGATGAGAGCAATCTCAAATGAGTCTACGTAAATGTTATCAAAACGTACTCACCTATGAGAGTGTAA
AGCTAATGAAGAGACCAGTCTCTATGAACACTTAAATGAAAGTATTAAAGTTAATGCATACTTAATACTTATGATCAGATGAGATGAGAAATCATCTAAT
GAGCTATGATGTACTAATGCTAGAACCCATCTTCCATGATATATGAGTTGAATGTAATTGAACTTTATATTGAGCACCGATAGGCTAGCTATGAGCAGTT
ATTCCTTCCTTCAAAAAGGGCGGAGGTTCACGTAACTCTAATAAGATGAGACTGTCCCGCATGCCGGGTATGGGTCTCCTTATATCTCCTAGTCTTTGAA
CCTATATTGCCAATATAGGGATCTAGCAGGGTTCAATTCTCTATATACGGTATCATGTTTTGGTTCACTTTGGATAGTGATTCCACCTCTTTTTTGTGTG
GGGATTACACATTGGATTTCATGATGCTCACATGATCTATGTGAGTCAAGGTTAAAGTTCCCAAAGAAAGAATGAAGCCAACCTCAACGAATGCACATAA
TGAAATGAACGATACCAAATGTGTTACAATAGGATGATCAAGAGGTGAGCTAGACTTAAGTAATAACATTAGGTTATTCTTGGTCATTGCACAGCGAATA
CGATGAGAGTCTTAAACTACATGCTAGGTATGACTGGTGGCTGCACTAGTATATGAAAGAATGGAAATGAAGTACGTATGAATGAATGAAGCAGACTCTG
TGTTTGTTAAAGAAGGCTCCCTAGTTGAGGTCCCATATGTTGAGCCCTCATTTTGGGAAGTCCTAATGTCAAGTACATGATTCCAAGGTCTCATGGTATA
TGACAGAATGATATGAACTATGTGATATGATATGTGTAATATGTTACGTGCTGTTTGCAAAATGATAAGTATGATGATGCATGTTACTCTCGTGGCATGA
CTTTCCTAATCCAAAATTGGCAAATCCACTGACTTGACTTTCCATAATTCATATCGATAGGAAAAAGCTTTTCTTAATCATGTGATACCTTGGTGTGTTC
TTGCATATACCCATACTTAGTACAACTGTGTACTAATCCCATACAACTCTACATTTTTAGGTGCAGGCACATGTGGACGTTATAGCTTACAAGTCAACGC
TGAAGCTATCCGGACGTGGAACATTCATTCGGATTTGGTAGACCATCATGATTTCGAGGACGCTTGAACATTATATTCTATCTTAGATAAAGGTTTGAGT
TAGTGGTGTATGTTCCACTAGAGTTTCTTTCTCATTTTATTTTAGACATTGTATTGGTGCCATTTTGGCAAGTATACACTTAAATACAATATGAGACTAT
TTCTTTCATTTGATGATCTAAATATTAGATGGTTGATTTTGAACATTTATTAGTTTAAGTATAATGTCTTATATGAATGTTATGTAACAAAAAGTTCAAA
TTTTCCGCTAAAATTAACCTAGATGAAGTAACGACGAGTATGCAGGCTTATTTGCGACCTCGGAGAGGTCAACGACGCCAGTCTCATCTCGGGTCTAGAT
TCCGGTCATGACACCCTAATTCCCTTGAACCTTATATTCAATGGTGTTCTTTGGCGAAAGAGATAAAGTAAAGAGAAGATAGAGATATTTGAGTTTGGGA
ATTGCGGGGTGTTGGGTTAGTTTAATTAGGTTTATGTCTTATATAGGCCTTTAACTAACTTAATTAGACACCCATTAACCCTTAATTAATTAACTAATCA
ACTAACTAATTAATTCCCTCAACTTAAAATTAGACAGTCCAACACAAACCCAACCTACGAGACCTCGACTTACGCTCCGTAGTTCCATCGACGCCACCGT
ACTAGCAAGGCGTCAATTGCGACAGAGACTGTGATTTTTTGGTATTTCTATGGAAAATTCTAAGTGTTGTCCAGCGACTACAATTGACGGCTCGTCAATT
GGATGTAATACTATATTAACACCTTTATACCAATTTTCATTAATTTTCGACATTTAAAACCCATGAAACATGTCAAGGCACACTAGTGTATATTTCACAA
TTCACCAGACGTAATGGACGTTTCTTGACGTTTTGGCTCTAACACTTTCTAAAATTTTCAAATAAATTATATTAGGCCTATAAATAGTGTTCTATGTCTT
AGTTCTTCATGTGAGACTCTAGATTAGGTATTGAACTTCCGGTGTGTTACATTATCCGCCCTTAGGAACATTCGTCCCCGCACCGAATGACACTAAATCT
TTTTATAGGGAGAGGATGACTCAAGACTAGCAACCCAACCAACAAAATCATATAACAACGAGTAACCAACTTAAATCAACATATCGACATGACATTTTCA
CATAGAAACTCAAATCAAAATTTACCACATATAATTGTTAAACATCACAACTTGAAGAATTTTTTTCTCAATATCAACATGAGGTCAACATGATCATCAA
GTCAGTTATTCCAAAACATCTTTCATAACAAACTCAATAACATTTCATGAACGGAAAAATACACAAAACATAAATAATTGCAATTTAAGCAAAATAGCAT
TTTCACCAGCAAACTCATTTTAGTATGAACACTTTTTCTTAAAAATCATAATTATGCCTATCTTAGCAAAACAAGACAAATCAAATTTGTTAATTATTTT
TAAGAGGATTATTACTAACCTCAACTTTGGCTAGAATTTTGAGGAAAAAGAGGAGGATAACGAGACTTCATGTCGGCCTTGGCCTCCCATGTTGCTGCCT
TAACTAGGTGGTTTCTCCATAGGACTTTTACAGAGGCCACCTCTTTGTTCCTCTACTTCTGTACTTAGCGATCTAGAATTTCCATCGGAACCTCTTCATA
GGAAAGACTCTCATCCATACCTAACCCTTCAATAGGATAAATAGATACGGGATCACCAATACACTTCTTTAGCATAGAGACATGAAATACCGGATAAATC
GAAGATAGTTCACTAGGTAGTCTCAACTCATATGCAACTTTTTCGACCCGTTGCAAAACCTCATTGGGACCCACATATTGTTGACTTAACTTCCCATTTT
TGCCAAATCTTATCGCCCCTTTCATAGGTAAAATATTCAAATACACCATATCACCCACTTCAAATTGAAGATCTCTTCTTTTATGATCGCATAGGATTTT
TGCCGACTATAGGCTATTTTCAACCTATCCCTTATCACTCAAACTTTCTCCATAGCGTCATAGATTATTTCGGGACCAAGGAGTGAAGACTTACCAACTT
CAAACCACCTAATTGGAAACCTACATCGGCTACCGTAGAGTGCTTCAAAAGGTGCCATGGAAAACTTGAATGATAGCTATTATTATAGGAGAATTTAATC
AACGATAGGGGATTGTCTAGTTACCTTTGAAATATATCACACATGCTTTTAACATGTATTCTAGGGTTTGAATAGTATGCTCTGATTGACCATCCATTTG
AGGATGCAAAGCGGTGCTAAGGTTCACTTGAGTACCCAACCCTTTTTGAAAAGATCTCCAAAAATGAGAAGTGAATTGTGCACCTCTATTCGATATAATG
GACAAACGGATCCCATGATGACTCACAATCTCATCAATGTAGATCCTTGCACAATCCTCCATATGTAGACTTAACAGGGATGAAGTGAGTAGATTTTGTG
AATCTATCCACTATAACCAAAATTTGAGTCATTTTGCCTTCGGGTTCGAGGCAACCCAACAAAGTCCATGTTAATATCTTCTCACTTCCAAGTAGGGACA
CCCATTTTTGGATTATACCACTAGGATTTAGATGCTCGGATTTTACTTGTTGGCAATTTGTACACATGGATACAAACTCCTCTATGTCCCTTTTCAAGCA
ATTCCACCAATATACCTCTCTAAGGTCACAATACATTTTTGTGGCACCCGAATGAATAGAATTTTGGGAACCATGGGCTTATTCAAAACCTTTCCCCTTA
AACCATCAACATCCAGTACACAATCTACCTTGGTACCTAAGCACGCCATCCCCCCTTGGGAGAATGATTCATTGAACTTGCTAAGTACCCATTTCTTCAA
CTCCATCAACAGTGGATCAAGATGTTGCTTAGACTTCACCTCAATCACTAAAGATGACTTGGAGTTATTATTAACCATAAAACCATCATTTTAGGAATCT
TACAATCGAACACCCAATTGAGCCAACCTATGAACATCTTTCAGTAGGTCTTTCTTCCTTTATTCTACATGAGACACACTACCCATGGTCATATGACTTA
GAGCATCCACAACCATATTGTCCTAACCGGGGTGGTAGAGAACACTCATGTTATAATCTGTCAACAATTTCAACCATCTTTTTTGTCGGAGATTTAACTC
CTTTTCAGTAAACATATATTGAAGGCTCTTACAGTCGGTATACACATCCACATGTAGACCATACAAGTAATGCCTCCATATTTTGAAACCAAACACTATG
GCCGCTAATTCAAGATCATGAGTTAAATAATTCTTCTCATGCACCTTGAGTTGTCTTAAGGCATAGGCTACTACCTTCCCATGTTGCATAAGGACACAAC
CCAAACCAACTCGGGTTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNCCTTTACGGCATCAGGTGATTGTCCGTCTTAATGGATTTTGAGGCGTGACACATTGTCTCTCCCATTTCCATTCTGAAATT
GGCATTGTTTGAAGTAATCGAACAGGACTTGATGTTCATACTTCACTTATTGACAATTCTGACACTGCGCCACAAGCTGCACAATGTCTTCCTTTATACC
CGACCATTAATAAATTTGATTTAGATCTCTATACATCTTGATTACACACCGATGAAGAGAATATCACGAACCGTGAGATTCTACCAATAACTTTTTAATC
AAGTCATCATCTCGAGGAACACATACTCTACCCTTATAGTTGAGTACACCATTCGTATCAAGAGTTGTCTCTTGAGACTTACTTATTGCAATATTCTCTT
TGAAATCTTTCAAGTTTTTATCCTCAAGTTATTCATCCTTGATATCCTCAATGAGTGTGGCCTAGCTTTAATGCTAGCTAGCACCCCTCCTCTTTCTGAG
ACGCCAACTACATGAACTCATACCTTCTAAGGTCTGGATTTACTTGGCCAAGGGTAGCTTGGTTACACTAATGTAAGCTAAGCTACCCATATTTACTATT
TTTCTACTCAAAACATCTGCTTCCACATTAGCCTTGCCCGAATGGTATTGAATTGTCACTTCATAATCCTTGAGTAAGTCCTTCCATCTTCGCTGTGTCA
AATTCAGATACTTTTGAGTGAATACATGCTGAAAACTACGATGATCAGTAAACACATTACACTTAACACATAGAGATAATGACACCAAATATTAAGAGCA
AATACCACCGCCGCCAATTCCAAATCATGAGTTGGATAATTCCTCTCATGCGCCTTCCATTGAAGCGAGTCATAAGCTATAATATTCTTATCCTTCATCA
ACGCAATACCCAGAACAGAGGGTGAAGCATTTTAATAAATAATGAAATCCTTAACTTCCTCCGGTAACACTAGGATAGATGCGATAGTCAATAGATTCTT
GAGCTTTTGAAAGCTTTCCTCACATTTTTCAGTCCATTCGAATGGTATCTTCTTCTTGGTTAAATTAGTCTAGTGAGTAGCAATCAAAGAAAAATTCTTA
ATAGGTCGACAATAATAGCTAGTGAGTCCAACAAAACTCCAAATTTCATTATAGACATAGTCCGCACCCAATTTCTAACCGCTTCAATTTTTTGAGAATC
TACCATCACCCCTTCCCTTGAAACTACATGCCCTAAAAGTGACACCATTTTCCACCAAAGTCACAGTTGGAAAATTTAGCCTATAACTTTTGCTTCCCAA
GAACACCCAAAATAGTACGAAGATGGTTGACATTCTCTTATTCACCTTTTGAATAAACCAAAATATCATCAATAAATACTATTACAAATAAATCAAAAAA
TGACTTGAACAGCCCATTCATCAAGCTTATGAAGGTTGCAGGTGCATTGGTTAACCCAAAAGACATAAACAAGAATTCATAATGCCAATAGCGAGTTCTA
TATATTGTTTTGGCACATCATTTGTCCTAATTTTCAATTGGTTATATCCGGATCTTAGAGAATACCGTAGCCCCTTGTAATTGGTCAAAGAGATCATCTA
TTCTAGGTAATGGATATTTGTTCTGAATAGTGACCCTATTCAACTGCTGGTAATCTATACACTTTCCCACACTACCATTATTTTTCTTAAGAAATAACAT
TTGGGCACCCTATGGGGAAGCCCTAGGATGAATAAATCCCTCAGATATAAGCTCTTTGATTTGAGCGTTAAGCTCTCTCGATTTTTCCAAATCCATGGGA
TATGGTTGAATTAAAATGGGATGGGCACCGAGCTCTAAGTCTGTACAAAAATCTATATCTCTATCTGGAGGCATACAAGTCTAGTCATTAGGAAATAGAT
TGAGAGTCAACCTCAACATCCCTCACATTAGATTGATAAGAAATACAACCTCTCTTTACCAATTTACTAGACCAAATAGAAGATATGATCTTAGCTTGCT
TATGCTTGTACACCTTTTCCCACTCTAATCTTTCCGTTCCGGAATTTCTAGAGTCATAGAATTAGTACTACAATTTAGCACAACATAATAGGGGGACAAC
CAATTCATGCCTAAGATAATATCAAAACCATCCATATCCAAACTCATAAAATCAGCCCTAGTCTGAAAACCAATAAACAAAATGGGATTCGCACGATATA
CATGGGTGACTATGATTAACTCTGCAATTGGGGTAAAAACATGGATAGGGGAATAAAGTACATAAAAAATCATATCAAACTTGGACACAAAACTCATGGA
TACATTATAATAACTGGGACCCAAAAAAACACATTAGCCATCTTGTCACAAACAATAGTAGTACATGTCATTAATCGCTTTCGACACCTTTGTCTCATTT
TTTCCCAAAAAGCGTAGCATTGATCACTATCCTCTTGATAAGGTACTTCCCTGCCTGGTTTAACATTACATCTATCCTCATTACCATTACAATTTTCTCT
ACCTCCACAACCTCTCTGATTATCTTCTTACCTACCTTGTGGACGGCCTAGGCAATTATTACCATTCTCTGTGGGTACCACTACTTTGAACTGCTAGTGT
GTGGAGTCGAATACACGTGTATGGGAACAATCTCTCCTCATATATCCAAGTCTTGGTCATAAGTGTTGGCCTTTCGGATCCCTTAGTATAAGAACCTTGA
AAAATTCCCGCATTCTTTGATCTTTTTACCAACACCTTGGCTTGACCGTTGCGTCTAACCCCCTCTACTTTCTTTACATTTGTCACCTCATTAAAACTCC
TCCATGCAAGTCACATGGACAGATAATACTTGCAACTTAGAATTCAATCCTCTAATAAACATCTGGATCCTGTTATCCTCAGTAGTAACAAACTACATAA
CATATATTGATAGAGTATGAAACTTGGCCCCATTAGCAGCCACAGACATACCACCTTGCTTTAGTACCATAAACTCATCCTTCTTGCGATCTTTCAAGGT
GTTAGAGCATACTTCTCTACAATAAAAGGCAATGAATTGGGTCCATGTAAGTGGAGGTAATGTAGAAGATCTGCACTCCATATAGCTCTTCGCCATTGCT
TGGCCTCACCTTGAATTTGGAAAGAGATGAACTCAACCCCATGTTGGTGAACAATACCCAACTTATGCAGCCACTCATAAAAGTCTAAGATGAAATCATA
TGAATCTTCAGTCTCAGAACCCAAAAATATTAGAGGCTTAAGTTTTATAAACTTAGTCAACATATCATCCATGCTCATTCCAAGTCATAACAAAACCCAA
CAAAGGATGAAAGTAACCATCATTATCTCATGTCTCGCCTCGACTTGGGCGTAGTTCTAGAAATAGGAGTGTTAGCAAAAATTCATAAAATGAAAGAATT
CATAGACCATCCAGCTCCTTTAAAAATGACTTGATCTGTTGGGCTAACACTGGGTCCAAAGGAGGAACGCTTACATTTCGAGCTGGTACCCCTCTTTTTA
CAACCTAAAAATGAGCTAGGTTGAACTAGATCCTAAAACTTGTTTCATTATCTTTTAAAGTCATAAAATGGTTGATAATTGTGTTCTTAGGTAGTATATA
AAGTTTGGAAGTGTTTGGAGGTCAAACGTCCAAGACGTTCGGAAACTAGTCGAAGTTAAACTAGTGTGTCGTAGTGTTTTGTAATGATATTTTGAGCGAT
GGTTTGAAGGTGAAATTCAGTACCGAGGGTTCCTGCACATAGCCTTATATACAAAGAGTCGAAACATATGAGAACGACGCCCGGGACCGTCAAAAGGGTC
CCCAAGGAGGACCCAAACATGTACTGCCAAGCTGTCGTGCCAGCCTATTTTGGGCAGTGGTTGCGCATTGCGCAGCTGTCATGCAGTGCGTAAAAATCTT
ACCCTGTGATGCAGGGATGTCACGAACCATTCTGTCTAGGATTTTTTGAAAAATAAAACTTGGAAGTGCCTCGGCGATGCGCATTAAGGTACAAATTTCA
TTTCGTCATTTTTAAGTCAAATTTGAGATGGTTAATTTGTCCAATAAGTGTAGGGTTTTTTGGCTAATTTAGTGGTGAATTATGGAAGTTTATATTTAAG
CTCCTAAACTCACCATTCAAAATAAAACTCAAAACTCAAAACAAAAAACCTCTCCATTCACTCTCTCCAAAACTCCATTGATGAAGCTTTGAATCTCCAA
GGCAAAAAATAAAATTTCTCAAGTTCTCTCCATAAATTTTGTGGGATTTTCATCACAATTAAGGTACGGTTCTTCATACTTGAAATCTTTTTCTGCAAGG
AGTCAATTCCAATGATTTTATAAAGATTATCAAAACCATGAATTATCAAATTTTGTGATCTATCCATGGGTCTTTGCATAACACGTTTTGAATCATTGCA
TTATGATTGTATTGATGGTAATTTTATGATTTTAACCTAAAAACTTTATGAACCTATGCAATCCTTGTTTTGACTTTTTTATGGGTTAAGTGATCATGTC
TCATTGCTTATGAATTCTACTCTAGGTTTTCTTTGGGATATGGAATTATGAAGAATTGTAGTGGTTTGATGTACGGGTTGTCTTAGATTGATAAATCTAT
ATTGAATAAATTTAGATTCATTGAGTATTGTAATGTTGTATTGAATTGATGATCATGACCATGGGTAAGGGCTTTTTGGTATTGAATTGGATGATTTAGC
TATGGATTTAAGTGGTGAGAATAGATTGGTGGTACACTACCCTAATTATCTTTATTTTATGTAATGTAGATCTTGAATGTTGTTGTGATTGGTATGGTGC
ACTTATGGTGGCGGTGCTATGTGCTTTACTTGTGAATGATCTGGCTTAGTCGGCGTTACTTTATGTATTATATTGAGCATGTTTTTTTCGGCAATTACTT
GATATATTATAATAAATTGTGTAGTTGATTTATGTGAAGTATGATCATATCTACCTATATGTGATTGAGGTGAATGTAGGTGTTCTTGTATTGATGTTGT
TAGGTGATCATGTTAGACTATGACTATTTCCTTAGGTATGTAGTATTAGATTTTATGTATGATTATTCCTAATTGACTATATGTGATCATGATAGACTAG
GGTGATGTCTCTGGTTGTGTTACTAGTGTATCTTGATAGGTTTACTTGTTTATTCCTACGTGATAGTTGAGAAATATTATACATGTGATATGGAGATGAT
GTGAGTGTCTTGATAGGTAGACTATGTCCTTCTTACTTATATATAAAAGATATGTGAATATGAACATCTTGACTTAGTAGGCTTATGCACCTTTGTCTTG
TATGTGTATGGATAAATGTTGAATGAATGTCTAGGATTTGTAGACCTAAGATGGTGCCCTTCTAAGAATGACTAATATGTGGAACCTTCTATATATAAAG
AAGGTTAATAATGAGCTATCCTTATAGACCATTGAATAGCTGCCCTAGTGGACCCATCTTTGGTAGGTGCATTATGAATAGTTAATAACTAAGAGATGGT
ACCTTTTTCATATGCCCCTTTTAATGAACTTACTCTATGAGAACAAAGGCTAGAACCGAGTGAATATGTTATGTTTTGTAGCTCTACTTAAGAAGGAGAC
TAGAGTACAATGTACCTTTACTTGAGAATCAGACTATAGTTCATAAAAGACCTTGATATTCCTTAACCATGTTCCTACATGGGATGTGTCCTAGTTCTAT
CCTTGATAAGTAAAACACCCTCCATCAGCGTAGGTTTATGATTTTGTATTCCAAGCCTACCTAGTATTGTCTATGTCAGTTATTGCGTATTCTCATCACA
TGGGATGCATAAGTTCTACAATGTGTCGGAAGTGGAATAAGATGTTATCTAGACATGGCATGAGTAGGCTTTGATGGTGCTAGAGTGTAAGTTCCCTAGG
TCTTTTTAAGACCATCATGTGCCCTTAATGAATGAAATGTCTTCAAATTGACTTGATGAATGATTATGACTTTAGCTAATGTATGTTGGCGAGAATGTGC
TCTATCTAGGGTAGCTTTGAGGGTTGCTTAGGTAAGCTTGAAAAGGGTGTATGGGCGGTCTCTTTTTGTCCTACTTAGGTGAATCATGGAGAAACCTTAG
GTGGGGAGTAAATCACAGCAAAAGGTAACAATCTTATCTTAGGTAGTATTAAGAATTGTTTAGGTAGGCTTGAAGAGGGTGTATGGGCGGTCTCTTATTG
TCTTACTTAAGTAAGTCGTAATATAACTTTGGTGGGAGGTATATATGTTGATATGGTTTGTAATTCATTTTAATGCTATATTATAGGTCTTAATTGAGAG
GTGTCTTACATGTGAAGCTTTTTTTATTTTTGGGTAAAACTTGAAACAAAATTCTCTATAAGTTTCAAAAATTTTATTTCTAAGTGCCGCTTTGACATTC
TCGAAGGGAAGGGAGGTTGGGATATTACGAATATTACTTTAATTATATAGCCTTTTCAGAGGAATAAATCAATAATATTATTAATTATTAACTAATTTAG
TACGCCAGATAAATTATAATAGTTGCTATGAAAACTGGGCTATTTGTATAGCAGTCTCTTATGAGATGTGCATCAGCCCAGATACATTGAAACCTTCTGT
TGTATGGCCCATTAGCCTATGGCCCTGTATAAGTCATGGGCTAACCTCTTGGATGGGAATGTGTAACTATTTAGTCGGGTTGAAATAAAAAAAAGGGAAA
ATTGTATAAAATAGCAAACTAATAACCTAAAATAAATGGAATAGCTAGGGTTTGATTTAATTGTGCTCCATAGCAAACGTTGGCAAAAATTTGCCAGGCG
TCTCTCTCCCAGAAGTCTCGCTCGCCACTCTCCCATTCCGCCTCTCTCGCTTTATACACAAAAGTGTATAATTTCTGTTTCTGTTTTGTATAAAGCGAGA
GAAAATTGTATGTACACATGCAAAAATGTATATCTTTGTGTTATACACTTAATTATATAATTTACAAACATTTTACTTCAAATATTGCAGAGAAAAAGGC
CAAAGAATTATACAATTGTGAATTATACAATTGCAGTGAAATACAATTTTTTCTAGCTTTATACAACAGAAGTGTATATATTGTGTTTCTGTTTTTGTAT
AAAACGATAAAAACATATATCTTCTTGCTATACACTTATAATTATGCAATATACATACATTTTAATTCGATTCAACTGTATGCAAAGCTAATTATACAAT
TGCAGCGAAATAGGCCAGCGAATTATACAATTTAGGCAAGCGAATTATACAATTTAGGCCAGTGAATTATACACTTTTATATGTATAGCGNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCACCCTCAT
TCTTCGAATATACCAAGATATCATCAATGAAGACAATCACAAAGGAATCTAGGTAATTTCAAAACATCCTATTCATAAGGTCCATGAAAGCCTCCGGGGC
ATTCTTGAGGTCAAAGGACATTTCTATTAACTCATATTGACCATACCTAGTTCAAAATGCCATTTTAGGTACATCATCACCTTTCACCCTAAGTTGGTGA
TACCTCCACCTTAAGTCAATCTTAGAAAAGTAGCTTGCCCCTTGGAGTTGATCAAGCGAGTCGTCAATCCGAGGGGGAAGATACTTGTTCTTAATGATGA
TCTTATTGAGTTGATGATAGTCAATGCACATCCTAAGGGACCCATCCTTCTTAACAAACAGCACCGGGGCTCCCCAGGGTGAATTACTAGGATGATTGAA
ATACTTGTATAATAAGTCTTTGAGTTGAAACTTAAACTCTTTCAACTCCATCAGAGCCACTCGGTAATGAGGGATTAAATGGGATTGGTATCTGGTAACA
AGCCAATACCAATAGTCTATTTCCCGCTTGGTATGAATTCCGATCAAGTTATCGAGAAAGACTTCTGAAAAGTCCATCAATATGTGGACCAAATTTATTG
GAGGAATATCGGACTCAAGACCTTTGACTCTTACAATATGGTAAGACACCCTTTAGAGATTATTTTACAAGCTTTTTGACAAGAAACAATACGACCTCAA
GGGATTGAGTTACCCCCTTTTCACTCAAAGACATGTTCATTAGGGAAATTGAACTTACCCAATCTTGTTTTGACAATCCATGGAAGCAAAAAAATCATGC
AACCAATCCATTACCAAAATAAGATTAAAATCAACCATATCAAGTTCAACCAAATCCACCCATGTAACTCTATCGGGTAAAGATATAAGATAACTCCTAA
AGACTCTTCTAGCCATAACGGAGTCACCCATCGTGGTTGTAACAAAAATCGGTTCAATCAAAATATCAGGTAAAACATCAAACTTTTTAGCTACTAGAGG
ATTTACAAATGATAATGTAGCACCGGGATCAAGTAAAACATAAACATCAATAGAGAAGACTTGCAACGTACCAGTGACTACATTTGGAGACTCTTCTTGC
TCACGCCTAGAACGGAGAGCATAAAAGTAGTTCCTCTTTAGAGCATCGGAACTACGACCACTTTCTTGATCTTGAATACTCCCCTTATCTTGACTCCTAA
CATTAGGACAATCCGTAACCTTATGGTCACTTTTGCCACACCTAAAGCAATTTTCCGTCCCAACTAGACACTCACCCTAGTGCTTCTTACCACACTTGGC
ACAAGTAGGTTTCTTGCTAGTGAGTTTCCACTTCTTCCATTTTGAGACTTAGGGTTAGACACCTTGTATTTGTTTGACCTAGAGAAATTGAAAGGACTTG
GTTCGAAACCCTCTTCTTGAACCTAGGATTGTATTGAATCTCAAGCCTACCCTTAGAAGTACCTCCCTCATCAGACTTGGTCCTCTTTAACTCTCTATTC
TTCCTCTTGAGTCTTGTATCCTCAATTTGTTGGGCATGAAACATCAACGGAGAGATATCCATATTGTCATGTAGCATCACCGAACGACATTGTTCAACAA
ACACTCTGTCACAAAGTCACACATCTCATACTTAGGATTAGATATTATGAAGGAACATATTTAGACCATTTAGTGAACTTCAAGGAGTACTCTTGAACAC
TCATACCTACTTGTCGAAGGTTGATGTATTCTTTCACTTTCGCCTCCCTTTTCTCCCTAGGAAAGAAACGATCAAGGAAAGCCCTATTAAACACCTCCCA
AGTGATAGGACCCGCTCTCAAGGCCCTATTATTTCTCCATTGGTGTACCATGTTTGAGCTACAGCCTTGAGTTGATAGGAAGCTAGCTCGACCTTTTCAT
TTGAAGTCAACCCCATAGCATAATGAATCTGTTAGACCTCATCAATGAAGTCTTGGGGGATCTTTATTCACTTTTAACCCATACAACATAGGAGGGTTCA
TCCTAGTGAAGTCCCTTAAGTGGGAAGCCATGGTACTACATTTTGTTTAACATGGGGTCCAACCTCCCTATTTGGTTGAGCCGTCATGGCTTGAGCTTAA
GTGTCTATCGCTTGAGCTTGGGTAGTCATAGATTGAGCCAAAGTCACAAATTCTGACCTTAATCTCTCCTTCCATCATAGGTGGAGGAATTACTGGAGCT
TGGTCTTGTGGAGGCACTTCTTTTCCTTGTGGACGGACTTGGTTCTCTAGGGTAGGAACTATTGCATTAGAAAAATATTCCTCCATTTTCCTTGAATCCA
TCCTTCTAGTATTCATATCTTATATCCACAAGAAGAGGATTAGAAGAAAAGGGACACATAGAGTTACCACTAATAAGGTACGACTTCCAAGATTACCAAT
AAGTGAGAATTCCTAAGCATCATATAGCCTCTCATTCATAAGTGTGGCGCGCTTCGCATCCACAAACAAGTCTCATCTTAGATGTGGTTTAGTGAGAAAT
CAACCCTAAGATTATTTAAACCTAATGCTTTAATACCAAGTTAGTGACGACCGGGGAGCACCCCCTAGACGTAACCGGCGTCATCGTCCTCGGAGAGGAC
TAAGACTAGACTCTTAGCATTTGTCACTACATTTCATAGGTTAAAATGCAAAAAAAAATTAAAACTTGTATATATTGAGGTTTACATAGACCTCTCACAT
ACTACTTAGGAGTTTATTTAGACACCTCGCATAGGAAGCTTACATAAGCTTCTAATTTAGACAATATACATAACATATAAGATTTTAGTCTAATATACCT
TCTCACATTAAACCATCTAAAATGAAGTCGAACCATTCGGGCATAGCCTAAAAAAATTATAATTTCCACTTAAGGATTACAACGATATCTTCAATAATAA
GAGAGAAAAGAATGTTTTTAGACTATAGCAAATCCGGCTAGGCTAGATAGAAGGCACCATCCTTGTCACGATCGGGTAGCACCCCCTAGAAATAACATGG
TGTACTTGACCTCTCGGAGGTCTTATACAAGCCCATAGTTATCATTCATCACATTGTCATAGGAAATTTAGTGGAAATTTAAAACATTCATGGTACATCA
CATGCTAGAACTTCACATCACACACACACACACACACACATATATATATACACACACATACATACATAGGTATACTCTAAGTCTCTTTTGCCATCTTAGA
CTCAACATCATTAGAATAGAATAGGGACATGACCCTTATCAATATATAACAATATCTAAACTATTACATAACTTTAAAACTAACTTGACATGGAAATCCT
TGAATCATAAGGATCCCTTTTTTGAGCAAGGGAAACACATATCAAGCCTTTCACTTTAGACACATACTTTAAGCATCCATAAGCTACACTTTGTGTAAAA
AAGTGAAGAAGAATGGTGTTTGTACAAGAATGCACTAAGAATGAAAACCATCCAAAAACATGCATATAAATATGACACTTTACTTTGAAATTATGCAACA
TGCCATTTGAAACAAACATCATAAACATTGGTACAATTAAATAATATACTTCACTACTGCATATAGATATATACAATGGTCATAATATCATATAAATCCA
TACATTGCATTTTAGGCACATTAGGAATTTCATACACAGTAACCTCCTTTTAACCTTACTATAAATGTTTACCCCCAATTGACCCTCTTGTAATACTTGG
TGCAATGCATGAATAATGTTCCTTTTCACTGTAACACTTCGAAAATCAAAGACGTGCTCTAGAGCCTAACTTAAGTGTCAAAAGGTTTATATACTATTTT
AAGGTCTATTTTAATTTATCTAATTCATTTAGGAGGTTTAGAAACCAAAATTTCAAAGAACGTACATGACGTCCGAAAACTAGTTCAATGAGGTGCTAGT
CTGCCTTACCTATTTGACTAGCTTTTAGGAGTCATAAGATGATGAAAATTGGTTGAAGGGTGTCTAACATGCATTAGAGTTATTTACTATTTGAAAATTC
TAGGCACAACTCCCCAAGAACCAACCAAGGGCCCTTGAGGAGGACCCTTGCATTTTAGCAAGAAGCTGCCAAAAGGCACAGTGCATAGACGAGTGAAATC
GAAGAGGCGTTTGTCAATAGTTGGGGCATAGATGGACAGCGTCGATGAACACATAACCAAATTAAATAATAACCTATTTTTCATAGTCTCTAAACTCATT
GACAGATGTGCAACATGGAAAGGAACAGTGGCCGTCGATTCACACACGAGGCATTGATCGGGGTCTCATCTATGGGGGACTGATTTTGTTGCACGTTTTT
AATTAAGTCATTTAATGGATAGTATTAGTTAGGAGGTTAATTAGGGTTTAGGGGATGTCTAAATAAGTCAGTTAATGAACTATATAAAGACCCTAATGTC
ATGGACTTAGAGTATTTGCTAAGACTTCGTGCAGATTTGACAACTGACTCACGAATTCTTCACGATCTTGTAAGTTCAAGTAAGCCTTTAACATCGGAAT
GCTAAGAGAATGCAAAGAAAGACTTGGAAAGAACAAAATAGAACTAAGGCATTTGTATTGCTTTGGAAGATTGCATACAACTTGCTTGGATGGTTTACAA
ATGAGAGGCCACCTATTTATACTACTTCCTAGGAGCTAAAATGTAAATAAAATTACTTACAAGTCCATATTCTAGAAAAGTCTACACTTTCTAGGATCTT
CCAAAGCCTTTCTTGAAAAGTCTAAGTTATTCTAGAGAATTCTAAGGAATTATTTGGCCTTTTTGATTAATCTAGAAGGTTCTAGAGCTTTTCATAAACC
TCTCCACAACTCTAGACTCTTCCGCCTCTATTTGGATGTAAAATTTAACAAGGATGTGGCGGGACGTCACACGCTCCCCCACCTAATGATGCGACGACCG
TGGCGCATTGCTGCAAAAAACCCCGGACTTTGTCTTTAAACTGCCACAAGTCTTCATATTTCTCCCATGTGTCCTCTTCTGAAGTATGTCCTTTCCAATG
TACTGGGAACATAGTGCTGGATTGTTGACCTCACTTTCGTTTGGCTTGATAATCTATGATAGCCTCAATCTCTCGGTCATGCGAGGCGGTGACAGTAGTG
GATTCCCATTGTGATTGGTTCCAGCTAGGATCTTCCTTGTCCTCATGGTACAACTTGAGGATGCTTGCATGAAACACCGGATGGATCTTAAAGTGTGGAG
GTAACTCCAACTTGTACGAGATCTTTCCCACCTTGGTAACGATGTTGAACGAACTCTCATATTTGTGCACTAAGTTTTGATGGATGCCTCTTAGTGATTT
GAACTGTGTTGGATTGAATTTGATCAAGACCATGTCACCTTCTTTATAGTCCGTGGGATGACGCATGCGGCTGGCAAATTTCTTCATCCTTTTGGCTGCC
TTGTCCAAGTAGGACTTGGCAGTGTCAAGCTGCTCCTCCCATCCCTTGGCGAGATGGTACGCACCCAAACTCATTCACTTAAAAGTAGTCAGAAACGAAT
GTGGAGTTTGGGGTTGTTGGCCTGTCGCCAAATAAAATGGTGTACGCCTAGTGGATTCACTCTTACCTAAATTATAAGAAAATTGCGCCATGTCTAGGAG
TCTGACCCAATACTTTTGATGTGCACTAGCATAGTGACTTAGACAACACTCTAATAGGGCGTTGACGCATTCGGTCTGGCCATCGGTCTGCGGGTGGAAA
CTTGTAGAGAAGTGAAGATCTGTGCCAAATATCTTGAATATCTCTCTCTAAAAGTTCCAGATAAAGCGGGGGTCTCGGTCCCTAATGATATGTCTCGGCA
ACCCCCAATATTTCACTATATTCTTGAAGAATAATTGAGCAGCTTCCTTTGCGGTGCAACAGGCTGTGCAGGCATGAATGTATCATACTTTGAAAACCTA
TCTACCACGACCTTGATCGTACCAAACCCATTGAACATCGGCAAGGAAGTGATGAAGTCCATGGTTACGCTCTCCCATGGGTGTTCTGTTACGGGTAGTG
TCTGTAGTTACCCTTCCGGTTGCCATTTCTCCACCTTGTCTTGTTGGCACATAAGACAAGTCTGCACATAGCACTCGATATCATCCCGCATGTGTGGCCA
AAAATAAATAACCTCGATCAGTGCCCTTGTTCTACGCTGCCCGGATGCCCAGCCCACAGCGTGTCATGGCTTTCCTTAATGATGCGCCGCTTAATAGCCA
CGAACTTGGGCACATAGACCCTCCGACTGTAGTGAGCAAGAAGCTATATTCTACCCAAAAGCACCTAGTTTTGCCTTGAGCGGCCAACTCCATCATCTTC
ATTGTATCTAGATCATGTTGTATACCATCCCTGATGGCATGCTGAATGTCACAGTGGGTTATAGTGATGCCATCAAGATCGGCCTTCCTACTTAGTGCAT
CGGCCACAACGTTGCCTCTTCCAGGCTTGTACTCCAAGATGTAGTCGAATTCTGCTAGAAAATCCTGCCATTTAGCATTCTTCGGGTTGATTTTTTTTGG
GTCTGGAAGTAGCTAGTGGCAGCATTGTTGGTCTTGACCACGAACTTGGAGTTTCGTAAGTAGTGTCTACACATGCGTAGGCAATGCACAATAGCGGTCA
TCTCTTTGTCTTGCACCGTGTATCGTCGTTCAACCTCGTTTAGTTTGCAGCTCTCAAATGCTATTGGGTGTCTATTTTGCATTAAGACTCCCCCAATGGC
AAAGTATGAGGCATCCGTATATATTTCAAAGGTCTTGGAGAAATCGGGCAGCGTCAAGACATGCTTTTCCGTAACTGCGGCCTTGAGACATTCGAACGCT
TTTTGGCACTTTTTGCTCCAAACCCACAACTTATTCTTCTTTAACAACCCGGTCTGTGGTGTGGCTTCAGTGGAGTAGCCTCTGATGAAACTGTGATAAT
AGTTCACAAGCCCAAGGAATGATCGTAGCTCGGTCACCTTTGTGGGCAACTCCAGTACTGGATCACCCGAATCTTTGCCTCGTCCATCCGTAGTTTGCCC
TAGGTGATAACATGGCCTACGAAGTGCACCTCATGCTGGGAGAACTCTCATTTCTCTTGCTTGATGTAGAGCTTGTTCTCTCGTAATACTTGGAAGGCTT
TCCTCAGCTTCTTCATGTGTTCCTTTAAGGTGTTGCTATAGATGACTATGTCATCCAAGTACACCACCACGAACTGGTTCAAGTAGGGATGAAGGATTTC
GTTCATCAATGCGCAAAAGGTGGCGGGTGCATTGGTTAAGCTGAAAGACATCACCAACTACTCATATGCTCCGTATCTAGTCACACGCGTTGTCTTCGGC
TCATCTCCCTCTTCGATGCAAACTTGGTAGTAACCGTTCCGGAGATCCATCTTGGTGAAGTACTTGTCCTTCCCAAGTCGATCAAATAAGTCTGCAATTA
GTGGGATAGGATATTTGCTCTTGATTATGACCTTATTGAGCACCAGATCGTCGATGCATAAGCGCAACGACTTGTGTTTCTTCTTTTGGAACAGCACTGG
CACGCCATAAGGTGACTTGGATGGAAGGATGTGACTGGCCTCGAGGATATCCTTCAACTGCTTTCTTAAATCTTCTAACTCATTTGGAGACATACGGTAA
GGTGCATGTGCGGATGGCTTGGCTCCGACCTCCAACTCTATCTTGTGATCTACTTCGCGCCTCGGAGGTAGTGTCTTCAGCAGCTCATCCAACATTGCGT
CCTTGTTATCTTCAAGGACAATCTCTATGGTTGGTGGCAAGGACTCTAAAGTACCATTGTCTTCTTGTGAACTTGCAATGGTTTCTAGGAACATCAGTTC
TTGTTTCTTTAGGCCCTTCCCAATCTGCATGGACGATAAGTGGGAGTGCCTTCTTTCTTTGGCACCTTGACTAGAGGTACCATGCATGACCCTTCCCGCT
CCATCACCATGAGTCATTGGAGGTAGGGGTCAATCTTCGTGTGGTAGCGCTGGAAGAACTTTTGCCCGATAATGATATCAAGTATATCGAAAGGAGCGAC
GGTAAAGTTTGTCTTACCTTGCCACTTTCCCAATGTGATGCTCACTCCTTGGGCGACCTTGCATATTGGAGTCGATGGGGGCATTAACTGTCTTGAAGCG
GGTGTTGCTTGACATGTAATTCCACCCTAAGCTCTATGCCACCGTGTTGGTCATGATGTTTGCTTTGGCCCCGGAGTCTACCATGGCACGAGCTGGTTGT
CTATTTATGGAGATGTCTACATACTGCGTGCTAAAGTCTCATAGCTTCTCGGTCTACTTAGATATCATACCGCATAATCCTACTATGCCCAATTGCGTCC
CACATCTTGTCTTTCCTCCTGCACGTCCTTCTCTTTCCGGTCGCGTAGGATAGCACAAAGGTTCTTCATTTAGGGGCACCTGGTATAGCCGTGCGGTCCT
CCACATATGTAGAAACCATCTCCGTTGTTGGTTTGTGCCCGCTTCTCTGTGTAGTTCTAATGCCCGAATCGCTTGCTATCCAGTTTGTGGGGGTCTTGCT
GCTTGGGGTGTGTCTGCTGCTCCTTGCCTCGGCCATCGTCTCCCCCAACTTTGGCGTGACTACTTCTTGCATCTCTGCCCTTCGCCTTTTCATGTCGTTC
ATGCTTGAAGCTCGTCAAGGACTCAATTTGTGTAATGTATTCTTCTATGATCTTAGCCTAACACCAATCCAACTCTGTCTTGACCCAATTCTGCAGTCCA
TTCATGAAGTGGAACAACATGTCCTCGTCTGTGAGGTTGGGTATTTGAAGCGCTAGAGTTGTGAACTCTTTCACATACACCCGAATGCGTCCCATTGTCT
TCACTTCCCAGAACTTCCGCTTGACCTCATACACGATGTTGTTAGGAAATAAGGATTTCTTGAATTCTTTGCGTAATTGCTCCCACGTGTTGATGGTGCA
CGTCCCCTACCCGATGTTAGCCTCTCTGCACCTCCACCATAGCATAGCCATCTCAGACAAGTACAACACAGAAGTGTTGATCTTTTTCTCGTCGCTTCTC
ACCCGACTACACTTGAAGTAATTCTCCAAGTGCCATAGGAAGTTTTCCACCTCTTGAGCGTCGCGGACACACTTGAATATAGGTGGCTTGGGAGCCTCGA
CCCTGGCCACCCTATCACGGTCAGGTGATGTAGATCCTCCAACGTCCACGCCTTCCTTGAGTGTTTCACTTTAGTCTTCAGCATTTCGATCGTGATAAGT
CTTCCATAAGACGTTACTCCAAGGAAGTAATGGCATCCTTCATCTCGAACTCGGCCCGCTGGCGAACCTCCAACTCTTTACAGATGTTTTTGTTCTCCTC
AAGGGTGAAGTTCTCAAGGGTCTTGAACTTGCCTTCTGCCACGTTCATGCATCGACCTAATATCTCTACGGCCTGCCTTGCCACTTCCACCCTTGTGACC
CATTATTATCTAGCGGTGAAATCTATGGCATCTTCACCAATTCATCGTCACTTGCTTCAACAGTGGAGGGTTGATGAGATGTTAGAACCTCGCTAGGTGT
GGAGTCATCCATAACCTTCTGACTACCCATTTGATGCTTTTTCCAATTTCGGTTCTTCTTTCCACCATCCATACGGATGTTGGTGGTGCTAGTTCCGTTT
ATGTCTTCTTCGGTAGCCATTCCCTTAGTATCAAACCATGGTCTGATACCACTTTGTCACGGACTTAGATTATTTTCTAAGACTCCGTGCGACACTTGAA
AACTTACTCACGAATATTTCACGATCTTGTAAGCTCAAGTAAGCCTTTAAGACTCGGAATGCTAAGAGAATACAAAGAAAGACTTAGAAAGAACAAAAGA
GAACTTTGAAAGAAAGCTTTTGTATTGCTTTGGAATATTTCTTATAACTTGCTTGGATGGTTTACAAATGAGAGCCCACCTATTTATACTACTTTCTAGG
GGCTAAAATATAAATAAAAATTGCTTACAAGTCCCTATTCGAGAAAAGTCTACACTTTCTAGGATCTTACAAAGACTTTCTTGAAAAGTCTAAGTTATTC
TAGAGATTTCTAAGGAATTCTCTAGCCTTCTTGATTAATCTAGAAGGTTCTAAAGTTTTTCGTAAACCTCTCCATAAATCTAGACTCTTCCGCCTCTATC
CGGATGCAAAATTTAACAAGGATGTGGCGGGACGTCACACTAAGCTAATTAAACTAACCTAATCCCTCGTAATTCACAAACCCAAACTCTCTTCCTTCTC
TCTTCTTTCTCTCTCAAGTTGAAGAACTCCATAGAAGACCAAGCTAGAAGAGGGTTCTAGGGGTTAAAAAGGTCAAGTTTCTCCACTCAAACTTCATCAA
ACAAAAATTTATGGGATTCCTTTCACCTTTGAGACCTCTTTCCTCAATGGGTTCCATCCAATTGATTTCAAAAGTAGAGTTTTCATGTGGGTCTTTTCCG
ATCTCGAAATTGATCTTGTGAATTGCTTTGTTTATGATTTCTTTTTGATATTATGGATAGATTAACATATATTGTAATTTAATTATGTTATTTCTTGACG
GATTGGTCTAGTCTATAGAATATGACCTATTTCCCTTAACCCTAGGTTGTGATCTTGATATGAATTGTGTAATTTTGGTTCAATTTAATTGGTTATTGGT
TATTTTACTATCCTATAATGTTTTGGTATCAATCATGAATAGATTATGATGAGTTATAGTCCTATAATGCTAGTTCTTGAGAAATCGATCTACGTTGTGA
AGTATGTTATGAATTTGACCTAAGTCTCTTATATTAAGCTATGAACTAGTAATGGATTGTGATGTAGTGATTCAATTGGCTTTGTTGTCATGTTGGTTAT
TGATTTATGATGCTGTTGTACCCTTATGGGGTTGAGTTAAGGGTTGACGGTAAGATCTTGATGATGGATTATGAAGGAGACCTCGTAAGTCTTGTGATCC
CTATTATTTACTTCAACAGTGGTATGTTGTGATTAAGTAATGATATTGCATTGACGTATACCTTGTATTAGTATTGATAGGATTGGTATTATGTTGAATT
GAAATGTCTTGACTATGGTTCATGAGGTGTTGGCTAAGATGTAAATGTTATAAGGATGGTAATTTATACCAACAAGCCTTATAATGATATGAATGTGTAA
ATGTGCTAACCTCATTTATATGGATTATAATGAAAGGACTATACTCATGCAATTCTAATTGAGCTATGATGATGATGATTATACAAGGGATAGACCGTAT
GACCTATACAAGAGATAGTCAATGAGACCAAAATTATACATATATGGTAAAACCTCATCATATAGACACCATANNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGCAGTGAAACATATCAATATTATGA
CCTGCCATTCTGCCAGCCAGGTCAGCATTTTTAGCTTGCACTTGAGTATAGTCGATCCCAACTAGTTAGACATAGTTGCTTTGTATCTTGCTAGGGTACT
GTCATATTTTCTTGCAAACATGCTTTGTTTTTCTTTGTGTTGAGCTGTGGGTTTATTGGAAACAACCTCTCTATCCCCACCAAAGGTAGAGGTAAGGTTT
GCGTACATCCTATCCTCCCTAGACTCCACTTGTGGGATTATACTGAGTGTGGTTGTATTATACAGAGACACTGTACTATTAACTTATTCTGCTTCTTATA
TACTTACATAAACTCAAAACGTTATTACTGGTTAGACCAAGGGCAAACTGTGATGAGAATATTGGTACTGTTTTATATATTTTGTATTGGTATGACTGGT
AATCTTTAGAGTTAGTTATGTTAAAAATTTAACTACTTTCAAGAATTTTGACCTTTTAGTTTCACTTGACAGGTGAGCTGCTTCCAGAAAAGGAATCCCT
TGGGGAAGTTCTGAATGGTGACCGTTTAACCAATACCTTGTATCAGTTGAAATTTGGAGTGGAGAAAGATGGGGTTGTCCTGTGCCACAAGAAGCTTGAT
CAAAATGATGTCTCAAAGTTCAGGACTGCTATTATTAAAGATTACTACTACCAGATGTACTTTGATGATCTCCCTTTCTGGGGATTTGTTGGGAAAATTG
AAGATGAACTCTGGACCCTGGATGGAAAGGGCCCCAAGTATTTTCTCTTTAAGCATGTCCAATTTGATGTCCTTTACAATGGAAACCAAGTCATAGAAAT
ACATGCTCTCGGTGATCCAAGCAATGTTGTGGATATAACAGAAGATATAGACCTAACTGTTACCTTCACATATACTGTACGCTGGAATGAAACATCAATT
CCATTCGAGAATAGAATAGCAAGATACTCGAGGGCTTCGGGAAAACCAGTGAACCGTCAAATTCATTGGTTCTCGATAATTAATTCAATTGTTATTTCTG
TTCTGCTGATGACCTTTTTTGCTGTGAGTATGATGCAGCGCCTTAAGAATGATCTGAGAAAGTAAGCCTCATATCATGCCCATTTTTGCTAATGGCACAA
CAAATAATCTATGTACATGAAAGCATCTGAAGCTGAAAGCACTGTCATCATATTTGTATGACTGATATGCAGATGGTCTAGCGGTGATGAAGAGGAAGAC
AAAGAAGTGGGTTGGAAGTACCTTCATGGTGACGTTTTTAGATGTCCACCAAACATGCCTCTGCTCTGTGCAGTTATTGGTGCTGGTACCCAGCTATTGA
CATTGTAAGTAAGCTCTTATTGATCCGTCAGATGACTTCATAGTTGTTTATGCCGTTCATACGACAAGCGAGCCATCTTCTATTTCTTTTGTGACTTAAG
ACTAGAAGAGAATCTCTGTGCATAAGATTGCCTGTTTGATATCTAGCTCAAGATATTTTATCTCTAGGCTGTAGGTTAATATTGTATTACATACCCTCTA
AGATCCAATAATAAGAAAAGTATGAACCTCATCATATATTCAACACCATCACGCCAAAAAATGCAGATTCTGAGGACATCTGTTCTTTCTCAAAAGAGAA
GTTTTGCTTTCTTCCTTGGAAGCATCTTTTGTTCTTGACTTCCTTCCCAACCAGATTATCCACGTGATACTATATGCAGTAGACTTCGACATATGTGTCC
TTGTATCCATCCTCTGCCCTTGCCAATAAACTCTTACAATGCCTTTAGTCATTTTGTGACAATGTTATCCCAACATTATGTTCCATGGTATCAGTATCAG
CATCATTTATCTTCTATATTCTGTATTGTTCCGGTAAAAGTAAGATATAATGGAAAGATAGCTTTGAGGAAATGTTGTTTAACCTTGACAATTAGAGCTT
AGATATTTTGAAAATATATAGTACAGAAGGTCTTGTAACAAGATAATGTAAAGCTTTCAATTTATGAATTCTAAAGATAATGTAAAACCTTTTAAGCTCT
TTTTTGTATTTTCAAAGTAATCCATGTGGTTTCCATTATATGCGAATATTTTCCATGTATGGGTGGTCCTTATTGCATGATTATGTTTGACCTATTTGTA
TTACCTAATTGATCATGCAAGGCACATTTTTTGCCTTTGGTTAACTGCTTCTTCTGATGCCCATACAGGTTCTGCTGCTTATTTATATTGGCGTTTCTTG
GTGTCCTATATCCATATAATCGTGGAGCTCTCTTGACATCCTTGGTCATAATTTATACCCTTACATCTGCAGTTGCAGGATACAGCTCTGCCTCCTTCTA
CAGTCAATTTATTGAAACTGGATGGGTAACTTTCATCAACTTCCTTCCAACTTTTTATTTCTCTAATTATTGTTTATTCAGGAACTGAAAACTTTTTTTT
TTAACCTCTAGGAAAGGAGTGTTACTTTCTCCGCAGTGCTCTTCCTTGGACCATTCCTCGTACTGCAGTTTTTCCTTAATTCAGTGGCGGTATCATTTGG
AGCTACTTTAGCTATTCCATTTGGCACCATACTTGTCATTATTCTTGTTTATACCCTCATCGCTATTCCACTGCTTGCTCTTGGTGGGATAATTGGCTAT
CGGCGTAGGTCTGAGTTTCAAGCACCGTCTGCCACAAAGAAGTGTGCAAGAGAGATTCCATCGCTAGCTTGGTACAGGAAGACACCTGGTCAAATGTTTT
TGGCTGGTCTTCTACCTTTCAGTGCCATTGTTGTTGAGTTACACCAGTTGTATTTTACCCTTTGGGGCTACAAGATTTCAACTCTTCCTGGTATTCTTTT
CTTTATGTTTATAATCCTTATACTGCTCACTGTGACCCTAAGCATTGGTTTGACATATATTCAGCTGACAGTGGAAGATCATGAATGGTGGTGGCGGTAT
GTATCAATTTGGATCTTTCTTTGTACTAATCATTCCTAGGGACTGCATGCATACATATCTCGCCCGTTACTATTTTCCTCACTGCATAAGCTACCTTCTT
GTGACTTTATGACATTAGTGAGTGACTCATCGAATCATGGTACCGTGAGAGGTACTGTGTGTTACATGAGAACTGAATGACAACTGAGTATTGTTGAACA
CCAGATGCAGGACACTAGAGTTAACAAGAGGTCCCTCTCTTTGGGACCAAATCCCACTTTTTTTCTGTTCATCAATTACAGTTAACATCAGTTTTGACAT
TCATGGTAGTTGTCATTCTGGTAATGAAATTGAACTCTTTACATTTATTAAATTGGGAGTGCCAAATAAGTTTTACTTGGTGAGTTTGGTGTAATTGTTC
TCGAAGTTGTAACCCTCATTTATACTGGATCAATATATATGTTGAGCAAAATGTGAACCCAGATTCAAAAGAATTTTAGGTTCCCAAACAATTGTTAGCA
GATATCTAAGAAATAACTGCAATGTAGCTTAATTTACTAAGTTGCTGCTTGCTATTCATTTGTTCTATTTGCTAGTTCTTTCACAAAATCTGTGGCTGCC
TCAGAAAACTGATCAATATGGTACTTGGTGCAGGTCTATTTTCCGTGGGGGCTCAACTGCTGTATTTATGTTTGTCTACTCCATATACTTCTATTGCAAA
TCAAACATGAGCGGAGTCTTGCAGACTACCATCTTCTTTGTATACAACACTTGCATATGCTATGCATTTTTCCTTATGCTTGGAACAATCAGTCTCCGGG
CTTCCTTGATGTTTACTCGTCACATCTACCATGCTGTAAAAAGTGAATGAGAGTCCTCCTTGATTGCTACTTCTTGAAGCACTCTTCAGTGATCTATGAA
GTTGAACAAAAAGGGTTTCCATTTTCATGCTTGATATCATTTTACAACCTCTTCAGTGATAGGAGAAGCTAGACAAAATGGAAAAATGTTTCTTGTTTTT
GGACATATGAGCATTGACAGCAAAACTAGCAGAAATGTCAAATTGGAAAGTACTCGGCATCCCTATATGAGCTGGAAATATGACTAGAGTCCAGATGTTG
GATGAAACTATGTAGTTACATTTTTCTGGTTCATGTTCTCAACATCAATTTTAAATTTTAGCACTGTCTGGTAGTTCATTCTGCTTACTGTTTGTTGCTA
TACAGCTGGGGTTTGATTCGATGGAAGTTGTTTTGCAGTTTATGGAGCCATTCTATCCATCAACTATGTGAAAATACGATGAAATCTGCATATTTTTTAA
CTGCTCAACACTTCAGATTCCACATTCTGTTATCATACTATGCTAACACAAGATTTTTCCATGAGACAACTCCATAGGCATTGGACGGAAGTTGCTGGTA
GGGTTTTTCGTGATCTTATTAACAGTATCAATTAACGCGAAACAAAAAAAAATAAAAATTGTTTCTCATATATAATATTCACATTTCACACTTGCGAGTT
GAAACGTCAGAGGATTCTTCCTTTTATTTTTTTAAGCATGGTGAAAACTGCACCCTGCTTTTTTGCAAGTACAATAGCTAGTCATGAGAACATGTTATTA
GAACAATATCTCATGTGAGACGACTCTTTTTAGGTACCAGGAATTGTAAGTGGAAAGGGTTACATTAGTTTTAATTAGCCAATTTCGGAGTCAGATTTTG
TAAGAAAATTAAAATATAAAGAAGTAAATACACAAAATCAAAGAAATCTAACATCTACCATCAATAAATTTTTCTTTTTCGAAGGAGATTCGGATGAACC
CCTTGCTCTCATCTAGATTTATATATGTTGTTAAGGTCAACGTCATATACAATATAGTCTCATTGTAAGTTGTGATCATGACAAACATTAATTAAGAGAT
AAAATGATTGAATTATAATTATTTTTTTCTTAACAATAAGAGTTAAATGTTAAAATATAACAATCTTTTCATGTTAATTTCCCTATTCATTAATGATAAA
CATATTTTACTTCCACGTTCATAAACGAACGTGATTATCACTTCCAATTTTTTAAAACCTAGCTATGTTCATGAAAAATTAAAAAAGCTAGAAATAAGTT
TAAAATGTGACAAATAACCATTAATTGAGTAAGTATTAAGGTTAAATAAAAAATAGGGAAAAGGGTCAAATATGCCCCTAAACTTTTCGAAAAGGTTTAA
ATATGCCCTCGTTTAAAGTTTGGTCCATTTATACCCTCGTCGTCCAATTATTGGTACAAATATGCCCTTATGGGCGTTAGTTGGTCACCTCAAAATATCC
AGCGCATTTTACTTTTCTTTAATTGCCCAAATGGATTTTCCACGTCATTTTAATATTATATCGTGGCATTTATATTACAAAAGAGAAAGGGTCAAATATG
CCCCTAAAAATCCGACCCATTAAACCCTTTTATTATCCATATTTTATGGTTCAATTATATACCCCTCTTTTAAATAATTTATCCTACCATATCCGATCCA
AAACCCATATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNCCCATTATCGGGATACCTTAAGCATGTATGTATATAGTATTTTAGTGTGTTCTAGCTATTCTTCTCATAATATTAGAGAAAATGGCTAC
ACTATTTATTTATGTCATGATTAATTATGTTGTTGGGAAGAAAGGTCTTAGATATATCTTCGACATGTATGAGATCGATGTTATTATATATGAATATTAA
ATATATAAACATATGTCTATTTATGTTAATATTATAGGTTTGGCTGTAGAATATTGTGTAATTAATGATCATGTTTAGTACTATCTTAGCAAAAAGTGGT
TGTATATGTATAAGTGTCGCAACTTAATTAATGTTTGATATTATTGTTGCTAATATTTGCTTTTGGATGTAAAGTTAGTACATTAAACATCATATTATTG
TTGCTCTTTTGTTTTATTTGCAAGATCTATATCATAAACATTTCAAGGTTAATCTTTAATGCAATATTGGACAATTTGAATAAGTTCTTCAAGTGTCATT
AAATGACATTCATAAATTCCCACCAGAAGTAGGTAAGGTAAAAAAACTTTACATAGTTGATCATAGGTTACTATTCAACACTTCAATATTGCCAACTACA
CGATTATAGGCTTTATTCTTATTTGAAAATCAATGTATTACGCCAGTAGTCTATTTTTATGTACATTTTACAAATAATTTATCATGCTCTTATTATTATC
TATTACTATTCATTTTTAATATCTAGATAACTTATATAAATATGAGTAATATAGTAAAATTTACCTTTATATTTATTCTTTTGAAAAGAATTTGTTAAAT
CAAATATGGACCTGAAAAATAGTAATTGTTTTGGCTTAACATATTTAGAAACATTCACCGTCTTGAAAATACTATGAACTTCAAAGGAGTAAAAATGCTT
CTTCTTAACTCGAGCAAATTCACTTACCAACATTTTCTTTATTGGTATATGCTTTGCTTAACTAGCCATCGGAAGAATTTGAGCATATCCTGATTAGGTA
TCTATCTTTGTATTTAGATTCTCCGTCTAATGCTAACTTTAGGCCTTTAACGCTCTTCCCTAACAAAGGTGTATTCAGAAACTTGAATTTGAGATCTCTA
ATTAAAAATAAAGAATACTTATCACTCTATCACATTCCTTGATGATTACTATATTCATATTTATTAAGAAGCATTCACAATCGTAGACTCTGCAAATTAA
TATATGCTTGTATGCAATCATGCTCACTATTCACTAATCAAGATTAATTAATATAATTAATTATAAACAATGAATTTGAATAATCTGTTAGTCGAAGGTG
TAGTAAAACTAAAAGGATTGAGAGGGGGTCATATGTGAGAAACAAAAACTCAAAGGGTGTAAAGTGTAGTTTAGAAAACATTATGACAGGTAATGCTGAT
GTCCGTCCTATCTTATGTGTCCTTATCAAAACCTCCGTAGACTTACTCTCCAGTCTACAATTCGAAGCTCCATACTTTTTCGATACGTATCTGTGTGAGA
GAGAAATGGCGATAGTGTATGCGGTTGTGGCGAGAGGCACAACGGTGCTGGCGGAGTTCAGTGCCGTGACGGGGAACACCGGGGCGGTGGCGCGGCGGAT
ATTGGAGAAGCTTCCAAATGAAACGGAATCGAGGCTTTGTTTCTCTCAGGATCGGTACATCTTCCATATACTCCGATCGAATGGAATCACCTTCCTTTGT
ATGGCTAACGAAACCTTTGGAAGTGAGTATAAATTCCGTCTCTGTTGTAGATTTTGTGTGAAGTTTCCTTTTTTTGTCAATCAATTTATTTCTCCAGCTG
TTAAGTTAATCTGAACTATAGAGCTAGAAACAAATAAAACCTGTTTCCAGATTAGGTTATTTTAAGAAATCTATTAAGTATCTAATTCATGAACTTTAAA
TTCTGGATCTGCATCTAATTTAATCCTGAATGGCTCCATGAACAGACGCTGATTTAGCATTTGGTCACTGTTATCCTCAACTTAAACCATGTTTATGCGT
GTGTTTGTGTTTTGGTTTAGCGCTCTTTGTTGTTCGATGTTAGAATGGCCAACTTGTGTGACTTCAAAGATCATATAGAAGCTAATTAGTGTCTTCTCAA
TATCTGGTTGGCACAAATATACCCTTGATTGTCCTATTTCCATCTGCAAATCTCACAGATGCCTTTCTGACTTTCCTAGTTTCATCTATTCAAACCTTTT
TTTAACGAGCATCTTTCAGCACTTCCTGAAAGAAACATTGTTGGCATTGGAAAATTTGTGAGTTGATATTTTATGGATATCTGTTGCTAAGGACTGAAAA
TTCTGTTAGTCATTTGAGTTATCCTTCACTCCTGCCACTAACGAATGCTGTTCTAGGGAGGATTCCGTTCTCATACTTGGAGGATATTCAGATGAGGTTC
ATGAAGAACTATGGTAAGGTGGCTTCTTATGCTCCTGCCTATTCCATGAATGATGAATTCTCAAGGGTCTTGCATCAGCAAATGGAGTTCTTTTCAAGTA
ATCCAAGTGCAGATACACTAAATCGTGTCAGAGGAGAAGTTGGTGAGGCAAGTATTTTTTCTGTTTACTTGCCCAAAGCGCGTGAAGCTTAAGGATTCTT
GTTTCATCTTCATTTGTTTTCCTTTTATTTATCTTTTGTTTTATCTGTCTTTTATGCTTCAGGTATTGAGTCCATGGATGCATGCATTAACTCTCCACAA
TATCCACAGTTTATTAAATTATCAATGGTTTTATATTCTTGGAAACTAAATAAGCTCCTACAGAACAGTTATGCATCACGTTTCAATTAAGATAATTTGG
AGTGTTGAACACAAAATCATTTATGATGATTTTCCGATGTTCAATCACTGCTAAAATAACTTCTCCTTTCCCTTAACTCTTACTTATCCTTTGATATCTG
TATACCTTCCTACAAGTACTGTCTGGCTTTTATCTCCACTTCGTAGAACTCGAGAAGCAACTAATGATCCTAACATCTCATGCAGGGATAATCAGCACCT
TTGTGAACTATAAACTTACTCTAATCTATTTTATATTCTGTATGAAACTCTTTCCTTCTACTTCTTCCAAAAAGAATAATATTTCTCTCAGTAGGAAACT
CTTTAACTTTGTACTTCTCATTTTGAGTTTGGTGGCATGCTCTTATAGCCATAAAATGTTATGTCATGTTTAAGACGACAAGCTCTAAGGGTAGTAATGT
TTGCCATACTCTTTTCTTTTCTGAACTCTAAACTGAGTCAAACACCACCATGTAAAATGAAATGGAGGGAATATCATTTACGACCATTTGATTTTTTCCT
GCAGTAAACAACTGACAGTTTTATCTTACAATATAAGTTGCTGTAGAGAAGCAAAGGAATATTATACCCTATTGCATTACCTAGTTATGATTCTGGTCCT
ATTGCATAATTTCGCTGCATGTGTTCAATTCTTACCTTTCTGGCTGATGATTTTTATAGTGCATTTACATCATGATATGCTACTGTTACATCCTTTTTTT
TAAAATCCCCACTCCTTCATGTATTGCAACTATTCTAAAAGTACAAAAAACTCCTTCAATGTACATCCAGATACGCACCATCATGGTTGATAATATTGAG
AAAATACTTGAGAGGGGGGATCGGATTGAGCTACTCGTTGACAAAACAGGAACAATGCAAGACAATGCATTTCACTTCAGGAAACAGTCGAAGCGCCTTA
GGAGAGCTCTTTGGATGAAAAACGCAAAGCTCCTGTAAGTATCTTTTACAAAGTATTGTAGACGTAGTCCACATCAACTAAAAAAGTGACTCACACTCTT
ACTGTTACAAGTTTCAAGCTCAGAACACTGTCAATTCAAATTATGTATACCCTGACAACACTTGCTATAATGAACGCCAACTTTCTCTGCTAATAATGCT
GTGACGTTAGTGTTGCTGAAGGCATACTTGAAGGTGTGCTTAAGCTCTAAAGCTATTCGCAGGGCAAACTGAGCACTTAGCCTTTCTTAGGCTTGAAAAG
TTTTTAACTAGACAATTAAACATACTTGGCAAAGCAATATGTTACTCATTTATTTTGATTTTGGCTATCAACAAAAATTTTCCTCATTCAGAAAACATTA
GATGAATATGTTATTGTTCAGGAATTGGAAATGTTGAAATTTAGTACTCCATTAGAAAAGTAGTTAGTAAATTTGATGAGAAACAACAATCAAAAAATAA
ACGTGAAACTGCACCTTTATAGATTGAACTTGAACATGATTGACACAGTATTTATGGTTAAAATCTTTGAGTTAATTGAAAAAAGTGAATTCGTTTGTAC
TAAATTTCTGTCTGTGGTTGAAGTTACTTTTTTCTTGTATTACGTGTTTATTTTTTACTTTAAGAACGTGCTTTAATTGGGTATTTGGAGTTCGTAATCT
TCCCCAGCTGCTATTGTGGTGATTGTCATAAAATGATTGCAGTGGGCAGTAGCTAGTCAGTGCTATTTAGGCTCCCCCATTTCTAGTCATTTGATATAAA
CAGGTGCACAACAATGCAAAAAAACTATGTCTCAATCCCAAACTAGTCGATGTGGTGGACTACTTTGCCGACATCCATCCATGAGGCTGGAACCGTTGCT
CCTCATATCCAAACAATATTATGATAATCCCTTATCCATTTTTCATCATACTCCAGTAGCAGTATAACATGTTCCTAGGTTCGGTGAGCTTAATAAGGTT
CAAGATCTCATTGTATAGCTTGTCTTTTGTTTCAGTCGTCTTAGGCTTGGGTTAGTTGGTGTTGCTGTTTCATACTTCTATCAACCTTGTTCGAGTTCCT
TTATAAAATATGACTGTTGGAGGAAGTAATTTACCTTTAGTTCGACTAGTCTAATACTCTAACTACATCAAGATTTGCATCATTCTCGTCCAAGAAAGTT
CTTAGTTTGAGGCCTTTTGGTCTTGTATATTTGTCAATCTGAGCTTCGCAACTTTCTCATGACAGGGGTTTGTTGACATGCCTGATTGTGCTCTTCCTTT
ACTTGATAATTGCTGCTTGTTGCGGAGGCATCACTCTACCTTCCTGCAGATCATGAATTCTCTGAAAAGGAGCACCATATTTGCCGCACTGTGGTTCATA
TTTCCAAGTACATTTAGATGAACTATATCATCAGATTGAAAGGTTATTGTATAATCAATCCAGTGGATTCTCGTTCTGGCACCTTTAGAAGTACATGTGC
GGAAAAGAATGATAAGGTTTGTATTGTTGTTGACAAAGCCTGTTGCCTTTCTCATTTGTAAATGTTCTGAACGACTCCTAAATTACTCTTAAGGTGTAAG
GTCTTCCGTGCCTGTTTGTAAATATAATGCTGTGCCGTGACTTACCTTTTGTACCATTTGTTCAAATGTATGGCCTGGACACCAGGGTTGTCAAAAATGT
CTCATGCCCGTTTTATTGGTCTGAGAATGGCGTGATGCCAAATTCTGCCGCTCCACAGTGAGCATTTCGATCTACTGGAAATTGACCAACTTATTTTATC
ACTTGATAACTAAACAAAATCCTATTAACTTTAATCATACATTGTATTTATACCGAAAAAGTTATGCATAACTCAGTAAATTACCTTTTTTAGCAGTCAA
ATTCTAGATCAGTTTCTAATTTATCAAAATGGCTTTTATAGGGTCCCAGTTCCACTAATATACCTGCCGTCCATGCACTGACTACAAGACAAATACCTCA
CTATGTTTGTTAGTGCTTGGTAATATAAAACCTTTTCTTTTATGAGAAAGTTCACCGAGAATAATTTTCTATTTGTGGCATAACTAGTATATAGTGCAGA
TTGACAAGAATTTAATTTTGCAGTTGGGCACATGAACAATTTTCCTCAAAGTTGTAGAAAGTACTTTTCATTTTCTTGTCACCGAAAATTATTTATAATT
GAAATTAAAACCGAATGAGCTGCAAGATTCAAGTCGAATTTCAAAAGAATTGACCAAGAAAAAATTCAAAAATATCCCCCACCCCCTACCAAACACATCC
TAAAGTGAGGTATAGACTGGGACTGGGATTGGGAAAAGGGTAAAATGCTTTCACTAGCTTAGCAAAGATTCCACTTTGTTAGCTATCTTTCTTTCTCATT
TCCTTTTTTCTTTTTCTTTTTTTTGTTATATAAGCCAAAGTAGGTACCCAAAAGCATCAATATTTTGTATTGCTTGGTGATTCCTCTGTAGTCCAGTATT
TCATTTTCTACAAGTTCCACCTCCCTCCATAATTAACCATTATCAATCTTATACATTCTCTATAATGGAAACTCTTCTCAAGCCTTTTCCATCTCTTTTA
CTTTCCTCTCCTACACCCTATAGGTCTATTGTCCAACAAAATCCTTCTTTTCTAAGTCCCACCACCAAAAAAAAATCAAGAAAATGTCTTCTTAGAAACA
AAAGTAGTAAACTTTTTTGTAGCTTTCTTGATTTAGCACCCACATCAAAGCCAGAGTCTTTAGATGTTAACATCTCATGGGTTGATCCTAATTCGAATCG
GGCTCAATTCGACGTGATCATTATCGGAGCTGGCCCTGCTGGGCTCAGGCTAGCTGAACAAGTTTCTAAATATGGTATTAAGGTATGTTGTGTTGACCCT
TCACCACTCTCCATGTGGCCAAATAATTATGGTGTTTGGGTTGATGAGTTTGAGAATTTAGGACTGGAAGATTGTTTAGATCATAAATGGCCTATGACTT
GTGTGCATATAAATGATAACAAAACTAAGTATTTGGGAAGACCATATGGTAGAGTTAGTAGAAAGAAGCTGAAGTTGAAATTGTTGAATAGTTGTGTTGA
GAACAGAGTGAAGTTTTATAAAGCTAAGGTTTGGAAAGTGGAACATGAAGAATTTGAGTCTTCAATTGTTTGTGATGATGGTAAGAAGATAAGAGGTAGT
TTGGTTGTGGATGCAAGTGGTTTTGCTAGTGATTTTATAGAGTATGACAGGCCAAGAAACCATGGTTATCAAATTGCTCATGGGGTTTTAGTAGAAGTTG
ATAATCATCCATTTGATTTGGATAAAATGGTGCTTATGGATTGGAGGGATTCTCATTTGGGTAATGAGCCATATTTAAGGGTGAATAATGCTAAAGAACC
AACATTCTTGTATGCAATGCCATTTGATAGAGATTTGGTTTTCTTGGAAGAGACTTCTTTGGTGAGTCGTCCTGTTTTATCGTATATGGAAGTAAAAAGA
AGGATGGTGGCAAGATTAAGGCATTTGGGGATCAAAGTGAAAAGTGTTATTGAGGAAGAGAAATGTGTGATCCCTATGGGAGGACCACTTCCGCGGATTC
CTCAAAATGTTATGGCTATTGGTGGGAATTCAGGGATAGTTCATCCATCAACAGGGTACATGGTGGCTAGGAGCATGGCTTTAGCACCAGTACTAGCTGA
AGCCATCGTCGAGGGGCTTGGCTCAACAAGAATGATAAGAGGGTCTCAACTTTACCATAGAGTTTGGAATGGTTTGTGGCCTTTGGATAGAAGATGTGTT
AGAGAATGTTATTCATTTGGGATGGAGACATTGTTGAAGCTTGATTTGAAAGGGACTAGGAGATTGTTTGACGCTTTCTTTGATCTTGATCCTAAATACT
GGCAAGGGTTCCTTTCTTCAAGATTGTCTGTCAAAGAACTTGGTTTACTCAGCTTGTGTCTTTTCGGACATGGCTCAAACATGACTAGGTTGGATATTGT
TACAAAATGTCCTCTTCCTTTGGTTAGACTGATTGGCAATCTAGCAATAGAGAGCCTTTGAATGTGAAAAGTTTGAATCATTTTCTTCATTTTAATTTCT
TTGATTATTTTCATATTTTCTCAATTGCAAAAGTGAGATAAGAGCTACATACTGTCAACAAATAAACTACTATTGGAAAGTTAAAATAGTGTGTTTGTTG
TATGTTATTCTAATGGAGTGGATTTTGTAAATCAATTTATGAACTGCTCCACTCTGTTCCTCTTAAAAGCCTTAATTCCAACATGAAGGGAACTGCTCCA
TCAAATTTTTGAGAATGTTTATCTGTCAATGGCCCTCTTTCCCATTATTTTAAAGTTCAAATAGAAGTGCAACAGCTACAAAGAGTTGACAAATACAAAG
CAGTTATTACTTTTAGGTTTCTTCACCAACTAGGCTAAGCCATTTTTCAGTCAGAAAAAGGCTAACACGGCAAACGTTTTGATCAACACGTGGAATTTCA
CAAATAGAGTTGGAACGGGAGAAAGTACGCAAACCTAAATTTGAGTGTGAGGTAGGTTGAGCGGATATAACTAAATATAAAATTCCATTTGAGGAACTCG
TTTTTCTTACTTTCACTAAAATTATTTTACTCATTTTAAGTGGCGTGTTTTCCTCTAGAAATATTTTTCTAATTTTTAAGATTTTATTATATGGTATACT
ATTAAATTCATTATTTTAGTATATATAAATGATAAATGTCATTTTATGTAACAAAAGATTTATAGCATGTGATTGATTCAAAATTCCCCTATTTATTACA
CGAAAAAAATGTTCATTAAGCCAAACTTATTGCTCCCAAAGTACATTTATTATCATTTAATTTTGTTTTTCCTTTTCATATTCAATGAAAGAAGGATACT
TCAACATTTAATTTTACACTTTACAACAACTCCTTCATTTAAAAATTCTCAACCATTTCATTCAAACTAATCCATGTCCCCCCACCCCCACCATACTCAT
ATATATGTGTGTGTATTTCCATCCCTTCTCATAACAGTAACTTATAATCTTACATTAATACATACAGCCCCCTTATTTACACATATATTTCTTTTGTAAC
GCAGAAAAGTAGTTATTAAAGAAGCTATCTCAAATACATAAGCAATATAGTAGTAATACTTATGGATTCAAAATCCACTAGCTATGAAACAGCAATTAAC
ATGTCTGAAACAGAGTCCACCAAGCAAAAATCATCTTCTGGTGCACCAATTATAGCTACCACAAAGACCATTTCACATAATCAGAAAGGAGGATGGCGAA
GAGGACTTAGCATTTTCGACTTTATTTTGCGACTTTGTGCCCTTGCAACTACTCTCGCTGCTGCAACTGCTATGGGAACTACTGAAGAAACTCTTCCTCT
TTTCACTCAGTTCTTTCAGTTCCAAGCTAGCTACGACGATCTCCCTGCTTTCTCGTACGTTTATTTATTTATTCCATTTTGGAATGCGTTATAATTAATA
ATTGAGTTGATCTTGATCATGTTCTTTTTTAAATTCAGGTATTTTGTGGTGGCAAATGCTATTGCAAGTGCATATGTTGTCCTGTCTCTGCCTTTCTCCA
TTGTTTGCATTGTTAGACCTCATCTCGTTGGAGTCAAACTTTTGCTTTTAATTCTCGATACGGTAATTAAATTCCGTTCATTTTGATTAAATAATTATAA
CATTTTTACATTTTAAAAGCTATTTATAATGTTGCAGGTAATGGTGGCATTTACTACAGCTGCAGCAGCTGCGGCTGCTGCCATAGTGTACTTAGCAGAA
AACGGCAACTCCACCACACAATGGGTGGCGATATGCCAACAGTTTGGGGATTTCTGCCAGCGAGTGAGCGGCGCAGTGGTGGCGTCCTTTATTGCAGCAT
TCATCTTCATCATCCTTGTTGTTTTCTCTGCTGTGACTCTACGAAGGGCATAAAAATTTTCTGAAAAAATTGGATTTCGTGTCTTTCATTTTGATTTTGT
TGTAATTTAATTGCATGCGTCTTTGTCCTTTTGAGTTTTTGCTTATTCACTTGTGTAATTTATCCACCTTTTCTCAGAAATTTGATATTATTTCAAATTC
AATTTTGTCTTTCGTCTAATTCTAATTTTAAAAATTACTGATAAAATACGATTTTAAAATTAAAAAAAAGAAAAATATGAACACTAAATTTTATTTTTAT
GACGAAGTAAATCACACTATCATTCATTTTTGAACGCCCACAAGCTAAAATTTCAATTTTCATGTGATATTTTACTAATTACACCAAAAATATTTATATT
AGACAAATTCGATGTAACGAGCTCAATCCACAGACTAATATAAATCTCGAGTTTAAAATCTCTAACGTTAACAATCTCAAGCCCAAACTAGTGAGCAGGC
TACCAGCCCAAAGGATAATATGAACACTATGATAATTCTGCTCAAAATTTAAAAAACAGAAAGATATGAAGCAAATAAGACAAACAAATAAGTAATACAC
ATTATAATTAATCATATTCATTTTCCTATATTCCGTATTTATGAAATTTAGTCAAACGTGAAAGGTAATGCAGTGGGCAGTGAGGGTTGCACTAGTCGAC
ATGTGTAAAGCACTTGACCGTAACAATGGTAAAATTCCCAAAGTGACGTGTCCATTCTTCCCCTTTTTCTCTCTTCCTTCGCCTGCAAGGTAATTACATA
CATTTTTTTCCAATATCCGCTTCACAGATTACATACTATAAACCCTAATCACTCCCAATTTCTGCTTCAATTCGGTTTCATTACACAGTAATTCGCCTCG
AGGGTTTTCTATTGGTAAGTTCTTGCCCCATCTATCTTGAATATCGAATGTGTCTCGGCATTATTGGTTATTTTCTATCGATTTGCGTTTGGTTAGAAAT
AGTATGGTATGCCATCTCTTGATATTTATTATATCTAATTTGTTACTAGGGAATTGAATTTATTTGATGGTTCTGGGATTTTCTTTCTCATATTTATTGT
CTTGAACTTCTATTTTAAATGCCACGGCTGTTTTAGTTTGCTATATAAATGTGAGATCTTAATAAAATTGTATAATCCTTGACAAATTTTTTAGCTTTGA
AATGAATTGGGTCCAAAGAGGAGAATGGTTTAAGAGTTAAAGTGTATTTGTCTCAATTTGTTTTGGGATTGAGAAATAGTTGATACTGATGATCTAATGA
TCTTAATTTCAGCTTTAAGGTTGTGGCTTACTTTTGGGAAATTTCAAGGAACATAAAGAGAACAGGCCTTGTTGTTTCAAAAAAGAGTTTTGGAAGTGAA
GTTCTCATGAGAATTTTTAGGGGAATGCAGAAAGTAGCTCGCGAGGATCAAAGGGAAGTAAGTTGCTGCAAGAAATCATTCAGTAAAGGTATTGGTGTGA
CCGCCCCAAAGGCCAGAAAGCGAGATAAATTGAAAGTGTTTCTCTAATTTGGGTCAAGGCAGAGTGATTGTTCTGTGGGTCTCTAGTTGAAGAAGGGCAG
CAAAAATGACAAGGATACTTGTCCAGAGAGGTTCTACAGGGTCTTCATCGTCATCGTCAAACCAGAACAGGTCGTCAGTGTCACTCCCTGGATCATCTGC
TTCTTCTTCTTCAGCTTCATCACAGCCACAGGTTTCTAGTACTAGTCAAGTGCCATCAGCTCTGAAAGATGATGAGTTGGTGGGAGAGTTTCCAGAAACA
ATTGTCTTGGATGATGTTTCAGTTGGTTCCTTCAATCAGAAAGGTGATGGTGATGATGCTTCAGTAGAAAGTTTTAGCTGTGACCGAAGCCTCCTTGAAG
AAAAGATTGTTGACAATGAGAAGGTTAGTGATGATGCTTTTGTCTGTGGGGACTCCATAAAAGCATCTAGTGGTTTAAGAGTTGAGGTAGTGGAAAATGA
AGGTACTTCTCTGCTGGAGCCTAAAGGTAGTTATTGTCCACCTCCCCCTCCACCTCCTGTCCCACCTCCTAAACCTGCTTCACTTAACCCTAGACCAAGG
AAATTTTCATTAGGTAGTTCAAATGCAGTACGGATAGGATCATCTAGGGAATTTGTTGGGCAGACCAATGTGTCAACTAGGACTTCACCTACTGGATCTA
GGCCATCGTCTCCACGGTCACACAGCGAAAGTGAAGGTTATAATAGCGCAGATGAGCAGAGTCCCAACTTTGGATCCTCACGCAATGATGTGGTAAGTCC
AGAAACTTATCTAGTAGAAACTGATGAAGGCTTCAGTTTATGCTCCTCTTATCCATTATAGGAATAGGATTGATTACTGGTTGATTTCCTAAGCACATTT
TATCAGCAAATACCGTCCGCCCTGCGCTAAATTATGCATCACATTAGTTGCTGTTGGAATGGTCATTCTGCTCATGTTGTTTAGCATGAGTAAAGGATGA
TTTATATAGTAATTTACAAGCTACAATTATCCTACTATCAAACACTGTTGCACATATCTGAAATGTGAAAACTTAACAGTTTTCATATTGTTTCAGGAGA
GAGAGCACCAGTTTGAAATTGATGTCAGAAGATCCAAAGGCTTAGAAGTTAAGAAAATGCGTGAAGATGGGAATTGCCTCTTCCGTGCAGTTGCTGACCA
AGTATATGGTGATTCTGAAGCTTATGATTTGGTCAGGCAGATGTGCATCGACTACATGGTAATTTTTGTGCAGAACACACTGTATACATGCGATTTTATT
TGTTGACTTCCTTTTCTTCTTTGGTAGGTTAAGAGTTTTGTTCACTTAATTTTGGTTTCATTTAGAAATGTGTTTTTTTAACATGCTATTAGATGGGGAG
ATGAAGCTATCCTCTTGGTTTTACATTAGAGGGTCACCAGTTTAATTTGGTCTCTGCTTGCTGATTTTTAATTGTAAAATGTGGGTGACAATGGCCTGGT
ACAATTGAGGATAGAAAGAGTGCACTGACAGAACAAAGTAGAGTACATAGCATCTACCATAATCAAATACACATCTGTTAATTTGAGAGCCAGATTGGTT
TCCTATTTGTCTATATGTAGTAGGTTCTTGGCATGCTGAGATGTCCTATGTTGCATATCTTTTTTATCTGAACTGAAGTAACTTCTTTCCCTCGACTGAT
GCTACAATTTTTTTCATTATATGGTTTTTGCATAATATTTTTAGTGGTGTATTTATTTTTGGGGTTTTTGGTTAGCTCCCTGGTTCAAGCATAACATCAT
GAATGGAGCCAACACTCCTACTTTTGTACTCTTTGCATCTACTTGATGCTAGTACTGGAACATCCTACTTAATAAAAAAATAAAAATTTAATGGTGTATT
TTGAGAGTAGAGTTCTGTCAAAGGTGGATCGATCCAGGACTGATGTTTATGGTTTCAAACAAAATCTAGTTATAATATGTAATAATTACTGGGTTTACAA
TTATATACTCATAGATATTTAGTGTGTTTCTTAGTACATGTAGAAGGTCCTGGTAAATGCTTATGGGTACCCACTTGTGAACCCATAGCTTGTCTAAATC
CGTCATCGAGTCCGGTAACTGTTCAAGTTGAAGTCACCTGCACTTGCGCAAAGCTGTGTTGTAGATTTGGTGAGAGAATCTTATAACTATGTATAGACAT
ATGTAATATTTGTTTTCCTGAGAAAATAAATAATAAATAGGTATAGACATGAAATTTCCATCATCCCATCTTATAGCCACTCCCATACATTTAAGAGAGG
GTTTTCTTTCAGATCTCAGGAGAGAGTGAGTCTGGTCCTTATATCTATTCTGTAAAGATAATAATGAAAACATCAATTAATAATTGAATTATATTTCAGT
TAGCGATTGGAATTTATGATAAAATATTTGAAAATATCAAGTAAATTTGACAAAACCATCTTTTTTTTTTGAAACTGGTAAGGTTGAATTTGACAAAACC
ATCTATGGCAGAAAATTGTTTTGTAGAACCTGGAGGATTAGGATTATAGTTGGTTGACCACCCATCTCAAAATTTGCCTTAAGTGAACTCTTTAAACATT
AAATCTATTGGGCGCGTTCATCTTGGCATGTGCTACAATGGCATTCTAGTGTATTCTAAAATTGGATAGACGTTCCCATCACATGGCTTCCTGAATAGAG
CAAAATGAATATTGTGAATTCATATAGTCAGTATATATAATTGGGATGGTCTTGATTATTTGATTAATTGACTGATTAGAATGCAAAGGAATGTTTATCC
CAAGAAAAAAAGGGACAACTAGTTTCATTTTACTGGTTGTTGCTAGTTTATTCACCACTAGAATTCTTTGATGGGCTTATTCTCAATGATGATTCTCATG
ACTTGTTCCTCGACTTCTTTCTATCTTCTACCTGGATCAATTAGCTTTCTTTTATCATTAAAATAACCCCCTTATGCTTATCCTTTTGAGTGGTCTGGGT
ACGATTCTTCCTGAAGCAAGGGTCAAGGCTGAGCTTTGGGTTTTTCTTTTTGGGGTTACTTTGTGGTAATAGGGATGCGTTAATGGTCTAGACTCTAGTG
GAAGGAAGTCCACAGTCCATGTATCTTAGAAATTGAGGGTCCCTGTCTGCAGTCATTTTAGGTATCAAACCTCACCTAGGAAAATTGGGGTTAAATTTTG
AAAATTATATTATAGTTGTAGTGCTAAGAAAAACACAGAGGTTTAAGTTCATATTGGTATGTCAAGGGGTGTCNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAACCAGTAAAATTAGACAACTTAGC
TTTTAGGTGGAATATTTCTTCTTACCTTTCTTAATATATCATTTACCATACTTTTTTGTTATTTTTTGAATTTCTGTTTTAGGTGTAATGACTAGAGTAT
TTGTTTATTTAATCGTATATAGTAAACTAGTAATACTTTTTTTGGTCAAAAAAGTAAAAATAACTTGACTAAAACGCCATTGTTTTCAATCAAATAAAAG
TTGGACCCAAAATAATGAAATTCCATGCATATAATATATATATATTTTATTTCTCCTTTAGCTGCATTGACTTCTATAAATATCGAATATATCTCTTGCT
ATGCTCACAGAATATGAACATTGTGAATTCCTAGTAAAATTTATAAAATCACTCATATTTAGACATCATTAGGTGCAAAGTATAAAATTACAAAGACATT
GTATTATCACATTGACAAAATAACATTTTAATTTTAATAATGCAAGGCAGAATCGAAAATACTAAGCTACACATAAATACAAGTTTAAATTTTATTTGAG
CATGAAATCGAGTATTCCGCGTTTCATGTTATTGCTGGGAATACATTGATTTACCCCATGAACATTACTACTCTCTTGCTACTACCTTTACATCATCATC
TAAATCTGAAATTCAGAATTACATTTTCCGATTCCTCTTTATTTTCATAATTGAAACAGAGAGAGAAAAAGAGTAGTTTTAAACCTTTTTTTTTACAAGA
AAACCAAAAAAATAAAAAATAAAAAAATCAAACACCCCTTTGTCTTTGTGCAGGAGCGGAGCTAGAGTTTCTGTTTCAGGTTCGTCCCAATGCTTTGGTC
CGAACACTGTATTTATATGTAACTAAGTAACTTAGAAGGATTAGAAATCTGAACTCGTATGTTTTTAAATATTGGCTTCGCTTCGCCTCTGCTTTTTATG
ATATCTATTTTTTTTAATTCCTAAGTTGTTTTCAAGCAAGATTCTCCAACTTCTCATTTCTCATAATCATTGTCGTCGTCATCACTTGATTCATCTTCTT
CAACATCCTCTGAATCATCATCATATTCTTCATCTTCATCGAAAAATTCGTCATCTGACTGAACAATCTGTAGCTTCAATCGTCCATCTTCTCTACATGC
ATGCAAGAATTCCCACTCAGGAATTTTAACTTCCTTGAGAATAAACCTACCATTTTCTCTAAAAGATTCAAAACAAACACAGGGCTTTCCATTTCTACCA
ATGCAAGAAATTGGAGGAGGCAATAATGCCCCTTTATTTGTTCTTGATTTAATTTTTGTATATTCATGACTTATAATCCCCTGATTATGAATGTTTGTTG
ATCTAATTTCTTCGTGTTCTTGATCATTCCCAATGCTCAATGCATTCATAATATCTTCAACATCATCACAGCTTTCAAATCCAAGGCTTTCTGTACATAT
TGAAAGACAATCTGAATTTCTTGAAGAAAAGCTATCACTATGCTTGTAATGTTTATTCTGACTGCTTGGTGGATAAATGGGGTCTCTGTTTTTCCCTTCA
ACCCCAGATTGGTGAATTGCTTCGAAAGATAATGACGAATTATTATAAGAAGAACATGTCGATGATGACGACGACGATGAGGTGGTGGCAGTGGACAATG
GAGGGAGATAATTAAAAGAAAACGATGAAACAGAATTTAATTCATCAAAAATCTCCATAAAGGATGAATCTTTATTTGGTTTTCTTGATTTAATCTGATT
CCATGAAGAAGTGGAATCAAGAATTGTTGAATTTTCTGGGAATGGTTTGTCAAAAAAGTGTTTTAGGCCTCCACAGGTAACCATATTTAAAACAGAGTTG
TTGTTAATTGAGCTAAGAACTGAGAAGCAACAAAAAGAGTTAACTTCAGCTTGGTTTTTCTAATGGTGAAACATAGGCGATTCTTGTGGTGAGGATGGGA
AGATAAGGTGTCAATGACTTGGTTTATTTAATTAGTTTATATCCAAATTTAAATCGTTACTAAAATTAGACTTTTTAAAACCGTTCCAATTATTTCGATG
ATAAGTGAGTTACGTTGGAGGTAGATATAGAAACATACACAAAACAACACAGGATGAGAATGGGATAGTTGATAAAGTCAAGAGAAATGTGATGTTTATT
AATAGTTCCTGTTTTACAGGAGTACCTCTCAATTTAGAAATGAAATAAATTTTGGTGGTTTCCATTGTATATCTGAAACTGTAAAATTATTGAAATAATA
AAAAGAGTACATGAATATCACATGTGGAATAATTTTACTTGTCAATTTACGCAAAAATAAAAGCAATTGTCATTTCTTTATTGTTGGTTAAGGAATTGCA
TCAGAAAAAAATCAACTTGTTATGCGAAGACAGACGGGCTTTTTAAAAGGCTGATAAGTCGCCTTCTCTCTAATTTTTGTACGTGAGAAGGTTCTAAAAC
GTATATAAAGTATTTGAATTGATATAAAATTACGTTTTAGTTATCTATCGATCTTGAAATATTTTTAACGTTATCGAATCGAAAATATCCTGCACTCGAT
GTTAATCTTTTGATTCATATTTTCTTTAATTTTAATAGCTCTCTTAAAATAAAATTATTAAATATTTATTTATTATATTTCTTAGAGCAACTTTCACATA
GAGGAAACACAAAAATTATATTTATATGCTATAAATATAGTTTGCATAATAGTGCTTCATAGCAAACATAAATATGTATATCTCGCTATATATATGCAAA
AAAAAGCAATTGTATAATTTGTTTCAGTTTCGGTATACATATACCAAAAATTAATTGTATAAATATGTGTTTGTATAANNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTTTTGCATCTTGAATCATCA
CTCTTGTTAGAAATGCAATTAAGGATAGTTATTGGCTTTATTGTGTTACTTTGGATAACGTTCATGGAGATACATTTAAAGAGAATTACAATGCAGATAT
TAAGTCTTGTGAGATTGAATCGTTGTAATAAAAAGACTCAAGATGGTTGTAAATTGCAGAGTAGTTCAAAAAGAATTCAACTAAAGGATGGAAGATACCT
AGCATACAGAGAAAGAGGAGTTCCGCTGGACAAATCCATATACAGAATCATCACTGTTCATGGGCTTCACAGCGCCAAAGAAGTTGATGTTCTTGCAAGC
CAAGTATGAATAATAATAATACATTATTTCTTGTTTTTAATGGCACGTTAATGCTGAATTTTTTTTGCATTGTTTAGGAAGTGCTTGAGGAAATGAGTAT
CTATATGGTACAATATGACAGAGCTGGATATTGGGAAAGTGATCAAAACATGAAAAGGTCAGTAGAAAGTGAAGGTTGTGACATTGAAGAATTGGCGGAT
CAACTACAAATAGGATCTAAATTCTATTTAATTTCAAATTCTGCGGGATGTTATCCTACCTGGAATTGCCTCAGGCGCATACCACACAGGATAAAAGGCG
TGGCTTTTATGGCTCCGATGATCAACTACAAATGGAAATCTCTTCCTCCAGATTTAATCAAATACGACAATACGAACAAGCTTGTGCGAATAATTTATTG
GTTCTGTTGTCATTATCCTCAACTACTCTACTCTATTTTCATACAACAATTTGACGGGGTTCCATTGTGCACTGCCTCTTTGTTTACCGATAAGGACAAG
CAGGATGAGCAATCTGATAATATGGTAAAGTTTTTCACTTACTTAACTCTTAATTAATTTTTATCAGTGATTGATGATGTTCATTAATTTTGCAGAAACG
TTATCCGACTCAAAATGCTTTCGAGTACTCTGTTCTTCAAGATTTTAGGGTGGGTCTGGGAAATTGGGAGTTTGATCCACTAGAAATGGAAAATCCATTC
CCTCAAAATGAAAGCTCAGTTCATATTTGGCATGGCAAAATGGACGATGTAGTAACTAGTACCTTACAAAGATATGTATGTGAAAGGTTACCTTGGATTC
ATTATCATGAAGTTCCTGATGTTCCACATGATTTCTGGAAGGCTGGTCCTGTTGGTGAACCCATCTTGAGGTCCTTTCTGCTTCCCCAACAACATCCATA
TCCCAATTTACAGGGCTAGTCCAAGCAATACGCTCCTTGTTAGGGTTTTGCCTTCATTGCTCGTAGTACTACTTGCTTCTGCTTCAATTGTCAAATTCGA
TAACATAAAAAAACAGATTCTAGTCTGGTTATGTTATTGCTCTGTAATGTTGATTGAGTTTTATTACCAAACATGGTTACTGAGTTTGTTATCAAACATG
GATTCCTTCATTGTTCGTATTACTATCTGCTTCTGCTGCATAATCAAACTTCCTTAGAATGAATACTGTTACTCTTGCTATGTTTCCTTCTGTAATGTTG
TATTGTTTAGTTTTAGCTATAGCAAATAAAAAATTCATATTTGTATGCTATAGCAAAGTTTGCATAATTGCGCTCCATAACAAACATAAAACTGTATAAT
TCACTATACATATACAATTTTATAATTCGCTGGCCTAAATTGTATAATTCGCTGGCCTATTTCGCTGTAATTGTATAGACCGCTGCCCATTTCGCTGCAA
TATTTTTAAAAAATTTACTTTGCATACAGTTGAATCGAATTAAAATGTATATATATTGCATAATTATAAGTGTATAGCAAGAAGATGTATGTTTTTCTCT
CGCTTTATACAAAAACAGAAACACTTCTGTTGTATAAAGCTAGAGAAAATTGTATTTCACTGCAATTGTATAATTCGCAATTGTATAATTTGTTCGCCTT
TTTCTCTGCAATATTTGAAGTAAAATGTTTGTAAATTGTATAATTAAGTGTATAACACAAAGATATATATTTTTGCATGTGTATATATAATTTTCTCTCG
CTTTATACAAAACACAAACAGAATTTATACACTTCTGTGCATAAAGCGAGAGAGGCGAGCGAGAATGGCAAGTGGCGAGCGGGATTTTTGGGAGAAAGAC
GCCTGACAAAATTTAGCTAACGTTTGTTATGGAGCACAATTAAATCAAACTCTAGCTACTTCATTTATTTTAGATTATTAGTTTGCTATTATATACAATT
TTTCCTAATTTTAAACCATTACCGAAAGTAGAAAAGTAAACTACATATTTTTTTCTCCAATAGTTTGATTTGAGACGCAAAAGAATCAAGCAATTTGATG
ATTATTTTTTTCTTCTTTCTTTTGGTGTCTCATACGTTATTTGTAACATGGGTAGATTTGAATAATTATAGTTAGTGTCCATACATACGCTAACGAGTTG
TCAATAACTTTGTTTTGTCTCTCTAATAATATACGTGACATTCAATATATTTACCCAAATATTTTAATTTTCCTCGTAAGCATTAAGCTATGCGCATGTG
CAAGATCGCTTAGAGTTGGTTTTCAAGTAAATTATAAAAAAATAATTTCCATCGATATCGAGTAATTTTCACACCTATCATATATAATAATAATATTGAA
CCTCCTAAAATAATAGTGTGTAGCTGTTAAAATAATAATAAAAAATATTGTGCTTTTTGTGATACAATCGAGGCATTTCTTCATTCAAATGGACACGCAT
TATCACTATACTAAAGACATAACTTTTGTTAAGGGTGTCCAGCTTAAATATATATCATTTAAATGTAGAGTTTGTCATATATTTATAGAAGGTAATTTTC
TGACGAAGGGGACAGCCTGGAGTAGCTATAGCTACACCCTTGTCCTCTTGATATGAAAGGGGAAAAAATGTTATCATCGGCCTTCAAAAGTTGATTCCGA
TCTAGAATTATTTAAAATTAAATCGAAATCGATAAATTGATAACCTATAAGTTCTTGACTTAGGATATAATTTCGTATTTTTATTTTATGATATCTCAAA
CACTCAATTATTCTATAATGCTCTAATATTTGCCTTTAAGCAATATGAATCTATAAACACATGTGACATGTCCAATATGACTCATTTGTTTTGTCACTGA
TTAATCAATATTGGTTCTATAACGATCTAACATGTCTAGAAACTAATAATTAATAAGTCAATATCTTAATAGTTCAATAATGATTTATATTTTATTTTTA
TTTTATCCATAAAAATTCTAATATAAATTTCTACTTCGCTTTTACAAGTAATTTTACTGTCTAATGGCATGTAGCTTTAGATTTTTTAAAACAAAATTGT
ATGACATTGGCTATTTATTAAGTTTATGATATGATAATCGAATAATTCTTCATAATTCTGATTCAGAAAATGATGAATCGTTATGTATATAGTTGTATAA
ATAGCTCCTCAATAGTATATGAAATGCAAGAATAAAATCTTCATTCTTTTGAATCTCTAGATTATGATACGGAACTAATGACTTTTAACTTAAATTTCAC
CTCGCAAAGAATCATTAAATTACATTTCTAGTCAACTACAATTATTATATCTTTCATTTCATCCTCAGTAATTCATTTCAACCATTTTGATTATTTTCCA
ATGATTTCGATATTTGACTTATTATATAGGAACAAAATTTTAGATTATAGTATTTGAGTGTGTATGGTATTAGATATTGATGTTATTCGGTATTCCATAT
TTTTAATCTATCAAATTATTTCCTTAATAAAGGTGTTACATCAATACAATAATTATTCGTTAGTACAAGTGCAAAGAGAAAGTTAAAGAATAAGAATAAA
TAATTCAAATATATATATCTTTTAATTATATCAATTTATTTTTCTTGATGTGTTCTTACTTGTTGATATTCTATTATTATGTATTCACATTAAAAATGGA
AATAATTGGAGAAATGACATTAAACTCTGCAATACAACCAACGATAATTTCAAGACGATATTATCGAATACCGCACTAAATCAAAATTTAATTTACTATT
TACCAAATTGAAATAAAGAGATGTATCTACGATATTATAATTAAATTTTTGAATAAACAATATATAAATAAAGAGATTTGATTATATTTTATAGGGATAA
TGCCCAAGTACCCCCTCAACCTATGCCCGAAATCTCAGAGACACATTTATACAATACTAAAGTCCTATTACCCCTGAACTTATTTTATTAATAANNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGTG
TGGCCGAGTTTAATCCTCAAAGCCCAATTTTAGGTTTTATCTTTTTGGGGTCTTTTCAGATAAAAGTACATGTAGGGATTCGAACCTCCAACCTCCAATT
CCTAGTCAAATTAGGAGAATACAAACCAGTTGAACTAATATAAAATTGATATCCTGTTATACAAGTTCAATTGCTTGTCCAAAACGGAATTAATGAGTTG
TAGTAGTTCATTTGATTTATGTTTTATTAGTATGCTGTAAATAATTTTTGTCAATATAATGTTGTTATATCATTCATTTATTTATTTACTTTAAAATGTC
GACGTTGCTTACAAAAAATGTGTGTATGCCACTGTGTGTCCTCCCCATCTTATCTTCACCCCTCTATGTAGCCTCACCCCCACCACCATCGCCCTCACGC
CCATAGTATTTTTCTAGGTTGTATACAAAATAGTGCTTCTAGGATGATAGGATGATTTTTTAATTTTTTTGCTTCTATACCAAACAGGCCAACACAAGAA
AATAAATAAGAAATCCATTATTTCTGGGTAAGCATTTTCCATGAAAAGCATCGTCCTTCTCCCAAACACACCCTATGCCTCTTTTTGTGGGTGCAGGGGT
GATGGAAGATGTAGGGGATGGGTGGTACATGTGCATATTGTTATTGTTTGGTTTCCATTTCATCATGTCGGCTTCTTGCATTTAACATGTCGGTGTCGAA
ATTTTTTGCTTAAATGTTACGTGCTTGATGCATAATTTTGTATCCTCATGTTCCCTTGATGCCGATAACTTACTGGAGAAAATACAAGAATATTATGACC
AATATCATGTCTGATCACTCAGATAGAGTTTTATCATGTATAAGTTGGTTCATCAGTATCTTTATCATTTATATGTCTTTTTGCACCGCCTTATAACTTA
TTTTGCTGCATCTTTATTTATATGTTTAACATTTTTTTTTTGTAGGAGCGCGAAAGGGACCACTTCTCCCAGTTTATAACTGAAGGATTCACATCCTATT
GCAAGAGGAAAAGGAGAGACAAGGTATGTCATGTGATTATTCAGCAATTATCTATCTGAATCCTTTTGCTGCTTCTGTCTCAACCGGTCGCAAGCAGAAT
TGGAGCACTTGTTACATACATCTGTAAAAATGTTATTTGAACGTGAAAGCACCAGCCAGGATGATGCTATTTGTTAGATGATTGTCATCAGAGATAATTT
TAGTGTAATTGTTAACTGTGTAGTCTGACATGAGTGAATGCTAGGGGTTTCCCAGTGGAAAAGAATGTGGTTGCGCTGTGTGAATTCACTTCTCTATAGT
TTTTTGTTCAATATTTTCATACTGCTTGAACCTCTGAACATCTACATTCTGCTGTTAGTTGTTTGCTAGTTTCTTTATAATGCATATGATTAACTCATGC
ATTGTATTTCCAATTATCTTCAGGTTCTTCCTTCTTTTGACGTTAAGGTGGTTAAGTTTTGCGTTTTGGTCTTAAATCACTTCTGTTTGATTTTTCTTAG
ATATCTTCATTTTCAAAAGGCTGGATTAAAGAACTCTCTTGGACCGAAATTAATATCCGTTTCTTTTTAGAGCTTTTGCTATCTGTCGCATTGGTGGATC
GTGTTTTGCTTATCGATTATCATTTGTGTGCATATCTTTCTTTGTTTCTCAATTCCTTGTTAGAATAACTTGAGTTATGTTTTCATTGCTTGATTGTAGG
TCTACGGCAACAACGTGGAGATCCAAGCATTATCTGAAATGTATAATCGCCCTATCCATATATATTCTTATAGCATTGGTAAATTCTCTTTTTGACTTTT
GATTGTTCTTTTTGTAATAAGATTGGTGATTGTAATACTCAGTTTTGCAGACTTGTGTCTGTTGACTTTTTGCACTAAATTATGGAACTTACTGATGCAG
AACCAATGAACACGTTCCATGGAAGTTATAACTCAGATACCCCTCCTATCCGTCTCAGTTATCATCATGGAAATCACTACAACTCCCTTGTCGATCCTCG
GCGATTATCAGTTGGTGCTGGACTTGGGTTTAGCTCTTTGCGAGGGGTATAGTCTTTAATCTGCAAACAAACATGTTATCTGTAAGGAGATAAGTTGTTA
GTCTCCTCAAACCGTCATTCTAGTGGTCGTGAAATACGATATCAATCTGTTATCTGCTACAGCAATATTGCTTTAGGTTATGCAGTTGAAATTATTCTCT
TTATATACTTTCTTACTGCCATTTCAGTAGTCTGTGAAATATGATAATGTTCTTTCTTCACCAACCTATCAGTTAGTTTCATGTATATATGTTTTTATTT
TCTTGCAGAAAAACGTCGACAAGGATAATGTAAAAGCTGCAATTAAAGCTCAACAGGACCAACAGATCGATAACGTTAAGTACCTATAAGTTCTATTTCA
TTTGAATGATCCCCATATACTTGGCTTTCATGTGGATATTTTAGTTGGCTAAATGGTCCCATTTCAGGCGCTTCTTGCTGAAGGACGCTTCTACTCAGAT
GTTGAGCTCACTGAAAAGGAGATGGAACGGATGGTGATTGAAGCTTCTAGGGCTGAGTATATTGCGCATGATAACAAGTTCCGGCAACAGCTTGGTCGTC
GAGAATCTTCCACATCCGGTGCTGAACCATCATCTTCAGGAACTAGTGAGTGTGATCTTACATTTTGCCCTTCTATTGATGCAAGATCCGTGAATTTGGT
GGTTTGAAATTTCAACATCGAATCACAGGGTCATCAGGAAGTGAGAAACGGCAGGAAGCTGGGCAAGAGCTGAGTTCGCCAGATTCTGCCTTTAACGACT
GCATCCAGGTTATGCTATCTATGGGTTTCAGCTATCCACGAGTGATTGAGGCTTATAGCATATTCGGCGATGATGTGGATTCCATGGTTTGTTACCTCAT
AGAAACCAGCTGTAGCAGCAGGCGCAAAGGAAAAGCAACTGAATGAGGAAACTGAGAAAAGAGCTGTGTGGATTAGTCTATCGTGTTTTTTTCTAGTATA
AGCATTTGCTTTGTGTTCGGTTGTCTTCTGAAGAGTACGTACTATCTTATATGGATTATTCTAATGTTTCTAAGTCGGACTCTGAGATTGTATTGCTATG
TTGCTGCTTGTGTAATGCCATATAAGTTGGGTAAGAACAAGGCTTTTGCTTAAAATTTGAGGATAATTTTTTTTTGACATTTCTAAGTACATGAAATGAC
CCAAGTATTTTGTAGTTCATCTACACGTCATAATTCATGTTAATTTGAGAATAATTTTTTGACATCTTTAAATGGAGCAGAAAATGTACTCCTAACTTTA
CTAACGTACACTGCTGCAAGGATTCTTTTAAAAAAGAAATTAAAAGTTGGTTTTTTACTTTCATTAACCAATAATGTATATCCGCTCGTGAAGTCAGCGT
TTTCAATAACACTTTTAGGCAAGTCTTGTGGCGTAAATTCAGGATGTGTTTTATAGGGCGTAAGTCCTAAATTTGGGGCGTAAATTTAAAACGTAAAAAC
ACTAGTCCTGAATGTAAATTTGGATTTGGGTGTTCTTTTTTACTTTAAATCATATTTTTTTTTATCATTGGTAATAATATTTTTCAAATAGTAATTTTAA
TCTTTTTTTTATTATTGGTTAGTAATGTATATATGTTATAGGTTATTTATTACTGTAAATTTTAGTTGTATTTGAAAGTTTAACTTTTGTTTATTTTCTT
AGTAATAAAATTATAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNTTGTGTCTAGCAATCCAACTCGCACGCTCGTACATTCGATGTACTGACGCCAATTGGTCTGCATTGTTTTATGATGCAGACG
CAGGTAACCAGGATCAGCATGCAACGCATCGTTGATCCAGATTAAGATCCAGAATTAGTAGTGAGCCTCCTTGAATTTCAGAATACATCCTTTTCATTTT
CTTTACTAGTATAGTTTTAGGATGTTGTTGGGTCTGTGCCAACGTCCATCTCAATTAGTATAGAGGCTTCGTAGGAAGTAAGTATTTCAGTTTGGAGTCT
ATTTTACTTGTAGAAACTTAAGTGCCAATTTGGCCAGAAGATTATACGAAGTATTTATTTTAGACATGGTCTATTTATTTATTAATTTGATTTTAATCTT
CCACTGAGTTAAGTAAGTCAGGCCCAAAATTCAATTGAAGGCCAGCAGTGGTCTTCGAGTGTCGGTCACGTCCAGGGTGTAGGCTCAGGGCGTGACAATT
AACTTAGGAGTGCTTAGGGAATTGATTAACTAATTAATAAATTAAGGGTTGAGGTCGGTTATAACTAATTACCTTACGACTACATAAGAACCCTAAGTCA
TTATACTAATATAACACCTCATAATTTCCCAAACCCAACTAGGTCTCACTTCTCTCTACTTTCTCTGACTACCCCAAAGACCCCCATTGAAGAACAAGTT
CAAGCTTCACTAGGGCTTCAAGATCAAGGATTTCTTATTCAATTCTCTAATATTTAACAACGTATGGAAGATATTCACTCTTGGGAATCCTTTCCCCAAG
TGGTTCTTCAAATATTGGTTTTCAAAGATGTCTAAAATTATGGTTTTCATCCAATTTCGTGGGTTATCTTTCAAATTGGTGTAATATTGTATTTATATGA
TTTATATTGATAGATTATGATTGTTTAATGGTGGATTGTTGTAGTTTGTTATACTTTGACCTAATTTCTCTACAAGATCCATGAATGGCCCCTTTTTCCT
AATCCTAACTATGAATTATGTTTACAGATGATTAGGGATGTGGTAATTGGATGTGTTACTGCCTTATTTAATATTATGTGATGATGTGGTGAAATTGAGG
GTGAGATCTTGAAGCAGATTCTTGGAAGCCCTTGGTAAGACTTTTAAGATCATAAGTACTTCACTTCAATTATGTTGGCCTAGTCTTGATGATGATGTTC
AATTAAAGTATGAATATGTGAATAGAATAGGAAGATAATTATATGGTGAGTACGATGGAATCTTATGAATATATTAATGTTAGATCTTGATATTGGTATG
ACCATGCAAGGTTGAAAGTGATTCTCTTGTGTACCTTATTATTATGATTATGATGTGATGATCTCACTTATATTGGGTTGTGATGAAAGGAAGTTATTCT
AAACCTAATTATCTATGATCATGATTACACAAAGGGTTAGTCACTAAAGCCTATATTCTAAACTAGTGATATGGATTGAATAAAGACATTTAAAAAAGGG
ACTTTAGATTAGCACCGAGCAAACTAATATGAGAGGTTTCCCTTCCCATGAAGGAAGGTAGGTTTACTATTGTTCTCATGAGATGGAGACTACAATACAA
ATGTCCACAAGATTTTCTAGAGAATCTCCTAGTTTCTTTAATATGTGCCTCCATGGGAAGACTAGATAGTGGATCCACCTAAAATACTATGTTCATATAT
GATTCTACCTTTGATAGTAGAGCACCTTCTTTCGGTGTAGGGTTTCATGACACCGGAGTCCATATTTAGCTCACATGGTCTATTGTCTGTTAAGGTGAAT
TTTCCTGAAATAAAAATGAATGAATGAATGAAAGTAATAAGATGAACAGTAACTAGGGGGACTTAAGGGTTTCTAATTAGTGTAGGTAAGTTTATGGGAC
TTTACCTATGCATTGCACAAGTTGACCTTGAGGGAAGTCCTCAGAGGATGTTCTTACGAACTTATATTATGAATGAAATGCATGATGTTGGATTATATAA
TGTTTCTCTTATATGATGTTGGTCCTATATAATATTGCTATAAATATGATATTGGTTTCATTTGAAGAACATGTTATTGGTCTAAATTGCTATGGATAAT
GATGAATACACCGATATGATGTTATATGAAGTATAGGCATTGCTTATGGTCACTTTACTAGATTACTTGGTTTATGTGGGGTATGGTGATTTGCATGAGC
ATTGAACTAGTTGGCTTGGATTGGAATTGTGAGTAAGGGTCTTGTATGCTTTGATGATATGAACTCTAGAACATGAAATGTTGATATGGCTTTATGATGA
TGTTATTCTTGTATATGGATATGACATGTCTTAATGTTGATATGACTATTGACTTGTATATGGTCTTATGTGTGCATTAAGGCTTTCAAAGTAACTTAGG
AAGCTTTTAAAGAAAATGTCCCTTTGTGCATGTTTTTAATGGTTTTACTTGCATATGTTTCCATACTTAGTTCATGTAGTTTGTGTTCACCTATATTCTG
TCTATTTCTAAAATAATGAATGTTCGGGCCATTGAAGAGCTTCAAGGCCATTTTTAAGGAAGACTTGGATAATTCCCATGTTTTTGGTGAATCCTCAAGT
CCGAGGATGAGGCCACTATTCTTGCTTAACTATTTGACTATTTCTAAGACAATGTACATTTCTTATCTTTTGAGACTATGTTGTAAGTCCTATATGGGAC
ATATTGTAATAGTTTAAGGGCTATGTAACAAACTTTTTAATTTTCTAATAGATGGTTATGTATGAGACAATATTAGAATATATTTTCAAATAAGAAACAT
AAGTAATCTTCATATATGGATAAATGAGAAGTTTTTGTACACTTCATACGTAAAGTTTTACTTTTTCCGCATTTTCCCTACCTATGATATGCAAATGCAT
CTAAAGGCTAGTCTAAAGCTTCTTCGAGGATGAAGACGCTGGTTACGTCTAGGGGTGCTCTATGGTCATGACAAACTTGGTATCAGAGCATTGAGGTTGA
GTAATCTTAGGAATGATGTCTCACGAAACCACGTGTACGGAGAGTCTTGTTCATAATTATGAAGCATGCCACACTTATGAACGAGAGGCTATGTTATGCT
TAAGAAATTCTAACCTCTTTATTATTTTTGAAGTCGTGCCTCAAGAGTCTTAACTCTACATGTCCTTTTCTTTTAACCCTTTTCTTGTGGTTATAGGCTA
TAACTACCAGAAGGCAGCCTAAGAAGAGTTGAAGAGGAGATTGTTAATGCGAGAGTTCCTCCTCAAAAACAAGCTCATCAAGTTTACCAATCTCCGATTA
ATCATGACGGATTCAGATATAAGGACGACTTTCATAACCTTGTCTCAAGCCATGAATATTGAAGCTCAACCCGTAGCTACTCAAACTCATGCTATGGAGG
ATCAAGCAAACCAAGAAGTTGGACCCAATTTGAACCAAAATGGTAGAACCATGGCTTCACACTTGAGGGACTTCACAAGGACAAACCCTCCAATGTTCTT
TGGGTCTAAGGTGAATGAAGACCCCTAAGACTTTCTTAATGATGTCTACAAGATCTTGTATGCTATGGGAGTGAGTTCAGATGAGAAGGTCGATCTATCC
GCGTATCAACTTAGGGATGAGTCTCAAACTTGGTATACTCAATGGAGGGACAATAGGGATTTAAGAACGGGTCCCATCAATTGGGAAGTCTTTTAGGAGG
TTTCTTGATAGGTTCTTCCAAGGGATAAAAGAGAGGCAAATGTATAATAGTTAATCAACCTTCGTCAAGAAGGTATGAGTGTGTTAGAATATTATTTGAA
ATTCACTAATTTGTCTCTGTACGCCTCTTCTTTGGTGTCCAATCCTAGAGATAAAATGAATCATTTTGTGACGGGTATGTCTGATGATGTTGTGGAAGAG
TGTTGTTCGACGATGCTTCATGACAACATTGACATTTCTCGTTTGATGGTTCATGCTCAACAAGTTGAGGAGAGTAGGGTTAAGAGAAAGAATAGAGATG
CTAAGAGAGCAAGTTCTTATGAAGGAGGTACTTCTAAGGGCAAGTTGGAAATTCAAGACAAACCTAATTTCAATAAGACGTTCTCCAACCAAGTTCCTTC
TAATTTCCCCAAGGCTAGTAATAATATGGTGTCTAACCTAGGTCCCAAGGGGGAAGAGGTGGAAATTCACCAAGTGAGAAACCTACTTGTACCAAATATG
GTAAGAAACATATGGGTGAATGTCTATTTGGAATGGATAATTTCTTTTGTTATGGAAAGAGTGGACGTAAAGTGAGAGATTGTCACGTGCTTCAAGGAAA
GGGGCGTAGTCAAGCACAAGCAAGCGGTCATAATTCTGATACTCCTAACAAGAGGAGTGGCAATTGGCCATGCTACATGACAACTTGAACATTTCCCATC
TTACGGTGTATACAAGAAGGGTTAAAGAGGCAGGGGCTAAGCGAAAAAAGTAGAAACGCTAAGAGAGAAAGGTCATTTTATGGAGGTTCTTCAAAGGATA
GGCTTGAGATATAAGACAAGCCTAGATTTAAGAAGCGGGTTTCTAATTAAGTCCCTTCCAAATTCCCCAGAGCTAGTGGTGATAGGGTGTCTAAACCCTA
AATTCAAGAAGGGAAAAGGTACTAATTCACCAAATGAGAAGCCAACTTGTGGAAAGTGTGGTAAAAAGCACTATAGTGATTTCCTTAAGGGACAGATAAT
TGCTTTAGTTGTGGCAAAAGTGGTCACAAGATGAGAGATTGTCCAAACTTGAAGAGTCAAGTCACGGGTAGTGGCCAAGCTCAAACAAGTGGTTCTATTG
ATGCTCCAAAGACGAGATGCCTCTATGCTCTCCGCTCTAGGGGTGAGAAAGAGACTTCTCCCAATATGGTGAACAGTATGTTGAAAGTTTTCTCTCTTGA
TGTATATTCCTTACTTGATCCCAGCTCTAATTTATCATTTGTTACACCTTTATTAGCTAAAGAGTTTGATATTTTACCCGATATTTCGCATGAACCTTTT
ATAGTGTCTACTCTTATGGCTGAGTCAGTTGTTGAAAAAGGGTGTACAGAAATTGTCCTATAATGTTACCCAATGGAGTTTCTTATGTTGATATAGTAGA
ACTCGATATGCTTGATTTTGATATTATGTTGGGTATGGATTGTTTGCATGCATGTTTTACATCGATTGATTGTAGAACAAGAGTAGTGAGGTTTAACTTC
CCAAATGAACTCGATGTTGAGTGGAAGGGGGGAAATTCTATTCCTAGAGGTTTTATTATTTCTTGTCTAAAAGCATGCAAAATGATCTCAAAAGATTGTT
TGTATCATTTAGTAAGAGTACAAGATCTAGACTCTGAAGTTCCTCCCATTGAATCAGTATCCAAAGTAAGTGAGTTTCTGGAGGTCTTCCCTAAGAGAGC
AAGGTCATTGATTTGCTACCGGATACAATTCCCATATCAACTCCTTATCGGATGGATTCGGACAACTTGAAGGAGTTGAATAAGTACCCTCTCCCTCGGA
TTGATGACTTATTTGACCAACTCCAAGGGGCGAGTTACTTTTCAAAGATAGACTTGAGATCAGGGTATCATCAACTTACTGTGAGAGGGGAGGATATACA
AAAGAAACCCTTTCTGACTAGGTATGGGCATTAGGAGTTCTTGTTCATATCTTACGGTCTCACTAATGCTCCAGCAGCATTTATGGACCTAATGAATAGA
GTATTTCGAAATTACATAGATTCATTTGTCATTGTCTTCATTGACAATATCTTGGTATATTCGAAGAATGAGGGTGATCATATGGATCATTTGAAGGTAG
TATTGAAAACCCTTAAAGAAAATCAATTGTATGCCAAATATAGCAAGTGAGAATTTTGGTTGAGGTCGATGACTTTTCTTGGGCACATCATCTCTAGTGA
GGGAGTTGAGATAGACCCAACGAAAACTGAACCGGTGAATAACTAGCCTAGGCCATTAACTCCGACTGACATTAGGAGTTTCTTGGGTTTAGCGGGTTAC
TATCGGAGGTTCGTCGATGTTTTCACCTCCATTGTTTCTCCTTTGACTACTTTGACCCAAAAGAGTAAGAAGATAGAGTTATCAAAGTCATGTGAGAAAA
GTTTCCATTTATGGAAAGATAGGCTTACATTTCCGCTTCGTTGTTGACCTTACCGGAGGGTACAAAGGGTTTTGTTGTGTATTGTAACACATCCCAAGTG
GGTTTGGGGTGTGTGCTTATGCGACACAGGAAAAAGATAGCCTATGCCTCTAGGCAACTAAAGGTACATGAGAGAAATTACCCAACTCGTGACCTTGAAT
TAGCGGTCATGGTATTTGCTTTGAAAACTTTGAGGTATTACTTTTATGGGGTTCATGTTGATGTTTTTACTGATCATAAGAGACTCCAATATGCTTTTAC
CAAAAGGAGTTGAATATTCGACAAATAAGGTGGCTAGAGTTGCTGAAAGATTATTATATGAGTGTCCTTTCTCACCCAGGCAAGGCTAGTGTAGTTGGCG
GATGCCCTAAGTCGTATGACTACGAGTAGTGTATCCAATCCTGAAGAAGACAAGGACCTAGCAAGGGAAGTACATAGGTTGTCTAGGTTGGCGGTGAGGT
TGGAGAGTTCTCCTGATGGGGGGTACTATGGTTCATCATAACTCCGAGTCATCTCTAGTGGTTGAGGTCATGTCCAAACAACACCTTGATTTAGCCTTAA
TGGAGTTGAAAGAATTGGTTCTTGGCAAGTTGAATGAATCATTCTCCTTAGGGGTGATGGTGTGTTAAGGTACCAAGGGAGATTATGTGTTCCCATTGTA
TATGGTTTGAGAAGAAGCACATGGGTCCCGCTACTCAATTTATCCACGATCGACAAAAATGTACCATGACCTAAGGGAGATATATTGGTGGGAAGGTCAA
AAAAGGGACATAACGGAGTTTGTCTCTAAGTGTCCGAATTGCCAACAAATAAAGGTCGAACACCTAAAGTCGGGTGGCTTACTACAAGAGATCCAAATTC
CAACTTGGAAGTGGGAAGACATCAATATGGACTTTAAAGTAGCAACCTTGGACTCGAAAGTCATATGATTCCATATGGGTGGTTGTTGACTAAGTCAACT
CACTTTATCCCTGTTAAGTCAAAATATTTCAGCGGAGAATTATGCAAGAATCTTCCTAGATGAGAATGTGTGCCGCCATTACATTTTTTTATCCATCATA
TCAGATCAAGACGCACAATTCACATCTAGATTTTAGAGGTCAATCCAAAAAGGGTTAGGTACTACGGTGAAGTTGAGCAGTGTTTTTCATCCCTAAATGG
ATAGTCAAGCGGAGCATACGATACAAACCCTTGAGGATATGCTTAGGGCGTGCATCATTGATTTTAAAGGGAGTTGTGATAGACATTTACCTTTGGTGGA
GTTTGCCTACAACAATAGTTTTCATTCATCCATTTCCATGGCTCCCTATGAAGCCTTGTATGGTAGGAGTTGTAGGTCTCCTATTGGATGGTTTGAAGTG
GGTGAGCCATCGCTTCTTGTTCTTGAGTTTATTTATAAAACTTTGGAGAAGGTTCATATCATAAGGAACCAGTTGCAAACGGCCTATAGTCGGCAAAATT
CTTATGCCGATCATAAGAGAAAGGATTTGTAGTTCGAAGAAGGTGATAAGGTGTATTATAAAATTTCACCAATGAAAGCAGTGGTTAGATTTGGAAATAA
AGGGACATTGAGTCCTCGTTATGTGGGTCCCTATGAAATCTTGCAACGATTTGGTAAGGTTGCCTATTAGTTGAAACTTCCTAGTGAATTGTCTTTAGTT
CATCCGGTTTTCCATGTTTCTATGTTGAAAAAGTGTATAGGTAATCCTGAGTCCATTCTTCCTATTGAGGGTCTTGGTGTCAAGGATAGCCACTCATATG
AGGAAGTTCCAGTTCAAATTCTTTATAGGCAAGTCAAAAAGTTGAGGAATAAAGAGGTGGTTTCCATAAAGGTGTTATCGAAAAAATCATCTAGTTGAGG
GTGCAACATGGGAGGCCGAGGCCGACATGAAGTCCCGTTACCCTCATCTTTTTGAGAATTAAGGTTAGTCATTCTTTTTATTAATATAAATATGACTAGA
ATTGAGGTTTCTTAATTTTTTGGTGACTTTTTGCACATTATGCATTTTTGAAAAACTTTCAGTGAAGTTACTTAACTATTTCTATTCAAATCTTGAAATT
TTGCTTTTGCTTGTTTTGAGTTATGTTGTGAATTTTGATATGGTGAGTCTTTATGAAATAATAGGTAGTATGTTGTTAAGTTGAACTTTATGCTAATTGA
CTCATGTATCTATGTTGAGCTCACAAGTGTTGTGAGAAGGAAATGTCTCATGATGAAGTGTTTTGAGTCTTATGTGTGGTAATATGAGTTTTAGTATTTG
CCTTGTTGAAATGACATGATTTATATTGATTTGATATTGTTGATTGGTTGGGCTGCTAGTCTTGAGTCTATTCCTTCCTTCAAAAGAATTTTAGTGACTT
CGGGGTCAAATGTTCCTAAGGAGGAAGGGATAATGTAACAGTTTGAAAATCCAACACACATTGTAAATCCCAACATTGGTGTCATCACATCTAACTACTG
TTTCTAAGTCCATTTTAAATGAATATAGAACATTTAAGAGGTATAAGAACCAAAACTTTTAAGAACGTTGATGTTTGAGAAATTGGTTCAAAGGGGTTTT
AGTGTAACTTAGCCTATTTGAATAACTTGTAGGAGTTAAAAATGTACAAAAATTGGTGTAAAGGTAGATAATAGGTGTTGGGTTGTTTCATGGTTGAAAC
GTCCGGGTACGACTCCCCAAGGACAAACCAAGGGTCCTTAAAGAGGACCCTTGTAGTTTGATGCAACACTGTCTGGCAGTGTGAATCGACGGATCAGAAG
ACGGAGCGTGTGTGGATCGACGGGGCATCAATTCCACCATCATCCTATACTTGGGTTGGTGAAGAAGTCCCCTTCACCTGCACAACATCTGAACTCATCG
ACGAAGTAAGAGGTGCAAGCTATGGTCCATGTGTAGATCGACGGGTGGGGCGTCGATGCCATCATCGTCCCACACTCAGAAAATTTTAGGAAGCCCCTCA
CCCGCACGGTCCCTGACCAAGACGATAAAGTGCAATACAGAGGGAGGGCTTTCCGTCAACTCACAGACGGCCCATCGATCGGGGTTTCGTCCCTAAGGGT
TGAGTTCCCTGCCTAATTTTAGTCAGTGTCATTTTGGGGGGTTAGGTGGTTTTTTATTAAGGTTTAAGGGAGACTAATTAATTTGATTAAGTCCCAAATA
TAAACATTCCCAACCCTCATTAATCTAAATACAACTCTCAAATAAACTCTCTTCTTTCTCTCTTATTTCTCTCTCTCTCTACATAAACTCACCATTGAAA
ACTAGCAAGGACTAGGGTTTGGGGAATGGAAATGGATGAATTCACCATCAAATTGTTAACAAATGTTAAGGTATGGGTTCTATTCACCTTTTAGACTCTT
TCCTCAAAGGGTTCCTTCAAAATAGATTTCAAAAGTTGAGTTTTCTTATGGGTTCATTCAATTATGAAATTAAAGTTATGAATATAGTTGTTAATGATTT
CTTCAGGTTATATTGAGTAGATTAACATGTAATTCATCTTGTTTATGGTAATTGTGGATGATTTGGTCTAAATTGAAGAATCTGATCCTCCATCCCAAAC
CCTAGGTAGTGATCTTGACCTATATTATATTGTGATCATTCAATTGAGTTGGTTGTTGATTATATTACTATCCTATGGTGTTATTATGATCAAATTAAGA
TGAATTATAGGCCTATCATGCTAGTTCTTGAGATGTGATATAGGTTATGAATTATAATGTGAAATTAGCCTATGTATCTTGTCTCAAGATGTGATCTAAA
GTTAAATTGTGTTAGATGCAATTAGACTTGTTATTCTATTGATTATCATTGTGTGATGATGTTACTCCCCAAGTTGGGTTGAGTTATGGGTTGGTGGTAA
GACCTTGATGATAGACTATGAGGAAGACTTGGTAAGTCTTAGAATCTCTATCTTTACTTCCAATTGTGATTAATTGTTGTTAAGTCATGATATTATATTG
GAGTATGCCTTGTACTAGGATTATAGGGTGTTATAATGTTGAATTGAAATGTCTTGAATATGTTGTGAGGTTGATTAAGGTGTATGTAATATAAGGATGG
TGAAAACTATCAAAGTGTCTTAATATGTTATGAAATGCTAATGTCTTAACCTCACTTATATGAATTGTGATGAAAGAACTGATACTCAAAAAATTCTTAT
TGAGCTATTGTTTATGATGATTATACAAGGGGTATACACTATGGCCTAAATTAAGCTATGATTGATAATTAAAGGCTTAAAGACATTTCAAAAAGGGTCT
CTAGCTGAGCATCGAGTGAACTAGATTGAGGAATGTCCCTTCCACATAGAGAAGGTAGGAACACTACATTACTCTTGATATTGGAGACTATAATGCATGG
CGCATAAAGAGGGTTTCAACTAAATCTCCTAGTTCTTGAACTATGTTGCTTCCATAAGAATACTAGCTAGTGGATCCACGCAGTTGCTATGTTTCATATT
TTAGTACTACTTTAGCAAGTAGTCCGCCTTCATTCGGTGTAGGGTTTCATGACACCGGATTCCGCACTAGCTCATGTGTTTTATGTCGGTTAGGGCATGC
TGTTCAAAAGGTAAACGAATTAAAGACTTAAACTCTAATTTGGATAACCTAAGGGGCCTAGCTTAGTTTAGGTAGGGGTATGAGACTCTACCTAAACATT
ACACTAGTTATCCTTAAGGGGATTCTTAGAAGGACGTTCATATATATGTTTATGTTATGATAATATATGATGTATATATGATGACCATTGAACGTTGTTG
ATGTTATATGTTGATTAGTTCATTTATAAATATGCCTTGGGTTGTAATGTTAATATATGATGAAATGTAAACCTATATGCATGATATGTAAATTTGGACA
TTGGTCACGTCTTCTTGTTGAGGTTACTTGATTGAGTAAGGTTATGAGGCTTTTCTTGGTCATTGCACTTGTTGACTTGATAAGGCCTTGTGAGTAGTTG
TCTTGCTTATTATGATATGTTTGATTCGTATTCATTCTTGTTATATTATTCCTTGATGTTAGGGTTGTAGTAAATCATGTTTTCAAGTATGGCAGGATAA
GTATTACTTGTTGGGATATTAAGCATGTATTGTTGGTTCATATGACTTACTTGACTTTGCATTAGGCCCCTAAAGGGATAATTTGGCTTGTTTTGATAAA
AAGTCCTTTTTAGCATGTTTTGCTTGTGTATGTGCATAAGATACCATACTTAGTTCATGTGGAGTACTAACCCATTTTCTTCCCTTTTCCCAAGCATTTT
AGGTTCCGGTCGTTGAAGAGTTTGGAAGGCGACATTGTTACAGGCTTGGATTGTTTCTTTCATCAAAGTGGGGTATGTCTTCAACTTTTAAGGGAAATGC
TATCATCTATATTACAAATTTTGTTATGCGTTTATTGACTCTATCAGTCCTTTCCTTTTTAATTGAATATTGTACTTTCGTATGACCTATACATGGTCTT
GTTGAATTGATATAAGGGCTATGACCATATTTTAATATTCATTTAGATTGTATGATATGAGACAATCGTTGAGACTATTTCTATATTTTACGTATATGTG
TGTGCAATAAAAGTAGAAGGTTATGTAACCTTCCTATATGAAGGGTCTATGTATACTCGATATGAATATATATTATGTGTATGTAGAGGTCTATGTAAAC
CTCCAAGTAGTGAAAATGAAAGTTTTAAATTTTTCTGCATTTTCAACCTTTGAATGTAATGACATGAGACTAAGAGGCTAGTCTTAGTCCTTGAAAAGCA
CAACGACGCCGGTTACGTCTAGGGGGTAAACATGGATGTGACAGTTTGCTCGGGGTACAACCACCCGATTAGCTTGGAAGGTCATGGATTGAGCTTGAGT
AGTGAAGGCTTGTGCTTGAGTAGTAATGTCTTGGGACATTTGGAGAAAGACATCCCTTATGTCATCATTCATCAAAGGAGGAGGATTGATCGGAGCTTGG
TCATCATTACCAACTTCTTCAATAAAAGGGACTTGATTGAGATGGGGAGGAACTCCCGCATAGGCATTCTCTTCATTAAGTCTTCGAGTGGGTATTCTTC
AAGTATTCATGGCCTATAATCACAATAAATGGATTAGATACTAACGGCACATAGAGCTAAGACTCTAGAAGAACGATGTTGGATTTCCAAGAAAAAGAGA
GTTTCCTAATAATCTTTTAGTTTCCTATTCATAAGTGTGGCGCGCTTCAAAATTATGAACAAGAATTTACATAGACGTGGTTAAGTGAGATATCGACTCT
AAAGATATTCAACATCATGCTCGGATACAAAGTTTGTCACATTCGAAGATCACCCCCTAGATGTAGCCAGCGTCGTCGTCCTCTTAAAGGAATATGTCAT
ATCCCGAGACCAAACTCTAGAATATATGAAACTCTCGGAATTCAGCCGGCGTACTTGACCTGTCGGAGGTCTTGTACAAACCCTTTCGTATCGTTCATCG
CTTATAAAAAAATATGAAAAGTAGTGCAGAATTAAAACTTTTTATAAAACATTTTATAAGTCTTTAAAATATCTTTCATATAAAATCATAAAAAATACTA
AGTCTCATTTCATCAAATCTTAGACACGAGAATACTTTGGGACACGGACCATACACGATACGATATAGAATACTTATTCTATTACAATACTTTGATAAAG
GAAATAAAATACATCTATGCCCTGGAGTCAAATGAGGACATACATCAACTTCACTTGAATGATGCTACAATCCAATTCTTTCTTCCAAAATGCTCCTGGC
CTACCAACAACTATAGAGATATATAAAAGCTTAGAATTAGTACAACCATATGTACTAAGTATGGCATAATGCATAAAATCATGAAAATGGACATTTATCT
GAAATATATATCTTTTTCACTAAAACATCATATGTCAATCATAATAATAACATTTATCAACTTAGAAACACATAAGATAACATTTAATCAATTTAGTACA
TTTTTAAAGCTACATTACAGTAACTTTAATACAGTGTACAGTGAATTCCTTCATTGTTACAGTGAAGTGCCTTATCTTCACCTTATACATTTCATATCAT
GTAGTTTTCTCACTAAAAGTTATCATAAGACTCACTTAAGTAAGACAAATAGAGATCTCCCATACAACCTCTCTAGGCACACCTAAATGATCCTTAAGAT
CACATATACTGAGATTAACACACACTTACAAGACATCATATACATGAACATGAGATTCCTCTACCAAAAGTGATCTCACTTGAGTGAGTTTTGAAGTGAC
CTCCCATACAATCCCTTACACACATCTTAAGAGATCCTATAGACATAGATTACATGACATTCTCCTTCCAAAGGCTATCGAAAGACTTACTCAAGTAAAT
CAAGAAATAATGTCAATGATTGATCTCCTAAAGATTACCTAAGTAATCCTTAACACTACCTAAGGATTAGATCATGTCCACATAATCAACTATCTTCCCT
AACTAGATTCATTCTTGAGACTTATCTAGGTAAGATAAGAAGTGACCGTTCCCATGCTCCCTTCACACCTTAACTACACAACCCTTAAATACTCTAGATA
AGTACTTATTCATTTAACATATTTTCTTCCTTAAATCATTATATTACTTAGTTCATTTAAGACTCATTATTCATATAAATACATTCCAGTAATGGTCTTG
GACAAAACATAGGGACACTAACTTACACCTTAAAACCCTATTGTACAATGTCTAGATAGTGTCTCATACCACCACATAAACTTTATAGAACTTCTCTAAT
GCTAGTAGGTAACCCATATGATGATAATAGGTAATAACCGGCATAGATCATGATAGCTAGATATGGAATTTGGAGTTCTAACCTGCTCCGATGAGGGTGT
TCTACTTTCCAATGGTAGAACTTGGACACATCCCATGTAGGCACATGGTTACGGAATATGAAGGGAGTCCTTTGTATTCTAGTCTCATCCTTTAACTAGA
AATACTTCTCTTACCATATTCACTTGGTGCTAGCCTTTGTTCTCACAGAGTAATTTATATCAAAGGTTCATATAAGGGGGTTCCATATCTAGTTCATAAC
CTAATCACATTTACCCTACCACAGAGGTCCACTAGGGATACCTTTAAATGGAGACAAGAAGATCATAATGACTTTCCTATGGATTTATATGATGTCGTTC
CAGACAATCAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNGGAAATTCTTAACTCACTTTTAGCTTAAATGTGAAACATTTATCATTATTTAGGGACTACTTAGTCCCCCTTATAACTTTAAAGAAAT
GAACTCAACTCTTGCTCTTTACTTAACTTTGAACTTTAACTCTTAGGGAATACTTAGTTCCCTCATAGCTTTTAATAATTTAACTCAACTCTTTTCTCTT
TCATCTACTTGTAACTTGATCCTTACATCAAAGTTAAAATGATCGTTTAAGACTCTTTGAAAACTTTAAGAACTCTCTATGACTTGCTTCTTAACTTTTA
AACTTGACTCTTAACTTCTTTGACTTTGATCTTAGCTTCCCTTGAATTGGATTATGGATTCAAGGATCATGATCTCATGTAATGGACGATTTCATGATGT
TTAGATGTACTCTAGAGTGTTGGGATTAATTAGGAATGAAAGATACATCACTTAGGAACTAGTATGAAAAGATAGGGAAATAACGGGGTCTCTAGGGGTC
TTGGCGCTCTAAAAGGCGCGAGGAGCCAGGACCTATCAGACAACCCTTTTCTGGGGTGATTTGTCTAGCGTGACACGCCAGGTCTTGTCATAGAGAGACT
GTCTTGAGGGGCTCTGGCAGGCGCGGCGCCCCAAGAGCTATCTAACGATGCCTCCAACTTTTCTTCTCTATTTTTAATCTCTAAACCTACTAAATTTCCA
TGTCTCCCACCCCAAATACTTAGGATCCATTAATACCTCATTACCCAATAGATAAGACCCGGAAACAGTTTAGAAACATGAACCAAATCTACTAGAGATC
AACTACAATTTTACCAACAAGAACTTCACAATTTTTCTTCAAGATTTTCATTCAAATAAACTCTAATTTGTTGTATTGAATCAAATTGGGGTGTGGGTAA
AAGGAACCAACACCGAATTATCTCATATACCTCGATAGGCATCACCCCCGATGATATACATGCAACAATCTTTGCATTTCTTGAACAATTCTTGTTTTTC
CTATTCTTTTCTCTTTTCTCCCAAGCCCTAAGAATTCTTAATTTTTGTAAAACTCATTTGGGACTTGGTATTAACCCATAAATAACCCTTAAAACAAATT
AGTCAATACTAGGGTTGTCACATTCGGGTTTACGCCCTAGACATAACCGGCATCGTAGTCTTTTTCAAGGACTATGACTAGCCTCTTAGTCTCATGTCAT
TACATTCATAGGTTGAAAAATGCGGAAAAATTTAAAACTTTCATTATCACTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTATTTGTTTTATAAATAAAATATAGGTCATTTGCCTTAATTTTTTAA
ATTATTATATTCGATTCAATACAAGTCTATCTTTTATATTTCAAATTTAAATATTTCAAAATTTATGTTACAATTTGAAATTAAAAAAGTTTGAAAATTG
AAAGGTTGATATATTTTTAAAAGATTCAAACTTAAGTAAGTAATTTGTAGTTTGCAAATTTAACATTTAAACTTTTAAGACTTGAGAATTTGAACTTTAA
ACTTTAAAAATTTAAAATTTAAACTTTTAAAAATAGTCTACCATATTAAGTTATACTTTTAAAAAAATCAAATATGTAATACATTTTGAATTTTTTTCAA
TGATAAACAATAAAGTTTTAATTTAATTACAAAATTCAAATGGGGGAGGGGGTGGACCTGGAATTCTTGTCTGGTATGGACCGGTCCAGGATGGTCATTC
AAATTATCACTGATACGTTCGGTATAGATTTCGCTTGACTCTCACTAGTTGACATCTGTTCAAGTCTAATTGTATTGGTTTGAGTCTTTCATGCCCCAAG
CCTAAAATCTATATGTGGCCGACACTCGGAGAACATTGATGGTCACAAACAAATGTTCTTTAAGATAATGTTTTTATAATACCCCGGAAGGTCAAGACCT
AATCTAGAGCCTCACATGAATAAATAAGACTTGGAATGATATTCATAGGCCTAATATAATGAATTTGAAACATATAGGAAGTGTTAGATTCAAAACTTCT
AGTAATTTCCATGACGTCCAATGAATTGTTAAATGTACGCTAGTGTGCCTTGGCTTGTTTCATGGGGTTTCAAGAGATGAAAATTAATGAAATTTAGTAG
GAAGGTGTTAAAATAGTGTTAAGTGTGTTTATGGTCGAAACTTACGGGTATGACTAGCCAAGGACCACCTTAACGGTCCTTGGAGAAGACCCACCCAAAT
GACTCAAAACTGTCAAACTGACAGTATGCAAATGACGAGCCAATCGAAGAGTTGCCGATTGATCGACGCTCTATCAATGGTAGTTGTTGTACAACACTTA
GAATTTCCCGGTGCTACGTTATCATTTGTAATTTCTTTAGTATTTAAGAATTTTGATGTTCTACCCAATATTCTAATTGAACCTTTTTTTGTTAAAACCC
GGTAGGTTACTCCTTTGTGGCTAGAAGAGTCTTTAGGAATTGTCCTATATTTTTGCCCAATATACTTACATGGGTGGATTTGGTAGACCTTGATATGTTT
GATTTTGATTTTATTTTTGGAATAGATTGGTTGCATGATTATTTTGCTTTCATATATTGTCGAACAAGATTGGTTAAGTTCAATTTTCCTAATGAACACG
TCTAAGAGTGAAAACCCCAATTCCTTGAGCTCGTATTATTTCTTGTCTAAAGCTTGTAAAAAGGTCACTAAAAGATTTCTTTACCATTGTAAGAGTCAAA
GATCTTGAGTCCGAAATTCCTCCTATAGAGGTGGTCCCCATAGTGAAGGACTTTTTGTAAGTCTCTCCACAGGATTTGTGGGAAAAACCTCCTTAGAGGA
AGTAGATTTTGGTATTGACTTGTTACCGGATATGAATCCCATTTCAATCCCTTCTTAATGGATGACTCCGGCGGAGTTGAAAAAGTTAAAGCTTCCACTC
AAAGACTTATTGGACAAAGATTTCATTCAACGTAGTATTTCACCATGGGGAGATCTAGTGTTGCTTATTAAGAAGAAGGATGGTTTCCTTTGGATGTTCA
TTGACTATCATCAACTTAATAAGGTCACAATTAAGAATAAGTATCCTCTCCCTCGGATTGACGACTTGTGTGATCAACTCTAAGGGAAAGCTACTTTCTA
AGATTGACTTGAGGTTGGGGTATCACCAAATTAGGGTGAGAGTTGAGAAATGTACATAAAACGGCATTTTGTACTAGGCATGGTAAATATGAGTTCCTAG
TAATGTCCTTTGGCCTCACAAATTCCCATGCTGCTTTCATGGACCTTATGAATAGAGTGTTGTGAAATTATCTAGATTTCTTTGTGATTTTCTTCATTGG
CTATATCTTTGTATATTGTAAGAATTAGGGTGAACACATGGACCATTTGAGAGTGATACTGAAAGTCCTTATGAAACAACAACTATCTGTCAAGTATAGA
AAGTTTGAGCTTGGTTGAGATTGGTAGTATTTCTTTGTAATATTATCTCAAGTGAGGGTATGGATGTCGATTCAAAAAAAATCAAGGCAGTTAAGAATTT
TCCTAGACCATTGACTCCAATAGAGATATACCTTGACCCAAAAGAGTGTGAAATTTGAGTGGTCATAAGAATGTGAAAAAAACTTCCAAATTTTGAAAGA
TAGGCTTATCTCTACTCCGGTGTTGACTTTACCATAGGGTACAAATGTTTTTGTGGTATATTATGATGCAATACGAGTGGATTTGGGTTGTGTTCTTTTG
CAACATGAGAAGGTAGTAGCGTATGCCGCTAGACAACTCAAGGTGCATGAGAAGAATTATCCAAATCATGATCTTGAATTAGCAGTCGTAATGTTTGATT
TGAAAATATGGAGGCATTACTTTTATAGTGTGCATGTGGATGTGTATATCGACCATAAGAGTCTTCAATATGTGTTTACTCAAAAAGAGTTAAATATTCG
ACAAGGAAGATGGTTGAAAGATTATGACATGATTGTTCTCTACCACCCCCAACAAGGCCAATGTGGTTGGAGATGATCTAAGTCATCTCCATGGGTAGTG
TGTCTCATGTAGAAGAAAGGAATAAATACATAGTGAAAGATGTTCATATGTTGGCTCGATTAGGTGTTCGGTTGGAAGATTCCCCAAATGGTGGTTTAAT
GGTTTATAATAAACTTGAGTCATCTTTAGTGATTGAGGTGAACAATAGAAATATTTTTATCCCCATGTTAAGACATGTTAAGAGCTTGTGTGATAGATTT
CGAAGGAATTGGGACAATCACCTACCGTTGATTGAGTTCTCCTATAATAATATCTATTATTCGAGTATTTCTATTGAACCTTTTGAAGCACTCTACGGTA
GGCGATGTAGGTCTCCGGTTGGGTGGTTTGAAGTTTGTGAGTTTTCACTCCTTGGTCCTGAAATAATCTATGAAGCTTTGGAGAAAGTTCGAGTGATAAG
TGATAGGTTGAAAACAACCAATAGTCGGTAAAAATCCTAGGCGTTCTATAGAAGAAAAGATCTTGAATTTGAAGTGGGTGATATGGTGTATTTGAATATT
TCACCTATGAAAGAGGATATGAGATTCGGCAAAAAGGGGAAGTTATGTCCACGATATGTGGGTCCCTATGAGATTTTGCAACTTGTCAGAAAAGTTGCAT
ATGAGTTGATACTACCTATTGAACTAGCTTCGGTTTATTCGGTATTTCATATCTCCATTCTAAAGATGTTTATTGGTGATCCCGTATCAATTTTTCCTAT
TTAATGGTTAGGTGTGGATGAGAGCCTTTCCTATGAATAGGTTTCACTGGAAATTCTAGATCGCCAAGTCAAGAAGTTGAGGAACAAATACGTGGCATGT
GTAAAAGTCCTATGGAGAAACCTCCTAGTTATGGGAGCAACATGAGACGCGAGGGCGACAAGAAGTCCCATTATCCTCATCATTTTCCTCAAAATTCTAG
CAAAAGTTGAGGTTAGTAAATATCCTCCTAAAAATAATGAAAAATTTGAATTTGAATTGTTTGGCTACGATGTCATTATTATAATTAAAAAATGGCTTAA
TGCTAAAATGAGTTTGCTTGTGAAAATTTTCTTTTGCTTAAATTGAAATAATTTGTATTTTGTGTATTGTTATCTTTATGAAATAGTATTGAGCATGTTA
ATTTATTTTTAAAGAAGTTTTTTCATAAGTGACTCAATGATTATGTTGAGCTCATGTTGATATTGAGAAGGAAATTCCTCAAGTTATGATGTTGAGCTCT
TATATGTCGTAAATGATGATTTGAGTTTCTATGTTTAAATGTCATGTCAATATGTTGATTATAGTTGTAACTCATGTTGTTATATGTTGTTGGTTGGACT
GCTAGTCTTGAGTCATCCTCTCCCTTATAAAATGATTTTAGTGATTTGGGGATGAATGTTGCTAAGGGGGATAATGTAACACACCGGAAGTCCAAGACCT
AATCTAGAGCCTCAATTGAATAACTAAGACTTAGAACACTGTTTACATGCCTAAATAATGTATTTTAAACTTTTCGAAAGTGTTAGAGTCATAACATCAA
GAAACATCAATGATGTCTAGCGAATTGTTAAATGTATACCAGTGTGCCCTTGGCATGTTTCATGAGGTTTTAAGAGTTGGAAATTAATGAAAATTGGTAG
AAAGGTGTATAAATAGTATTAGAGTGTATTAAAATAGTATTAGAGCTGATCGAATATCCGTCTATGGTAGTCGTTGGCAAACAAAGAGAATTTTTTTTAA
AAAATGCCTCAAAACACAATCTATGTCGCAATCAATGCCTTACAAGTTCAAAGGCATCGATGGAACTACAGACCGTAAGTCGAGGTCTCATAGGTTTGGT
ATGTTTTAGACTGCCTCATTTTAAGTTGAGGGAATTAATTAGCTAGTTGGTTAGTTAATTAATTAAGGTTCAAGGGGTGTCTAATTAAGTTAGTTAATGG
GCTTTATAAGACATAAACCTAATTGAACTAACCCAACACCCCACAATTCCCAAACTCAAATCTTTATACCTTTTTTCTACTCTCTCTTTATCCATAAAGA
ACACCATTGAAGACATGTTTCAAGGGCATTAGGGCTATGAGAATTCCACTTTCTCTACATAATTATTCAAGGACTATTAAGGTAGGGGAACTCTTTACTC
TTGTGTTCTCTTTCCCCAAGAGGCTCCTTAAAACTTATTTTAAAAGTTGTCAAAAACATGGGTTTCCTTCTTATTCCAAAATTGATCTTTCAAATTGAAT
TTTTATTGGTTTCCTTTGATTATTAATGTTAGAATATGATTTTTTATGGGTTAATTATTGTAGTTCTTGATCTTTGACTTAATTTGTGATGAATTTGATC
CTTCACCCTAACCCTAGTGAAGATGATTACGATTGTTAGAGTTGGATTTGTTATTGTTCTATTCACTATATTATGTTGATGATGAGTGAGTTATTGGCTA
ATTATGATGAATTGGAGGAGGATCTTGAAGAAGTCTTTTGAAGGTGAATCGGTCAGATTTTGTGATCTTGACTACTTACTTAAATTATGATGGTTTATAC
TTGATTATGATGTTCACTTGAAGTATTACATGTGATTAGATTAGGTAGGTGATGGAATGGTGAATGTAATTGAAATGTCTTGACTATATGAATTGTGAGA
TTATGTTTAACGTGTGATGATATAAGGTTGATTGTGAATCAATTGTGTGCCTGACTATGATATGATGATGATAATGATGTGTTAATCTCACAAACAAAGT
GTGATAATGAAAGGACATTGTCATGCAATACCTAACGAGCTAATGACTATGAATATACAAAGGGGTTAGTCTCCTATGACCCATATTAAGCTTTGACGAT
TAAGGATGACTTAAAGACATTTCTAAAAGGAATGTTAGCTTATCATCGAGTGAACTAGTTATGCGAGGTGTCCCTTCACAATGTTTGAAGGTAGGTTCAC
ATTCGTTCTCATGAGATGGATATTACAACGCCATTATGCATAAAGAGGGTCTCAAGTATGTCTCATAGTTCTTAAACTATGTTGCCCCAATAGGAAGACT
AGTTAGAGGATCCACCTAGCATGCTATGTTAATGTTTTAGTCCTACCTTGGCAAGTAGAACACATTATTTTAGTGTAGGGTTCCATGAAATTGGATTCCA
TGTTTATCTCACATGGTCTATGTCGATTAAGGCAGTTGTTCCCAATAGTAAAATAAATATAATAAAATGAACTCTAACTAGGATGAATTAAGGGGTTCTT
CTTAGTATAAGTGGGGGTATGGGACTCTACCTATTCATTGCACTAGATGGACTTGAGTGAAGTCCTAGGAGGATGTTCTTATGATCTTATAACTTTAATG
ATTTTAAAATGTTGACTTCACATTTTCATGATCCTATATGATTTTAGTTTCACTTATGATCATCTTGTTGGTCCATAAGTCTATATATGATGATAATTAC
TCATGATCCTAGGTTATGTGAAGTAAGGCATTACTTACGATCACTGACACGCTTTCAAAATGAGCTAAGGTATATAGAGACTCTTATGATCCTAAAAAGG
AAAATAAAATGTTGAAAGAAGTGTTTTATCATTCGTATATTAGATTTGAAGTCATTTGGAGGTCGAACGTCCAAGACGTTCGGAAGTTGGTATTTAAATG
TGCTAGTGAGTCCTTGTATGTTTGGCTTGATATTATGTTTTGTTTGGAGTTTATAATAAATTTAGTTGACCCTAGTACCTTAATAAACGAGTTAAGGGTA
AAAACATCTGGGGACGACGCCCCAGGGACCACGCAAAGAGCCCACAAGAAGGACACAAACCTTGGACAAGAGGCTGCGCAAGGCAGCGTGCAGGAGCAAC
AATGAGACCTTGACCTCGCGACGCACCTCACTGTCCCAAAAATTATTTGGGTCAGAATTGGAAGTCTGTCCCGCGAAGCCCACTCCCAGATCCGGTTGCG
TCTTTTTTAAGTCAATTTTAACATATCTAAGAGCACCAATTCTTGTGGGGGTGTTTTGGTAACTTAGGGGTCATTTTATGAACTGATTTTAGGAACTTTT
TAAACCCTTTCCCATTCCAAAACCCAAACACCCACTAAGAAATCAAATTCCCAAAGTTTCTTATCTTCCAAAAACCCCAAAACCTCCATTGAAGACCAAG
CTCAAGAACAAGTTATGGAATTGGATTCTTGTATTTCTCTTCTCAGGTTTTCATTGTCTTCTTAATGTATAAGATATGGTGATCCTTCATCCATATCTAA
CCATTCATCTATGGAGTCCATTTAAAGATTTTCCCAAAAATGAATTCTAAGTCAAAATCCTATCTTTCAATCTAGCCATGGGTTCATTCTCAACTTGATT
TTAAAGGATGTTAATAATGAATATACATTTATATACTAATTTTATGATGAATTTCTATCCAATTTTATAAATAACGCATTATCCTCCTAATTTGTCAAAT
TAGTCTATAATGTGGGTCCTGTGATCTTGACTTGATGTCTATAAAATTTGATAATATTGTATTGAACTCGTTATTGCTTTTACACTCTATATCAATTGGT
TATGAATTGTTGGGAATTGATCAAGAAGATAATTAGCTTGGGTATTTGGTAAGTTGACTTTTTTCCTCTAATTATCCTAGAATGTACATTGAATTGTGTT
GATTGGTATGGTCCACTTATATGGCGGTGTTTACATTCTTGTATATGTTTATGTGCTATGATCATGGTCGTGAAGGCATTGGATGCAATATGAATAGATA
TGATGATACATATATTAGGAAGTTTAATGATTTAGCCTTGACTCTAATATCATGTCTAGCTAAATGATGTTATTTTATATTATGTGTATAGCCTACACTA
TTTGTTTAATCTAGGTGTGGAGATGATGTTATATGTGTATGTGTGATGATCGTGTAAGGGTTAGGTGTGTCCTATATTGGTAATGATCAATAATATCCTT
ATTGCATGACCCCTACCCATACGAATCCTATATGAATGGGTGATCAAAGTATGCTAGGGTATGATATTCTATTTTTGAATATGTACTTGCCTCTTATGAT
GTAGTGTGAGTGTGTGTAGTCTATAGTACTCAATACTCTATATGTTTGTTTGACTTGAGACTTGAAGAATGTTGGACATGTGTTGTAGTCATTAGAATGT
GGCTTCCTCAATACTATGTGATTGCCATTATGTGATCATGTCAACTAATGTACACACACACACACTTCATGCATATCTATGAGTAAGATAGGTTCATGAT
GACTAAGGAAAGGTTTGTTCTCCTATTCATCGTTACATATTTTTATGCATTAAAGTACATGATTAATGAAGTTATGAGCATGTGTGACTAGAGGTGTTTA
TGTGAAGGTAGATCTCACATTCTATGCAAATGCACACGATGCATTATTTTATGAACATGTGAAAGGACATTCTCGCATGTATTAGGGTCTATGATGAAAG
TACATGCTCATCTTATATTCCTTTGAGCTATATGTTGTATGAAGGAGAAAGATCCTAAAGCCTTCTTTATGAATTAATAAACTAAAGGCTTTAATATATT
TAAAAATGGAGTTCGATCCTAGCACCGGAGAACATGAAAAATGATACAGGGACCTTCACATTAATAAGTCCCACTTCCCACAAATAGAACCTTCATGTTA
GCAAGTACGGGTTCGCAACACAGATGTCTCATGAGATAGAAACCTCCATGCTAGTAAGTCAAGGTTTCTAAAAGCATTCTCCATGTTCAATAACTACGTG
CCCCTATAGGTTATAGCTTGTGTTTTCCACATAGATAGCTATGTACGATTGGTTGCACCTTTGGCAAGTGCTAACCTTCTCTTTTCCGTGTGAGAGTAGA
ACACCGAATTCCATGTAGCTCACATGGTCTATGTCGGTTATGGATGTGTCTCCTGAAGGTTAATAATTAACTAAAATAATAATATGAACTCTAATCTAAA
CTTCATGATAATTGTACTTGGTATGGGAGTATTATGGACCCTACCTATACATTTCTCTAGATGACTTTAAGAAAGGATAAGATTGGAGACACATATGAAG
TAAACACTTATGTTATGTATGACTTTTATCAATGCATGTTAAGTGACCTTGTTATGTTAAGACATGAAATATGACTATGCATGTGAATTATACTTATGTC
ATCTAAATGGTTTTACTTAGTAAATGTGGGGGTATGGGACTCCATGAGTACATTGCACAAGTAAGATTGTGAAGGGATTATAAGGGTACTTTACCTATGA
TATGAACTAAGTAATTTATGACTAAGGTTGTAGTAAAGGAACGAGTCCTTATATGATTATATGAAGTATGTGGCCTTATGTTTACTTGTAAGTGAATAAG
TTATGACTTTTTAAATGTGTTGTGACTTGTTGAATATGTTATGCCTAGTCTAGGGTGACTTCTTAGGTACACTTGGTGGAAGTAGTATTATGGGATGCTA
CCTACACATTGCACTAGTGTGATGTAGGAGTTGTCTTAGGTGATGGTTTTTATGTGAATTTTATGTCTATGAGATTTTTATTACTTATGAATGTATGTGC
TTGAGTTATGAATCATATTATAGAAGACTATCATAAGGTGACCTCAAAGTGATACATTGTACTAAGTTCACTTTAGCGTTACTTAAGGAAGGAAGTAAGA
TAAAAGAGAGGTAATGTATGGTATGTATTACATATGTTTCAAAGCATGATAAATGGTTTTAGGTGCTATTTTGAGTATTACCCATATCTATATTATGTAT
GTGAACTATATTGAGCTTATATGTGCCTATGTTCATGAAGTTCACTAAAAAGACATGTGACATGATTTCAAATAAAACGTCCTCTTTAAATGCATGTTTT
TGCATGGTTTTCATACATAGTGCATTCTTGTCATCATATTTTTACAGAAAGTGTAGGTGGTATTGGCTAGAGGATTTCTCCTACATGAAGATCTTTGATA
GATCTCCCAAGTTCAAGAAGACGGATCCTCATGATTCAAGGATTTCCCTATGTCAAGTTCTTGTTCAAATTATGTAATAGACTCGATATTATTTTGTGTT
GTAAGGTCCATTTCCCTATTCTATTATATCGAGTTGTGTTTTAAATGGCAAATGAGACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATGTAGATTCATAAATATAAGGCAACCTAGATATTAATTA
AATACAATTATTACATCAATCAATGGCCCATAGAAAACTACAGTAGAATTCATAAGCATTAAGTCCAAATGACTTAACCCATAAAGTAGTCAAAACTAGG
GTTCATCAATTAGATAGGTTCATAGGTTAATTGAGTTAAAATAATATAATTACTAAAAATTCAATCAATATAAATGCTTAAAAACCTTTAATGCAAGAAA
CCATGGATAGATCATGAAATTGGACAATTCATCTTTTAAAACTTTAGAAAACATCTTTGAAAGTTGGGATCCTTGATTAATAGAGTTTCAAGTATCAAAA
AGTATACCTAAATTAATATAATACTCAAATTTTACTAACGATCTCCACTCAATTCTCCAATTCAAGCCCTTCCTTTTGTTTTTGCTTCAACGGAGTTCTA
GAGAATTTCTACGGGATTTTTGATTTTGATTTTGAAGATTGAAATCTTCTAAGTGTTAAGACTTATAAACACATTTAAAATAGCCAAAATACCCTTAATG
ACCCACTCTTTTTTTTATCTGGAAGTTGGGTGAATTTACCAATTCACCCTTCACTTAACCGTGGCCTCCGTAGGAAAAACAGTACCATCGTCGGAAGACC
ATCGACGACCCGTCCCTTGACCAACAGACCATCTTATTGGTCCTTGGTTTGGGATTGAGGATGGTCTTTGGATTCTACTTACCCATGCCTAAGTTTCCAT
CAACAAACCCTCACCTACGGGGTTAACTTACCCACTGGATGTTGATTGTCTTCGTAGGTTGAGCTTTCTTAGGCAATCTTGGCTCAATTAAAAGGGTCCT
TCCACAAGGACCCTTGGATGGTCATTAGAGATGTTTGCCCGTAATTTTTCAACCCAAACATGCTTTTATACAAGTTTAGGACCTCTCACATGAATTTCAT
CCAAAATGAACACGTAAAACTCGATGAAACATGCATAAACACACAAAGTTGTTTCAAGGCAAACCTTTCGAACGTCATGGATGTTCTTGGATGTTTGACC
TCCAAACTTCACAAAACTTGAACAACTACGAATAAACACTATAATAAATCATTTAAGGACCTTATAACCTATTGAAACACACATAAACACATAAAACCAC
ATGTGAGACACATAAGTGACTTAGTCATCAAACGTCTTGGTCGTTCCTTGACGTTTCACTTCTAAATCACCTAAAAGTCTAGAAAATGCCTCAATACAAC
ATTAGAGACCATTTTAGGACCTTATAACATCATGAAAACAATTTTAGGATCTAGCTTCACCTAAGTCATTTTCGATGTATTACAATCTCCCTCACTTAAA
CAACATTCATCCTCAAATGACACTTGCCACTCTCCCAACACTTCCAAGAATAGAGATTCAATTAGCAACTCATGACCATACCATTTAAAACCTCATACAA
TGCAAACATCTAAGAGAACATCAATTTCACATAACCAAGAGCATCACAACACAACAAGAAACTAGAATAAATTTTATAACTCATTATGCTATAAAACTTA
CATGCTTCATTCCAATTAGCAACAACTCATTTTATATTCATTATCATGCTCATATACCTCGGTTCGAACCACATTGCAACAATTTTGGAGCAAAGAATGA
ATTAGTCAATTTTGCAAAATTTTCATAGTGAGCTTTAACTCCCTGGCAGCTTTACAATGAATTTTTCCAACATTTTTCAAAAATGCAACTTTTAGGAAAT
TCATGATATAAACATGCATATATGAAATATAAAATCACCAAGAAGCATATTACAACATAATCATGACTTCATAAAATTCACAATGGAAGGACTTAATGTA
ATTCAATTTCAACAAGACATTTGAACACAATGCAACATACTTTTATATTTTTCTACTCTCAACTTGAGTTGAATACAAGAAATGAGACAATCAATCACAA
CTCCACTACTCACCATACTCCCCCACTTAGAAGAAACTCATAACAATAAGGAAACACAAGAACTTACCATCATCATCATCATCCGGCTTTTCTCCTCTAG
ACCAGAGTGCATAGAAATGCCTCTTATTTGGAGAATCAACTTTTGGAACATTAGGAGCAACTTTCTTACCCTCTCTTCATCTAGAAGTAACGGTAGGAGA
ATCTCTCACCTTTTGTCCTTTTTTACCACAACCAAAGCAACTCCTGGTAACTCTTATGCATTCCCCATAGTACCTCTTTCCACAAGTGACAAATGTAGGT
TTTCCATTTTTAGAACCACCTTTTTTCTTCAATTTCACCTTATCACTCCTAGGATCTTTTGAGTTTGAGCCCTGTTTTGGAGCCTAGGTTGACCTTGTTC
ACTAGAACCACTCCTTTTCATGTTTCTAGTCATCCTCTTAAGTTTGGACTCTTCAATTGATTGGGCATACACCATGAGTGTAGCTTGGGTCATATCATCA
TGTAGCATGGAGGTACGACATTCTTACTTCACTAGATCAGCGACCCAGTCACAAATATACTCATATCATCCCTCGGATTAGACATAAGGGATGGGGCATA
TATAGATAACATTGAGAACATCAAAGAGTATTCCTCAACACTCATATTGCCTTGGTTGAGATTGATAAACTCATATACCTTAACTTCCCTCCTCTCACGG
GGAAAGTACTTTCCACGAAAAGATTCCCTAAATTCTTCCCACTCAATAGGACCCGATTCAACCGGCCAATTATCCTTCCATTCAGTGTACCACACTTGAG
AAGCATCCCTCAATCGATACAAAGCAAACTCCGCCTTCTCCCTAGATGTAACCCATATAGCACTCAACACATTCTACACACCATCTAGAATCTCCTGGGG
ATCTTCTTCCATCATAGAGCCAAGAAAGGTAAGAGGATTTTTCCTCACACAAATCTCACAATATAGATGTCATAGTTCTCTCCACAACATTCACTCTAGG
CTCCATACTCAAATTCACTTGAGTAGTCATGGATCGGACAAAGCATGCAAAGACTCTCTAATATCTCTATTACTCAACTCTGGGGGATCAACCGGAACAT
CATTACCTCCTTCCACAATAGGGACTTCATCACCTTGAGCACCTTGAGGAACTTTCTCAACTTGCTAAACTTGAGGAGGAATCTTCTCAGGCACATCTTT
CTCATCAACTCTCCTAGTCAGTGTTCTCCTCGTATTCATCTTCCTAGAAACACTACGGCATGACATAGGAGTAGAAAATAAGGAAAACTCTATAATCCTA
TAGCCTCTCGCCCATAGATGTGTCGTGAGTCACACCGATGATTAAGACTCTACTAGATCTAACTTAATGAGACTTCTTGATTCCTAAGACTACTTTCTTA
ACCTATGCTCTGATACCAAGCTTATCACATCTCGATACAATACACTAGAATATAAGGAACTCTCGGAGCGCAACCGGTGTACTTGACCTCTCGGAGGTCC
TGTAAAAATCCTTTTGTATCGTTCATCACATCTAAAGACATATGAAAAGTAGTGCTGAATTAAAACTTTTCATAAAACATTCTATAAGTCTTAAAAATAT
CTTTCAAATAAAATCATAGAAACTTCTAAGTCTCATTTCATCAAATCTTAGACACGACAACACTTTGGGACATGGCCCATACACGATATGAATATAGAAA
TACTTAATCTATTTAAATACTTCGATAAAGGAAATAAAAAATATCTATGCCCTTGAGTCAAATGAGGACACACTTAAACTTCACTCGAATGATGCTAAGA
TCCAAGTCTTGCTTCCCAAATTCTCCTCACCTACCAACCACTATAGAGATATATAAAAGCATGGAATTAGTACAACCACATGTATTAAGTATGGCATAAT
GCATATAATCATGAAAACTGACATTTATTGGAAATATGGATCTTTTTTAATTAAAACATTATATTTCAATCATAAGAATAACAATTATCAACTTAGAAAC
ACATAAGATAAAATCTAATTAATTTAGTACATTTTTAAAGAAAAATTACATTAACCACAATTCACTATAAAGTGAATTCCTTCAACAATGAAGTGCCTTA
TCCTCACCTTATACATTTCCTATGATGTAATTTTATCACTAAAAATTATCCTAAGACTCATTCAAGTAAGACAAGAGAGATAGCCCATACAACCTCTCTA
GGCACACTTAAATGATCCTTAAGATCACATATAATTATATTAACACACACTTACAAAATATCATACACATGAACATGATATTCCTCTACCAAAAGTGATT
CTAAGTCTCACTTGAGTGAGTTGTGAAGCAACCGCCCATACAATCCCTTACACACACTTAACAGATCCTATAGATTACCTAAGATAGAATTATTCTCACT
TAGCACAACAACACATACATGACATGACATTCTTCTTCCAAAGTCTAACGAAAGACTTATTTAAGTAAATCAAGAAGATGAAGTCCATGATTGACCTCTT
CAAGATTACCTAAGTAATCCTTAAAACCACCTAAGACTTATATCATGTATACATAATCAAATATCTTCCCTAACTAGAGTCATTTTTAAGACTTATCTTG
GTAAGATAAGAAGTGACCATTTTCATGCCCCCTTCAAACCTTAACTAGACAAGCCTTAACTACTCTTGATAAGTACTTATTCATTTACATACTTTCTTCA
TTAAATCATTATATTACTTAGTTCATTTAAGACTCATTCATCACATAAAGACATTCCAGTAATAGTATTGGACAAGACCTAAGGACTCTGACTAACACCT
TCAAAGCCTATTGTTCATTGTCTAGATAGCGTCCCATACCACCACGTAAACTTCATAGAACTTAACTAATGCTAGTAGATATCCCATATGATAATAATAG
GGAATAACTGACATAGACCATGATAGCTAGACTTGGAATTCAAAGTTCTAACCTTCTCCGATGAGGAATATGAAGGGCGTTCTTTGTATTCAAATTTCAT
CCTTAAACTAGAAATACTTCCCTTACCATACTCACACGATTCTAGCCTTTGTTCTCATAGAGTAATTTACATAAAAGGTTCATATAAAGGGGTTCCATAT
CTATTTCATAACCCAATCACATTTACCCTACCAAAGAAGTCCACTAGGGCTACCTTACAATGGCGACAAGAAGCTCATAATGACTTTCCTAAGGATTGAT
ATGATGGCATTCCATCCAATCAATCTTAAGTCTATCATTCCTTTACTTGAAGAATACCATTACGGCTTTCAGCTTTAACATTCATAACCTTTACAACTAG
GTTCAAGGTTTAACATAAAGGACCCTCTTAACTTAATTTAAATTCTCATTCATCCATACATATAAGACTAAGAGTATTGAGAATTCTAATTCAAGACATA
CCATATTCACATACATACATGCATCAAGTAAGGGACACAAGTCAACCAAGACAAGACACAACATACTTCACTTTAACACATATTACTTGTCATTCTAGAA
GCACATATAAATAACCATTATCATGTTTAAGTCATTCTATTCACTACCATATCATCATCAATATGATCATCATAGACTCAGTTTACAATTAGGAAGAATC
ATTCATCGACCCTAATACTATACATATAAAGCCATACTCATAGTCAAACATGATCACCTAAATAGCATCAATAGAAGAACACATATACTTTCACATTACT
TATCATGTAGCTATTATCAAACTTCACATAATAAACTACACAAATCATCAGCATACTTCAAGTAGTGTCGGCAAGGCCATGATGATCATAATACATAAAG
TAACGCCGACAAGGCCACATCAACTGCAAGTAAAGCCCATAACACCGCCACGATAAGTGTACCATACCAATAACAACATAATTGAAGTCTAATTAACATA
CAATAAAGTGAATTGGGACAGTGTGCCACCACTCCATCCTCAACACCTCAATCCAATGTTAAATCATCCAATTCAATACCATAAGACCCTTATCCATCGC
CACGAACATCAATTCAATACGAAAACAACCATACTCAATGAAACTAAGTCAATTAAATTTAGATTCATCAATCTAATGCAACCTATATATCAATTCAATA
CAATTATTAGATCAATAAATATCCCTTAGAAAACTACACTAGAATTTATTAGCATTAAGTCCAAATCACTTGATCCTTAAAGTAGTCAAAAACTAGGGTT
CATCAATTACATGGGTTCATAGGTTAATTGAGTTCAAATTATATAATTAATAACAATTCAATAAATATTCAATGCTTAAAAACCTTTGATGCAAGAATCC
ATGGATAGTACACCACTTCTACTAAGTATGAGACCATATGCACAGATATCATGAAATCATGCTAAAAGGGACCTTTCATTAAAGTATGCAATTTACTTTG
AAAAGCATTATGCACATTCACGAAGACCATACCAATCAATAAGACATATTACTTAAGTCAAGAACATGTACATAACAAGACCAATAATACTAAGTCTAGT
CAAGTCAAAATACATATAACATAATTTAGCACATAGTCAAGACAACTGTATCATCAAGTTATAACATCAACAAGCATAAATAAGTGTTCATTACAACATA
ACCCAGGAAAGACCATTACCCATAAACCCTTATTAAGTAAACTAGTTCAATGACAATGCAAGTCCCCATAACCTTACTCAACCAAGTAAACCCAACAAGA
ACCTTGATCAATGTCCATCTTAACATAGCATATCATTAAGAGTACATATTATCATACTTAGAAATAGGGACCACACACGTGTTCATAAGTTAAACCAATA
ATCTTATAATATCATCAATGTGCAATATCATCATATACATAGCATATACAATTATAAGCATATACATATATAAGAACAACCTTCTAAAGCTTCCTTCAAG
GAAAATTAGTGCAAGGCATAGGTAGAGTCCTATACCCCTACCTAAGCTAAGTCAAACCGCTTAAGTCACCCTAGTTAGTTGTACTTCATTACTTTATTTT
TGTTTAGGAAAACTTGCCTTAATTGACATAGACTACAATAGCTAAACATAGAATCTGGTGTTGTAAAACCTTACACCGATGGAAAGGGTCTGCCGGCCAA
AGTAGAACCAAACATAAATGTAGCTTTCTTGGTGGATCCACTACCTAGACATCCTACGAGGAAATCATAGATAAGGAACTAGGATATAGGTATGAACTCT
TTACATGCCATTTGGCAATTGGAGTCTTATCTCATGAGAATCCATATGGTGAGTATCCCTCATAGGAGTAAACACCTCATGTGGAACTGTAGGGTGAATC
TTCCTCTATGAGAAGTCAACACCTCCCATTGTCAAGTTCTCTTGTTTCCAAGCTAACGTCCCTTTTGAAATATTTTTAAGTTGTCCATTATTATAAAAAC
TTAGTTTAGGTCATAGGGACTATACCTTGTATAATCATCACCATCATAGCTCAATAAGAATTGCATGACCATTGTCCTTTCATTACAATTCATAAAATTA
AGGCTAGCACATTTACATAGTCACGTTATATTAAAGCACATTGATAAGTTATCACAGCCCTTATAACATTTATATCTTAGACAATAAATCACAATCCATC
GTTCAAGATATTTCAATTCAACATCACACCAAACCTATCAATCTAAATATAAGGTATACTTCAATACAACATCATCACTTAATCACAAAAACCTACAATT
GAAGTAAAGAATAGAGATCACAAGACTTACTCAAACTCCTTCACAATGCCATCATGAAGGTCTTACCATCAACCCTCAAATCAACCCAATAGAGGTTTAA
TATAATCACACTATTGTAAACATCATTATAACAAGACCAATTGAATCACTATACAACAAATCATCACTAGTTCATAGCCTATAATTAGAGACTTAGGTTA
AGTTCATAGTCTACTTCACAATCTAGGTCAGTTACTCAAGAAATAGAATAAATTGAGTACAATGTATCAAAATATACTCATAATTAGCATAATAAAAACA
TATGATAATAATTCAAACACTAATCAAACCAATTGAATCAATACTATACAATTCAATTCAAGATCACAACCTAGGGTTAAGAAGAATAGGCCATCTTCTA
CAATTGAGACCAATACATCAAGACGTAATATAATTTAGTTATAATACATGTTAATATACTCATAATAAACAAAATAAGTCATAACAAATAAATTTACAAG
ATCAATTTCGTATTGGAAGATAACCCACTTGAATTTCAAGTTTTTGAGATCAATTTGAAGGAACCTTTGGGAAGAGAGATCCCAAAGGTGAAAGAAAATC
ATACCTTGTTGATTGATGGAGTTTGATGGACAAACTTGACCATAAGCAGCCCTAGAACCCACATATAGATTTTTCTTCAATGGGGTTTCTTTGGAAGAGA
GAAAGAAGAGAGAAAGAGGAGCTAATTTGGGTTTGAGAATTATGAGGGCTTAGGTTAGTTTAATTAGGTTAGGCATCTTTATATAGGTCATTAACAAACA
TAATTAGACCTCAATTAACCCATGAATAATTAAATAACCACTTAATTAATTAACTTAACTTAAAATTTGCAGCAAAACAGTGTGCCCATAGACTACACCC
CGATCGATGCCCATTTGTCAAACAACGACCAAGGGACCAACCATCTTGTTTGTCCATTGTTTTGGTCAGATACTGCCCAAAATAGGAATCTCGTGGATTT
ATAGAAGTGACCATATATGGTGGCCATCAACGCCCTATCGATTGGATTACGATCCATAGAATGCACTCATTTGTGAACATTGCCTTTTTCGCAGCTTTTT
GCCAAATTTCTAGGGCCCTTGATTGGTCCTTGGGGAGTTCTACCCAAAAGATTCAATTATAAACTAACTATAATACATGTTATACATCCTTCTACCAAAA
TTCATAATTTTCCGACTCCTTAAACTTAGTCAAAGGCTAAGGCACACTAGCATTTCGTTGAACTAGTTTCCGGACATCATGGACGTTCCTTGACGTTTTG
ATTTCTAAACTTCATAAATGACTTATATACATCAAAATTAACCTTAAAACAGTGTCTAAACCTTTTTACACTTATTTTAGGCTCTAGATTAGGTTTAGAC
TTTCGGAGAGTTACAGTAATGATGTTTCATATGATCTACTTATGGTTGCAGTACTTATGTGCTAAACTTTAGGCTAATGTTTCCTTGTCAGCATTACTTT
ATGAATTGTGAAACAGTGTGTAATCTTCACCATTACTTTATTTAGTATGGCTTTATCATGTTATAACTTGATTATGAGAGTATTATGAATGTCTAGATGA
CTTATGTGTTTATGTTGAGTCAAAGCATGAGTTCTTCTAGTTGATGATGTGTGTGTCTAGTAGACTATAGTATAGTCACCATTTGGATTCCTGGATGTTG
ATGTATAATGTTTCTTGATAGATTATATGATACTTGTGATACGTAGATTGATGATAATATAGTAGTGAGTAGGATGACATATAGATGATATTGGTTATAC
CTATGTGCTAATTGAATGATACTCTATATGTAATATAGTGAAGTATGAGTGTGTCTTGTTTTGGTAGACTTGTGTCCCTTGTTTTATGCATGTACAATGT
GAATATGAGTTCTTGACTTTGTATGTTAAAGCTTCTTAGTCTTGTATGTCGGATTGATATGTGACCTTGAACATTGGAAAGAAGGCCCTTATGTAGATCC
TTCAACCTAGTTGGAAGGTTATGATATCCTTGTAGTTGAAAGCCGTAATGGTATACTTATTGTGCTAATGGTGGAATTAGGGTTGATTGGCTGGAAAAGC
ATGAAATCATCCTTAGGAAAAATATTCACCTATCCTCTTAACCATTGTAGGGCAACCCTAGGTGACCTATGTGGTAAGGTATAATGTGATTGGGCTATGA
ACTAGAAATGGAACCTCTTGATGTACTCCTTTATTGAACTACTCTATGAGAACAAAGGCTGGCACTGAGTGAGTATGCTAGTGAAGTAGCTCTATTATAA
ATATGAGAATAAAGAACAAAGAAACCATCAATATTCCTTAACCTTAAACCTACAGGGATGTGTCCTAGTTCTACCATTGGCAAGTAGAACACCCTTTATC
GGAGTAAGGTTGACTCTGGATTCCATACTTAGATACCATGGTCTAATTCGGTTATTGCTTATTCTTATCATATGGGATGCCTACTAGTGTTGAAGAAGTT
CTATGAAGTTTAGGCGGTGCTATGGGACCCTATCTACGCATCGCACAATTAGTCTTTGAAGATGTTAGTGAGTGAGTTCCTAGGTCTTCTCTAAGACCAT
TAATTGAATGTCCTTATGTGATGAATGTCTCTTAATGAATAAGTAAAGATAATGACTTAAGTTGGAAAGTATGTTAATGACTAAGTACTCACCTAGAGTA
GTTTAAGGGTGTATTAGTTAAAGTATGAAGCAGGCATAGGAAGGGCCACCTCATGTCTTACCTAAGGAAGTCTTAAGAGTAACTCTAGATAGGCAAAGTA
AATTGATAAAGTAGACGTGATCTAAATTGAGGTAGTCTCAAGGATTATTTAGGTAATCTTGGAGATGGGGTATGGGTGTTCTCTTTTTAAATTAAGTTAA
GTCTTTGGATAACCTTTGGGAGGTTATATGTTTATGTTATTATGTGAAGTGAGAATGATCTTATCTTAGGTAATATAAAGAATATCTTAGGTGTGTGTGA
AGGGATTGTATGGGCGGACGCTTCATAACTCACTCAAGTGAGCCTTAAAATGACCTTTGGTAGGAGGATCTCATGTTTATGTGTTTTGTAGGTATTGTTG
ATGCCATATTTCAAGGTGTAAGTTTTACTTTAACTTACAATAAAGTTCACTGTGATGTTACAGTAATATGTGATAAATTGATATAAATTTCTTATGACTT
ATATTGTGTTCTAAATTTGTTGTTTGGTATTTAAATGTGATTTTTATGCTTATTATAATATGAAGATTTAATCAAAAAGAGAATGTTTCCCATAAATGTC
CATTTCTCAAGATTTTATGCATTATGCCATACTTAGTACATGCATTGTACTAATTCCGTACATTTTGTTATATCTAAAGGTGTAGGTGGAAGGTGAAGCT
TGGAAACTAGGATTCTTTCAAGCAAGTTTAAGTATGTCCTCACTTGAATCGAGGACATAACTATATTTAGGCTTATTTTATCAAAAATATTGTATTAGAC
TAAGTATTTCTATATTCATATTGTATGGGACGTGTCCCAAGTATTCTTAAGTCTAAGGTTGGCATATGTTTAGACTTAGTATTTTCCTATGATTTTAATA
TGAAAGATGTTTTAAGATATTTCATGTGAAATGTTTTAATTCTGCACTATTTTCATACATATATGCAATAAATGATGTGAAAGTTCTTGTACAAGATTTC
CGAGAGGTCAAGTGCGCCATGTTGCACTCCGAGAGTGTCATATCTTCTAGGATGCGCTGTGAGGATGTGACATAGTATGTTTTTGCATGTTTTACATGTT
CGTTTTGGTTGAAATTGATGCGAGAGGTCCTTAAGTTGTATACTATCGTATATACGTTGGAAACGTCCAGGAACGAATCCCCAAGGACCACCCAACGGGT
CCTTTAGACGGACCCAAAGACTGCCTAGACACTGCCTTGGTAGTGTCAATCGATGTCCTAGATCGATACGCCGTAGACAAGGTGACACCCCGTTGATAGG
GACGTAGCTCAAGACTTAACCATGTGATCTTAAGCTCCAAGGAAGGAGGTGAAGTCACAAAGGACGGAGCAGCAGGACAAGCCGCCGTCCCATGAATGCC
CCGTCAACTACTCTCGTTCATGCAACCTGCAACTGCTAACCATGCACACTATTTCATTAAAGGGGTGAATGAGAAATTCATCCCACATTCCTAAATTACT
ATGGACGGTTATTATGGGTTATTTTGGGTATTTTAAGTTGATTAAAAACATGAAAACCCCTTTCTCAATTCATTCTTCAAAAATTAGACTTCCATCTCAA
AACAAAACCTCTCTAGAAACCTCCATTGGAGATGAAGCTCATGAACAGACATGGTGATGGATTCTCAAGCTTTCTTCATCAAGTTTCGTGGTTTTCTCCT
ATAATGGTGTATGGTGATCCTTCATCTTTAGATATCAATTCATCTAGAGAGCTCCTTCAAAGGTTTTCAAAGAGAATTCATGATCAAACTCTATATCTTT
CAATCTAGTCATGTGTTCTTTTTAAAAATGATTTCAAAAACGTGATGATAATGAATTGGTGATTAGCTAATGTTTTGAATGTGATTTCAATCAAATTTAA
TAATTAATCTATGATCCTCCTAATTTATTAACTTAGCCTATAATGTAGCATTGTGATCTTGATTCTAAGTTAATTAAATATGATTCTAGTATGTTTAGTT
GTCTATTTCTACTGTTTTGTATTAAAATTTATGGTGAATTATTAATAAGTGATCAATGATGATCAAGGTTTGGAGGTTTGGTAAGTTTGATCTATATTTC
CCCGATCTATAAAATTGATGATGTAGTGAACATAATGTGATCTTGATCCTATAATAGTTGAATCATGATTTTGTTTATGTTATTGTATATTTAGATACTG
CCTCATATATGTATTATTGATGAACTATGAGTATTGATCAATGATGATCAAATATTGGAGAATTGGTGAGTTTGATCTACTTCTTCTACTTTTCTGTAGA
ATTTCTAGTTTAATTTCCCTTGTATGGCATTGTGTGGCATGTTCCACTTATGATGGTGGTGTTTACTTCCTTTTCATTCTATATGTATTGTGATCATGGC
CTTTAAGGAAATTGTGTTATGAATGTGTGGTTATGATGATCATACAATGTAAAGTTATATGTCTAGTCTTCAATACTAGTTTGCGATCTAGGTTAACTAA
ATGAAGTTGTTATGATTATGTTTGGTCTATGTGATGTCAATGATGAAGTTCTTTGGTGAATGACCCCTACCTATGTAACCCTATATGAATGTGTGATCTT
AGCCAATGATAGGATTCTATAATGCAAATGTTGAAGTTGTCTTGTTTCCTATGATATAATGTGGTGTGTGCTATATGCATGAATGTGGATTGTGGTCTTA
AGAGGGTGGCTGCCTCAATATTGTGTTGATAGTCATTATGTGATCATGTTTTCCAATGTAAACATACTCACACCTCATGCATGCTTAGAAGTAGTATAGG
TTCATGGTGTCTAATCAAAGGTAAATTCTCATATGCACTAATGCCTACTACTATGCATGTAAAGTATATGTGCATGAAGTATGCAATGTATCTTTAATAG
GATGACTTGATAGGTTTACTAGTGTATGCAATGGTATGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTTTTCCCCAAAAACACAAATCGCTAATTTCTCCCAAGAACACAAATTGCTAATTTCCTT
CGTCCTCATACGCAACAAACCTGTACATGGGATCGCTAATTTCCTAAAGGACACAAATCACTAATTTCCCCCAAGAACACAAATCGCTATTTTCCTTCGT
CCTCATACGCAGCAAACCTGAACATGGGGGAAAAGGAAGTTCAGCAAAATTAGGGATTTGCTTTGGGGAAAAGGGATATGGGTTTTGGGTCGGATATGGG
TAGGATTATTTAAAAGAGGGGTATAATTGAACCATAAAATATGGGTAATAAAAGGGTTTAATGGGTCGAATTTTTAGGGGCATATTTGACCCTTTCTCTT
TTTTAATATAAATGCCACGATGTAATATTAAAATTACGTGGAAAATTCATTTGGGCAATTAAAAAAAAAGTAAAATGCGCTGGATATTCTGAGTTGGCCA
ACTAATGCCCATAAGGGCATATTTGTACCAATAATTGAACGGCGAGGGTATAAATGGACCAAACTTTAAACGGGGACATATTTAAACCTCTTCGAAAAAT
TTAGGGACATATTTGATTCTTTTCCCTAAAAATATATTGAATTGAAACGAACCAAACCAAATCCAGAACTGGGCTGTTGGCTTTCTTTCATCTAATGGGC
CTGCGTGCTATGGGCCCAGTTTCTATACCATCCTACCCAAGCCCGGCCCACTTAGAGCCCTGTATTTAAAAAGATAGCAATCAACTGGACTTTTCATCAT
CGGCTTACAAACCCTAAATCGAGGGTTTTCTCTTACAGGTATCTTTCTTATCTACCGCTCTCTCATTCACATTGATGCATCATTTCTAGGGTTTGAATTT
GGATATATTGATTGATATTGTAAGATTTTGTGTCCTTTTGTTGTTGAGAAGACGTGAAAATGATTGAATTTTTTTTAGCTCCTGATATATCTGAGAACTG
ACTTTTTTGTGTCTGGGATTTTTTATTGACAGGTGAGTTTGAAGGAGGAGAGATTTTTGAGCCATGAGGTATGAATGAAGCTTAAAATTTCTGTTTTTTT
TCTTTCAATTTAATATGTTATTTGTTTTTACTGTGTTATATCTTCTAAGTTTTGCTTCGATAATCAATTTTCTGCATTGTTTTGCTGATTATAAGTAGTT
GATCCACCTTTCCATGCAATTTTTATTCATATTTTATGTTTTTAAAAAGGCAGGAATACTACGCATCTGAAGCTTTTATACTGTTAGAATATTGGTTATA
ACAACCTAGTGTTATTTGGCATTATTTTGATTTTCTTTGACTTTTATTATGTGTTTAAGTAGTTACTCTTTTGATTATTTCCTTGGTTTAAGTGAAAGAA
TCCCTTATTACAATTATTTTTTTCAAAGAACTCGTCTTTTTATGTGGAAACCACAAGCATTATGCTTGAGAAATGCTCCTCCCGTGTTCAGCATTTGAAT
TGCAGTTTTGATTATTTTTTCATTTTTATAAGATCCTTTACTATATGACCTTTTTGTTTAGTGATAGTTGTGTATCAATTATTAGAAATCCCTTTTGATA
TCCATTTAAAGGTGTTGCTGATTATTCTAGACCTTTTGTTTAGTAATAGTTGTGTCTCAATTATTGAAAATCCCTTTTGGTATCCATTTAAAGGTGTTGC
TGTTTATTCTAGTTTTAATTTGATTTTGATTCTTTCACAGTAAGCTTCAGAGTGAGGCCCTCAGAGAAGCCATCTCTGTGATTAAGAATGATTCAGCGGA
GAAGAAAAGGAAGTTCAGCGAGACCATTGAGCTCCAGATTGGATTGAAGAACTATGATCCCCAAAAGGACAAGCGTTTCAGTGGATCTGTTAAGTTACCA
CACATTCCTCGCCCTAAGATGAAGATCTGTATGCTTGGAGATGCTCAGCATGTCGGAGAGGTAATTTTAATGAATATGTTAACTAGTGGGCAATATCTGA
ACTGATTATGTTAAGAACTATGCTATTGTTGGAAGGCTTTACTGAACTAACATCTCCTGCTTGCAAGATTTAGCTTAACAATGGGATGATTAATTTCTCA
TTAAAACAAGCCTGAAACATCAGAGTTTTTTTTCCTAGCCCACCAGACATGACACCTTGATGTTGGATTGTTATTGTTATTGATATTGTCTTGGGAATAT
TGTGTCTGTTAATATCAGATTAGCCAAAAAACTGCATCTCTTTGTACCTTTCCTGAGTCTTCAGTTTATTTGTTTAGAAAGAATGATTAAAACTTTGTGC
TTTTTATGTTTGCAGGCAGAAAAGATTGGTTTGGAGTACATGGATGTTGAAGGCTTGAAGAAGCTCAACAAGAACAAGAAACTGGTCAAGAAACTTGCAA
AGAAATACCATGCTTTCTTGGCTTCAGAATCTGTCATCAAGCAGATTCCCCGTTTGTTGGGGCCTGGTCTGAACAAGGCAGGCAAGTTCATAGATTATCT
TAATTCTTTATATGCTGTTTGTTTATGTTTGCTGCTTTTCTTCATCCAGTAGAATGTTGCATTTGTCACTTTTTTTCAGTGGCAATCATGTGCTCATGGT
AGTTTAGTCCAAGCTTGTATGTTCACCTTCAAATTCAATGTCTGAGTTGCTTTTTCCATTTGTAAATGCAGGTAAGTTTCCCACCCTTGTTTCCCACCAA
GAGTCTCTTGAATCCAAGGTTAATGAGACCAAGGCCACAATCAAGTTCCAATTGAAAAAGGTGCTCTGCATGGGTGTTGCTGTTGGAAACATGGATATGG
AGGAGAAGCAGATCTTCCAGAATGTGCAAATGAGTGTCAACTTTCTTGTTTCATTGCTGAAGAAGAATTGGCAAAATGTGAGTACCTCTCGGAGTCCTAG
TTTAACCATCTCTATTTCAATATTTTCCTGGATTGAATACTTTACATTCCAGTTCTAATTTCTGCTATGTTTTTGTCAATACAGGTTAGGTGCTTGTACT
TGAAGAGCACCATGGGAAAAACACAACGTATCTTTTAAGAAGATTTCTGTTTCTGTTGTTGGAAATTTTTCAGGCTTTCTGGCTGTGAGCTGTAGACACT
TTGAAAATTTTGGGTAGTTGTGATTTTTGTCATCTTGTTTTGAATATCTATAAAACTTTTAGGGCTATGTCTGCTTTCTCTTCGTTAATGATGTTTTCAC
TGATCCCAGTAACAATCCGAGATGCCAATTGCAGTACATTACTTTATTCTGTAGTTTTTGACACTGAAACATAAAACTGTGTTGGTTTTTATAACAATCT
CACAGTACATCATAAAAAGCTTCTTTGGTGTAATATTCTCTAAGAGACTTGAAAAAAGAATATATTCAAGCCTACAAATTATTTACAATGTCTTTAGTAA
AAAGGGCAACTATAAGTTGCAATTTTATTTTTTTAATTGACTCTTTCTAATTAGCCTTCGTGGTTAGCTTATAAAGAAATTGGTGTAGTTACCTTGAGAA
GTAAGCTTATTATTAAACCAAAACTAAAGGTGATAAAACAATACTCGTTTCAAGTTTATTATTCACGAGGCATCACCACTCTAAAGAATTAACAGACTGA
AAGATTGATGTATGAGAGAGATTTAGATCGATGATGCCTGCGTTGTAGTCCGAGTCTTGTAGTGTTCCATTTCTAAGTTGACCGTAGAAAGTATTTCGCA
CTAATGATTTTGGAGAGTGATAAATATCTCGTAATATTAATTTAGATTCACATGAACTAGTTTGGAGAGCGATAAATATTTTGTAAAATTAATTTAGATT
CATGTAAATTAGCTCGAACAATAATAGTTTTTGTTTTGATCATATTTCGAAAAAGAGTACAAAATGAGTAGGGAAGGGCAAATAGGTAAAGACTCCCATT
GTAATTCCAAAAAGGGTAAAGAAGAACCCATGGGCTGCATCTTAATTCGGCAATCCCCAAAACATAACTCACTCTATATATTTGTTGAAGGTGACATTTT
GAGATTGCCTAACACATTGCTCTCATTTGGAGTCTTTCTAATCCTCTCTGCTCGTCCTTGATTACTCCGCCTTCCTTCTCCAGTAAGAAGCCTCCCTTCT
TTTTAAAAGAAATTTAATGTTTTTGAACTTTTTGGTTATGATTCTGGACTTGTGTGTTTCATGTGAATATCTCGTGTTATGCTTGTTGATGTCTTCTGAG
TATTGGGTTTGTCTTGTTTTAGTATTGGTTGTTGAAATTTTCAATTTTTCCCTTTCCATTTGTTGGTGAAATTCATGGTGTAGGATTAAAGGTTGGATCT
TTAGTCTTAGCTGAATTTTGGGTGTTTGGAACTACTCGTTATTCTTTCACTCTAAATTCAGTTTGATGTTTTTTTTCTTGTTTACCTGAATGACATGCAG
ATGGAAGATAGCTCTTTCGCTTTCTGGTTTTAGTAGTAACTTTTTACAAGTGTCTAGCAGGTCACTCTATATGGAGTTTCGAGTGAAGAGCAGTACCTTA
TTGAATGTTAAATTGATTACAAATTACAATCACTTTGTTAGAAAAATCAGAAATGTAAACCCTGTTAGTAACTTAGTTTTACCTGATACGCAACATTAAT
TGGGTGAAGATAAAAATTCTAGTTTCATTTGAATTCAATAGATCTTATACTTTTTCTTTTTTGAGCACCAACGAAGATATTTTTTCTTGAACACTAGGTG
TTATAAGTAGTTAACTTTTTTTAATCAGGTGAACATGTCAACTGTCGGACTTGCTGCAACCTCTATAGTAAAAACTGCTCCTCACACCCAAAGAAAGAGT
GTCTTCATTAAGACCCCAGTGTCTCTGGGGTTTGTAAGGAGCATTTCTAAGGGCTTTGGATTGAAGTCTAGCTCTGGCTTTAGAGTAGCAGCATCAGCAG
TTTACAAGGTCAAGTTGGTTTGTCCAGATGGTGTTGAGCATGAACTCGAGGCATCTTCAGATACTTACATACTCGATGCAGCTGAAAATGCTGGAGTCGA
ACTCCCTTATTCTTGCAGGGCAGGTGCATGCTCAACATGTGCTGGGAAGATTGTATCAGGATCTGTTGATCAATCCGATGGATCTTTTCTGGATGATAAT
CAAATAGAGGAGGGCTATGTGCTCACATGTGTTTCTTACCCAACCTCAGATTGTGTGATTCATACTCACCAGGAATCTGATCTTTACTAGTTATTTATAT
ATCAAATTATGTGTATGCTCTTGTTTTAGGTTGAAGCAGTTGGAAAATTGTTCTGTAATTGAGAATGGTCAGGTGTAGAATTCAATCAGGAACCTTTTGT
GTTTGAATGATGTTCGTTTAATGAATGGTTCACTTTGTGAAAATGATATCCGCACCTGGTGTTTATAGCAAACTACATCCATTTGATCATGTGCACATGA
ATAATATCTACCAACAATGAACAACTAGAGAGATATGTGTCGTAAATGAGACATAAATCCAGTATTAAATGTACCTCTATATAAATCCAGTGAAAGAAAA
CTTGAAGAAAAACAAAGTCACAGGAAACATATTTTGAACTGAAGAGAAAACTGTAGGTATTATTTTTGAGACACAAAAGAGTAATTGTTGGCGATGATCT
GAAATCAGGAATTGTATTTGCTTAGACGCACTTTCCTTTCCATGCGATATCTTTCAAGACATCTAGTACATGTCCGGCGAATAAAATTGGCAACACAGGG
TATTGGTATCCACATTGATCCTGCAACTTGTGTAAGCTTGGAAAAAATAAAAAATCCATGAACTCCGAATAGTGCAGCAAATGAACATGCAGCGGCGATA
ACCCACTCGCCGTTGTGATTTGGCGATATGAGTATAACAGACATTGAATAGGTGACCATGAGAGACACAAGTGACCATAGCAACAATGCAGTGTTTTCAA
CATGGAAGGGCAGCAGGGCAAAAGTCAGAGCAACAGCAAGAGCAAAAGTAATGGAATTCATTATTAAAAATGGGTAAAAAAGACCTTTTTTTGGTCCCCT
TACGCTTGGAAATGAATGTTTGTGGATTGAGGAATTGGTTGTCTTGGCAGGCATAACCAGAGAGGTCTTATTATTGTTATTAGTGTCGTCGTCTTTCGTT
TCCCAACCGCCACCTGGAGGACTGAGAACAGCTTGAAAACTAGCCGTTACAAGCAAAGTAGTAACTATCAGGTATGCATTTCGCGCATCCTCTGTTAATC
CTTTACGTGAATCCACAATTGCTGCTGCATGTGATCTGATTACGTTGGTGAGGTCAGTGAAATGTGGAATATCTTGAAGAAGATCCGCCATTGTAAACTT
CTTAGGAAGTTCTGATGTCGTCATGGCACCAACCTTATCCAATATTTTCTTAATTTTTACATAAACTTGGTTCGGATTATCATTCGAAGCTGAAAATGTT
ATTTGATCCTCAACAATATCAAGAGCTGTCTTATCATACCGATTCGTAGCATTAACATACGCTTGTTCCTTTGCTAAAATCTTCACAACCTGCAGATCAT
CATCATATATAATAATAAAATAACCAAAAATGAATATATATTGATGACTTGAAGAAACATGATATACCTCAACTTGACTTGTTTCTACAGCAATGTGCAA
CACTGTGGATCCCTCGTTATCTTTCCAGTCCAATATTCTTTTGTTGTTAGTCCGGTAGAGCCAACCCATTAGAACTTTAAAAGCCGGCAACTTGTTACTT
AACACAGCGAGATGCACTGCTGTTTCTCCTCGAATGGTCACTTCCTTGATTGCGGTGGGGCAAGCAAGGAGAAACTCGCCGAGAAGCTCAACATTGTCAG
TTTGAGCAGTTACATAGTGCAGCGGTGTTAGCCTCTCCCTGCTTCTGACTTGAATGAGTTTAGGATCATATCTTATGAGTACCTTCACAGTGTCTACCTG
TCCATTACTCAGGGCTATATCCCCTGGGGTCCAGCTTCCTTCCGAAACTAGGCATTAAGCTCAACATTTCAATGGCAAAAGCAGTGTTCCCACAAGCTGC
AGCTGTGTGCAAAGGGGTTTCTACAAATTCTAACGCGTCAATCTCTTTAAGAATTGATGGATTTTCTTCAATTATTCCGTAAAAAGCATTAATATCCCCA
TTTTGAGCTGCTCGCTTCATCTCATCCATTTCCTATCAAACACTCAATAAAATTAGTCGCCTAAATACAATCTAAACTATAAATGTAGGAGACCTCATCC
TTTTAACTAAAAAGGTCAAAAATCTCAATTTCCTCCTTAAAGCTCTCGCTTTAGTGGCTTGACAGGAAGCAGTATGGAAAGTGAATGTGTGTGTAAGTAA
GAGAAAGAGATACCTTTGTAAATGAAGTATGGATGTTCACTCTTCAGTAGTTTGTGAATTGTGATTAAACAATTGGGTGCATAAGTCTAGTAAAATACTA
ATTGGGAGACTTGTGTTGGGGGGAAAAGTATCAACAGTACTAGTACCTTCTATAAAGGAAAGGGGTCAACGGGAGGAGGATTGTTTAAACCTTATAAGGC
AAAAGCGCTCAAAGGGAGGAGGATTGTCTAAATCTTATAAAGAGTTCACTTATCTCATTAACCATCGATGTGGGACTTTTGTCATTCTTTAACACCCCAC
TTCACGCCCAGTGTTTAGCATCTGGTGCGTGGGCAATTTTGATTTTGGAGAGCCCCAACTTCGGGTGAGACGGACCCTGTTTTGATACCATGTGAAATTA
GGTCTTACGCCTAATTCACACCCAAAAGTCAACTCAAAGAAAGGAGGATTGTCCAACCCTTATAAAGAGTCCACCCATCTCATTAAACACCGATGTTTAA
CTTTTGTCATTCTTTAACCCATATATTTCAAAACGTACAGAAATAGTTTAGATAAATATTATAGGTAAGTAATAGGGTAAAGGCGTAGGGATAGACCGTA
ACAGAGAGAAGAATAAAGGAGGAAAAGAAAAAAGGCAGCAAGAGATGTGTTACTCCAAGAATTTGATGTTATGTTACACGAGGACCAGAGAGAGTAATTT
CTTTATAAAATATATGTGAACTAAAAGAAATAGGTGTATCTAAAAATGAATTAACGATATAATTTTCTTGTTCACGGTCAGTCGAGAAAAAATAATCTGA
AATGTGATAATGGATAATTTTAATTTATTTTTCTTATTTTTATTTTAATTTATTTTTTTAATAATTTTTTAATTCTACCTTTTTATGTAACATGTTTAAA
ATCATAAGATTAAAAAAATCAAAATTGAATTGACTTATCTTAAAGCAGGAAAAGATTAAAAAAATACCAAAAAACGCGCTCAATTAATAGTTTGGAATAA
AATGTCATTGCAGTCAATAGTTTAGTCTAAAAATACCCTTGAACTATTGATGACAATGACCCAAACTATAAAACGAGAGCATTTTGATCAATTTCACATA
GTTCAAAGACATTTTTAACCTATTTCGTATTTTAAGCGAGCAAAATAATTTTTATACGTTTTTTTAGTGTTTAGGTAAATTTAAAAAAAAATGCTTATGA
GCACTTGATTTATACAAATCTTTAATTGAACATGACATTCAATAATCTTTTTTTCATCATATCGAAATCAAAATCAATCAAACAAATTGAAGCGAGATAA
TGTTATTTTATTCCTAATTTAATTGAATGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCCTCCGATTTGAGCTATTTTATGGAATTGAATCAAATTTGAAATTCATTTCTTTCACATTTTTGTCT
TAAAAGAAAGTTCACTTAATATGTATAAATAACCACAATAAGTAAAAAAGAGTAATATTTGAGAATTGGCAATAGACTTAATCTTATACATGTCTCTGAA
AAAATTTACTTAATGCAGTAGTCTCTCAAAACAAAATTAGCCATCTTTGGCATTTGCAATCGTATATTATAATAATAAATATGTATATCTCTACTCGAAC
GTTACGCTAATGGTGAAGATAGAAACCATACTTTTTATTAATGAAAATGTTATAGTACAAATTAGAAGATTAAATGTTGTACTACCAATTTATGTGAATG
TGGAGCTAAATGTAATGGTAAATACAAACTAAATATTGTACTAATTAGTTACTGTAGCATTTTATGTCGAGATAATTTTCCACATATCGAAAACCAAACT
ACCCTGGACTATTAGAAGAAAATGTATGTCCCTATACAATTAACCCTTAAACAGGAATTGCTGTCCAAGGGTAAAATTTAATTTTGGGGAAACAAATAAT
TAACTTCCACTTTTAGGTAGTACCTACACTATTTTAAATTAAGGGTGTGTTTGATATGTTTTACTTTTTCCGTCTCATTTTATGTGACAACATTTGATCT
GGCACAAAATTTAAGAAATAATGAAGATTTTAAAATATTTATCAAATCGTTCTTTAAAAAAGTAACTCATTTTTCTCTCTTCTCATAAATGTATTAGAAA
ATTAAGATCAATAAAGGTAAAAAAGAGAAATTATACCTTTAAATACTTACCATATAAGAAAATGAGACGTGTTTTTTTACATAAAATGGGACGGTGGGAG
TATCATATTTGTCTATATTAAATGTATTTTGGAACTAATTCCAACTTAAAAATTAATCACGAGAAAAAGATTGATCTCATTTGTTTTACTAAAATCAGTT
TTGTCTAAATAAATATTTGAATAAAAGTAAATAAGTAGAGATTGTTTGTAATAATGGTTGTTGTTAGTGATTACTGGTAATGTTGGAGACTGTTAGTTTT
GTAATGACTGGTGTGATGATGACATTTAATAGTGGTGATGGTGATTGTCCTGGTGAAGTTGATTGATATTAATAGTTAGTGATATTAACAGCGATGGGTG
AAGAATATATATGGTAATTGATGATGTGTTGATGATAGTAGCTGTGCTAGTTATGATAATGAAAATGGTTCATTGGTTTGTAGTAGAGATTGATCGCAAG
GATTGTAGTGGTTGATAGTGATGGTGGAGGTGGTAGTAATTGTGAGTATGGTGATGGTTGTTGAATTATTGAAAATCTGTAACTAAATCTATGAAGATGA
AGAGAATAGAAGATGGAGAAGATGAAGAAGAAGAAAAATCATTGAGAAAACTGTGTATTGTATATTGCAGAAAATTGAATTACAATATTGGTTTGTTACA
GCATATTTATAATGTGACTAATTATATCTAACTACCTATCATGTGCAAGTTAAGATGCTAATAACTAATTTCTAACTAACTTGATAAAAGACTAACTAAC
TCACTAATTATATTTACTTCAACCTATTCCTATTTCATCACTCCCCCTCAAGCTGGCAGGTGCAAAAATGTTAAGCATTCCCAGCTTGCCAACTAAATGT
TCATGTTGTACTCTTGGAAGCCCTTTTGTCAATATGTCTGCTGTTTGATCCTTAGTTCCCACATGTTCAGTCTTTACTAACCCCTCTTGAATTTTCTGCC
TAATAAAATGGCAATCAATTTCAATGTGCTTTGTTCTCTCGTGAAACACAGGGTTTGCAGCAATTTGCAATGCAGCTTTGCTGTCACTGTAAACTTTAAC
AGGTATCTCAATTCCAGCCTCCAATTCTTTCATTAGAGTTGTCAACCATACTATCTCAGCTACTGCACTTCCCATACTTCTGTATTCAGCCTCTGCTGAA
CTCCTAGACACAGTGGTTTGTTTCTTTGACTTCCAAGAAATCAATGAATCTCCATACTTGACCAAAAAACCTGATACCGACCTTCTTGTATTTGGACATG
ATGCCCAATCTGAATCACAGTATACTACCATAGTATTAGATTTATTACTACTCATCAAAATTCCAAGGCCTGGCTGTCTCTTGACATATCTGATTATCCT
CATTGCTGCATCCCAATGAGATTTCTTTGGCTGCTGTAAAAATTGACTAAGAGTTTGTACTGAGAATGCTATATCAGGTCTTGTTAAAGTCAAGTACAAT
AATCTTCCAATGACTCTTTGATACTATCCTACATCTTCTAACATGTCATCATCTTCCTTTCCAGTAAGCTTGTCTAACTCAATTGCTGTCAACTTCTCAT
TTATTTCTAATGGTGTCCATGCAGGTTTAGCTCCCCCTAGTCCTGTTTCTGAGATTATCTCTAATGCGTATTTTCTTTGATTGATTAATATTCCTTTCTT
TTACCTGCTAAACTCCATACCAAGAAAATATTTCAAATTTCCTAAATCTTTGATCTTGAATGCTTTGTGTAATTCTTCCTTGGTCCTTCTAATCAACTCC
AAATCATTCCCTGTTACCAACATATCATCCACATAAATAAGGATGATCACAGTGCTTTTACCTTCTCTTTTTATAAACAATGAATGATCCAATTTGCTCT
GTTGAAATTGAGAATGCAGCAAGGCTTCTGTTAACTTTACATTCCATTGTCTACTTGCTTGCTTGAGCCCATACAAGGATTTAACAAGTCTACAAACTAT
AGACTCCCCCTGACTTGGAAAACCTTGTGGCAACTGCATATATACTTCATCATGAAGATCCCCTTGAAGAAATGCATTATAGACATCAAGTTGATGAATA
TGCCAGTCATGTTGAGCAGCTATAGATAATACAGTTCTCGCAGTAGCAATTTTGACAACTGGAGAAAAAGTCTCATTGTAATCAAGACCTTCCGTTTGAT
TATACCCTTTTGCCACAAGACGAGCCTTAAACCTTTCTATGTCACCATTGGCCTGAAGTTTAACTTTATATACCCATTTACAACCTATAGGATGTTTCCC
TTGAGGTAAAGAGTCCCAAGTATGATTATCCTGCAAGGCTTGTATCTCAGCATTCATAGCATCTATCCAACGAGGGTCTTGTGAAGCCTGTTGATAAGTA
GATGGTTCAACCACAGTGTTCAGCATGCTCAAAAAACTATAGTGTGAAGCTGACAAGCCTATATAGGACATATAGTCTTGTATGGGATATTGTACAGAAT
TCCCAGATGGTGCAGTCACATAATCTGTCATCCAGAGAGGTCTAGAGGACACTCTTTGAGACCTTCTTGGAGGATTATAGGAACTATCAGTAGAAGGTAT
AATAGGAACCTCTACTGAAGCAACTTCTACTGAAGTAGGCATCATATGTGCATCAGAATATGAATCAGATCCAAGATGAGGTGAAGTAGGACAAACATGT
ATATCAGGATTGATATCATAAAAGGATGAATCACATGAGTAATCATAATCAAAAGAACAATCATCACCAGATGTAGAAGAATGTTGAAAAGGAAATGTGA
ACTCTCTGAACACCACATCTTTATTTACAAAAAACTTCTGTTTTACTATGTCGAAAAGGATATAACCTTCAGAGACAGATGAATACCCCATGAAAACAGC
TTGTACAGCTCTACTTGCAAACTTATCACCTTTTGGTAAAGCACTTGCATAACACAAACATCCAAGTACCCTAAGATGATCTAAACGAGGCTTTCTCTTG
AACAACATTTCATAAGGAGATTTTCCTTTTAATACAACTGATGGCAGCCTGTTAATAATATATGCAGATGTAAGAACACAATTACCCCAAAAATTATTAG
GAATATGACCTTGAAACTTTAGAGCTCTTGCAAACTCTAGCAAGTGTCTATGCTTCCTCTCAGCAACTCCATTCTGCTGAGGGGTATATGCACAAGTTTT
CTGATGAACAATCCCCAAATCTTTAAACCATTCAGCTAAATCAAAATTCACAAACTCCCCACCATTGTCTGATCTCACAGTTTGAATCTCAGCCTTGAAT
TGTGTTTGTAGCATCTTGAAGAAAGATCTTAAAATAGGCAATACATCATTTTTAAACTTCATAAGAAATACCCACGTGACACGAGTGTAATTATCAACAA
CAGTAAGGAAGTATTTATTTCCATCAAAAGTAGGAATGTTATGAGGTCCACATACATCCATATGCAATAGTTGGAAAGCTTTACATGATTTTAAATCACT
ATTTTGAAAAGCTAATCTGGTATGTCTAGCTAAGAGGCACACATTACAATTCTCAATAACATCTTTACAATCACCTAATTTGCAACCAAGTATCTCCTTC
ATAGTTGTGCTGGAAGCATGTCCCGGTCTTTTATGCCACAGCAATTTGTCAGTTTTATTCAAACTATCAGCACACTCCATTTTTGTGATTGTATTACCTG
CAACTGCTCTTTTTGTGGAATTCTTAGAGTTCATGAGATAAAGCCCATCCTTCTCTCTACCAATCCCCTTCACTTTCCCAGTGGAAAGGTCCTGGAACAA
ACAGAAATCAGGATAAAAGGATACAAAGCAACTCAATTCCCTAGTTAGTTTTGACACTGATAGAAGGTTGTACTTAAAATCTGGAATAAAAAACACATTG
CTGATTTCATCTGTATTTGTAAGCTTGTATTTCCCTGTGTGTGAAACTAAAGTCACTCCTCCATTTGGCAAATAAACCTTCTCACATTTCTCTGGATTAA
TAATCCTAACATCAGACAAATTATCCAAATATGCAGTCATATGATTGGATGCCCCTGTATCAATTATCCATTTCTCTTGTTCTATATTAGCCATAAAAGA
ATGGATCATACCTGCCATATTCACCATATTGGCATGAGATTTTTCTTCATCTAGCAATTTTACTATCTGATCATACTGTCCATTGTTAAAAGTTGGTGCT
CTCTGCATATTCCTATCATTAGAACTGTTCTCTGTCATCTCTGCATCTCTCTCTGTATGAACATTATATGCTGTATTTTCTTGTCCTACTTTCTTCTTGT
TTTTGAAATAATTTTGAGAATATCCTATTAGTCGATAACAATTGAGCTTTGTATGTCCCTTCATATGACAATGATCACATTGCAACTCCCAATTTCTTTG
TGATTTCTGATAACCATCTCTCTTACTAGCAAGAAGTGCAGCTACTTCATTTTCTTGTCCCATGATAGATGTGTTTGCCATAGTTCTTTGGCTTTCCCTT
TCAATAAGCATAGAATAGGCTTTGTTGACACTAGGTGTAGGAGTAGTCATTAGAATTTGGCTTCTCGCATGATCATATGATTCATTAAGTCCCATTAAAA
ATTGCATTAGCTTTTGACTCTCCATATGTGCAACAAAATCCTTGGATTTAGGACAATCACAAGGATTGGGAACCATACTGTCGAATTCGACCCATAAATC
TCGAAGTTTTGAGAAATATACTGAAATGTTATCTGAACCTTGCACAATTGTTGCTATTCCTTTGTGCAACTGATAGATCCTTGATGCATTGACCTTGTCA
AAACGCTCTCTTAGATCTTCCCAGACTGATCTGGCATCTTTGGCATATAATATTCCTGTAAGTAACTCCTTTCCTACTGAACTCATAATCCATCCCACTA
CGATTGCATTGCAACGATTCCATTGATGACTAAGTTCTTTATCAAAACTGTCCACACTCAAGGTACCATCGATCAATCCCAACTTGTTCTTTCCTAACAG
CTGGATTCGCATCGCTCGACTCCATAATGAATAGTTTTCTGATCCTGTCAATCGTATTGAGATGATAGCAACTCCAGTAGTGTCTGAAGGATGAAGATAA
AGTGGATGATTATGATCAATGTCAGTTTTAGACATTGTTAAAGATCAAATCAACAGAAAATCTCAACAAAATTAAAGAATTCTACAAAGATTATGCAGGA
TCTAACTCATAATCATGAGTTTCTGCTCTGATACCATGTTGAATTATTGAAAATTTGTAACTAAATCTATGAAGATGAAGAGAATAGAAGATGGAGAAGA
TGAAGAAGAAGAAAACTCATTGAGAAAACTGTGTATTGTATATTGCAGAAAATTGAATTACAATATTGGTTTGTTACAGCATATTTATAATGTGACTAAT
TATATCTAACTACCTATCATGTGCAAGTTAAGATGCCAATAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAAAAAAAAAAAGAAGCCACAAATCCCAAATACAGAAAAAGGATTAAAGTAAGGGT
GTTAATGGCTTCAAAAATTTTGTATGTATGTGTAATAGATCTATTGACCTTTGTATATATTGTTGTTTTCATTGTTCTTAGTGAAATCTTACTGAAATGG
TGCATAGTAGATAATTGTTGATGTCATCCATATGAAGGGATCTGGTCACAAGATATTAGATGCTATTGTTTTTTGTTAAACATGGTGTCTGGGCCAGCTC
GCTCACCTCATGACTAATTCCATGGGATACCTGCCACCTCTACAAGGATAGGACAGATGGGAAGAAATCACCAAGTGTTTTTTTGTCTCTGCTAGGGTTT
GAATTGGAGACCTCATGGTTCTCAACCCACCTCATTGACCACAAGGCCATGCCCTTTGGTGTATATTAGAAACTATTTCAATCTTGTTGAGTAGTAGAAT
GAGTTCTATGAATACTTCTAGTGCATGACATTTTCCAATGATCCAATCATACACAATTCTGGGTATTACATTAAAATAAAGCCCTCTTGTACATTTTGAA
GTAACTAGATGTAACAAATCTGTCAAGTCAGACAGTCTTAAGGTATAAGACTAATTGTTAAACTGTTTCTGGAATAATCTCTTTATCCATAACCTGACTT
CTGCCAGTTGCTGTCAATTGGTTTCTGAAAGGAGCTTTTGGTAATATGCAATTTTACTACAGTGAATTTGAAGAGCTGGAAGCAGTTCCAACCATGGCTG
TAATTGATGGTCCTCTGGAGCCTTCATCGTCTACTGCATCAAATGCTCCACATCTCCCTGAGGACAATTCCTTTGTGAACTTCTTCAGTGTATGCCTTTT
TCTCCCTTCCTCTTTGCTCTTCCTTCTAATATACTGTGTCTGTTGTGCAAGAGATCTTACTGAGAGAATATCTTTTTCGTGTGCAGTGCTTTTTCAATTT
TTTTATTTACCCTTGCTAGGCATTTGTGTTCAGATCCTTACGTTTGTATAGAACAAGTTTCCTTAATATTGTGGGGTGTTTGTCTGATATGCATTCAATA
TGTTAGTGGACTACGTGACTCTCTTGTGCAGTTCAAAATTTACCAGTTATTTGACCCTAATATACAAGGGTAGAACACTGTCTAAATTATTTGCATAAAG
TCTCGAGGAGTACCGAGACGGCGATTCCGGCCATGAATCAAGGTTACTCTGTTGGCAGGAATTTCTTTAACAACATTAATTAAAAAACTAGCAATGATTA
ATTTATGTTAGTAACGGAAAAACATGAAGTAAATATTAACTGCTTCTTGAAAGAAAAAATTGCTGGAATTTATCTTTTTTGTCTATGTTGTCTCATCTTG
ACTAAATTTATGCTTCTCTTTTGCAGAATGCATTGACAATTGGAAATGCTTCTAATACTGCAGTTCAAGGGCAGCTATACCACGCATCTCCAGCTACCCT
ACCTCCTCCTCGTCCTCCTCCTTCTGTTCCTTCGTCTTCAGCACCAGTCCTGCTTCCATCTCCTCCTCTTTCAGCTTCTTCCCTTTTGAGGCCCCTCCAT
GATGCACCTGAACCAGATGTCAGTGCTAAATGGTCCTCAAATCTGGTGAAGCCGTCATCTTTTTTTGGTCCTCCACCTGCCTCCTCTCCGCTGATGCCTC
CCATTTCTTCATCAGTGCCTACTGCTCCTCCACTTCTTCCACTTGGAAATCTCCAGCGCCCTTATGGAGCTCCTTTGCTTCAACCATTTCCTCCGCCCAC
TCCTCCTCCTTCTCTCACTCCTACTTCTTCTTCTATCCCAAACAATATTCCTGTTGTTAACAGAGATAAAGTGCGGGAAGCACTTGTAATGCTTGTTCAG
GTATGTTTTCCTAGATTCCTTAGTTACCTTGGTTTGCTAAACATTCTTGAAAACATTAAGCTTTTAGTATATGCAGTTGTTTTCTTTTAGCATTGTAATG
AGACATTGATACAACAAGGTATGAACTCTCTGCTGAGAGGGTTTATTGAAGGAAAACAACTGTTCTAACTTGCATAGCTATGTAAGGAACAATCCACATA
AGGTGAGTAGGAATATGCAGTAATAGCTTAAGGACTTGAGGTTTCATCTGGAGTCATGTCTGGATGCCCTTCCACCTGAGAAGCCTGACGACATTTACAG
TCTAGGATATCTGAATCTACACCTTTTGCATATATATGGTGCATCAGTGAACCTGATTACTATCTGGTTGCTCTTGCATTGGATATTTGATTAACATATT
GGAAACTACACCAAATATAACACTTGACTGTTTTGCTTTCTTATTTCTTAGAAGTAATAAGTAATTGTTTATTCATAGAAAAAAGGGATATGTATACCAT
GACCGTCACACGTGTGAGAATCATGGAATTTACCATAACCGTGAGCTTTACTCTAGGGATCTTCTTTGACCCTGTTTTTCAAGTATGGATTGGGTAACCA
CTAGTGTGCAAGATGGGTTTTGATGGTATGTGTCATTCATTGATGATAATATGTTAATTGGCAAAGCTAGAGGGTACTAAAACCTGATACTGTAGAGAAG
CACTGTTGAGAATAAGGAATGAACCCTTCGGGGTGGCCCAGTGGTTTGAGCTTGGGACTTTCATGATGGAGGTCTCAAGTTCAAAACCCCTTGCCGGCGA
AAGCAAAGGGTTTACTTTCTGGGTCTAGCTCGTCGCACCAGGCTTGCCTAGTCTCGGTTACCCTTTCTTACGTGGTTTGCGAGCTATTGCATTGGAGCGG
GGGTTTACCCTGTGCGCACCCAAAGAGTAGTGGCTGCGGGTTTCCCTTGTCATCAAAAATAAAGAAAGAATATGGGATTAATGATGAGTAGAAGTAAGTT
AGAAAATAAGTGTTAAAAGTTTATCCTCAGAGCTTCAACAAGAAGAATGAAAAGTAAAGATTGGGGGATCGTGTTGGCTAGAAATTTCAGCTTCCTAGGC
AGTGTTATCAAAGGCGAAAAAGCGCGAAAAACTCCTGTTTCCCCTTTCAGTATTTTCCTTATTATATGAATATTTTTTTGTGAATTCCTCATCATACTCC
CCTATTTTGTGGTCTTATTTATTGGTAGTGTTAAAGCATGTGTGTATTTCACTAATAATAGGTTAATTTTTGCCTAAAATGGGTCAACTCTCAATTCAAG
TGCTATTAAGGAATGTTATAATTGACATGAACTTAACCTGTATGACTGAAAACTTTTTCCTGCATGAAATTGTTGGTCAACTACGTTTTATGTACTAGGG
CAAAACTGATTCACTTGGAGGCTGGTAAAATAAAATATTACTGGCGTGGCATGGCGCTACGCTTCAGCATGATATGGTCTTTGGTCCTTAACTATACCAA
GCGGGAAGGAGGAAGGATGGGTCATATATTTAACACATAATAGTGTCAAAAATGGAATCAATATAATTGGATGCCAAGTATATTTCATAAAGGCTGATTA
AGAAAGGTCATCTTTTGTGCCCTCGGGGTTTAGAAAAGAAAAGAGAAAAGGATCATCTATTTTCTTGTCTTTATGTTATAACACAGGGACAGCTGCTCCC
CAAAATTTAGCTATTAAAGTGGGAAAACCGAGGCTATAAATACCCCACATCTGCACTTTGTAGTACCGATGTGGAACTCTGCAATGGACCATAACAAACC
ACCACGCTCCGCATCCATCTTCCTTGTGTCACCATCCAAGGCACGATGGCCGGTGGGTGGCTCTAATTCCATTGTTATAACCTTCGAGAGAACCACACCC
CAAAACCGAGGCTATACATACCTCACGTCGGCACTTTGTAGGTACTGATGTGAAACTTTGCAATGGATGACAACACTTTATCCAAAAAAAAAAAGGATCA
TCTATGTGCTTTCTGGCATAACAAAATATAAGAGCAATATAATGGAATGAGCAAAAGCTTTCTAACTGCTCTACAATTCGAAAGTGGAAATAAATTTTCT
TTTTGCCTGTATGAAGAACGCCAAATTATCTTCTTGGCACTCTATCAAAACCACATAATTTTGCAGGAGATTGATAAAACCTCGGCTGTAAAATACAACC
ACACATAACAATACCTGCGATGGACCTCTAGAGAAATTGAGATTAAAGAACAATGAAAAGGTTCTGAATTCAGCTGTTGTGAAACTAGTGAGGGATTCCT
CTAGTAGTTAAAGAGTTATAGTGGTGCTGTAAGTACACGGGTTATTGACTTGTCTACTCTTGATAGAGTCAATGGTAATGCTTTTGTTTCCTTTTTTTTT
TTTGCCAATTTAACTTGTTCTTGTTCATATTGTTCCAATTACAAGCCTAGATTAGATAAGTTATCTGCTGGTCTCTTTGTGCATCTAATCTGATTTTTAT
TTGAATAACAGGACGACCAATTCATAGACATGATATACCGGGCACTGCTGAATGCACATCATTCGTAATTCAAGGAGGAACTCTTCTAAATCATCTGATG
GAATTTCATTACATCCTTTCAACCAGGGCTAAACAAGAGGATCAAATGGTCAGTGTATAGGGAGTTCTTTGTGTTTATGGCGTCTGTGTGAGACCCGCCT
TGTATAGATATATTTTGTTCCAGTGCATTAGGTTTTGGAGTTGAACCTCTTTGATATATAGTTTCTTTTATCTATGATCTGGACATTCCAATTTTGTTCT
TTACAGCGTTAAATCAAGAAACATGTGAACAGTTGTACTTATATGGTTATTAATCCATAGTTCGGTTTAGTACTAAAGATTTAAGAATTGATTGACATAA
ATATTGGAGTAGTATTTTTAATTAATTATGAAGTATAAAAACAATGAATGTTCAATAAGGAGCAGCCTGCACCCAGTGTATGTTATGAGTGCTTAGTTTT
CTAGAGGTACAAACTTTTGTTCGTTGTTATCTATAATGGAAGTTTTAGGTTTTGGGTGCCCACAGCTTATATAATTATAAATTATATTGCTACTATAATT
GTTCAAATTTTAAATTTTATCAAATAAATTTTTTTAAAGTGATGTAAACATGAAGGAAACACAATTTGTTGTTATAAAGTTAGTATTAGTATTAACATTA
TTAGAAACAAATGAGAGATAATATGTACAAGATCGATGATCATCTTATCAAGAAGTCGAAATATTTGTATCATACGTGACTAATAAAAATTCACTAAAAT
TGTGATAAATAAGGAACATGAATCTATAACTTGAAATATATAATAAGTTCACTGTTATGAATTTTAAAATATATAATTTAATATCTGGATCCACCTGCTG
AGGTACTACATTCATGTATTTCTTTGTTTACAGAATCAAAATAGATACCCAAATTGATAATTGAATTCCACATAGATTAGCTAGTTCCAACATATTATCC
AAAACAGAAACCAGTCTATCTATAAAATTCCACATGTCAATAAGAGATTGATCAACAACATATCTATGATTTTTATGAAAGAGACAATCCTACTTGTCAC
CACACATTTCCCAAATATGAATATTGTCCACAGAAATCATCAATTATTTGTATACACTCTTTTTTATTCCTAGTGAACCCCCCGTAACACTAACACAAAC
ACTATTCGGAGAAGAAGAAAACAAGAATGGCAGCAACAATGTCCAGTGTTGTAGGCTTAGCTAACTCATCTCTTTCTGGATTTTCTTCTGCAAAGAAGAC
TAGCCTTTCCTCAGGTATGCCCATCATGATTTTCTCTAAATGCATTTGCAAATGAGTTTTAAGTTCTTTGATAGACTTACACCATCATGTTAGGTTGATT
TAGAACAATTGATTCTTCAAAAAGAATTTGACTTTTGTATACACCTTTTTTTTTCCCTCTGAATTCCGCCCTGACTAAATCAGAGTCGTGTACATCGACA
TTTTATAGACTATAATGTGCTATCTATTATATATTTTCTGTTGATAGACTTCATGAGATCACCAGTGACAGCAAGAAACCCTTTAAGGGTAGCAAAAGCT
TCAGGAGGCAGAGTTACATGGTAAATTACTAAATTAAGATCCATCCAATTAATACAATGGATTATAAGAATATTTCCATATTATTTTTTCCACCTAGAGT
TTTGATGATAATATTTTTTTATGAAATTCAGTTTCCAGAGGGACTGGCTAAGAAGAGACTTGAATGTGATTGGATTTGGTTTGATTGGATGGTTGGCTCC
TTCAAGTGTTCCAGCAATCAATGGAAAGAGTCTTACTGGTCTTTTCTTTGAAAGCATTGGCACTGAACTCTCTCATTTCCCCACTGGACCTGCTCTCACT
TCGCAATTCTGGTACATTTTTACGTCTTTTTTAATTCTTTAATTTCAACTTTACCCTGTGTCATTTGTCAAAACATATTGAAATGGAATCATCATATTAC
AGGCTATGGTTGGTGTGCTGGCACTTGGGGTTGTTCCTCTGCCTGACTTTTGGACAAATTGGATTCAAGGGACGGACTGAGGACTATTTCTCTAAGTAGA
GACATTATTTTCTTTTGAAAATTTCATGTATAAATTATAATTAAGCTACTGAAGTATTTATTTTTCTTTCATTTATGCATTCCAAGATTTTCAGCTTTAT
GTTTATTAGTGAAAGCATGATATATGAGATTAATGTGTTATCATAAACAATGATACAAATTTAAATATGGAAAATGAAAGAATAAAAAATAAAGATTGAA
TTTAAGATAGACATTTGACAAAGATCAATTAATCATTAATTACGAAATACCAACAAAGTGAACATAAACAATAGATGAATACTCTCAAAGTAAAAGAAAT
TAAATTCCATTTGATAACATAACTAGTAAAGTTGTGTTCAACAATGACAATGGACAAGTAATTTCAATTACAATCGATTCTTGGAATTGAAGAAAGTTAA
AGAAAAATAAATCTCAGTAACTTAGAACAACAAAAATTCTTCTCTCTAAAAGACGTGGAATGTTTAATTTTTTTTGTGAGAGTAGCCGCCTAATTACAAC
AATAACCTTCAATTGAAATCGAAAAAATATTATTTTCTTTTTAATCTCATTGTCTGTTAGGACTAAAAAAATCTGTTTAAATTAACTTATTTTTGAATGA
TTTTTGATTTAGAAATAACTTTTTAACTTTGATACTAACAGAGGATCACTACGGCATGTGGAGGGCCACACGAATTACAGAAGATTGTTTTTTTTTCTAC
AAATATGCAAAATACTTTAAGCCGTTAAATGGGGGCCCTTCCTTACAAAATCCCTGCCAATTGAAGCCTTCAACAACGGCTACAATTACATTCAATATTA
CTATCTGCTCAAGCAACAATAATGCTCGATAGAGACAAATGGTTAGCTAGTAAATGCTTAAATTTATTTACATTGCTACTATTAAGTGACTCGGGGAGTG
TGGTTTCACTTTATTAATCATTAGGCTACATGTATAATCGTGATTTTTTAAACTTACGTATATAACTTGAATAATGTCAACAAAGAAACAAGTAGGTGCA
TACCAAATAATTTGTGTTACGAAAGTATTTAGCCCTTTCATTCATTCTAGCAATCATTGAAATACACAAGCCTAAAGGGCTATTTCCCACTTCTCTTGTT
CCCTCTTTTTGTAAAGTAGTTAAAAAAACTTGTGAACAGGGGAAAATGAGTTCATCAAGATCAACTTCTTTGCATAATGATAAGTATATGCAAACAGAGG
GCTCTGATGACTTGTCGGTTTCGGCAAGAAAACTGGCTTCTACTTTATGGGAAACTAAACTGAAGGATTTGGAGGAAATGGGTTGGAAAGAAAGAGTTTC
AAAATTGGGTTCAGCAGCTCTGCAATTTCATCACCCTGTTTCTGAGGTGGGTTTAAGGGAAAAATTGGTTTTTGTTTGGTTTTTTTCTTGGAAAAGTTTG
TAGCTTTTAAGTTCATCATATTGTATGTGCTTTTAAAATTTTATATTGAGGTATTTTTGTTCTTGAATTTTGCAGAGAATGGAGCGATCCAAAGTGGGTA
GTCATAGAAGAAGAAAATCTACCAAGGCTGATCTCTCGAACCAAAATGATTACTCGATAGAGGTATGCTGCTGTGACAGTTTATCCATTTTTTAGTTGGA
GGAACTGTTCTTTATAGGTTTTTTTAGTTAAAAAAAATAACTTTGGTGTTGGGTTAGTTTGTGTTCTACTAATTTTGTATCTGCTAACTTAACCTGTCCA
CTAAAGCTCGGACATGTGAGAAGAAAGTGCGTAATATTTTTTGTCTCCACTGGAATTTGAACTTGAGACCTCAGGGTTCTGAGGCCATTTTGTTAAAAAT
TAGGGGTGATTAGTGAAGATTCACTTAACTAGCTTGAAATTGAGGCAAAGCAGTTGTTGAACCTATCCAAGTTTCCACTTTGGTTTCTCTTCTTAGTGGC
GTTTTGACGGCCCTTTGGCCTCTTCCAAAGTTGAATGGACAGAAATTATGAACAAAGGAACAAACATGTGACTTGTTTGATGGTTCTAGTTTAGGTTCTA
TCAAAGCCGACAGGCTACAGGTTATATGTTAATATCCTAAAACTGAATTGATGTATGTTTGAAATTTTTGTTTTTGTGGAAGTTTTTCTTGTAAGATCTC
CGAATGTATTACTTTTGTTAGCTGCTGCTACTTTGAGTTAGCTACTCTATATTGAATTATATGGTTAATACAAGGATGAATTTGCAGCTTGATAGAAAAA
ATCATGAACAGACTCTAAGTAGGCATCATTTGAAGGATGTGTGTCATGGCCTTGACACATGTAAAGAGCTGCTGAAAGTTCTGAGTCATGTCTGGAATCT
CAAAGATCAGAAATCTACATGTTCATCCCTTTTCTCAGCTATAAATACAGAGCTTGACCGGTTGTGTGATGAGGTGTCTAAATTGAAACACGAACACAGA
CATAACCACAGTGAAGTTGATGTCCTCTTGAAGAAGTTTGAAGAAGAAAAGATGGCCTGGAAGGTAAAAGAGCAAGACAAGATTCATACTGCCATTACAT
CCGTAGCCAGGGAGTTCAAGACTGAGAAGAAACTGAGGAAGCAAACTGAGAGATTAAATAAGAAGCTAGGTAGAGAACTGGCGGATTTAAAGGCATCTCT
TTCAAAGGCAGTCAAAGAACTTGAAGGCGAGAAAAGGGACCGAGAGATATTGGAGCAAGTGTGTGATGAATTAGCTAGAGGTCTTGGAGAAGATAGAGCT
GAGATGGAAGAATTGAAGAGACGATCTGCTAAAATCCGGGAAGAGGTGGAAATGGAACAGAAAGTACTTCAACTAGCTGATGTCATGCGGGAGGAAAGAG
TTCAAATGAAGCTATCAGAAGCCAAATATCAATTTAAGGAGAAAAATACAGTTGTGGATGAGTTAAGGAATGAACTTGAAGCATATTTGAGATCCAAAAA
GGGCCAAGAACAAGGCTGTGATTCGCTGAATTATGAAACAATCAATGAGCTTGAGAAACAATTTAGAGGAACGCTTCCAAGCACACACCATTACCGAGAT
AAAGAGAAGGCAGATGTAGAAATACTCGATAAAGAAGAGGATGGAGAAGAAGATGATTCAACTGATAGTGATCTTCATTCAATTGAACTAAACATGGGTG
ACAATAGCAAGAGCCATCAATGGTCCACTGCTCTACAAAATGATCCGAATAGATTGTTGGTTTCTGATAAAAATAAAGGGAGGAGGTCCATCGCAGAGAA
AGAAAACGTGAACACCATATATAGAGGAATTTCAAACTTACTTAACAATGGAGGAACACCAGAATTCTCTTCTCAAGCTTGGAAGAAGGATCATGCGGAT
GAGACGGAGAGATATAAAATGATCAAGAATCTTTGTGATCGTATCATTTCTGCTTCAAGAATTACAGCCTCTCAAGGCTTTTCTGGTCCAACCAACAACT
GTAGCCAACAGAAATTTTCTGCCAATGATCCTAACAAAGTGATGGTGAGGGTTTTGCCATCTTGCAGGGAGAAACTTGAAGGAACACCAGAGATTATTGC
ACTGTCTTGCAGGGAGCTACTCGAATGAATGCCAGAATGCCAATCTCAAGAATCCATCATAAATGGCATGCTTCTCCAGCCTGATGCTTCTTTCACATAA
CTACATGGACATAAATATGTTGTTCTTTGTCTGAATGAAAAGCTAAAATATCTGATAATTCAGGAATGTCAACAGAATTTTGAGTTTTGGCTGTTGGATG
AGACAAAACATTTCAAATTTTGCTAATGTTGTCTAAGGACTGAATTGCTCTATTCAATACTATATATGACTTTTCAGATTCTTCATTTCTGTACCTCTAA
TGACTCCCCTAGTATCAATCTTTTGTGTATTCTTATGTTACGTGCTTCACTGTTCCCACTTCTGTTATGCTTAGCCTACTACATTTCCAGTCAATTCGAG
GTAAACAATGAGTTGACTCACTCAAGTAGAATATTTCCACAGGTTGAAGCAAATGTCTAACTCTTATTGAGAAATTTCCTTTAAGTGATATCCATTTGGA
GAATCATTAAGTGGATTCAAAGCTTTACGAAAGTCTATTTTAATGTAGGTGTAATCTGTCATTGGAGAGATTTTTTTACTGATCTTTCCTGAACACTCAA
TCATCAGGTTAAGGGAATGTCTTCCATGTGCTTAAGCTGGTTAATGAATCTTTTCTTGCATAAAGCACATCCAAATGACCATCTTATAAACAGTTGAACA
GTGAAGTACTTTCAGTTCCCTTCATGTTCATTTATTTTATATTGAAGAAACATCATCAACAACTTCAAAAGAGAAGAATAACAAACAAATATACAACATT
AGTAGCTAGATCATTCAAGTTGGTTGGTTTACTCTGGGACGGATGCGAGCACACAATGGATTCTTCATCATAACGGTGAATTCCAGCTTCTCAGATAGAT
CAACATTGTTTCCATCCACAGCCTTCCACTCAAAATGCCAGATCAAATTAGCCACAATGTGCTCTAAATGGAGCATAGCCAAGCCATAGCCTGGACATAC
TCTTCTCCCTGCACCAAAAGGCATCATCTTGATCTCTCTAACGCCTGTTATATCAAACACTTCCTTATCGTGACCGCCCGCTGATAAGAACCTATCTGGA
TTGAAATCCAAGGGATTCTCCCATACTTGTGGATCCAAACCCATATCTGCAACCATGAAATTGACAGCTACATCCTTAGGGATGACATAACCATTGAGTT
CCACTTCCTCTGTCACCGTGTGTGGCTGCAGGAAGTGACCTGGTGGATGCCGCCTTAGACCTTCCAAGATCACTGCTTTTAGGTAAGGCATTTTCTCTAG
ATCTTCCTCTTTCAATCCATCCGGTTTCGAATTCTCTCTGCTCACTATCTCAGATATCTCTTGGTATAGTTTTTCCTGAATAGAAGGGTATTTAACCAAG
TTAGCCATAATCCATTGCAACGAGGTGGCGGTAGTATCCGTTCCAGCGGTGAGGAACTCACTGCAGAGGCTAACAATCTCTCCCTGATTAAACTTCCTCT
TCTTCTCAGGGAATTCCAAATTCAGCAATGTATCTGCATAAGCCACCACATCTTCCTCAGTTTTTGCTTTCATTCGAGCCTCGATCAGTGGCACAAAGAC
ACACTCTTGCTCTTGTATTAGTTGGAGGAGCTCCTTCCATTTCTTCCTGTGTATGATCTTCTGAAGTGATCTTGGGAAGAAGCTGAGATTGATGAATCGA
CCCGCACTTTGAATCCATCTTCGTTGTACATCGTTGATCCGTTTGACTTGAGCCTCGTCAATGTTTTCACCGAAGCACATCAAGACAAGTAGATAGAACG
TAGCATAATGAAAATGATCAATCAACCTGATCCCTTCCGTTGCTGCAGAATCAGAACGAAGCTGTTGAATAAGGATAGTGAGTACCCGTGATCGGACCTT
AGAGTAGGACTTGATGCGCGAAGGGTGTAGGATTTCAGATACCATGTTTCGCCGGAGGAGGCGCCATGAGGGGCCATAGGGAGCGGAAGAGATGTTAAAT
CGGCAACTTTGAAGGCTTACACTGGTCTGAGCGGCCTTTGGGCGGTCAGAGAAAACAGCACCTTGTTGGACTAAAGCTTGATATGCTAATGAGTGGCTAG
CTACAAATATTGAAGGACGACGAAATCCAATTCCAATTCTTAAGTTGAAAATAGGACCATATTTAGTCTTGAGGTCCCTGAGAATGAGTTCTATATCAGC
ATTAGCGCGTAGTAAGCCGGTAATCACAGAAAATGCAAAGGGTCCTGGGGGAAATTTCTTCTGTTTATTGGATTTGAAAGAAATACACAAAGTGATTATG
AGGCTGAGGATGAGGATGATGAGCCATAACTCCATTATTTTCCAACTCTGTATGATCTGCACTACTTAATCTTTCCACCAAACTGTGGTACAAGTGCAAT
ATTAGTGGAAAAAAAAGATTATATTACTTGTGGAGAGTAGTGATTTTGCTTGTGTTTCACGCACAAAACATAAGAGAGACAATAATTGCTCCATTTACAA
TTTTTTATGTTTAGGAAAGGAACACTTGAACTGTCGTTGCAGAAAAAGAAGAATAAAAAACTGATAAATCATATGTATATCTTTCACGTAATACATAATT
TAACTTGGTTTCGAATCACATTTATGCCCTTTAACTTTGAATGTGTAGAAATAGACACTTAAATTTGTATAAAGTTGAACAAACACACACATGTCCTACA
TGTCATTTTTTGTTGTACGTGTATTATGCCATGTAGGACTCATGTGTTTATTTATTTAAAAGTTGGATAGTTAAAGTGCATGGTTGTGCATTATGAAAGT
TGAAGTTCAAAATTAAAATTTGGAGCCAAGTTTAGGGTCCAATATATGTATTATGTCTATATCTATATCCTATCTTATAGTACGCTTCCCGCTCCTCTCT
ATTTTCTCTAAGTTTTACATAACATATATTGAATTTAATGGTTAAAATTTGATTGATCAAAGTAAATTTTTAATCAACATTTAGATAATAAATATATTTG
TATATCGATTTGATTTCAATAATGTTATTCTTCGATCTTAATAAGTAGTAATATATTATCTTGTCCATAGATATAGTAAAAATAATCTTCCTCCGACAAC
AAACACATCAGCTTAATAAAATATTATCTTGTCCAATAATTTCTTCTTTTTTCTTCACTTTTACTTTATTGTGTAATTTTATAGTTAAGAGTTTCACCGA
CGACTGGCCAAGAATTTTGGATTACTAAATATCCCTATTTGTTTTTGCTGTTTTTCCTGTCAATTTGAAATTACTACACATATTATTGGTCTATTTGATG
GTTAGATACATTTATTTAAGATGCTAACATAATCAAAGATGAGTTTTACTTAGGTCTTGGGCCTAACTCACACCCCAAAAGCTAGCTCAAAGAGTCCACC
CATCTGATTAATTACCGATGTTGGACTTTTGTACTCGAATTTAGAATTTAACATACATCGACATGTTTGTGCAATAGAGAGATGCAACACACATCTAAAC
ATCAACAACTTGAAGAGAAAGAAAAACAAACAACATTAGGTAGGTAGCTCATTCAAGTTTTGTTTACTCTGGGACGAATGTGAGCACACAATGGATTTTT
CATCGTAACGATGAATTCTAGCTTCTCAGATAGATCAACATTGTTTCCGCTTCCACTGAAAATGTCAGACCAAATTAGCCACAAAGTACTCTAAATGGAG
CAAAGCTAAGAGATAGCCTGGACATACTCTTCTTCCTGCACCAAAAGGCATCATCTTAATCTCTTTATTCCCTATTATATCAAACGCTTCTGTATCATCA
CTTTGATAAGAACCTATCTGGATTGAAATTGCACAACTAACTCGGTTTGAAGCACATTTAAGAAGATCTAAAATTACAAGGCTATAACTATCTATCGGTT
TAAAGTTATTCAAAATATATTATTTTATTTCTTTATGTATAATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCTCATGTCATGATAGCACCTACTAAGCTAGCGTTTGATCATAGATTTTTAAAT
ATTCTTGACAAATATTATTTTGGTGAAATTTCACCATGTGTTTAGCCATAGTATTTGGAAAATATATTTCACTTTCTTAGAAAAAATATAATTTATACCC
ATAAATTTTAAAAATATCCAAACTAACCATAAGTTTGTATTATACGAGTCAATTGAATTTTTTTTTACAACAATAACAAAAAGTGTGCATGACACTAGAG
CAATGTGATAATTTGGAGTAAGTGCAACAAACATCATTTCATACATCGTGAAGTAGACAAAACACATGACTTTGTTGTCTTGAGTCAATTGTTCATCATT
TTCATCAATAACCATATTATTATTCAACATTCATAAAATATTTCATCACTACTTTGGAATTAACGTAAAAAATTATGTAATACAATGTAAGCAACAAATA
TAGAGAGTGTTTTTGTATAATATAAAAGTTTGAGATAAAATTTCAATTTTTAAAAGATCACAAATAATGAAATTTAATCCAAATATTAAAAAAAACTAGT
ATTTGAAAATTTGAAATATTTACTAAACATATTTCTCAAATAATGACAAAGTATATGAACAAACACTATTTATCAAACTTTTCGTCAAATATTATTTGAA
AAAATCTATGACCAAACAGGCCCTAACATTTTGTCAAAATAAAATGAATCCATAATCCAAATCAAAAGTAGCCGGCTATCATGCGAAAGATGGTGAACAA
ATACAAAAAGCAAAAGGAGAAGAGGGAGAACAAATTATACGTACAATACTCCCAAGATATGATATCGATCGGTAATCAAGCTACTAATTACAATAAAAGT
ACAGGATTAATATAAAATGAATTGTCTCTGTATACAAAATAAAGGCTAGCTCGAAAAAAATTAGAGGGAGAATGACAACTTCGAACATCTTGAGCTCACC
CTAGGCATCTGAGCCACAAATATTGTGCTCGAAGTACACATCAACGATGAAGACTCATACTATCTGCAAGCTTACTTTAATAATTTACCCTTTTTAATAA
TTATTTATCGTAAAACATTTGCCTTGCTTTTTTTTTTCTTTTCTTTTTTTAATTTTATGGAAATGAAGTTAAAACACACGAGATTGTATTTTTTTTCTTT
ACTATGTTCTTCGGTAATTTGTTCACTAAAGTTTGGATAAATAAAATAAAATTATCTTAGTATTTTTGAATTTTGTGATAATTTAAAAGTACGTTAAACA
TAGATTTTTTTTTTAATTTTATAGTCTTAAAATGTTAAAGTAGGAAATTGAAATTAAGAAATTGTAAAAGAAAAACAGAAGAGGTGTATGTAGGTGTTTG
GTCATGCTATATTGTATCACGATATGGTATCGTGAATAGTAGCATAGTCAGAATTTTCAATAAGGGGGTTCAAGATTCGTAAAAATAGACACGCGGAATA
GCTGAAGGGGGTTTGATATCTATTTTGTATACATACAATATTATTTTTAACTATGTATAAATAGTATAATTTTCCCTCAAAGGGGGTTCGGAGACCCACT
TATGTCAAGGTCGCTCCGCCCTGATTGTGAGATGGAATCAACGTTTGGACATGACGATTTTACGTTGATTCCATCTCACGATTCCATATTCTCCAAAAAC
CATGATATGGAATCATATTGAGAATATCATATCATGATTTGAGATATTCTAATACAAAAAATTGATTCACAGTTTTATATATGTCAAAATAACTCCACAT
TTATATCTACTAACCATTTATTTCACATACCAATAAAATTAATAATCATATTATTACTTTTTAAAATTTATTATTCTCACCAACATAAAATTTATTCTCT
CCAAGATTTAGTCACTTTAACTCACACTTTACGATTATTGAGTAATAAAATGTTGAACCCGTGAAAGGTGTTTCATGTTTACTCAAATATATTGATGAAA
TAATTACTTAAGTGGAGAACAAATAGTTTTATACTAATTTACTATGCGATTTTATAATTTTTATTTAATTAATTAGATTGAATAAATAATTAGGGTTATT
TAAATAGTTTTAGAACTTATGAGATTTTTATGTTTATGAAAAAATTTATAACACCAAAATTTCATATTAACAAAACTTTAATTTCATTTCATAATTTTAT
ATTATGATATCATATGATTTCATATCATAATACCATATTACATGGCCAAACGGGTCCTAAATTGTATTTTGGGGGTTATTTTTTCAGAAACTTTAAAAAA
AACAAAATAAATTCAGAAATTGTATGCCTGCCTTAGTCCTTACTGGTTACAGTGTTGGTTGAGTTGACTATTTAATTAGAAAATCAAATTCCTTTCTTGT
TTATTCAATTGAAGAATTTGTGTTTCTTCATCTGGATCGGGTAAATGGGTCGTATGATTTCTCAGTTGGTCCTACCATTTCACTTGCTGCTAATGCTGGG
TGTCTCTCTGGCTTCACTAAATGATCATCGCTACAACATTGGAGATGAAGTCCCTCTTTTTGTCAACAAAGTTGGTCCTTTGAGTAATCCCAGGTATTCC
CTCAAATGCAGTTTTTTCAGATTTTCTTTTGATTCCGTGAGGAATGTTGTTAAAATTGTTAAATTTTGTGCTGTTATTGACAATATTTGTTGCCATTAAT
CAGACTTGTTGCCGAAAACCTCTTCCTGTCACCTGAGCTAGATCCAGGATGTTTAAATATCCCTCTGTCCCAATTCATAAGATACTTTTCTTTTTCGAGA
GGCAAATCGTTTAAGTTTGATTGGCAATTTGCACATGGAGCATTCAAATTTTTTGAAATGAAATTTATATATTTGTAAACTATTTATAAAAAGTATTGGT
CACAATAATTAATAATTCAAAATGTTTACTCGAAATCCGAAAAGTGCCACATAAAATGGCACAGAGGGAGTACCATTACACTGGTTGATACTTGTGACAG
TGACCATAAACTTAGTATAAATACATACATTCAGCTTGGAAGAGAGGTTCAACTAATAATCACCAAGAATTTTATATAAAATGTGCTGCTACTAAGGATA
ATTGAGTTTTAAGGCTTCAGTCTAGCCACTTTGAGAAAGGCCTAGTGACCAAGTTTGTTAGGCATGGTTTCCCAAATTGGAATACACAATGTTCAATTTT
GTTGTTCGAATTGGTCTCAGGAGACGTCAAATTAGTTGATTATTTAGATTAGAAAGTGGGAAGTAACGGATGTTATGTCATTTGCCAAGGACAAAGAGAC
TGATGAGGGACTATAATTGGTCTTGAGTGCTTCTATTCTTGAAGAGGAAGATAGTCATTGGTGGCATTTCCCTAAAAGTTTGTCTTTAAGAATCATTTCT
ATATCCTTTATCCATTGAAAAACGAATTGCTTAAACTTGAATTATGCAAAGTGAAATAAGTTGTCATGTCCTTATATGGTTTTGACAATCCTCAACCCTC
GGGCTAGTTTTTGGTGTTAAATTAGAACTTATGTCTATTTTCTCAAAATGGTAACAAAACCAGACTCGTCCTTATTATTGATTTACCCAATATTGGGTTC
TGATGCATGACTGAGCTACAGTAGAATTTAGGGTTCGGCAGAGCCATGTAGTTTTAGTCTAACCCCTGTATTTATGGTAAGAAATTCACTTAATATTTAT
AGATAATTTACGAGAACCCAGTAAACAAATAGAGTAGTGGTTCAAACCTCATAAACTTAAAATCCCGAATTTGCCTTTGCAGCCAATGTTACATTGATCA
TGCATCACATGTTCCAGTCCTAGCATGGGTAAGGGGTGCTAAGGGCTATGTAGCTCGGACTCTTCAAATATGTCAACGGGTGCGTGTCGGATTCGCCAAA
AGTAGTGTATTTTTGGTGAGTTCGACACAGTTGCGGCATCAAAAGTGAAGAGTCCATGCAACTAAGGCTAAGGGTCCCATATTTGTTGAGGGTATGGCCT
ATTGTCTTCTTCTGTGGTTGTAGCCTTTGACTATCCTCATCTCATGAGCTAAACTTTGAGTTGAGTTAGGTTAAGGTCCATATTTTTAACTTATTGCTCC
TCATCTTTGTGGCAAATTATTTTTTGACTTGCAAGCTTGATATGTTTCAGAGAGAAAGAGATTTTGTTCATGGTACACATATTTTACAAGTCCTCAATAC
ATGTTGGAAGATTTGACACTTAATTCTTTTTATAAGTTTAGATGGTAATGGCCAATGGGTATTAGATTCCTAAAAATGTTTTGTATATCCACACTTTTAA
ACATGAATTTGCTTCTTACTTGGATCTTTCCTTCTTCTTCCATGATTGTATTTGTTAGTGCTAATTTTTGTGGTATACTTCTGAACGTTTCTCTTTTGGA
TCATCTTTCGTTGCGGCTTTCTTTCTTCCCATTTTTGCTTTCTTTTGCCAAAAAGAACTATGAGATCTTTCAGCAAAATGTATCCTCCTTAGGAAGTCAA
TGATTTTTTATTTTTTTTGGGCACTTGTTGATATCTTCCATGGATTTCCCAGGCTATTGTGGTACATGCTAAAACTTATATGTGCTACATAAATGAAGCT
GTTAGTCGTCTTGAAGAACTTTCAGCATCTGCATTTAAATGTGTTCAAGTTTCAAGGTCCCCATTCTCTTATCTTTTTCTAAGCATGAAATATTTTCCCT
TTTTAAATTCCAACATAGACCAACATATAAGGAAAATTTTTCTTTCTTTTTAGATGGAAGCTCTCCAACTCTGCATCTTCCATTGATATTTTTTTTAGTG
GCTTTAGTAATTCTTAGAGGGTCTTTCTCATTCTTGTGCAAACTTCTATGTAATTTGAATCATCAAAGCAAGGACCTTNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGTACATACGTCTACAAAGCC
TCTAAAAGATAAAAGACTAGAGTAGGTCAGGACAGACCCCACCTTACCCTTAACTACAATACAATATTAGAATGAATTTACCAAGGACTCATTAAAGATC
TGAATCAACTTGGAGCTCAGCAAAAGTAGCGGAATATCGTGTGCTCCTACTAAGGAGGTCTACTAGATAAGTACTTGTTCTTGCAAAATGAAAAGCCTTT
TTTCGCACGAGGGACTTAGTACGAAAAATGTACTGAATATGTAAGGCAATAGAATATGTAATACGATAGCTTAAATGGAATCAAGTACGAATATATTAGT
GCATAGATTAGGAGAGAAGACCACCTTTGCTTACTCTTGTGAGATCGTGTAAGTTACATTCTTTTCTCTACTTTTCTATATTTTATAATTTGTATAGGGC
ATGTGATACCAGTGACCAGCTTATCAGTGGTAGGAGAGGATGACCCATGCTAGGAATTTAAACCCTAGTATGCGGTCCTCATAATTACACCATTTGAGAT
CTTCCCAAGCTAGGCTTTCGCCCCTGAGACGCCACCCTTGTATACCAATAGGGATCGGCCCATGCTAGGCTTTCTCCCCTGAGTAAACCACCCTTAAGTT
AGTATCGATCCATGCTAGGACTTTTCCCTCTGGGTTGCCACCTATAATTATATAGATTGCTTCATTTAGAATCTTTAATCTTTGAGGTTGTTGTTTATCG
ATTCCTAAATCTTTTGACATTGTTCAACCATAACTCTTTTGATATTGTTGTTTAGGTGTTCATAATTATTTTGAAGACACACCAATAGGAAAAAACCAAG
AACACAATACTTCAAGGTTGTAGCAATGACATAAGGAGCGATGTAACATGAACATATTATGTGAGCTTAATAACACAATTGACTTCAATTGACTAAGAGT
AGGATTCACCAAACTTTCTTTTGCAAATACCATTTCTATACAAGCACAAGGGGGGTAATTATATAGGTATAGAATAGTGAAACATATAATAAAGTAGTTC
TATGCACTAAGTAGAGGGGAAATATAGTTAGCTATTTGGAGAAAATGCGCTGCGACTGCATCCTTTACTAGGAATAGAACTTAGGAGATTCACTTTCATC
GATAAGAACAACAAGTATCAGATTTCATGCCAAGGAATATAAAATTGAATAGCCTTACATACCTTATCCTCTAACAAATATATTATCAAGATTCTACCTC
GCCTTTTTTGTTTTAATCTTAAATATAAGTAATGGTAAACTAAAAGCAGTTATCATACCATGAGCCTTGTAAGACCATAGCTAACTTTGAAAGATAATGG
GCCCATACAACCTTTAACATAGTGTGTATCACCACATCCTCATTCTATGTCCAACACATACATTATACTTCCTTCCCCAAGATCAACCAAGTTGTGCCAA
AAGTAATACACATAGAATAGCCCCAAATATTCTTTATCATACAATCAATTATTGAACTCACCACCTGCTTGAGTTCTTTATGACAACATACCACTAATTC
CTCACTCAAACTTATACATAAGGAAGAAAAAATGGAGCAGTCACCTTACCTAAATTTCTGAAACTTCTCCTTATAACTTGAGTTCTTTTAGAACTTCAAC
TTAACTTCACACTTACGACAAAGAAGAAGATAAAGGTATTTTAATAAAAAAGGAAGTGAGAAGTAGTTGTTGCAAATATTCTGCCGTTGTACTTGTATTA
GAGCATTAAATTCATGTTTTTTCCTAATCATTCATGGGAGAATTAAGCTAAATCCATGAGTTTTCACTTACCTTGGTTTGCAGATATGAGGGTTTCTTCA
CGAACCCCAGAAGAACTTTAAGGATGTTGGTTTTATCTTTAAGAGAAAAGAGAGAGAGAGATATTTGTAGATAAATTCTTATATTTATGTGTTAAATGGG
GTGAAGAGATCAGCTCATACTAGATTTATATGGAGCTTTATTAACCACAAAAATATCCTCTAGAATCTTTTTTTGGTCCATTTTTAGCCATAAATTGGTC
AAGTAGGTGATGCATCGGCTTATGTGCATGAAGCATCTTAAAAGGTCAAACTAAGTGATGCACCTACTTGCTTTCACTTGGGCTTTATCCATATTGGCAC
TTGGCTGCTGGACTTACTTTCATTTTGATTTTCATTTAATAGGTTTTAGCTTCAATTGATCCCATTAATATAAGCCTAAATCTGGTCCATCTAACTTGGG
CTCTTTAACTATATTATATCTCAAGTAGGTGATGCAGCAGCTAGTTTAATTAAGCCAAGAAAGCAACTCAATTATTTTATTTCAATTTCTTAATGTTCAT
CCCTTTTTATTCAACATAGCACTTAACATTCAACTTTAAGCCCAATTACCACCTTACTATATCTACTTAAATACTTTCCATCGGAGTTAACTTGCAATAC
ACATGTTGAAACGTGCAAGGAATTACATCACCTTCTGAGATACTTTAAAACAACACTAATCATCTAATAAACATGATCCCTCACCTACATTGTAAGTCTA
TGTTAAGTATCACATGAATAGAACTAGCATATACACAATACAGGTTGTTACTTTAGCATTTGATTTGTAGTTTTTATCCCCGAGACTTTGGGAAGTTTGA
TTTGATTTGGGTAATGGTTTATATATTAACTAAGTGAGACAATTTTATTCTGATAAGGATAGATTACAATGCGGAACAACTAGGTAAAACCTATATGAAG
GATATATATAGTGAAGTTACAAAGGGTGACCCTTTCTATCATCTAGGATTATGGTGCCCTTGTCACTTCCAAGTTTTGGAGGAAGATACATGAGGAATTA
GGCACACAACTCACCTTTAATACATCTTTTCATTCCTAGATAGATGGACAATCAGAAAGGACTATTCAAGTGTTGAAACACATGTTGAGTGCTTGCATGA
TCAATTAGGGAGGGCATTGGGATAAGCTCTTATCATTATGTGAGTTCTCCTATAATAATATTCATCACTCAAGAATTGATAGCAACATTTGAGGTGATAT
ATAGGAGGGGATGGAGATCACCCATAGGTTTGTTTGAGGCCGAAGATGTGAAACCTTTGGGGGTTGACTTAGTGAAGGATGCTCGAGATAAGGTGAGAAG
TATTCCATCTTAACTTCTAGCCGCTCGTAGTAGACAAAAGAAGTATGCAGATCATAAGGTGAGAGACATAGAGTTTCAAACTGGAAAACATATTTTTCTT
AAGGTATCACCCATGAAGGGGGTGATGAGATTCGATAAAAGGGTAAAGTTGAGTCCGCGATATATAGGTCCCTTTGAGGTTCTCAAATGTGTAAGACTGA
TGGCTCATAGGTTGGCTGTATCCCCTAATTCATCTGGTGACCATTCGGTGTTTCATGGGTCTATGATGAAGAGATATCATGGTAAGGGTGACTTTATCAT
TAAGTGGGACTCAATTATGCTAGATAAAGACCTCGTCTGTGAAAAGGAAGCAATTTTTGTTCTTTATTATGATGTTCATAAGTTGAGGTCCAAGGAGATT
AAGTCCGTGAAGGTTCAATGTAAGCATCGACCAGTCGAGGAAGCTACTTGGGAGACCGAGTAGGACACACGAGAAAAGTAGACACAATTTCTCACTAATT
CACGTACTACTTTACTCTTCTCTTAGCATGTTTTACCTTAGTTTCTTCACCCGGGGACGAGTGATGGGTAAATTAGTATCTATTGTAACAACCGAAAAAT
GTCGTTATGTAATGCCAAAGATGGAAAAATTAGGGCCGAATTTTTTTTCCATAGTATTAGGTTTTTCCAAACCTTATCCAAATTTGGAATAAATCGGAGT
CATCAAGATGATGGTAAATCCGGTACCAATCAGGCAGAGTAAATATGAATTTGATTGCTTGAGGTGTTAGATAACTCGTCAAGAACCTGTACAATTTTAC
GAAATCGAATTTGAGTGTGTAGAGCTGTAGAATCGACCTTAGCATGAACAGTGATGTCTGAGCATAATGCGATAGAGATGTGTTATAAAATTAGGGAATT
GAATTTATTTTGAGTGTTTTCTGTTAATGTTTTTTTGCTGTATGGGACAATAGAGTGGCAGTGGTGGTTGTGGCGGATGAGGCGGGACTTGAAATTGTAG
ATTTTAAAAGCGGGCTTAGTATTTCAAAAATTTCGTTGTAGCGGGATTTTAGGCCGTAGTAGCTCTGCCATCTAAAGTTGTATGATTATTGTTGTAGCGA
CACAGGCACAAATTAAGTCATTAATAAAACCCCTAAACGACCATATTTGTCACTTTTAAACTTTTAGAGCTAAAGAACGACCCTAGGTCGTTCTAACTCA
TTTTGCATCATTCTTGAGGCTAAAGGAAAGCTTTTGATTCCCCAAATCAATTTTTCAATCCGTATAATGTAATAGAATTGGTCAATATTGATGGTGAAGG
GTTTCTTTATAGAATTTATGGTGGTAATAACCCTAATTTGGTTAGTTAGGTTCATGGGTTGATCTAGGGATTGTAGGATTGTTAATAATTTGGGTAATTA
ATGATTGTTTATTTACTAAGTTATTAATTTTTTGTAGACCAAGAACAAGTGGAACGAATTCGGAAAGGGAAGAATAAAGTTTCTTAGGGTTTCATGCTTG
TTCCAAGGTAGGTTATGGTTGTGATTTGATGATCATGTTGTGTATGGATGTTCTTGCTTCATTGTGTTACTTGTATGTGTATGTGTATGAATGTTGCAAT
ATTGATAACATTTGTTGTAAATGAGATAGGTGAATGATGTAGACATGAAATCGTGATGTAAATGTATGATCTTGATAATATACTTGTGATTGTGATTGTG
ATGTGTGAATGGGGATCGTTGCCACATACTCGCAAGCTAACTGGGATCGGTTGTCATGTTCTTGCATAACATTGGATCGGGTTGCCACATTCTAGCAAGC
TAACTGTTTGAGTTGGGTTCCATGATAGGACCAAAGATGTGATGAAGCATGTGAAATTTGTTGTTGATTCTTTATGATGATGATGATGATATGGAATATG
TTGATATATATGCATATGATTATAATGTTGTTTGACTTGTTTTATGTTTCACTAGTGGGATTGTCGCATGATCCTACCAATACACTGTGGTTGTGTACTG
ATTATGTACTTGCTCTTATTTTTATTTAGTAAAGGGCATTTTCAAGTGGCTATTGACAGAACTAGCCTAGGAGACTAGAGATTGTCGCATCAACTTCAAG
AGTAAGGCAAATTTTCTTGGATGCCATAGAGTTCTCTTTCATATAAATCAACCATTTACGGACTTAGACATTTTGCTTAGTTAGTGATTAGTCTAGTATT
TGGGGTTGAGACCCTTCGTGTCTATACTTGTTATTTCGAAGTAGTTTTGGTATATTGACTTTCATATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATTGAGACACGGAGCACGGAGAAAATTCA
AACAGATGAACTACAAAGATGTTTGACGGTATAGTTGATGGATTTGTGAAAATCAATATATGCTTTTTCCTATTAAACTTTTCATTACAATATCAAATCA
TCTACAAAGATGTTTGACGGTATAGTTGATGGATTTGTGAAAATCAATATATGCTTTTTCCTATTAAACTTTTCATTACAATATCAAATCATCTACAAAG
ATGTTTGACGGTATAGTTGATGGATTTGTGAAAATCAATATATGTTTTTTCCTATTAAACTTTTCATTACAATATCAAATCATCAAAAATACATATTTAC
AAGTAAGTCTTTTTAAGATGTAAATTTCATAATTTTAAAATCATTTCATACGCTAACCATATGTTAAATTGAAATATTTTTTCTTGTTAAAAGGGTCCAT
CATCCATGAATGGTTATTTGAAGGGATTCAAATAACGATTTCCATTAGTTTCCGTACGCTGGTATTCTTACAAGTATTTGCAAACAAGTTATGTATTTCA
ACTTAAAGATAAATTTTGAAATAATAGTTCAAAATTGCATTTTATCAACCGTTCACTTTTCAAACTTTAGCTTTTTAAAGTACAGATAGCATTTGCGTAA
ACGCCAAATTGACTAAAGTACTAAGTATAGGGCATGAACATATAGCCAAGATAGAAAAAAAAGACAAAATCTAACCTCATATTTTTTTCTGGGAATACTG
TAAACATCCAAATTTATATATATAAATATATGATACTTCTCCTGCTTAAAGAAGAATAATTTTTTCTTTTATTTTAATAAGAATGATCTCTTCTCACTTT
AATTTCGTATTTAAGGTCATGTAACATGGGACCCACACTGCAACTTCCTATAACCTAACAGCGACACGTGTCCCTTGGCACGTGAATTTCCCGTGACCTC
TCAAAACAGAGCATGTAGTACAAATTAACGTTGAAGGAAGGCACCGTTTGCTTCCTTATTTATTGATTCTCTTCTTTTTCTTCAGAGATTCCAACACCCT
TTTTTTTTATTATTACCACAAAACGAGGGGAAAAAAAGAAGAAGAAAGGCGGCGCCTCAGTTTTTCTTTTTGTAAATTGTATTGAGTTTAAAATATGGAA
AATGAGCATGTATCGTCTTCTTCAAGAAATGAGACAACACCCAGAAATAATGCTAATACGGAAATTTCAATAGCGACTGCGTCTTCAATGTTTCCTGGTT
TCAGGTTTTCTCCAACTGATGAAGAATTAATATCATATTACTTGAAGAAGAAACTTGAGGGCTCTGATAAGTGTGTTGAAGTTATTTCTGAAGTTGAAAT
TTGGAAACATGAACCTTGGGATTTACCAGGTACTTTTCCTCTTCTTTTTTTTTTCTCTTCATATTAACATGATTTGTATGTGCTATATATGTATGTATAT
ATTATTATGATGGTGGTGGAGGAGCTTTGATGAATAGAGTTATCTCGCACTCGCACTTGTGTTGGGTTAGGTCAAGTTATACATGTGCAAGTAGTTTAGA
ACACTGGTCGCAGTGAGTTAGGTAAGTTGACATAGAGGGAAGTTGGTTTGAACACCGTCATTCAAATTATTTGTCCTAGTGAATCCATGGTACCTCCGTA
AAATTAGATTTTTTTATGTGATCTAATATTAGCTGTTGACACTCATTCTATCAAAACGTTAAATGGTGCAGTTAATTGAATGCTTAGTTATTTACAATAT
TGATAGGGATATTGGTATCAATGCTACCAAATGGTGGTGTGTGTATGTATGTATGTACGTATGTACGTGTATAAGTATATGTTGTGATGGCAGTAGCCCA
ATTTGAAGCATATGATATCAAGTAAAAGGGTATGAGTGAATCATAAACTTGTTAATCTGGTAGTTATATGTTTTTCGAGATTTTGTTCAATAAGTTTGAA
ATTTAAAGTAACTTCACTAATATTGTATTTTTTCCTAATTTTGATGTTACATTTGTTTTGTTTCTCTTTCATCGGGTCACTTCCTTCGTTGTTGTAATGT
GATTGTTTTCACAGTATATTCATAATAGATTCTTTTTCCCCCCTTTTTTTGTACCTTAAAACAGAGAAAGTGATGGTCAAATATTCCTTTTTTTAAATCT
TTCTAAAAGGTAATGAATTCCTGATGAAACAAATAGGAAAGTATGTCCACACAAAGAAGAAAAAGAAAGGAATAACCTCCTCTTGGATAGTCGGTTAATA
AGATTCTTCCTGTGTATCAACTTTATCGAATCTTAGGTTGATTGATATCAATTGCAAAGTGAAGAATCTCCCTGTTTTGACAAAAAAAGCAATAAGAGTG
CTTCTAGATGAAGTCATGTTATAAGGGTTAGAAATCTAAACTAAATAGGTTTCTTGTTTGACTATATTGCTAGTCTTCCCCATTGTATCTCTTAAATAGT
ATATACAGTGTGAACCATTCAACTGCATGGTTTCACTATTGCAACATCCTTTTTCTACTGAATACAATTAATGGAAAATTTTAAATTCTGTATATGTCGT
GATGTATCGATGGTTAGGATATGCAAAAAGCTAAGCGTATTAGTATGGTGATCACCATACACTGTAAAATATAGGATTTTACGGTAGTTAAATAGTTTAT
TCATTTTTAAATTTTTTTTATAAGGTGCTTGGAAATGATGAGAAGCATCACATTATCCTTATTCATTTGACTTTTTTAATTAGTTACTCTGTGAGTAGTA
ACTCATACCTACATACTTGTTCAATTAATTGATCAATCCTTCTTCACATGTAACAGCTAAATCCGTCATTCAATCAGATAATGAATGGTTCTTCTTTTCT
CCTCGTGGAAGGAAGTACCCGAACGGATCACAAAGTAAAAGGGCAACTGAATCTGGTTACTGGAAGGCCACAGGAAAAGAACGTAATGTGAAGTCTAATT
CGAATATCATTGGCACAAAGAGAACACTGGTGTTCCACACTGGTCGGGCACCTAAAGGACAGAGGACACAATGGATAATGCATGAATATTGCATGATTGG
GAACACTAATTACCAGGTATGAGCTCGGATCCAACCCATAGGGACTGATCCTCCTCATGTGATGAACTCTCTATCTTGTTTGCTGCGACATCAAATTCAA
CTCCTACTGTTAGTTGTTTGTTCCTTGTGTAAATATGTTGTTCTTATGAATTCTTATATACGTATCATCCTAAATTCCTAATTTTAGCATTGGTAGTTTC
TTTTGTTATGTGATGTTAAATGGTATGCTCAATTTTTGTTGAAAGAGAGAATAAAAAGAAGGAACAGTTTGGTTGATGTAACAGTCACTCATTATAGCTC
TGCAGCCTGCTCCAATGGTCTTACCAGCTATGCCAAGTGAAAAGTAACTCAAAGAAACAAATATTTTTATTGGTGGTAGGCCATAACATAGCCATAGATA
CTATAATGTCTCATATGAGGGAAGAAGCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATACGATATAATCAAACTAAACAATTAAAATGTTAGAATAACAAACAATACAATTTAGCAAAATATTGTA
TCTATCATACAATACAGTATAATAGAGTATAATACAATACGATATATTATGAAACAATGGATAACAATGATTCAAATAAAATGTTAATATTTATGAATCA
TATTAATGTTAGGTTAGGAGTAATAAAGAGGGAATATATACTATACTTTTACTATTATTAAGAATATTGAGGATGCATGTAAATGGTCACGTTTTTAGTG
CGAAGGAATTTTTTCGACAACACAAAAAGCAGCTCCACTACTTCCGTAGTCGTGTTTCCCTTTAACCCTATTTTGCCTCCGCAATTTCTCCATGGATTCA
GGCGGCGGCGGACCCAATAATTCCCGGTACCAGCGAAAATTGCCGTCGTCCGATCGTTTCCTCGGCATTTTCTCCACCGCTCACTCACAATCCCAACCCT
CTGCTTCGACTTCCGCCGCCGAAGTTGAGCTCAGCGAGCACGACATTTTTGACGCATCCTCCGATGCAATTCAACACTCCACTCCTTCAACTTCAACAAG
TCCGATCGCTAATTATCATCGGTCCCCTAACCATCTCTCCCATCACAAACATTTCGGTATCCTAGCCGCGTTGCCGGAGTCTGAGTCCCACGCGCAGGCT
TTGCTCTCCGTTTCTTCATCCTCCTCGTCTTCCTCTACGTCGTCGGCTCGTTTAATTCCTACAATTCCTAAACGGCCGCCAGTGGATCGTGTTAAATATC
TCCAGTCTGCACCGGTGAATGTACCTGTAATGTCAGCAGCAGCGCGCCGAAGAGGCAGGCATTTCGACGATGTTGATGATGATGTCGACGGTGGTGAGGT
GTTACCACCGCATGAAATTGTTGCGTCGAGAAAGACACCAATTTTGGCATCCTCTGTGGTTGAGGGAGCTGGGAGGAAGTTGAAAGGGAGGGATTTGAGG
CAAGTCCGAGATGCTATCTTGCAGAAGACAGGTTTTCTTACCTGAATTTTCTAGTAAATTTGAGATAATTGTTAGGTTTCTTCTTGAATTTGTATCAGTA
TCAGGGCTGATTGATAGCTGTGGTTAGAAAGTATCCGCAGTAATAAGTTACATTGTCAATTAAATGTGCATGCCATATAGAGAAACACATTATTTAATTA
TCATCATGGTCATTGGCATTAGCAGTACCGGTTGCAAATCCAAGAAGATTGTCTTTGTCAGCTGCAAGTTGGAAGTGAAAGCTTACCAATTGCAATTTCC
AGGCTTATAGGTCTAAACTAGGTGGGTGCTTGGTGGAGGTTTTAACCAAACTAAGCCATTATATAAAGTCATTCACCAAAATAATATGTTTTTCTAAAAT
TTTACAAAACTAGTATAAACGTATTCCACAGTAACGTTTTAGGATATATTTTATTTTTTATGGCGTCAGATTGATATATGTCACTCACAGTAACGTTTTA
CTCTTAAAACGTTACTTACAGTGACGTATATCAACCTAATGCGGTTAGTTTTTAAAAAATAAAATATACCTAAAACGTTATCCTGAAATACGTTTATACT
AGTTTTGTAAAATTTTGGAAAAATGTATTACTTTGATAAATTATTTTATATAATAACTTAGTTTGGTTAAAAATTCGTGCTTGTGCCTGTCCTCTAATAT
GTAAGGGCCCAAAGTTAAGATGGGGCTTATCAAAGCTTATTATATTAGATAGAATGGATAGGAAAGAAAAGAAAAGCAGGGATGGCATTTGCAGTTAGCA
GCCTCTGTTTCTCCTTCCAACTAAAAGCGAAGTGCCAGCATGATATAAAAAGTTCTTGTTTGAGCTATTGTGAGCGCGAAAAGCCTGTTGGCTGTTTTGT
CGCATAAAGGTTGTTACCTAATATGTTTTTCTCTTTGCTAGCTATCACTTTAAGGTGTGCGCATGGGCACATCTAGGTAGAAGCAAGGAGGTTCTTTTAT
TCGAAAAAAGCTCAACTCTGTGTTAAACGGGTTCAGTTCCTGCTATTTCTAATCTTTTTAGCTTTAGGCGTTTTTTAAATATTCTTTACACACACGCCTT
CGGCAAATATCTTTCCTCCACCCCTGGGTGTGTGCATATTTTTCAAATGCTTTACAGTTACAAGTGCTGGTCTTATTTATAATCTTAGAATTGCCTTATT
TGATGAACCCTGTTGAGTCAAACTTGTAACATTGGAAGGCCTATGAAAGTGTCAAGGAGAATGAACAGTATTATTGCTGAGGCATCGTTTCTACTTTCTA
CACTAGAAGTCAACAGGGAAGAGAGTGGAGAGACTGTATCTAAGTCTACTTTGTTTCTTGGTATTTGCGCTCGAGTCATTACTAAATTTTTGTTGAAACG
GAGAGGAAGTTCTTTTGACATATCAAGATTCGCAGGAGAAGAAATAATCACAGCTGTAGTTCTTCCCTCTTCCACTGTATGGACATCCTCTGGGTACTAT
AATTTCTGATTTGCACAATTAGTAGCAGTTCATTGTAAGTGCTATTGTCCCTCCAACTTCCTCCTATATTCCCCATCTTAATCCATCTCAAACTTTTGTA
ATGGCAAGTATCAAATCCCATGTGGTGAAGAAATTCATGTTGGATAGGTAAATGGTTAGATTTCGGAAGAAACAATATGTACTTGTAGTAGATGACCTTT
GGTTAGTCAAGGTCGTGTGCTTCAACAAATATTTCGGATATATTAAAAAGAAAAGCAGTACATCAAATTTGTTACAGATATAATCGTCCATGCAGCAGTG
TCATGCAATATTATATATTAGTCCATGTACATGACTGCACAGTCTAGTCAAATAAAAGTTTCTGGACAAGGGTGACAATTTTGATATTTGAAGAGATAAG
AACTCCATGGTAACCATATTAGAAGACAGTCTGTGGGTTTAGTAGTGAAAAAGCTCAGGGTAAGTGTAAGATCGTGGGGATAGAGAAACTAGAGAGAGCT
CAACAAACTTGCTTCTCCTTGGTCCTAACTATGTGTTGTAAACTTGCTACTCCCATCAGTTCTAACCATATAATTTAACCTTGCTACTTCAATCCTAACT
ATGTCACGTACTTCAGCATTGGATTCTCAGATCAGTTTTTGGTTCTTCATGAAAATGTTTCAGTTATCTTTGCATATGGAGAATATATGTAATTTGAAAG
ATGTTAAAAGCAGTATATTTGAAGGCGAGTATAAGGTGCTCCTTGGGGCGTCCTGGTGAAAGGTGCAGTAACTTGCGTCAAGGTGTGCGTGTGAATGGTG
CACACTATGGGGTCGGTAGGACGCCTGGATTTCCTGCATTCCTGGCAGCAGGTTATGCCCCCAACGGTGAAGGGAAATTATGTAAGCCTTCAATTTTCAA
AACCTCTCTTTGTGGTTTGTTTACCCGGTATGCTTCTACGTATATCTGTTAAAGTTAAGAAGCTCACTGTTATCACCTTTCAAGTTTCTCTTTGTAGTTC
GTTTACCTAAGAACCAAATTCTTTTCAGTATACCTGAGAAGTGAGCCCCAAATTCACTCTCTTCAATGACCCTCTTCCCTCCCTGCCCCAAAAGAAAAAA
GAAAGAGAACATCTTGAGTGAGTTGCGCCATTCCCCCGTCTTCTCGACCCATTGGAGGAAATACCAGCCTAAAGTCCAAGATTCTTGCAAAATTGTTACT
CCCTCCGTTTCACAAAGAATGATCTGGTTTGATTTGACACGGAGTTTAAGAGTATGAGTAAACTTTTGGATATTGTGGTGCTAAATTAAAGTTAAGTGAA
ATGTACAAAACTGCCCTTTGATTTTGTTGCCTTAAACATGTCACGTGGAAAGTTGAATTTAAAATGTTATTAAAAAAAGAGGTCGTTCTTTTTGAAACAG
ACTAAAAAGGAAAGGAGGTTATTCTTTTTGAAAAGGAGGGAGTATTAAATTTTTGTAGGTCATTTTTCTTGTGAACTTTAATAGTTTTAGTTCCTTTTTT
TTAAAAAAAATGCTTTAGAGGGTGTAAGAAGTAGTTTAATTGCTCTAAAAGTTGGACATGAGTTGGTAGGAAATGGAATATAATTGAAAACGAAAATGAC
CATAAAGTTAGGTTGATGTTAGGGTATTAAAGTTTTGGGTTGTTAGCATGTTGTTAATTTGGCTAAAAATAATTTTACGTTTTCTGACCCTGAAATTATT
ACTAGTATAATTTTTTACATTTTGGACGTAATAATATATACAAATATTAATATTAAATGGTCATGTTCATGCCTTGTGTAAAATGCGTTGCCTCGCACAG
CTTAGAGCTACCTTGTAACATTAATCTTTTTACAGAGGTATTTATGAGGTGAGATGTAAATGATGAGAGGCCAGTTCAAAATTCAGATAAACGTCCTTGT
ATAGAAATAGGAGTAAATATAGTCTTCAAGGTTTCGTTGCGGAGATGAAATAAAAGCTTAATTCTAACTCTCCTCACATTTATTGAAGGTGTCACACCAA
CCACCCTTCTGGTTGGGAATTCAGATACCTGCAGCTATCATCAACCACATGTTTCAATGTTATCCAAAAACGAACACATCTACTAGTTTCAATTAGACAA
TCTACTAAGAAGGCACACAAAAGTTTTTCCCAATGTTGGAACAGAAGTGTCTAATAGGAACACATATTTAATACATTGTCGATATACTAGATCTTTGGTT
AATCCATATTTGCAGCATGTAGGCTTGTTAATGAGGGCTAGGTGATCTTTACATTCTTCACTCAGATTCATAAGTGAATTTCCACAATATAAAGCATGTG
TATATCCATGAGCCTCTAGCTTGTGGTCCTTCACAAGAAGAATTATGAAAGGACTACACATCTTCTCTTTATTTTCCTCCTACTTCTTTTCCTGGTAATA
AATGTATATATGTTTAGATTTGGGAAATCTAAGTGGTACTTTTGGTTGGAAATATCCGCCCTCCCTGCCAGCGAAAGTACGCGGTTTGCTTTCTGGGTCG
AACTCGTTACCTTTCCTATGTGGTTTGTGAGCTATTGCATAGGTGCGGGGGCTTTACCCTGTGCGCAATGGCTGCGGGTTTCCCTTGTCAACAAATAAAA
TAAATTATTTTATCCCAACATGACATGTGTTAGAATTAAGAAGTTATTGAAAGAAAAAAGAAGAAATAGATAGATGTTCTCTTTTAAACGACTAATTAAG
TTTCTAATTAACATGTAGTTATAATATTGTTGAACACTACTAACGCAACGTAATATCTATTGGGTGAGAAGATAAATACATTAAGAAAACACAGAGGGTT
GGCACGCTATTGATCATGATAACTCAAATTTGGTCCCATCATCTTTAAATTAAATACTGTATAATTATGTTATAGCGACTCTTGAACGAATCGTGAAAAC
ACTCATCTTCTTTAAATTTTATGTGAAAAAGTTGGTGACATGTATGCATAGTATATAAGAAGTTATGAGTCAGCAAACTCTAAAGAGAATTTAAGAGCCT
GCATTTGTTAATTCAGTGTTTCCAACTACCATAACAGGCCTTGTGGACCCTTCCATTTATTGTTATTTCATGAACTACTTGCTCCTCTATTTATACTTAC
AATGCTTTTTTTCAACATTCACTACTTAGAATTATTTTCACTACACTCTATAGTCTATACGCTATAGCTAATTAACACAAGCTTAATCAGATGGCATCAT
ATCAGCTTGGTTTTCCACTCTTCATCACTTTGGTTCTTGCCACACTTCAGTTATCGTCTTGCTATGTCTTGAAGGGTTCTGTTACTTGCCTAGACTGCAG
TCAACATAACGATCTCTCAGGTAAATATTCTTTTTTGATCGATATATAGTTTTCTTTTTCCGTAGAATATGATTATTTGTGATGAGTATTTAAGTAGTTA
GATGACATATGTTGAACGTAGAAAAATTGTATATATGTTGGTAATATCTCATAGCGTTAGATTTCGGAAGCAAACGTTTTTGTGTTGAGTGAAACAAGCG
ATACATGGTAGGAGTTGCTGTACTATTTGTTACAAAATGTTTACTATATGTAAGTGACAAAAGTCATATTCCTCACTTTATTGCAAGTTTTTTCATCATA
CCAAACAATAACATGACAGGCTTAAAGGATATTGCATGATATCATATATTTTTAGGAAAATAGAAACTAAGCTCTCCCTGTCCATAAATTTGAAAATAAT
ATTGTCTGTTCATGAAATTTAGTCAGTTTTTGGAAATATATCTTCAAAGAAATTTGAAGTTCTATGTTAGGTGAAATTTCACCTTTATTCACAAACCTTC
AAATTATTTCAAAGTAAAAAATACATGTCCAAACACAATTCAAAAACTATTTTTCAACAAGTTAACTTCAAAAGTACTTTTTTTTTCAATTTTCAACTAA
ATTTATGATCGTTACGCAAGCTAAGTCTTGAATATTATATCATATTTTGACCATACTTTTCAAAATTGAGCAGGAATAGAAGTTTTAGTGAAGTGTGGTC
AGGTGAAAAGATTGGCTATGGCTACAACAGAAGAAGATGGCTCTTTTGAAACAAAACTTCCTTCTACTCCACCAAACAAATGCTATGCCAAGATCCTTGG
AGGTCCTAATCAGCTCTTTGTTTCAAGAATTGAAACAGACCCCAATATTGTCAAGTCTCAAGAAGATGATAACTCCTACACTATCTCTAACCCTTTAAAG
TTCTACACAAAATGCCCTTCACCCAACAAGAGTGCTAAAGGAAAATGTCATGATGAGTTTGGTTCATCTAAGACTATTGATCTACCATTGCCAAAAGAAT
GGGGAATGCACCAACTAGCTACTATGTCCCTGTTCTCCCCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCTTTTACAAAGTATTGTAGACGTAGTCCACATCAACTAAAAAAGTGACTCACACTC
TTACTGTTACAAGTTTCAAGCTCAGAACACTGTCAATTCAAATTATGTATACCCTGACAACACTTGTTAACCCATAAATAACCCTTAAAACAAATTAGTC
AATACTAGGGTTGTCACATTCGGGTTTACGCCCTAGACATAACCGGCATCGTAGTCTTTTTCAAGGACTATGACTAGCCTCTTAGTCTCATGTCATTACA
TTCATAGGTTGAAAAATGCGGAAAAATTTAAAACTTTCATTATCACTACTTGGAGGTTTACATAGACCTATACATACACATAATATATATTCATATTGAG
TATACATATACCCTTCATCTAGGAAAGTTACATAACCTTCCACTTTTATTGCACATACATATACGTAAAATATAGAAATAGTCTCAACTATTGTCTCATT
TCATACCATCTAAACAAATATCACAATATGGGCATAAACCTTCATAAATTCAACAAGACCATGCATAGGTCATACGAAAGTACAATACTCCATTAAAAGA
AGAAGAATGAAAGAGTCAATAAGATCATATTAAAATCCATAAGCTAGAGGATGGCATTTCCCTCGAAAGTTGAGGACCTACCCTACTCATAACAAGTAAT
TCCTCCAAATTTTAAAAGCAAACACCAAGTCCGCTAATTCAAGGTCACGAGTGGGGTAATTTCTCTTATGTACCTTTAGTTGCCTAGAGGCATAAGCGAT
CACTGTCCCGTGTTGCATAAGCGCACACCCCAACCCACTCGGGATGTGTCACAATATACCACAAAACCCTTTGTACACTCCAGTATGGTCAACACCAGAG
AAGAAGTAAGCCTATCTTTCAACAATAGGAAACTTTTCTCACATGCCTCCGACAACTCAAACTTCTTACTCTTTTGGGTCAAAGTAGTCAAAGGAGACGC
AATGGATGCGAAACAATCCACGAACCTCCTATAGTAACCCACTAAACCCAAGAAACTCCTAATGTCAGTCGAAGTCAATGTCCTAGGCCATGTTTTCATC
ACTTCAGTTTTCCTTGGGTCTACCTCAATTCCCTCAATAGAGATGATGTGCCTAAGAAAAGTCATTGACCTCAAAAAAAATTCACACTTGCTATATTTGG
CATACTATTGATGTTCTTTAAGGGTTTGCAATACTACCCTCAAATGACCCTTATGATCCCCTTCATTCTTTGAATATACCAAGATATCATCAATGAAGAC
AAAGAAAAATGAATCTAGGTAATTTCGAAATACTCTATTCATTAGGTCCATAAACGCCGCCGGAGCATTAGTGAGACTGAAAGACATGACTAAGGACTCA
TAGTTCCCATACCTAGCCCAAAAGGCCATCTTTGGTATATTCTCACCTCTTACCCTAAGTTGGTGATGCCTGATCTTAAGTAAATTTTTGAAAAGTAACT
CGCCCCTTGGAGTTGATCAAATAAGTCATCAATCCGAGGGAGAGGGTACTTCTTATTAATGGTAAGCTTGTTGAGTTGGAGGTAATAAATACACATTCTC
AAGGACCCATCTTTCATCTTCACAAACAAAATCGGAGCACCCCACAGAGAAATACTAGGCCTTATAAATCCCTTATCTAGTAAATCCTTGAGTTGAGCCT
TCAACTCTTTAACTCGTCTGGAGCCATCCGATAATGAGGAATTGATATGGGATTTGTATCAGATAGCAAATCAATGACAAAGTCAATTTCCTGTTCGGGA
GGAATACCATGAAGGTCATTTGGGAAGACCTCCAGAAAATTCATTCCCTACAGGTATCGACTCGATGGAAGGAAATTCAGAGTCTAGATCTTGGAATCTT
ACTATATGATATAGACAACCTTTTAAGTTCATTTTGCATACCTTTAGACAAGAAATAATACGACCTCTTTAGGAATAGAACTTATCCCCTTCCACTCAAC
AACGGGTTCATTTGGGAAGTTAAACCTCACCACTCTTGTCTAACAATTAATGGATGCAAAACATGCATTCAACCAATCCATACCCAATATAATATATAAA
TCAAGCATATCGAGTTCTACTAGATCAACATAAGAAACTCTACTGGGAAACATTATAGGACAATTTCTATAGACATTTTTTGTAACAACTGACTAACCCA
AAGGAGTAGACACTATGAATGGTTCATGCAACATATCGGGTAAGATATCAAACTTTTTAACTATTAGAGGTGTAGAAAATGATAAAGTAGCGCTGGTTTG
GATCAAGTAAGGCATATACATAAAAAGATAAAACATTCAACATACCGTTCACTACATCGGTAGAGGTATCTTACTCACCCTTAGAGCGGAGAGAATAGAT
GTGGTTCTTCTTTGGAAAATCACTAGAACCACTTGCTTGAGTTAGACCACTACTCTTTTCTTGAATCTTCAAGTTTGGGAAATCTCTCATCTTGTGACCA
CTGTTGCTACAACTAACGCAATTATCCGTTTCCTTAAGGAAATCACCATAGTGCTTTTTACCACACTATCCACAAGTTGGCTTCTTATTTGGTGAATTAG
TAGCTTTTTCCTTCTTGACTTTAGGGTTCGACACCCTATCACCACTAGCTCTTGGGAATTTTTAAGGGACTTGATTCGAAACCCTCTTCTTAAATCTAGG
CTTGTCTTATATCTCATGCCTATTTTTTGAGAACCTCCATCAAAAGACCTTTCTCTCTTAGCATCTCTGCTTTTTCGTTTAGCCCTTGCCTCCTTAAACC
TTCTTGCATAAACCATAAGATGAGAAATGTTCATGTTGTCATGTAGCATGGCCAATTAGCACTTCTGTTGTAAGTCCTCCGACACCCCGTCTCAAAACGA
CTCATTTGGTCTCTAGGATCGGAGACCAAAGAAGGAGCATATTTGGACAACTTAATGAATTTTAAAGAGTACTCATGGAAAATCTTTCCTCTTTGGCGAA
GATTGATGAACTCCTTTATTTTTTCCTCCCTAATCTACCTAGGGAAGAAACTATCTAGAAAAGCCACCTTAAAGATCTCCCAAGTCACTGGACCGCCTCT
CAATGGCCTATTTATCCCTCCATTTGACATACCAAGTTTGAGCCACAACCTTGAGTTGGTATTTGTCCAACTCGACCTTCTCACTTGAAGAGACCCACGT
AACATATTGTATCTTGTAAGTATCATCGATAAATTCTTAAGGTTTCTTCATCAACCTTAGACCCATAGAAAGTAGGAGGGTTCATTCGAGAGAAGTCCCT
TAGATGGGAAGCCATTGTAGTGACTTGTTTATGAGGATGGGGAGAAATCTCCCGATTGGCTTGGGCCGTCATAGCTTGGGCTTGGGCTTGAACCATCGCG
GCTTATGCTTGAGTAGTAATGGCTTGGGCCATTTGAGCAAGAATCTCCCCATGTCCACCCCCGTCTTAGGTGGAGGGTTAGCCAGGGCTTGATCAGCATT
AGCATTTTCCTCAAGTGGAGGAACTTGGTCATCATGGCGAGGAGCTCCTGCATTAGCAACTTCCTCCTTAAGTCTTTGAGCTGCATTCCTTGGAGTGTTC
ATGCTTCCTATAAGCACAACAATAGGATTAGATGCAAAATCTCACCATAAGTATACTCTATTGGCACAATATAAGATTTCCAAGAAAAAGAGCGATTTTC
TAAGCATCATATACGTTCCTATTAATAAGTGTGGAGCGTTTCACAATTATTAATACGAACCTATATAGACGTGGTAGAGAGAGAGAGAGAGACATAACTT
AACGATATTCAACCTCATGCTCTAGTACCATGTTTTTCACATACGGGTTTACCCCCTAAATGTAACTGGCATCATCATCCTTTTCAAGGGCTAAGACTAG
CCTCTTACTCTTATGTTGTTACATTCATAGGTTTGCAGAAAAATTTAAAACTTTCATTGTCACTACTTGAGGTTTACATAGACCTCTACATCACATAATA
TATATTCATATCGAGTATATATAGACTTTTCATATAGGAAGGTTACATAGCCTTCTACTTTTAATGCACATACATATACATAAAATATAGAATAGTGTCA
AGAATTGTGTCATCTCATACCATCTAAATGAATATCAAAATATGGGCATAACCCTTAAATCAATTTAACAAGACCTTGTATAGGTCATACGAAAGTAAAA
TATTCAATTAAAAAGGAAAGGAATGATATAGTCAATAAGGTCATAACAAAATCCATAAGATAGATGATGGAATTGCCCTCATCAGTTGAGGACCTACCTT
ACTTATATGAAACAACAAATCCAAGACTTCAACAATTCACCTTTCAAACTCTTCAATGACCGAAACCTAAAATGTTTGGAAATAGAGAACAAAATGGGAT
TAGTACTCTACATGTACTAAGTATGGTATCTTGTTCACATACTCAAGAAAAACATGCTAAAAAGGACTTTATATCAAAACATGCCAAATGCAAAGTCAAG
TAAGTCATATCAACTAAGCAAACATGCTTACTATCTCAAGTAATACTTATCCAACATACTTGAAAACATGATTTACTACACCCCTAACATCAAGGAATAA
TATCACAAGAATGAATAAGAGTCAAACATATCATAATAAGAAAGACAACTATTCACAAGTCCTTATTAAGTCAACACGTGCAATGACAAAGCAAAGCCCC
ATTACCATACTCAATCAAGTAACCTCAAAAACATGACTAATGTCCAACTTTAGATATCATGTATTTAGGTTCACATTTCATCATATATTAACATGAAAAC
CCAAGGAATATTCATAAATTAACTAATCAACATGTATTATCAATAATGTGTCATGGTCATCATAAATGCATTATATATTATCATAATATAAACATATATA
AGAACCTCTTTGTAAGACGCCCCTCAAGGCTTACTAGTGAAATATTTAGGTAGAGTCCCATACCCCTACCTAGACTAAGCTAGACCCCTTAGGTTATCCA
AGTTAGAGTTCAAGCCCTTTAATTCGTTTTCCTTTTCGGCAACGTCTTTCCCTAACCGGCATAGACCACATGAGCTATTATAGAATCCGGTGTCATGAAA
CCCTACACCGAAAGAAGGCGGACTACTTGCAAAGGTAGTACAAAAACATAAAACATAGCAACTATGTGGATCCACTAGCTAGTATTCCAATGGGGGCAAC
ATAGTTCAAGAACTAGGAGATTTAGTTGGGACCCTCTTCATGTGCCATGCATTATAGTCTCCAATATCAAGAGTAATGTAGTGTTCCTACCTTCCTTATG
TTGGAAGGGAAACTCCTCAATCTAGTTCACTCGGTGCTAAGCTAGAGTCCCTTTGTGAAATGTCTTTAAGCCTTTAATTATCAATCATAGCTTAATTTAG
GTCATAGGGTCCACCCCATGCATAATCATCATCATCAATAGCTCAATAAGATTTGTATGAGTATAAGTCCTTTTATCACAATACATATAAGTGAGGTTAA
CACATTAGCATATCATAGAATATTAAGGCACTTTAATAGTTTTCACTATCCTTATATCACAGACACCTTAAACAACGTCACAACTTAGTCAAGACATTTC
AATTCAACATACATAACAACAATTAATTACAATTGGAAGTAAAGATAGAGATTGTAAGACTTACCAAGTCTTCCTCATAGTGTATCATCAAGGTCTTACC
ATTAGACCATAACTCAACCCATCTTGCGGAGTAACATCATTACATAATGATAACCAATAGAATAACAAGGCCAATTGCATCTGTATAACACAATTCAACT
TTAGATCAAAACATAAGAAAAGATACATAGGCTGATTTCACGTTATAATTCATAACCTAAATCACATCTCAAGAACTAGCATGATAGGTCTATAATTCAT
CTTAATTTAATAGTAATAACACCATAGGATAGTAATGGAATAAACAAACAACTCAATTGAATGATCACAAAACAATCTAGGTCAAGATCACTCCCTAGGA
TGAGGGATAGAGGATCATATTCTTCAATTTAGACCAAACCATCAACAATTACCATAAAAAAGATGAATTAAATGTTAATCTACTCAATATAACCTTAATT
AATCATTAACAACTCAATCCTTGAATGAAACTTATAAGAAAACTCAACTTTTGAAATCTATTTTGAAGGAACTCTTTGAGAAAAGTGTCTAAAAGGTGAA
TAGAACACATACCATAACATTTGTCGACAATTTAATGGTGAATTCGTCCCTTTACAGACCCTAAACCCTTGTCCTTGCTAGTCTTCAATGGTGAGTTCAT
ATACAGAGAGAAATAATAGAGAAAGAAGAGAGTTTATTTGAGAGTTGTGTTTACATTAATGAGGTTTAGGAGTATTTATATTGGGAATTAATAAACTTAA
TTAGTTTCCCTCAAACCCTAATTAAATCACCTGACCCCTAACTAATTAAATGACACCCACTTAAATTAGGCAGGAAACTCGACCCTTACAAACGAAACCT
CGATTGACGGGCCATCTGTCAGTCAATGGACAACCCACCTCCTCCGTCCTGCACTCCATTGTCTTGGTCAGGGACTGTGTAGGAGAGGGGCTTCCTCGAA
TTGTGTAAGTATGGGACGACGGTGGCATCGACGACCCACCGGTCGATTCACACATGGACCATAGCCTGCACCTGTCCATAGCCTGCACCTCTGTACCCGT
CGATGAGCTTGGAGGCTGTGCAGGTGAAGGGGACTTCTCCACCAGCATAAGTGTGGGACAACGGTGGCATCGACGCCCCGTCGAACCACACATGGGCCGT
CTTCTGTCCCGCCGATGCACACTGCCAAACAATATTTCATCAAACTACAAGGGTCCTCCTCAAGGGTCCTTGGTTGGTCCTTGGGGAGTCGTACCCAAAT
GTTTCAACCATAAAACTAATCAATCACCTATTATCTACCTTTCCACCAATTTTCGTACATTTTTGACTCCAAAAAGTTAGTCAAATAGGCTAAGGTACAC
TAACACCCCTTTGAACAAACTTCCCGGACGTCATGGACGTTCTTGGATGTTTTTGTTCTTAAACCTCTTAAATGTCTTAGATTAATTTAAAATGGACTTA
GAAACAGTACTTAGACTTGATGACGCCTATGGTTGGCTTTACAATGTGTGTTGGATTTTCAAGGTGTTACACCAACCAACATGTTAGTACCATGGCTTCT
CGTTTTAGGGCTTTTACAAGGATGAATCCCCGTAATTTGTATGGATCCAAAGTTGAGGATGACCCCCTAGAGTTCATTGATGAAACCTACAAGATCCTCT
ATGCTATGGGGTTTACTACTAGTGGGAAGGTCGAGTTATCCACTTATTAACTCAAAGATGTGGACCAAACTTGGTACATCTAATGGAGAGATTTTCAACA
AGGCTTTTCTTGACAGGTTCTTTCCTAGGGAGAAGAGGGAATCCAAAGTGGTGGAATTCATCAACCTTCTTCAAGGAGGTATGAGTGTACTTGAATACTC
TTTGAAATTTACTAAATTGTCAAAGTATGATCCTTCTTTGGTTTCCGATCCTAGAGTTGAAATGAGCCGCTTTGTGAAGGGAGTATTAGATGACTTCAAG
GAAGAATGCCATTCAGCTTTGCTACATGACAATATGAACACTTATTGTATCATGGTTCATGCTGAAAAAGTGGAAGAGATAAGGGCTAAGATAAAGAGTA
GAGATGCCAAGAGGGCAAGGTTTTTTTAATGGTGGTTCTTCCAAGGGTAGGCTTGACATTCATGAAAAGCCTAGGTGTAATAAGAGGTCTTATAATAAAG
TTCCTTCCAAGTTCCCTTAGGCTCTTGATTATAGGGTGTCTAACTCCTAAGCCTCAAAATGGAAGGAATACTAGTTCACCAAACAAGAAGCTTTTTTGTG
CGAAGTATGGAAAAGGTCGTCTCGGTGAATGTTTGGTTTGAACAGGAAATTGTTTTTGTTGTGGTAAAAGCGGTCAGAAAGTTAGATATTGCCCAAATTT
GAAGGGTTAATAAAGGGTAGTGTTCATGCTCAAGGAAGTGTTTTAATGTCGAAGCTCCGAAGAAGAATCACTTTTATGCTCTCCGCTCTAGAGGGGAGAA
AGAGAATTCTTCCGACGTGGTGACCGTTATGTTGAGACTTTTCTCTATTGATGTATATGCTTTACTTGATCCGGGTGATAAACTATATTTTATTACTCTC
TTTATAGCTAAAAAGTTTGTTATTTTGCAAGACATTTTAATTGAATATTTAATGGTAACTACTCCAGTAGATGAGTCGGTGGTTGTAAGAAGGGTATATA
ACAATTGTCCTATAATGTTTTTCAATAGAGTTACTCATGTGGAATTATTAGAACTTGATATGGTCAATTTCGATGTAATTTTGGGGAAGGATTGGTTGCA
TGATTCTTTTGCTTCCATTAATTGTAGAACTAGAATTGCCCAGTTCAATTTTCCAATTGAACCCATTTTAGAGTGGAAGGGGGGAAATTCTATTACTAGA
GGTCGTATCATATCTTGTCGTAAGGCTTCTAAAATGATCTCAAATGGGTGTCAATATCGCATTGTAATAGTCAAAGGTCCAGACTCCAAAAATCCTTCCA
TTGAGTTAGTCCCCGTAGTAAGGGAATTTCACAAGGTCTTTCCTAATGATCTTCCCGGAATCCCTCCCGAATGAGAAATTGATTTTGGTACTGACTTGCT
ACCGGAGACCAACCCCATTTCAATTCCTCCTTATCGGATGGCTTCGACCGAATTGAAAGAGTTGAAGGCTCAACTGAAAGACTTACTAGACAAGGGATTC
ATTAGACCTAATATTTCTCCATGGGGTGCTCCTGTTTTATTTGTAAAGAAGAAGGATGAGTCCCTTAGAGTGTGGATTGATTATCACCAACTCAACAAAG
TCACTATTAAGAATAAGTAGCCTCTCCCTCAGATTGATGACTTGTTTGATCAACTCCAAGGGGAAAGCTACTTTTCTACGATTGACTTGAGCTTAGGGTA
TCACCAACATAGTGTGAGAGGTGAGGAGATACCAAAAAAGACATTTCAGACTAGATATGGTCACTATGAGTTCTTAATAATTTCCTTTGGTCTCACTAAT
GCCCCGACGACATTATGGATCTAATGAATAGGGTGTTTCGAAGTTACCTATATTAATTTATCATTGTCTTCATTGATGACATCTTGGTATATTTGAAAAA
TAAGGGTGAGCACATGGACCATTTGAGGGTGGTGTTACAAGTGCTTAAGGAAAACCAATTATTTGCCAAGAATAGAAAATGTTAGTTTTAGTTGAGGTCG
GTGGAATTTCTTGGTCACGTCATCCCTAATGAGGAAATTGAGGTTGATCAGGAAAACTGAGGCGGTCAAGATTTGCCTAGACCATTGACTCCAATTGATA
TTAGGAGTTTCTTGGGTCTAGTGGGTTATTATAGGAGGTTTGTGGATGGTTTTTGCTTCCATTGTATCTCCCTTGAATACTTTGACCCAAAAGAGTATGA
AATTTGAGTTGTCAAAGGTATGTGAGAGAGTCTTTACAGATAGTCTTACTTCAGCTCTGGTGTTGACTTTTTTGGAGGCTACCAAGGGCTTTGTTGTGTA
TTGTGATGTATTCCTAGTGGGTTTAGGGTGTGTCCTTATGCAACATGGGAAAGAAGTAGCCTATTCCTCTAGGAACTTAAGATAAATAAGAAGAAGTAAC
ACACTCGTGATCTTGAGCTAGTTGTCGTGGTATTTGCTTTGAAAATATGGAGAAATTACTTTTATGGTGTCCATGTGGATGTGTATACCAACCACAAGAG
TCTTCAATACGTGTTTACTAAAAAGGAGTTAAATCTCTAACAAAGAAGGTTGTTGGAATTGTTGAAGGGATTATGACATGAGTGTTCTCTATCACCTTCA
GGAGGCCAATGTGGTTGCTGTTTCTCTAAGTCGTATGACCAAGGGTAGTGTATCTCATGTAGAAGAATCCAAGAAAGACCCAGTGAAAGATTTTCATAGG
TTTGCTAGATTAGGTGTTAGATTGGAAGATTCTCTGAATGGTGGTTTTATGGTTCATCATAACTCTGAATCATCTTTGGTGGTTGAGGTAAAGTCTAAGC
AACACTTTGATCAACCATTGATGTAGTTGAAAGAATCGGTTCTTGGTAAGCATAATGAGTCATTCTCTTTAGGGGGGATGGTGTCTTGAGATATCAAGGA
AGGTTGTGTGTTCCCAATGTAAATGGTTTGAGGTACCGGATTCTTGAGAAGCTTTTGGGTCCCGTCACTCTATTCATCCAGGTTCTACAATGATGTACCA
TTACCTTAGGGAAGTGTTTTTGTGGGAAGGCTTGAAGAGGGACATAGCGGAAATTATTGCAAAATGTCCAAATTGCCAACAAGTGAAAGTTGAACACAAA
AAGCCTGGTGGTTTACTTCAAGAAATCCGAGTACCTACTTGGAAGGGGAATACATCAATATGTTTTTTTTGAAAGGTTTGCCTCGGACACAAAAGCAATA
TGACTTCATATGGGTGGTTGTGGATTGTTTGACAAATTTGCTCATTTTATTCCCATCAAGTCTACTTACTTAACGGAGGATTATGCAAGGATCTTCCTAT
ATGAGATTGTGTGTCTCCATGTTTCCGTTATCCGTCCTATCATATAGGGGTACACAATTCACATCTATATTTTGGAGGTCATTCCAAAAAGGGCTGGGTA
CCAAGGTGAAGCTAAGCACGACTTTTCATCCTCAAACGGATGGCAAAATGGAGCATACTATTCAAACCCTTGAGGATATGATTAGAGCTTGTATAATTTA
TTTCAGAGGAAATTGGGATAAGCACTTGCATTTGGTTGAGTTTACTTACAATAATAGCTAACTTTCATCTATATCTATGACTCCTTATGAAGCCTTGTAT
GGTGGAAGATGTAGATCTCAAATTGGATTGGTTAAAGTGCACGAGTCTTCATTTTTGGGTCCCTATTTGATTAATAAGACTTTGGAGAAGGTTCATATCA
TAAGTAATTGCTTGAAAACAGCCTATCGCCGGCAAAATCCTTATGCTAACCATAGGAGAAGAGAATTAGAGTTTGAAGAAGGTGATAAAGTTATTAAAAA
ATTTTGCTTATAAAAGGGGTGGTGAGATTTGGCAAAAAAGGAAAGTTGAGTCCTCATTATATAAAAATTTTGCTTATGTTGCCTAATGATTTGGTATCGG
TTCATCCGATGTTCCATGCTTAAGAAGTGTATCGGTAATCCTAAGCTCATTCTTCCCGTTGAAGGTCTAGGTGTTCAAGAGAACCTCTCCTATGAGGAGG
TTCCAGTTAAAATCTTTGAGAGACAAGTTATGAGGTTAAGGAACAAAGAGGTGGCTTCCATAAATGTGTTAATGAATAATCACCTAGTTGAGGGTGCAAC
ATGGGAGGCCGAGGCCGGCATGAAGTTACGTTACCCTCATCTATTTGATGAATAAGGTTAGTTATTACCACTAATAATGAAAATAATGAAGAAATTTGAA
GTTTCTTTGAATTTTGATGAATTTCTTAAAAGATGATCATGTTACAATGGAATTATAGTAAAATATGCTTATACTAAAAAATTTCCAATTCGTCTTGTTT
TGAGACATGTTGTGCTTGTTGATATAGTGAGTCTTTATGAAATGATATTGAGCAGTTTAATATGTTGAGTTTTGGGTAACTGACTCCTTAATTATATGTT
TAGCTCATATTGTTGTGAGAATGAAATTCCTCATATTTTGATGATTGAGCTCTATGTGTAGTAATTGATGTTTGAATTTCTATGTGTAAATGCCATGATT
GATGATGTAAGTGATGCTGATATGTGTTGTTGGTTGGGCTGCTAGTCTTGAGTCTATTCCTTCCTTTTAAAAGAATTTTAGTTTCATTCGGGGATTAATG
CTCCTAATGGGGGGATAATGTAATATTCCGAAAGTCTAAAGCCTAATCTAAAGCCTAACATAAGTGTCAAAAGGTTTAGACACTATTTTATGGTCAATTT
TAATGCATATAAATCATTTAGGAAGTTTAGAAATCAAATTTCACATCAACAAACGTCCATGACATCCGAAAACTAGTCCGATGAGGTGCTAGCGTGCCTT
AGCCTATTTGACTAACTTTTAGGAATTGGAAATGTAAGAAAAATTTGTGGAAACGTAGCAAATAGGTGTTTCATGGTTGAAACGTCTGGGTACGACTCCC
CAAGGACAAAACAAGGGCCCTTGAGGTGGACCCTTACATTGAAGAAACACTACCTGGACAGTAAGCATCGACGAGACCACCTACGGTCTGTGTATGGAAT
GACGGGGAAACGATGCCACCGTCGGCCCATACTTATTAAAGTTTAGGAAGTCTTCCGCCTGCACAGTCTCTAAACTCATCAACAGAGTGTAAGACGGAGG
AGTGAGAGTGTGTAGGTTCACGACAACCTGGCGGCGGGGTTCCATCTATGAAGGATGAGTTTTCTGCACGTTTTTATATTAATTCATTTAATTAATTAGG
TGGTTTAGGGGTTAGTTAAGGATTAAGGGGAGACTAATTAACTAACTTAACACCCATATAATAGCCCCAACCCCATATTAAACTAATTAGAACTCTAAAA
CACAAACTCTCTTCCTTCTCTCTTCTTTCTCTCTCTACTTGAACTCACCATTGAAGACTAGCAAGGAGAATGGTTTGCGGGCTGGAAAGGGGAGAATTCA
CCTTTAAATTGTTGTCAATTGTTAAGGTATTAGATATAGTTCACCTTTGAGACTCTTTCCTCAAAGTGTTCCTTCAAAATGAATTTCAAAAGTTGAGTGT
TCTTATGGGTTTCATCTAATTACGAAATTGAAGTTATGAATTGAGTTGTTGATGATTTCTGCAGGTTATATTGAATAAATTAACTTTTAATTTAACTTTT
TTATGGTAATTGTTGATGGTTCTGTCCAAATTGAAGAACATGCCCTAACGTAGCTTATGATCTTGACCTATATTGTATTCTAGTCATTCAATTGATTTGG
TTATTGATTAGATTACTATCCTATGTTGTTATTATGAATAAATTAAGATGAAATATAGGCCTATAACTCTATTTTATTGAGATATGATTTAGGTTATGAA
ATATATTGTGAAATTAGCCTATGTTTCTTGTCTTAAACTATGATCTATTGTTGAATTTTCATATAGAGATGCAATTGGCCTTGTTATCTTACGTTTATCA
TTGTGTGATGATCTTACTCCTCTAGTAGGGTTGAGTTATAGATTGATGGTAAGACTTTGATGATGAAATATGAGGAATACTTGGTAAGTCTTAGAATCTC
CATCTTTACTTCCAATTGTGATTAATTGTGGTTAACTGATGATATTATATTGGAGTATTCCTTGTATTATGATTGATAGGATGATATGATGATTGAATTT
AAATGTCTTGATCATGGTTTTGAGGTTTATTAGGATATAAATTCTATAAGGATGGTGATGTACACCAATGTGCCTTATTATGAAATACAATGTAATGTGT
TAACCTCACTTATATGAATTGTGATGAAAGGATTACACTCATGCAATTCTTATTGAGCTATTCACGATGATGATTATACAAGGGATAGACCTTATGACCT
AAACTAATCTATGATTATTAATTAAAGGCTTAAAGACATTTCAATAAAGGGACTTAGCTTAGCACCGACTGAACTTGACAACGGAGGGTGATGATTTCCC
AAAGTTGAAGATTCTCCCTATAGTTCTATATGAGATGTTGGCTTCCCAAAGAGGAATACTCAGCCAATGTATTTCCATGAGAGGATGTCCCAACCACCAA
GTGGTATCAAGAGGGAATATACTATCTCTTAGTTCTTGAACTATGTTTCCCCCATAGGAAGACTATCTAGTGGATCCACCTAGAAAGCGACGTTTGTATT
TTGTTAAACTTTGGACGATGGACCACCTTCAATCGGTGTAAGGTTTTACAACAATGGATTCCACACGTAGCTCATGTGGTCTATGTCGGTTAAATAAAGT
GTTCCCTAATGTAAAATAAAGTAATGAAGTATAAACTAACTATGGAGACTTCAGAGGCTGAACTTAGCCTAGGTAGGGGTTAAGACTCTTCCTATTCCTG
CACTATTTGACTTTGATGGAAGCTTTAGGAAGTTGATATTATGTATTCATATGATAATGATATATATGATGATAGTATGTTGATACTACAATGTAAGTGT
CTATATATAATGATTATTATCCTCTTGATTTATGTAGTTGGATTATATTGTTAAACTTAGACATTGGTTATGTTCTCTTGTTAAATCTACTTGGTTGAGC
AAGGTTATGGGGCTTTTCTTGGTCATTGCACTTGTTGACTTGATAAGGATTCATGAGTAGTCGTCTTGCTTATTATGATATGATTGACTCTTATTCATTT
TTGTGATGTTATTCCTTGATGATAGGGTTATTGTAAATAATGGTTTCAAGTATGTCGGAATACATATTACTTGTTGAGTTAATAAGCATGAATGGTTGGT
TAATATGACTTTCTTAGCTTTGCATAAGGTTCTTAAAATGACCTGTTTTTACTAAAAGTCCTTTTTAGCACGTTTTGCTTCTATAGATGCATAAGGTCTC
ATACTTAGTACATTTGGAGTACTAACCCCATTTTCTTCCCTTATCCCAAAGATGTTAGGTTCTGGTCATTGAAGAGTTTGGAAGCCGACATTGTTGAAGG
CTTGGATTCTTCATTTCATAAAAATAGGGTAGGTCCTCAAATTCTAAAGGCAATGCCACTATCTGGCTTACGGACTTGTTAAAGACTTTCATTTCTTTCC
TTTTCAATTTAGTACTATACTTTTGTATGAAAAGTTTTAAAATATCTGCATTTTCAACCTATGAATGTAATGACATGAGAATAAGAGGCTAGTCTTAGTC
ATTAAAAAGGACGACAATGCTGGTTACATCTAGGGGGTAAACATAAATGTGACAAACTTTGTATAAGAGCATGAAGTAGAACCTGATTGAGTTATTTTTC
TCTCTCTCTACCACATCTATGTAGGTTTGTATTCATAATTGTGAATCATGCCACACTTATGAGTAGGAACCTATATGATGCTTAGAAATGACTCTTTTTG
TTGGAAATCATATATTGTACCGATAGAGTATACTTATGGTGTGATTTTGCATCTAATCCTATTGTTGTGATTATAGAAAGAATGAACACTCAAACGAATA
TGGCTCAAAGACATGAAGAGGAAATTGCAAATGCGGGAGACCCCGTGGTGATTAACTTCCTCCACTTGAAGAAGATGCTAATGTAGAGCAAGCATCGATC
AATCCTCCTCCTCTGATGGATTAGAATATAAGGACCACTCTTCATCAAATGGACCAAGCTATCGCTACTCAAGCACAAGCGGACACGACTGAAGCCTAAT
CTATTATGGCTCAAGTAAACTGGGAGGTTGTGCCCCGTCCTCATCAACAAGTCACTACTATGATTTCCCGTCAAAGAAACTTCACACGAATGAACTCTCC
TACTTTCTATGGGTCTAAGGTTGATGAATACCCCCAAGAATTTGTTGGTGAAGTCCCAAAAATACTTGGGGTAATGGGGTTTTCCACAATTGAGAAGATC
GAGTTGGCCATATATCAAATCAAGGACGTGGCGCTAGCTTATAATGTGCAATTGGAGGATAATAGTCCACGAAGGGGTGGTACAGTCACTTAGGATATCT
TTAAGACAACTTTTCTAGATCGGTTCTTTCCTAGAGAGATGAGAGATAACAAAGTGGTGGAGTTCATTAACCTTCGCTAAGGAGGAAGGACTGTCCATTA
GAACTCTTTTATATTCATTAAGTTATTCAAATATGCTTCTTCTTTGGTCTCTGATCCTAGATACCAAATGATCTTTTTTGTGACGGGGGTGTCGGAGGAC
TTACAAGAAGAGTGTCATTCGACCATGCTACATGAAAACATGAAAAATTTCCGTCTTATGGTGCATTAAAGAAGGTTTGAGGAGGCAAGGGCTAAGCGAA
AGAGTAGAGATGCTAAAAGATCAAAATCATTTGATGGAGGTTCTTCAAAGAATAGGCTTTAAATATAAGACAAGCCTAGATTGAAGAAATGAGTTTAAAA
TCAAGTCCCTTCCAAGTTCCCAAAACCTAGGGGTGATAGAGTTTCTAGCCCTAAATTCAAGAAGGGAAAAGGCACTAATTCACCAAATGGGAAGCCTACA
TGTTCCAAGTGTGGAAACGGTAATCTTGGTGAGTTCTTTGTAGGAACGGTTCTTTAGTTGTGGCAAGAGTGATCACAAGATGAGAGATTTACCAAACTTT
AAGAGTCAAGAAAAGGGTAGCGGTCAACCTCAAGCAAGTGGTTCAAGTAATGCTCCGAAGAAGAACCGCTTCTATGTTCTCTGCTCTAGGGGTGAGCAAG
AGACTTCTCCCCACATGGTGACGGATATGTTGAAAGTCTTCTTTATTGATGTATATGCCTTACTTGGTCCTGACACTATTTTATCATTTGTTACACCTCT
AGTAGATAAAAAGTTTGATATCTTTCCCGATATTTTGCATGAACCTTTTATAGTGTCTACTCCAATGGGTGAGTCAGTTTTTGCAAAAAGGGTCTATAGA
AATTGCCCAATAATGTTGCCCAATAGAGTTTCTTATGTTGATCTAGGAGAACTCAATATGCTTGATTTTGATGTTATATTGGGTATGGATTTCTTGCATG
CATATTTTTCCTCCATTGATTGTAGGACAATGGTGGTGAGGTTTAACTTCCCTAATGAATCCTTTGTTGAGTGGAAAGGGGGAAATTCTATTCCTAGAGG
TCGTATCATCTTTTGTATGAAAGCATTCAAAATTATCTCAAATGGTTGTCTATATCACATAGTAAGAGTCCAAGATCTAGACTATGAAGTTCCTCCTATT
GAGTCGGTCCCCTTAGTGAGTGACTTTCCGGAGGTCTCTCCTAATGACCTTTCCTATATTCCTCCTAAAAAGGAAATTGACTTTGGCAATGATTTACTAT
CGTATACAAATCCCATATCAATTTTTCCTTATCAGATGGCTTTGACTTAAGTAAAGGAGTTGAAGGCTTAACTCAAGGATTTACTAGATAAGGGTTTTAT
ACGGCCTAGTATTTCTCTATGGGGTTCTCCGATTTTGTTTGTAAAGAAGAAGGATGGGTCCTTGAGAATGTGTATTGATTACCGTCAACTCAATAAGGCC
ACTATTAAGAATAAGTACCCTCTGCCTCGAATTGATGACTTGTTTGATCAAATCCAAGGGGCGAGTTACTTTTCAAAGATAGACTTGAGGTCGTGGTATC
ACCAACCTAGGGTGAGAGGTGAGGACATAATATCTAGATTTTGGAGGTTGTTCCAAAAAGGGTTGGGTACTATGGTGAAGTTGAGCACCACTTTTCATCA
TCAAACGGATGGTCAAGCAGAGCGTACTGTACAAACCCTTGAGGATATGCTTAAGGCGTGCATTTTTTATTTTAATGGGAATTGGGATAAGCATTTGCCT
TTGGTGGAGTTTGCCTGTAATAATAGTTTTATTAATCCATTTGCATGATTCCCTATGAAGACTTGTATGGTAGGAGGTGTAGGTCACCTATTTGATCGTT
TGAAGTGGGTGAGACATCACTTTTTGGTCCCGAATTGATTCATAAGACTTTAGAAAAGGTTCATATCATAAGGAACCACTTACAAATGGCCTATCGTCGG
CAAAAGTCTCATGCTGGTCATCTACGAAGAGATTTGGAGTTTAAACAAGGTAATAAGGTGTATTTGAAAATTTCACCAATGAAAGTGGTCGGTAGATTTG
GCAAGGAAGGGATGTTGAGTACTCGTTATCTGGGTCCCTATGAAATCTTGCAAAGGGTTGGTACGGTTGCCTGTGAATTGAAACTTCCTAGTGAATTGGC
TTCAGTTCGTCTGATTTTCCATGTATCTATGTTGAAAAAGTGTATTAGTGATCCTGAGTCCATTGTTCCTATTGAGGGTCTTGGTGTTAAGGATAACCTC
TCTCTTGAGGAAGTTCCGGTTCAAATTATTGATAGGCAAGTCAATAAGTTGATGAATAAAGAGGTGGTTTCCGTAAAGGTGTTATGAAAGAATCATCTAG
TTGAGGGTACAACATGGGAGGCTGAGGCCAACATGAAGTCCTGTTACCCTCATATTTTTGATAATTAAGGTTAGTCATTCTTTTTAATAAAATAAATATG
ACTAGAAATTGAAGTTTCTTGATTTTTGGGTAAGTTTTTTGCAAAATGTGCATTTTTGAGTACTTCACAGTGAAGTAACGGTAAGATTGGTGCTTTAGAC
TTGAAATTTTGCTTTTTGCTTGTTTGGAGTTATGTTGTGCATTTTGATATGGCGAGTCTTTATAAAATCATATGTAGCATGTCGTTAAGTTGAACTTTGT
GCAAATTAACTCATGTAATGTAAGTTGAGCTCTGAAGTGTTGTGAGAAAGAAATGTCTCATGATGAAGTTATTTGAGTCTTATGTGTGGTAATATGATTT
TTAAAATTTCATTGTTTAAATGACATGTCCCGTCGATGGGGTTACATATGTGAAGGGTGAGTTTACTGCACGTTTTTATATTAATTCACTTATTTAATTA
GGTGGTTTAGGGGTTAGTGAGGTATTAAGGGGAGACTAATTAACTAACTTAAAACCCATGTGACGTCCCCAACAAAAATTAAACTAATTAGAAGTGTAAA
ACACAAATTCTCTTCCTTCTCTCTTCTTTCTCTCTCTATTTTAACTCACTATTGAAGACTAGCAAGGAGAAGGGTTTGGGGGATGTAAAGGGTCGAATTA
ACCATCAAATTGTTGTCAAACGTTAAGGTATATGATCTAATTCACTTTTGAGACTCTTTCCTCAAAGGGTTCCTTCAAAATTAATTGCAAAAGTTGAGTT
TTCTTACGGGTTTCATGCAATTACGAAATTAAAGCTATTAATTGAGCTGTTGATGATTTCTTTAAGTTATTGAATATATTAACATGTAATTTAACTTGTT
TGTGGTAATTTTTTATGGTTTACTCTAAATTGAAGAACATGATCCTCAATCCCTTACCCAAGGTTGTGATCTTAACATATATTGTATTGTTTTTTCATTC
AATTGATTTAGTTATTGATTAGATTACTATCATGTGTTGTTATTATGAATAAATGAAGATGAATTATAGACCTATAATGCTATTTTATTGACATGTGATA
TAGGTTATAAAATATATTGTGAAATTAGCCTATGTATCTTGGCCTTGTTATCGTATTGGTTATCATTGTGAGATGAAATTACTCACCTAGTTGGGTTGAG
TTATGGGTCGAAGGTAAGACAATGATGATGAACTATGAGGAATACTAAGTAAGTCTTAGAATCTCCATCTTTACTTCCAATTGTGATTAATTGTGGTTAA
GTCATGATATTATATTGGAGTACGCCTTGTATTAGGATTGATAGGATGGTATGACGATCGAATTGAAATGTCTTGATTATGGTTGTGAAATTTATTAGGA
TGTAAATGCTATAAGGATGGTGACGTACACCAATGTGCCTTATTATGAAACGCTATGTAATGTGTTAACCTCACTTATATGAATTGTGATGAAACGACTA
TACTCATGCTATTCTCATTGAGATATTCATGATGAATATTATACAAGGGATAGATTCTATGACCTAAACTAAGCTATGATTGTTAATTAATGTCATAAAG
ACATTTCAATAAAGGGACTTGGCTTAACACCGAGTGAACTTGACAATGGGAGGTGATGACTTCCCAAAGAGGAAGATTTTCCCTATAGTTCTGTATGAGA
TGTTGATTTCCCAAAGAGGAATACTCATCGAATGGATTCCCATGAGATGAGGCCCCAACTACCAAGTGGTATCAAGAGGGAATATACTATATCTTAGTTT
TTGAACTATGTTTCCCTCATAGGAAGACTATCTAGTGGATCCACCTAGAAAGCTACGTTTGTGTTTGGTTCTACTTTGGCCGGTAGACCACCTTCCACCG
GTTTAAGGTTTTACAACACCGGATCCCACACTTAGATCATGTGGTCTATGTCGGTTAAGGCAAGTTTTCCCTAAAGTAAAATAAAGTAATAAAGTATAAA
CAAACTAAAGTGACTTATGAGGTTTAACTTAGCCTAGGTAGGGGTATGGGACTCTACGTATGTGATATACCATGGTTTCACGGTATAATTAATACTTTTT
CCTTAAGTTTAGTGTGTCCGGAAGCCTTTGTTGTGCTAATTTTGATATAAGTTTCTCTTTGTTTTGCAGGAAATCTGTCCAAAACTGAAAGCGGAGATTC
TGAGCGAAAAAATGCAGAAGAGACCACCTGCGGAGCTTATGACGGTCCGTCGTGCCTGTAACGGTTCGTCGTGCCTGTGACGGTTCGCAGGTGGCAGCAT
AGAGAAGTTGCTTAAGGAAGATGGGGAAGTCTAACCAAGTGTGGGATTACGAAGTTTGTGATGGTCCGTCATGGCTATGACTGTCCATCCTGCAGGTTCG
TCGTGAAGATCAGAGAAGTGATCCCAGTACCCAGATTCCAAGAGTTGAAGTATTTTGAAACGAAGACCCTGGACGGACCGTTGTGCCTATGACGGTCCGT
CATACTTGTCGTCGAGGGGATGAAGAAAGCAGCAGAAGAAATTGCACCAAGTATGGGACGACGGAGTCCACGACGGTCCATTGTGACCACGACGGTCTGT
CGCGTGGTCCGTCGACACAGCCGCGTTTTGGCAGATTTCCAGTAATTAGAATCCTTGTTTAATTAGGTTTTTATTTTTTTATAAATAGTTTGAAAAACCT
CATTTTTGAGGTTAGACTCTGGGAGTTTAGACATCATATTATTAGACTTTCTGTTTTAGTGTTTGATTTTTGGAAATTCTTACAAATGATTTTTGGTGAT
TAATCAAGCAAATTTTCAGACTTTATTCTTTCTCATTGAAGTAAGTACATGAATTCTTATTTAATATATTTGAATATTGTGTTTATGGCTATGAGGAACT
AAACTCCATAACTAGGGTGTGGGAACCATAGGCAAATAATGAGATAAACCCTAGCTAAAATAACAATTCTAGAATAGTGTCTTACATGTATTAATAATTC
TTTCACTTAGAAGTCTTTTTAATGGATGATCAACGTTAGAACTCGCCTTAATGCTACTTGCCGGACAAAGGAGGTAGATAATAGGAAAAAAATTATTAAC
ATAGATTTAGTGTATACTATCTAATAGGCTAGTATTGATTGGTACGAGGTAATAACTTAGTCAAATATCGAATACAATGCTTAATATGAGGTAAAGATAA
GGGTTAGGAAAGCAACACACGCAGCCGGACCAAGGTGCGCAGTGAGATTTTCTAGATGTCGGACTAAGGATTTAGAAATACATAACTTATCACTTTGCAT
GCAAGATACTAGGAAAGAATTGTTATAGTTAGAATTATCAAGTTATGAACCTATGGGGAACACGTAAACCCTAGTTACTTTGATTAATTGATTAAAACTC
GAAATTAAAAGCTGTTAAGTGTCTCTGTCAAGTTCGTTAGTTATTTTTACTCATTAGGAAATACAAACCCCCTTTTTTTATGCATTTACTTTCTTAGGAA
GTCATCAACCGAACAATAGTAATAACAAGTTGAAGTTAAGTCTAGACTATTTTCCTCGTGGGAACGATCCCAACCTCACTAGTTGGTTTATTTACTTAAC
GGGACCGCTTTACTACTCATTTGAGAAGTAAGTTTGAGCGTATCAAATTTTGGCGCCACTGCCGGGGAATTTAGCTTTTAGATTAACTTGAACTTATTAC
TAAAGTTTAGTCGATATTTTCTTGATTTTACCTTGTTTTATTGTTTTTGATTTCCTTTCAGAACTATCCTCCTTGTATGCCAAATACACGGAGAGGAAGA
GAACCCTTGTTTCCCTACGATCGCGAGCTAGAGCGTACACTGCGCAATATGAATCGAAACTTGGGAATAAATGATGAGGATCCAAACCAGAACATCCCAG
ATCCAGTGGATGTTCATGGTCAGATGTTACCCAATGCTCCGGGTGAACATCAGCAGAGGGGACAAAATCCCGTTCCACGGCCCCAAGCATACTACAGAGG
GTATGATAACATAGCAGACTCGGATGGGCCACTTGTCTTGCCCCCTCTACCCACAGGCCACACTTTTGTGGTAACTAGTAGCCTGATGCAAATTCTCACT
GTCAAAGGTTTTTTTTCAGGGCTACCTTCTAAGGATCCACATTCCTATATAGCTAAGGTAAGGGCAGTGTGTAAAAGTTTTGTGGGGAGGCCTGTTTTAG
ATCTAGATGTAATAGGTCTCAGAGTGTTTCCTCTCTCACTGATGGGAGAGGCTGCTATGTGGTTTAATGAGCTCCCATACAACTCCATTTTCACTTGGAA
CCAACTACGGGATGTCTTCTTAGCACGCTACTATCCGGTCTCCAAGAAATTAAACCACAAAGACGGGGTGAATAACTTTGTGGCACTACCAGGAGAGTCA
GTTAGTAGTTCTTGGGATAGATTCACCTCATTCTTGAGAGGTGTTCCAAATTACCGTATTGATGATGAGTCACTGAAGGAATACTTCTATCGGGGACAGG
ATGATAACAATAAAGCGGTGTTGGACACTATAGCAGGTGGATCTTATGGAGAATACCCTTATGCTGAGATTGCTGAGAAATTAGAGAAAATCTCCCGTAA
CAACAAAGCATGGAGTACTAGGAAGTCCGATACAGGGAGAAACACCTTCACAGTGCAGTCCACTTACAACCCAGCCACAGATTATATTCGTGAAGAAATG
GCTCAGATGAGAACTGAGCTTGGGTTGGTGTAATAAACCATGTCACTAGGGATGCAAAAAAGATTAATGCAGTCAACTACTTGGCTAAACAACCACCTCC
AATCGATGAGTGTTATTATGAGGAGGATTCGAATGCCATAAATGAACAGATGGGGGGTTTCCGACCAAGTGTCCAAGGCTCTAATCAGGAGAATTGGCGC
CAAGGTCAAGGGAACCAAGGTCGGAACTATGGTAACTACAATCGTGAGGGTCATTATGTCCGATATGGAAACTACAATCGCGACAACAACATCAATAGGG
GTAACTATGGTAATAGAAACGACAAGAATGGACCCTATGTTCCTCCTCAAAATCTTGAAGTTACTCCTAGGGATGGTGGAGGTAGTATGTCGCGAGTTGA
GGATATGTTGCATAAAATGATGAGGAGGTTTGATGCTAGTGATGAGCACAATAAAGAGTTGACGAATGATTTAGCGGGTATTGGGCAAAAAGTTGATACA
CATGCAATATCGATTAAGCAACTTGAGTTACAATTGGCCCAATTATCTGCAACCGTGAACACACGGCAACCGGGCACTCTTCCTACCAACACTGTCCAAA
ATCCAAAAAATGATGGACATTGTATGGCAATTACTACTCGCGGTGGCAACCAAACCATTGACCCACCTATGCCATCTAATGGGAATCAGGTTACAAAAGA
TACTGATAAAGTGGTAAATGTTGATGCTAATTTAGAGGATAACATTGCAGAAGATGCTGAAGTGCCTAAAAAGGTAACTCCCATGCCTAGGCCACCACCC
CCATTTCCTCAAAGATTAGTGAAAAAGACTGAGGATGGAAAATATTAGCGTTTTATAACAATGTTGAAGCAACTTTCTATCAATGTCCCTTTGGTAGAAG
GTTTAGAACAAATTCCCGGTAATGCCAAGTTTATGAAAGATTTGGTCACAAAGAAAAGATCGGTTACTTTTGAGGATGATGATAGAATGCAGCATTGTAG
TGCTATTTCTACAAGATCTCTGGTCCTAAAGAAAGAAGATCCGGGTGCGTTCACTATTCCTTGTACAATCGGGCTATAACATTTTGCGAAAGCATTATGT
GATCTGGGGGCAATCATAAATCTCATGCCCCTCTCGATTTACAAGAAGTTGGGTTTGGGTGACCCAAAGCCCACTGCGATGCGACTACTGATGGCTGATC
GAACAGTAAAACGGCCCATAGGGATACTTCATGATGTGCTAGTAAAAGTGGAGTCATTCATCTTTCCGGACGATTTTGTTATTCTTGATTGTGAGGTTGA
TTTTGAAGTGCCTATTATCTTGGGAGGACATTCCTAGCTACGGGAAGAGCCTTAGTAGACATGGAAAAGAGGCAAATGAAATTTCGGTTGAACAATGAGG
AAGTGACCTTTAATATTTGTAGGTCCATCAGGCAGAGTGGTAAGCTCCAATCGGCATCTACTATATCCTACAACATGGGTGAGACATTTGAGACACAAAT
AGAAGAACGTGTAGGTGTCGAAGCATTAGTGGCAGTGATAATGAACTTTGATAGCGATTGCATTGAAAAGTATGAGTCATTAGTCGCGGCTCTTGACCGA
GGTGATGTTCGATTTAAACCGAAGAAATTTGAGCTTGATATGAAGAATCGCGAGTTCCCACCCGCTAAACCATCTATAGAGGAAGCTCCAAAAGTTGAAT
TAAAAGGTCTCCCACCTCATCTTAGGTATAAATTCTTAGGAAATGGTGACACTTTACTGGTAATCATTGCATCAGACCTGGATGAACAACAGGTTCAGAG
TTTGGTGAAGGTACTAAAAAGGTTCAAAAGAGCTAATGGGTGGACCATTGCGGACATTATTGGGATCCCTCCTGGTATTTGTTCTCATAAAATCCAACTC
ATGCCTGATCATAAGCCGAGTATTGAGCACCAGAGACGCTTGAATTCTCCTATGCAAGAGGTTGTGAAGAGGGAAATCATCAAGTGGTTGGATGCTGGAG
TAATCTATCCAATCGCTGATAGTAGTTGCGTATGCCCGGTTCAGTGTGTACCTAAGAAAGGGGGAATGACTGTGGTCCCCAACGAAAAGAATGAACTTGT
TCCAATGAGACCGGTTACTGGATGGAGGGTGTGTATGGATTACCGTAAACTGAACTCATGGACTGAAAAAGACCATTTTCCTATGCCCTTCATTGATCAG
ATGTTGGATAGACTTACCGAAAAAGAGTGGTATTGTTTTCTTGATGGGTATTTGGGGTATAATCAGATTTCTATTGCACCAGAAGATCAAGAGAAAACCA
CTTTCAGTTGTCCATATGGGACTTTTGCATTCAGAAGAATGTCGTTTGGGTTGTGCAATGCACCCGCAACCTTTCAGAGATGTATGATGTCAATATTTTC
TGACATGGTGGAGGATACTATAGAGGTTTTTATGGATGATTTCTCTGTGGTTGGTGATTCATTCAAGTGGTGTTTAACAAATTTATCTGAGGTTCTTAAG
AGATGTGAAGACTGCAATTTAGTACTAAACTGGGAAAAGTGTCATTTCATGGTGAAAGAGGGTATTATGTTGGGTCATCGCATTTCAGAAAAGGGCATAG
AGGTTGATCGATCTAAAGATGAGGTAATAGAGAGACTTCCCCCGCCGATCTCTGTGAAAGGTGTGAGAAGCTTTCTTGGGCATGCAGGTTTTTACCGAAG
ATTCATCAGAGACTTTTCAAAGATTGCACACCCATTGTGCAAATTGCTGGAGAAAGAATGTAAATTTTGTTTTGATGAATCCTGTCTTAAAGCATTCGGT
GAGTTAAAAGAAAAGTTAGTGTCTGCGCCTATCATTATTTCTCCAGATTGGAACAGTCCATTTGAGGTAATGTGCGATGCTAGTGGGGTGGCTCTTGGTG
TAGTATTGGGACAGAGAAGAAACAAAATCCTTCACCCAATTTACTATGCTAGTAAAGCCCTAAATGAAGCTCAGAAGAACTACACAGTGATTGAGCAAGA
ACTCCTCGCAGTAGTCTTTGCTTTTGAGAAATTTCGCTCCTATTTGCTAGGTACTAGAGTTATAGTGCATACTGACCATTCAGCATTGAGATATTTCATA
GCGAAAAAGGATGCGAAACCAAGGCTGATTCGTTGGGTGTTACTGCTGCAAGAATTTGACTTTGAAGTGTTGGATAGAAAAGGGACTGAAAATCAAGTTG
CTGATCATTTGTCTCGTCTAAAGGATGAAGCTATGAGAGAGTTAAGGGATAAGAATGACATTAATGATACTTTCCTCGATGAACATGTATTGGCTGCTTC
ACAAGACTTGATTCCATGGTTCGCAGATTTTGCGAACTATCTGGCTAGTGATATTGTTCCATCAGACTTGTCCTTTCATCAAAGGAAAAAGTTCATGTAC
GATGTGAAGAAATTCTTTTGGGATGAACCATACTTGTATAGGAGTTGTGCCGACGGGCTTATTCGGCGTTGTGTGCCAGAATGTGAAATGTTGAGTGTGT
TGGAGGCATGCCATTCTTCACCTGTTGGCGGACATCACAGTGGTATCTGAACCGCTCACAAGATATTGCAATGTGGTTACTATTGGCCAACTCTTCATCA
ATATGCTCATGGGTTTGCTAAAGCATATGACAAATGTCAACGAGATGGTGGTATTTCAAGAAAGCAAGAGCTCCCTCTAAACCCCATTCTTGTGATTGAG
TTATTTGATGTTTGGGGTGTTGACTTTATGGGCCCTTTCGTGAGTTCTCATGGGATGAAGTACATTCTAGTAGCAGTTGATTATGTATCTAAATGGATCG
AAGCCATAACCCTCGCAAACAATGAAGGGAAGAGTGTCACTCCATTCTTGAAAAAGAATATATTCTCCTGTTTTGGCACCCCAAGGGCCATTATTAGTGA
TGGGGGCTCCCACTTCTGCAACAGATTGTTCAAGGGGTTATTGGAGAAATACGGGGTTTGCCATAATGTGGCCACTCCTTACCACCCTCAAACTAGTGGG
CAAGTTGAAGTATCGAATCGGGAGATCAAATAGATATTGTCCAAAACAGTGAATGCTAGTAGAACGGATTGGTCAAGGAGACTTGATGATGCTCTTTGGG
CCTACCAGACAGCATATAAGACTCCCCATAGGTATGTCTCCATACCAAATTGTATATGGGAAAGCTTGTCATCTTCCGGTTGAGTTAGACCATAAAGCCA
TGTGGGCTATGAAGAAGTTAAAAATGGGTTGGAGCAAAGCTGCAGAGCAACGCTTAAATGGGTTGAATGAACTTGATGAATTTCGCTTAAAAGCCTATGA
AAGGTCAGCCCTATGCAAAGAAAAGATGAAGAAGTATCATGACAACAAAATTGAAAAACGAGAGTTTATGGTGGGGGATTTGGTGCTTTTATTCAATTCC
AGATTGCGCTTGTTTCCAGGCAAACTCAAGTCCAAATGGACTGGTCCTTACACATTTACCCAACTATTGCCTCATGGAGCAGTTGAGTTTGAAACTAAGG
AGGGTGTGCGGTTCAAGGTGAATGGACAGCGCATAAAAATCTATCTCGGGCATGCTGAATCGGCGAATGAAGTAATCGAGGCATACCATCTTGATGAAGT
CTGAGTAATCAAGTGGACCCAGTCGTGCCGCGACACTAAATCAAGCGCTTGTTGGGAGGAAACCCAATACTTATCGTCTTTTTAATAATATTAGCATTTT
TCTATTAATGGGTTTTAAATTTGCAGGCACATCACCAGGAAATTCTGCAGAAAACTACTCCACAGCAGCCACTAACGGATACATCGATGGACCCTTGCGC
AAGCGACGGACCGTCGTATGCTTCCGTCACACCAGGTATGTTTTTCTGTCTTTTTAAAATTAGAGCACACACGACGGAACCTATGACGGGACGTCACAAG
TGCGACGGACCGTCGTCGGGGAACCGTCGCGCGATTATTGAATTCTACCCGACTCGACTCGGCTGGACCCTTTTCAAAATCTTATCGTTTATACTCCCCA
CCCCTCCATATCTCACCCCATTACATCCTTATTCCTCTCATCTCCCCTCTCTTTTCAACTTCCACACTTCCCCTCACTAATCATTGCTCCCAAAATCCTC
CTAAGCCTTATACTTATCATCTACTAGTCGGTGCTGCTGCTGTCGGTGTCTACCTTGCCAATTGAATCATTCTCCGTTTGTCTTTTCTCCATTTCCAAGG
TATTTGTCTCTACATTTCCATTTATAGTCATTTATCTTGCTTTTTGGTTAAGTAGTTAGTATTAGCTTAGTTCTTAGTCGTATACTGTTTCCTTTATATG
CTTATGTCTAAACCTAGGCTCAAAATGTTCGAATGTGCCATGTTGATAACCCTAGGCATAGGTGATTGTGCATTGGTAGTTTCCTAGGTTGTTGGGATAG
ACACATATAGGTTCACAACACTAAAAGACCATGTGGGTTCATCGGGGATGCATCAGGTACCCCCAGTTCTAACACTGCTACTCAGAACGAGACCCTGATG
ACGGGCCGTCGCACACACGACGGACCGTCATAGGGTTCGTGTCAAAAGCCCTAGCACCCTGTCCCAACGACGCCTGTGACAGACCGTTGTCTTCACAACG
GTCCGTCCTACACAACCATTCTGGTTGTCAGAGAACCTGTTTCTAAGGGTCTCTCAAAATTTTCTAAGTGTCCTATGACGGACCATCATACCCACGACGG
TCCATCCTACGCGACCGTCATGATGGTCAGACCCCTCTGCTAAGGGTCTCCCAACATTTTCCAAGTGTCCTACGACAGTCACTTACGACGTACCGTCGTC
TCCTCGACGATCCGTCCTGCACGACCGTCATGATGGTCAGAGACCCCTCTGATAAGGGTCTCCCAAAATTTTCTAAGTATCCTACGATGGACTCTTTTGA
CGGACCATCGTACCAACGACGGTCCGTCCTGCTTGACCCTCATGATGGTCAGAGACCCCTCCTTCAGGGTTCTTTATATATACATAAGCTAAGTACAACA
CGACGGACCTCATGACGTTCCGTCATATCCATGATGAGCTGTCATTTAGCCCGTCGTGTGATACAGTTTCACTTTCACTAACACACTATTTTAAATGTTT
TATGTCGTATGGGCTTGCCTTTCTTGTTTGCCACTACTCGTACTAATAGTGATCCTTTGCAGGTACTATCTACTATGGCACCCAAGCAAGACCGAACCTA
CGCACGCGGGCGATCCAAGTCTGTTGCCCCGTCTGCACGCTTGATCATCGGCTCTGATGATGAGCGGGACCCTGAATATGTGCCCCAGGCACTTCTGCAC
CTTCCCGTGCTGCACGTGCTCCTAGAGCCACACCCAAGACGGTGGCGTCCGGTGTAGTCACTGCCTCCCAGTCTGATGAGGAGCGCACACTGACCGGCAC
ACCCTCTGGGTCAGCCACAAATGAGGAAGGAGCGTCTGGCTCCTTAGGAGTATCATGGTCCGAGGAAGCTACAGGCTCTGCTGAGGTTCCCGCACCCGCC
ACTGCTGCAGCGTCTACCTCGTCTGATGAGGCTGACAGTTCAGACTCTACATTCGGCGCACCAGCCTAGGTCCCCACCCCAGCCTCTGACCAGCCAAACC
GGTGGTGTATCGAAGGCCAGTTTCAAGTTTACTCCTACGCCAAATTCCTGACTAATAAAGGAGTAATGACTCGGACACTCACCTTGGAGCGGCGGGTACT
TACAGGGAGTGTCCCATCGATGCCGGAGATCCACAACCTATTCACCAGGCATCCCTTAGAGTGGACAACCCGTCCGTTGGGACGATACAACGAGGAAATT
GTCCGAGAGTTCTACGCATCCTATGTAGCGACTCTCCGATCACAGATCGATAGGTGGGCTGCTCCCGCTAAACATGCCCCACTGGAGCGGGTTCAAGTCC
GGGGCGTGCAAGTTGACATTTCCCTGCCAGCTATCGGCCGGTTCTTATACGGCGAGAGTGTAGATGCTATGCAGAATCCCCACACTGCCAAGTTTGACTA
CCGCTGGCAGATAGTGAAGGATGGCCAGTTCTTGTGCGAGCAGGCACTGAGAGAGACCACCAAGAGGTGGATGGCCCTGCACCTATCAGTCGACGGAGAG
GGTGCAGATTGGGTCACTGAGCCGAAGGGGGCCATCAAGAAGGCAAACCTCACGTTCATCGCGAAGTTCTTGTGGCTGCTCGTCCATCACTTCCTTTCCC
CCACAGCTGCTGATAACATCGTCACCGGGGATCGAGCAGTGTTGATGGTGGTGATGATAGCCGGATTCCAGGTAGACTTTGCATGGCTTCTCCAGGCAGT
CATGCACGAGAGGCATTCAAGGTCACTACTACCTACCCATTCCCGTGTATGATTTTTGCCCTTTGCAGGACCGCAGGTGTGCCCATATGGCACATAGATC
AGTTGAAGACCCCGCAGGGCACCGTTGACGTCGGCCTCATCAGAGACGAGGCCAATGAGTTGGCCCCACGTCTAGGGCCCCATCCAGAGCTGTCACCACT
TGCTGATGATCTTGCGGATACGGTGGCCCTGGCCCGCACCGCTACACAAGCGTCCACTGAAACTACCCCGGTCGAGTCTATCTCGGGTAGTAGCCCAGCC
CCGAGCTCCTCTCGCACAGCCCCTCTACCGACACTGGTCCCGCTTGCTAGGGTCCAAAAACTGGAGGCACAAATGGCCACTCTTCTGCATCATATCCAGC
CGTGGATGCAGAAGTCGATTACTGAGTTTGAGGTGCGGCTAGAGAGGAAGATGCAGCAGTTTACCGAGCGGAAGATTGCTGAGGTTAACCAGCGCCTAGA
TGCATTTGAGTTGAGAGTGTTAGCCCGCCCAGCTCCTCCGGTAGATGTGTCAACTCTTCAGGCTGCAGTGGACAGTCTTCGTGCAGACATCGACACGATC
CTAGAGGCGAGAGTGCCAGAGCCTGTCGAGCCTGCTGAGGACACTGTATTGGCGGCCCTGTTTGCTACTTCAGAAATTCCCCCACCTTTCCCTCGAGAGA
GTGCCAAGAGGCGTAGGGGTCGATCAGAGGATGAGGCGCCACCAAGGAAGAAGGAGCGCCGAGAGATTGAGGCCGCGAGGAGAGCCTCACTTGCTGAGGG
GGAGGCACACCAAATCAGAGCATCGCAGATAACGGCTGGGGCGTCTAGGTCCCGCACTGTAGAGACAGCAGAAGGCACTACTGATGGTGTGGTTGTTGCT
GAGGACATCACTGAGGGTGTCCAGATTGCTGAGGACACCACTGAGGGTGTCCAGATTGCAGAGGATGTCAGTTCCGGGAAACCGGACCCACCAGCTTGCT
GATCGATGGCGCTATGTGCCACAGGTTTGCTTAATCTAACCCTCTAATCTTTAGATTTTTTTTATGCATTGGGGACAATTGCATGCTTTTTTTGTTGGGG
GTGGGGTAAATGGAAAGTGAGTGTTAGGGTGAAGTCTGAGTAGCCCAACTCACTATCCTCTTTTGGGATTTTCTTGCCTGTGTTCTTTTTCCCCAAAAGA
CTGATTACTTTTTCTGTTGAACCGGCACGTTATATCTCTTGTACATAGTTTAACTTTGAAGCATGATGACTAAAATGATATCCTGATAAAACTGGAAAAT
ATTGCATGACTAGGCGTAGTAACTCATAATTGTGTGGCTCTAAACATGAAATAGAGTTACACCATTGCATTACCCTAAATCTTCAAGTCAAACTAGGTGT
TTGTTAATCTGGTATAGTGATGAGATGTCAAGTAAGTGTGAGGAAATTTAAATAGTCCACTACTGGTACTGAGCTAGAACTTGCCTAGTTAGTCCTGCTA
AATGTAAGCTGTAACAGACAATTAGGAAAGGATCATAGGCCCTTATTCACGATAGCCCATTTCTATCCTAAATAAAAGAAACCAAATGAAAGTTATCCTT
CTTTGATCCAAATAATTTGAGCTTAAAATTAGACCTTTCTTTTTCACCCCAACTAATCTTTTCTGGGAACAATATGTTGGCCCTGGTCCCTCCTTGGACA
TGTGCACCTCAGCTTATGCCAAAATCATATGTTGAGGATGGCTAATGCATAAACAACCTTCGTTATGGCCCTGACCCGACTTTGGGTATTGTGTACCTTG
ACTCATGGCAAAGCCATGAGTTGAGGGTGGCTGTTTTGAGCAATGCTCTGGAAAGTGGGTTTGAAAGAACAAGGAGAGAGAAAAAACAAAAGTAAAGTGA
CTCAAGAACTTGTTGAAAGAAAAGGAAAGGAAAAGAGAAATATTCAAGAATTACAAACAAGAAAAGAAAAGAGTCACTTACACAAATGAAGAAAGAAGGG
AAATAGCAAGGTGAAAGAATAGGAGAAACTGGGCGAGATAAAGTGATAGAAAGTGGAAGGTTTAGCCGATATGTCAAGGAGGGCAAAAAGTCACTAAAGT
ATACCTAAATATACCCTACCTGACTCTGAGCCTACGTTACAAGCTAAAAAAGTCCTATCGTGATCCTAAGGGTTGTATAGCGAACTTAAGACAGTGAAAA
TAAGGGAAAGCTTATGGCAATAGGTATGAATGAGTGTGACTTTGTTCTGAGAGCGAGTGTTGAAATGTAATCCTTATACTCAAACATAAATCATTGTGTG
AAAAATGAGGATTTTGTTCTAAACTGAGGACACTAGTTGCAATACCAGAATTGTTAGCACCTCGGTGAAAAATTGAATAGGATAGTTGTTAGTGCATGGT
GAGTCTGTGTCATGTTCGAATCCCAGAAAATTCAAGCCTAATAGTGATAGCATGCATAGATTTGATGAGATTAATCGGGATTGATAGCCAAATGATTGCA
AAAGATAAAACCTGAATGCTATTGTACAAAGATTGTGTAGTGAGTCATAGTGCGTCGCTTGAGGACAAACAACAAACTTAAGTTGAGGGTGTTGATATAC
CGTGGTTTCACGGTATAATTAATACTTTTTGCTTAAGTTTAGTGTGTCCGAAAGCCTTTGTTGTGCTAATTTTGATATAAGTTAATCTTTGTTTTGCAGG
AAATCTTTCCAAAGCTGAAAGCGGAGATTCTGAGCGAAAAAATGTAGAAGAGACCACCTACGGAGTTTATGACGGTCCATCGTGCCTGTGACGGTCCGTA
GGTGGCAGCATAGAGAAGCTGCTGAAGGAAGATGGGGAAGTCTGACCAAGTGTGGGATTACGAAATTTGTGACGGTCCATCATGGCTATGACGGTCCGTC
CTACAGGTTCATCGTGAAGATCAAAGAAGTGATCCTAGTACCCAGATTCCAAGAGTTGAAGTATTTTGAATCGAAGACCCTCGACGGACCGTTGTAGGAA
CAACGGTCCGTCATACTTGACGTCGAGGGGATGAAGAAAGCAGCAGAAGAAATTGCACCATGTATGGGAAGACGGAGTCCACGATGGTCCATTGTGACCA
CGACGGTCCGTCGCGTGGTCCGTCGACCCAGCCACGTTTTGGCAGATTTCCAGTAATTAGAATCCTTGTTTAATTAGGTTTTTATTTTTTTATAAATAGT
TCGAAAAACCTCGTTTTTGAGGTTAGACTCTGGGAGATTAGACATCATATTATTAGACTTTGTGTTTTAGTGTTTGATTTTTGGAGATTCTTACAAATGA
TTTTTGGTGATTAATCAAGCAAATTTTTGGACTTTATTCGTTCTCATTGAAGTAAGTACATGAATTCTTATTTAATATATTTGAATATTGTGTTTATGGC
TATGAGGAACTAAACTCCATAACTAGGGTTGTGGGAACCATAGGCAAATAATGAGATAAACCCTAGCTAAAATAACAATTCTAGAATAGTGTCTTGCATG
TATTAATAATTCTTTCGCTTAGAAGTCTTTTTAACGGATGACCAACGTTAGAACTCGCCTTAATGCTACTTGCCGGACCAAGGAGGTAGATAATAGGAAA
AGAATTATTAACATAGATTTAGTGTATACTATCTAATAGGCTAGTATTGATTGGTACGAGGTAATAACTAAGTCAAATATCGAATACGATGCTTAATATG
AGGTAAAGATCAGGGTTAGGAAAGCAACACACGTAGCCGAACCAAGGTGCGGAGTGAGATTTTCAAGATGCCGGACCAAGGATTTAGAAATACATAACTT
ATGACTTTGCATGCAAGATACTAGGAAAAAATTGTTATAGTTAGAATTATCAAGTTATGAACATGTAGGGAACACGTAAACCCTAGTTACTTTGATTAAT
TGATTAAAACCCAAAATTAAAAGCTGCTAAGTGTCTCTGTCAAGTTCGTTAGTTATTTTTACTCATTAAGAAATACAAACCCCCTTTTTTTTATGCTTTT
ACTTTCTAAGGAAGTTATCAACCGAACAATAGTAATAACAACTTGAAGTTAAGTCTAGACTATTTTCCTCATGGGAACGATCCCAGCCTCACTAGTTGGG
TTATTTACTTGACGCGACCGCTTTACTTCTCATTTGAGAAGTAAGTTTGAGCGTATCAGTATGCCTTGCACTAGTTTAGTTTGATGAAAGCTTTAAGAAG
TTTATATTATGAATGCATATGATAATAATGTATATTATGATAATATGTTGATGTTACAATGTAATGTCTATATATGATGATGAATATCCTCTTGATATAT
GTAGTTGGATTATATAGTTATAGCAGGACATTGGTTATGTTTTCTTATTAACTCAACTTGGTTAAGGAAGGTTATAGGGCATTGCTTGGTAGTTGTCTTG
TATACTTTGTAAGGATTAATGAGTAGTGGTCTTGCTTATTATTATATGATTGACTATTATTCATTCTTGTGATGTTATCTCTTGATATAGGGTTATAGTA
AATTATGGTTTTAAGTATGTTGGAATACGTATTACTAGTTCAGTTAATAAGCATGTTTGGTTGGTTGATATGACTTGCTTGTCTTTGCATTAGGTTCTTA
AAAGGTTAAAGTTGAATTTTTTGACTAAAAGTCCTTTTTTAGCACGTTTTGTTGTATATGTGCTTAAGGTCTCATAATTCGTACCTATGGATTACTAACC
CCATTTTCTTCTCTTTTCCCAAATATTTTAGGTTTCGGTCATTGAAGAGTTTGGAAACGAAATTGTTTAAGGCTTTGATTCTTCATTTCATCCAAGTAGG
GTATTTCCTCAACTTTCGAGGGCAATGCCACTATTTATATTACGAATTTGTTAAATACTTTTTCATTTCTTTCCTTTTCAATTGAGTTCTATACTTTTTG
TATGACCTATATGTGGTCTTGTTCAATTGATGTAAGGGCTATGTCTATATTGTGATAATCGTTTAGATGGTATGAGATGAGACAATCTTTGAGACTATTT
TTCTATCTTATATATGTATATATGCAATAAAAGTAGAAGACTATGTAACCTTCCTCTATGAAAGGGTCTATGTATACTCGATATGACTATAAATTATGTG
TATGTAATGGTCTATGTAACCCTCCAAGTAGAAGTTTTCAATTTTTCCGCATTTTTCAACCTATGAATGTAACGAGATTAGACTAAGAAGCTAGTCTTAT
TCTTTAAAAAGGACGTTGATGCTGGTTACGTCGAAGGGGTAAACCCAATTGTGACACATATAAATCAACACAATTCAATGTACATTCTAAGCTAATTAGA
GTAAATAGGTCAACTTATAAAATACCCAAGCTAATTAAATTCTTGATCAATTTCCAACAAATTATAATCAATTGATATAGAAAGTACTAACAATAACCAA
TTCAATACAATCTAATAACAATTCTATAGACATCAAGTCATGATCACAATACCCACATTATAGACTAATTTGGGAAATTAGGAGGATCATGGGTTATTCA
TAATATTGATAATAAATTCATCATAAAATATGTATATAAACATATATTCATCATTAGGATGCTTTTGAAATAAATTTGAGAATGAACCCATGGCTAGATT
GAAAGATATGATTCTTGACTTAAAATTTATGTTTTGCAAAACCTTTGAATGGACTCCATAGATGAATGATTATCTATGGATTAAGGATCACCATACATTA
TAGATTAAAAATCCGATGAAAATCTAAGAAGAAAACTCCAAGTATCCAACTCCATAGCTTGTTCTTGAGTTTGGTCTTCAATGGAGGTTTTGGGATTTTT
GGAAGAGAAGAGAACTTTGGGAATTTGATTTATTATTGGGTATTGGGGTTTTAGCTTGACAAATGTTCCAAAAAGGTCCTAAAATCAGTTAATAAAACGT
CCCCTAAGTTATAAAAATACCCTAAACGAATTGGGGCCTTAGACATGTCAAAATTGACTTAAAAACTAAGCAACCAGATCTGGGAGTTGGCTGCGCGTCG
CGGGGAAGCCTCCTTGTTCTGCCCCAGATAATTGTTGGGATAGTGAGGTGCGTTCTAGGAGTGCATTGCGAGGGAAAGGTCTCATTCTTATTCCTGCACG
CTGCCTTGGGCAGCGTCTTGTCCAAGGTTTGGATCCTTCTTTGGGTTCGGGTGGTCCCCGGGTAGTCGTACCCGGATATTTAGACCCTTAACATGCCTAT
TAAGGTACTAGGGTCAACTATACTGCTTCTAAACTCCAAACTACACATAAAATCAAACCAAACATAAAAGGGGACTCACTAGCACATCTAACGACCAACT
TCCTAACGTCTTGGACGTTTGACCTCAAAATGACTTCAAATCAAATATGCGTACTATAAAACACTTTATTAACATGTTATTAACCTTTTTAGGCACAAGT
GAGGCTTTAGATACCTTATATCACTTTGAGTACGTGTAAATAGTCCCCCACTTAGGACAATATTCATCCTCGAATGACACTGAAACATTTAAAACACTCT
CAACGACTCAATGGCTTCCATTAAAGCTCACAACACTTCAACATGTTATCACTTAAAAGTCAATGCACCAAACATACAAGAAACACTAACTTATTTCTAG
CATGCAATTAAAGCAACATAATCAAGCATGGACTACTTCTATAACTCATTTCATGCATACATAATTGTTCATATTTATTGCTATATGGAGGAACTACCTT
CTACAATTTTTTTGGCATGTTCATTATTTCATCACAAGGTTAAACATACTATGGATTCCAATTGCACACTTAGGCATAATCAACACTTCAACTCATGAGA
AAATTTAAACACTTCATTTAGTTGCACAAGAATCATTAATAAGGTAGATTAACTACAATCTTATAGTCTAGACATAATACCATTGAGGTCATATACCTTG
CTCAGCTTTGTTAAAGGAGGAACTACCTTCTCCTATTAAAAACATACACACATGGCATAATAGAGTTTACATAAAAGCAATGCATAGATATAGTTCATAT
TAAGAACGATTTCTTTACTCCAAACCACATGATGCTTATACTTCCTTCCCTATGAAGTCAACATGGTAGGTCACACCAAGCACATTACAACATTAGGATG
TAAATTTACAGCTTTCCGTTTCTAGCACATCACTTGCTTTCATAAACATGCATCATTTATGAAAATTTATCACATTTTATAGGATCACAAATAAACATAT
GTTTGACTAGCCATCACTTCTAAAGAGTGAGTCTATAATAACACTCCCCAATTCTTAGAAGTTACACATTTTTCAAAGAGACTCACCTTTTCATATTTAA
AGGAGACTTCATCCCTCATGGTGAGGATTAGGAACCACAAATTAAAGTGACATAAAGCATGCTCACAGATCTATCTCATGAAGTCTAATTGCACATTTAT
CATATAAGGAGGCACAGCAACATGAGAAACATGCAAATTTATCAAAAATTCCTTTCTCACGCAATAATGACCTTTCATAATATGAATAATATATTGTCAT
TTAAGACATTAATGGCATATGGAGAACATACAACTTATCATTTTATGCAAGACTCCTATCATGTACAAGCTACTTAGGAACTCTTTGTTTTCAATCTTGA
GTAAGAATTGAAGGAACATATAGGGGCATCTACCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGACAATAATAAATGTTCACATGGGAAGAAATACCTGACTTATAATTCTCCCGGCAGCAAAACA
TGTGCTGGCAGTAAGATCTCATAATTTACTTTATTGGAGCCAACATTATATTGTCCCTAAAATCTTTCATCTTTTCAAAATTATAGAATTGCAACGTCTC
CAATTTTCTTATAAAATATTGACATCTCTAAGATTTAATCTAGTTATTACGTTATTGCAAAAGTTTGCTAAGAATATGAGTTCAAGCCTTATTAGCATTC
ATAATTATTTTTTGATTATAATACAAATATAAAATATCGAATCAAATTTTTTTTAATAATATTTGCTCATGTCAATACAGCGTTAGAACTCCAAAGATAA
TGCAGCGATTAGGCTAATACCAAAATTGCTCATAAGATACATAGTATTAACTAACTTTAATAACTCAATTAGTCAAAAAGAAGTAAAAGGGTAAAGATGG
AAAAAAGTACAAATACCCATACACCTCATCTACCAATCAATCAAGGTTACTAATTCTTGATTTGTTTCAAAGAATTTATGTATCTGGTAAGCCCAATTCA
AACCCATAAACTGAAAGTTCCAATTTTTTTTTTTGGTCATGATGATTAATTTTGTCCCCTTTTTTTCAGAAGATTAATGGTTTTCAAGAAACTTGTATTG
ATGATGATGGGTTGTCTAGGATGTGCTGGTCAGCCCACAGAGCCTTCTACTGAGAAAACTGAATCTAAATCACTTATAAATGAATCTGTTGTTGTCACTT
CACCTAGGGTTAAACTTGGTGATGGTAGATATCTTGCTTATAGAGAAAGAGGGGTACCCAAAAACATATCCAAATTCAGAATCATCATTGTTCATGGCTT
TGGCAGTTCTAAAGAAATGAGCTTTATGGCTTCTGATGTATGTAGATTCTCTTCCTCTTTCAATTTTTTTTTTTGATTTGTATCTATACACCATAGTTTC
TTGATTTTGAATATTACTTTTTACAGTTTGAGACTGATACTGGTAGAGAATTGTGAATTTGGTACCAATATCATAGATTTGAAGAGAAAGGGTTGAAATT
AATAGATCCATAAATGGTTGTTTTTTTTTCAAGAACAATTGAACTTGGCATTACCTGGTTAGAACTACTGTTTACTGTGATAATTGAAGTGACTTAAAGG
CAGAGTAAGTAATTGAAAATTTCTTCTGCTTTGTGTTATGTGGCGTGGAATCCAAAAATGCACTACTTTTGGAGGATCTGACATGCAGTTGGAGATATTT
TTTGAGAGTCCGAGCAACATTGGTTTTGTGGTTAGCATATTTAGATTCTTTGAGGGAGTGGGGAAGTGTGTTCTTTTTGTGCTAAGGAGATGTTATTCTT
CAATTAGGTTGTCAAAAAATGTCTAGTTTAGGATGATCTAATATTGCTCTAGCTGCCAGGAACTTCTTGATGAATTGGGGATATACCTTTTGATCTTTGA
TAGAGCTGGATATGGAGAGAGTGATATAAATTCAAAAAGATCACTTAAAAGTGAAGCGTCTGATATTGAAGAGCTAGCTGATCTGTTGGAATTAGGATCC
AGATTCTACGTAATAGGTGTGTCGTTGGGATGTTACCCGGCTTGGAGTTGCATCAAGCACATTCCTGGAAGGTTAGAGAACTAACTTGAGAGCTTTTAGC
TTGTTGGCTTTACTGGTTAAGGTTTAGGCCTACTAGATTTTTCTTTTGAAGTATAATCCATTGCAGGCTTGCAGGTGTTGCTCTCGTCGTTCCCTTTGTC
AATTATAAATGGCACACACTGCCTAAGGATCTAGTGAAGAATGATTACAGGAAACAACTCTCTCGGTGGGTAATTTGGATCACATGTTATGCTCGGGGGA
TATTACATTGGTGGTTGACTCAGAAAGTTTTTCCATCAGCGTCTGTTCTTGATGGAAATCCTCAATTTTTCTGTGAGAGAGACTTGGAAGTCTTGAAGAA
TACACCGGGATATCAGTTGTTCACTCAGGTAATGTTCCATTCAGACAAAAAAAGAACACATCCTGTATGATCTGCTGTATCCGAATCGCTATTCTGGTTG
TTGGCAGTAAAAGTCACTCACTACATGTTTAGGTTCCGTAAATATGATAAATTTGATCAGAAGCTGTACATTAATTTACAGGATGGCCTTAAGGACCGAA
GTATATTTGACTCCCTCTGTAGTGACGTTATTGTAGCTTTTGGAAAATGGGATTTTAATCCGTTGGAGCTAACTGACCCATACCCTCAAAATGAAAGCTC
AGTTCACATCTGGCAAGGTGTCAAAGACAAAGTTGTGCCTGTTCAATTACAAAGACACGTCTCGCAAAGGCTGCCCTGGATTCGATATCACGAAGTTCCT
GACTGTGGTCACTTGCTTGTGTATGAAACTGCAGTGTGTGAAGCTGTCTTGACATCACTTTTGCTTGGGGAAGATCCTCCATTATACAAGCCAAAGTTAG
CAGATCACTAAGTATTTATACCCTGTAAGTAGATTCATTCTTGAAATTAATTAATACAAGTGTGATTGATTTGCATTGTCTTCATAAACTTTTTGAGGTA
TTTCAACTGTACTAGACATAGATATTGAAACATAAAAGGGAAAGGGGAGGAGAGAAGGATATCTTTAAGGCGGCGAGACTTGCTATTACGGGTATCAGCT
TTCATTCAATAATCTTGTCACAGAATGATTGACACCCCCCTCTCTTACCTACATCTAAACTGAAAATGAAGTCAAAGGGATTGAGTCATGTAGATCTGTG
TGCTGTTACAGATTCATCGAGTTGGATGCATACTGCTGAATAACTTTACTTGTTTTCATCTAAGGTGCATCGATTTGCAACAAATAGAAATCAAACTCCA
GTGTGGAGATTGCTAGAATAGTTTTGATATTTTTGTATGTATTCAAGAAGAATTAAGACAGATAAAGTGACTTGGTTGAGTTTTTTCTGCAAATAGAAAA
ACTTCATTCTTGAGTCTTGATTGTTGTTTTGTTTCTCTCTCTTAATCAAGTATTGGTAAACAGACATGTTCCATGAAGGATTTCTTTGAATGAGCAAAGA
GAAGGCCTTGAAATGTTATGTGCCTTATATATCAAAACAAGAAACGCAAATTATATAAACCATATCACTCACTTTCATGTTTCTTAAAGCAACGAGTTGA
AGTTTTACATAATGAATCCAGTGGTTGACATCTCGATTGTTTAATAAGATAATATGACTCCGCTCTTTGGCATGTTAATAAAGAATTGGTTCAATGTCAG
ATCAATTTGAGAGTGAGCCTAGCTATCACACAGGGGCTTGCTCGCAAAACTAACACTACCATAACGCAACATTGTGCCTACATTGTCAACAACAACATAC
ATAACTTGGTCTTACAAAGTGGGGATGAAGAGGGTACAACGTACATGAACCTTATCTCTATTTCAAAGTTGAGGCACATTGGTGGTTTTCGATGGATCGT
TCACTCAAGACAAAAATAGTCTAGAAAAAAAAGATGGAATTTATGTAAAAATAAGGCAATAGATAGTTACAAAAACAACCGATAGTAAAAAAAAAATACT
ACAACAAAATGGTACGTCAAACTACACGAAACCACAAATAAAAGAACAAGAAATTGCAAGAGTAGTCCTACAACTACAACTCTACTAGTAAAGGAAACAA
GACAATGTACTCATTCCTACTAGTATGGACACACTCCTATATACCAACTTTCTTCCAAAATTTGTGTCCTCCCCCACCTTCCTATCTGAGTTCGCAAATA
ACTAAGGTAAAGTTACCTAAAAGTTAGTAAATGTTACCTTTCAGATGACTCTTTATTGTAAGAATTGACTGATAACCCACCATCGATGGTAACTGAACAA
TTATAACAGTTGAAAATTAATCAATTACATCTTCCGACTTTTATTTTTTAAAATAGGGAAACTTTCGTATATATCCACTCAAAAATAACCTAATTACTCT
CCATAGCTATAGTTTAACAATTACAATTTGTAGCTACATGTTATAGGGAGGAGAGAGGCGAGCGATACTGGGAGAGAGTTGAAAGATAGAGGTCAAAAAT
GAGAGAGACTTGAATTGTATTTGTATATCGATTAGATAAATTGTATATTATGTATAACTCCCCAAATTAAAAATTGGGCTGAATTATTGCATCGTCAAAC
TCGCTAGAGATGAATGGGCCTGCCATTTTGACGGCCCAATGGATAGTTTACACTTTGCAGTTACATTGCTTTGTCAGTAACAATTCAGTTATGAGTCAAA
CAACAACAGAAATAGGAAAAATTATCTAAATAGACAACTTAGTTTTGTTATATTCTTTAAAAAATTTCACTATTTGAAAAAATTACAAAAATTATTCTTA
ATTTTTGTGATGTATAACTCTGACACATTGCTTTATGAAATGTATCGGTCGGATACATCACTTTACGCGAGGTACATTACTTTTCACATTATATTAATGG
GATATACATCACACTGCACGATGTGTTGATCAGATGTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTATCATATTGATATGTAAAAAATGCAATCTTATAGTACTTTTTGAATATCTAAATTTT
TTATTTAAAATATTATATTACTGTAATCCAATTTAAGTTTAAAAATTAGTTAAGTTTAACTTTTAACAAAAACACAACATGACAGTTAAAACTGACACGG
TGAGAGTATTAGTTTTACAAAAAAATTGGAGAATGGTACTCATTGATGCTAAGTTAAACATGGTAAAAGGGTATATATGAAATTTCGATACTTTACTACA
CAGAAGAAGTCTCCAAGCAGGCGCCTCTGTGTGTGTCTACTTCTAACCGAGAGTATATATAAGATCTCAATGCTTCTTGCTACTATCGAGAAGAGATTCT
AGATACAGAGATATCTTTTTATCAGTGAGTCTACTTTTATCCGAGGGGTTTTTATAAAAGTTTTACTCTGCTACTCTCTAGAAGAGTTTAGAAGCAGGCG
TCTCTCTGTTGACGTGTCTACTTAGCTGAGGGTATATATGTAATTTCAATACTTCTTACTACTATTTTTAGAAATAAATAATAAATAAAGGTGAATGGAG
AGAGTACTTTTTCTGTACATTTTTATTTGTCACAATTTTTTGTGAGAGTTAAAAATTGTGTAATATTTTAAAGATGTATTCTTTCATATTAAAAGAATCA
TTATATTTGTAAATAGTTTCTAAATAACTACATTTTTTATCTTAAAAATGACAAATTAATATAATTTAACTTAATAATTTATAATGTGACAATTAAAAAG
AAATAGAGGTAGTAAATTTCGGTAAATATTTGCAAAGTAAAACTAAGAAAAAATAATTTTATTTACATAAAAAAGAAAAAAAAACTTTTTTTATTTTTTT
GAAAACTAAATTAAAGTGTGGTGTATCAATCCCCTGTTCATCATCTCTCCCATCAGATATATATAGAGCCAAAAAAAAGGAAACTGGGCTTCCTTCAATT
TGGAGCATTTCTAGGGTTTCTGTGATAGTCGAAGTTGGGTCTCAGCTTACAGCAACTTGCCGTTCTCAGATTCGGTGCAATAATGTCGCAAAACGGGAAA
TTGATGCCGAATCTGGACCAGAACAGCACGAAGCTGCTAAACTTGACGGTTCTTCAGAGAATTGATCCTTTCATTGAAGAAATCCTCATCACTGCTGCTC
ATGTTACCTTGTACGAATTCAGTATTGATAACAGTCAATGGGTATCAAATCTTACCGATTTTATTCTTTTTAGTTGTTCATACTTTTGTATTCACATACT
AATTGTTAGTCTAATTCGTAATTGAATTGTCGTGCAGAGTCGGAAGGATATCGAAGGATCTCTATTTGTTGTCAAGAGGTGATTTTTTTGAAATTTTTAA
TTTTGATATAATCAAATCAACTAAATCTCAGTTTCTATTTTTTTTTTTTTGGTAATAGACCGTGAAATGTTTTACCATACCACCAAAACAAATTCAAGTA
CAAGTAAAGAGCACCCATAGACTCAACCTCCTTTCAGATTGTTAAGTCTAGTGAGCCTCAAAGCAAAGCCTAATTACATAAAGAATAGATCAAGTATCCA
CTCCTCCTATCATATTTCAAGTATCTAAACAACTGTAATCTCTCCCTTATTATATTTTGCACATGCTGTATCATAAACTCTCTACTTACACTTTGTCCTC
GAAAAATCTTTTGATTCCTGGCAATACAAATGTTATAAATAGTAGCTCCATGTATAGTTGGAGTCTGCTTTAGTTCCTGTAACCCTCTTCCTTCATCTGT
GTCTGGGCTTAATGTTTCCCTCGTAGTAAAACTATGTTTATGCTGTCTGTTAACTTATTATAACCTTCCTCTTTTATCCGACTTTGTGGTTAGATAAAGC
TAACATGGAGGAGGTTCATGTTTTTTCGTATCTTCCTTCACTTGTTCTTTGAATTTGATGAAAACAGTGACCTGGCCTTAATACTTAAAAACTCATCTTT
ACTGGAATATATGTTTTAAGTTTTAATTTTGATCCCTGTACTTCTTTCTTTTGTGATAATTACTTTTTAGCGGGTCTTACAGGAGTTCTCAACCTCGGTT
TCAGTTTATTGTTATGAACCGCCGAAATACAGGTCAGTTCATCTGCTTTCAAATAAAGACTATAAACACAATATCTCTTGGCTTGCCTTTTATGTTCAAC
GGATTTGAATGTAACCTTACTTTTTTGCTGCTGAAAAATGTTCATAAAATTGAAGCATATACATGATTGACTATTTGATGTGGAGACCTCAAGCAATACT
ATTCATCAGGTTTATAACCTTTATGCATTACAACAATGTAACTTCCCTTTTTTTCCTTTAACAAATAAGTACCAGGGTAGATATACCCATAAAATCAGCC
TTGTCATTTGGACCAATCTCTTGCTTTACTCAGATGTGAAGTTCTAAACTTCTAATATGAAGGCTAGCATTTCCCTTATTTTAATGGCTGTCAGCATAGA
TCCACAAAATGGAAATCAAATAAAAAGCAGAGAATAATGCAGTTGGACTACCATTGAATAAGAGGAGCCATCTTAGAACTTGAAAGACAGATGCCTTCTA
TGAGGCACAGGAGTACCTTGTCTGGTCGTGTGGTATGCTTAGTCGTGTTACAAGAATTAAATGATGCCCTGGATTGACTTAAGACCAAAACTTCTTACCG
CTCGCACCAATAGCAGGAAAAGAAGTTCTCTTTTAATAAAATTGGATAGCTGAAGTCACTCATATTCTAAATAAAATTTCTGGCCTGCATGTTGATCAAT
TAGTTTAAAATTTCTAAAACCCTGTCTGAATAGTATAATATGGCAACTGGAAGTTACTTCTCAATGCAATTATCAGTTAATAAACGAGGACTGCACGACA
TCGAGTACTCATTTTGATTTATTTAAAAAGAAAGATAACAAATATCCTTTTTACATTTTCCTGTTCCAAATTCAAAGAACTTCCTGTTATGAAAAGATAT
CGTGGGGGTACACGTCTACAAATAACAAATAAAAAAATTAACAGAAATGGTGCATGTATCTTAGTAAATTGATGTTTAAAGCTTGTCATATGAATTGCCA
TATTTACTGAAAGTTGCAATAGGGAGTTTGTGAGTTTTCCTCCTGTGTGAGTACATTTGATCAATTACTGTGCCTTAAAAAGTGTTTATTCTGGTGAGCA
GATAATTTGGTGGAGGATCTGTTGGGAGATTTTGAATATGAGATCCAGCTTCCATATTTGTTGTATCGAAATGCTTCCCAAGAAGTTAATGGGATATGGT
TTTATAATCAGCGTGAATGTGAAGAAGTTGCAAATCTCTTTGACAGGTAATCTTTCACAGTTTCTCTCCCCAGAAATGATTCCTCTCCTCCCCTTCTCTT
TCCTGTTTTAGCATGGGTAAACTTTTTGGTTCCATGTAGGGTGTTAATTCTAGAAAACAAAGCAGTTAAATTTGTCGGATTCAGTTGGTCATGCCTTTGA
GATCTTGAAGAGTAGTTTATTTCTGGTACTTATACTTCATTGTGATTCGATGGGGTTCATAAGTTATCATATTTCTCCAAATTGAACTTGCTCAGTGCAG
ATTCTCCTTTGTTTATTTGATTTGGGGAATACATATGTTTGAATATTTGTTAGTTGATGATTTTTAGATATAGTGGAAACATAGTTTTTGCGAACTTATA
AACAATCAGGTGTATAAGCTAGTGTCTACTAGGCCTAGCTTAGTTTCAGGAAATTAGTTTTAAAATATTTTAGAGCCCTACTTGATTCTCTGAAGGAACT
GTAGTACGTAATATTTATTGATTTATTAATGAAGATTGTGGAAGTGAGAATTCAGACGGTTGTTGCTTACTGATGCAAATCAGCACTTCCAACAGATCCT
AGTTTAGGGAATTGTTCGGCCAGCTTAATGAGAAACATAGGGATCAAAGGAGTACCTTTCTACCACACTGAATACAAACATATCTTCGATGTTTTCTCTT
TGTTGATCAACTTTTAAAGCTGTCAATCAATTTAGTGTTTACTGGTTTTCAGGATACTCGGTGCATATTCCAAGGTGCCTACCAAGTCAAAAGTTCCATT
GACAAAGAGGTATATAATTTATGCTAACTGAAATTTAGATACCCCCCCCCCCCC